{"paper_id":"94f9c72e-01f0-4777-b085-4cc44449a3dd","body_text":"Endometrial stromal PRMT5 plays a crucial role in decidualization by regulating NF-κB signaling in endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Endometrial stromal PRMT5 plays a crucial role in decidualization by regulating NF-κB signaling in endometriosis Guijun Yan, Xinyu Cai, Manlin Xu, Hui Zhang, Mei Zhang, Junxia Wang, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1800392/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Oct, 2022 Read the published version in Cell Death Discovery → Version 1 posted 9 You are reading this latest preprint version Abstract Decidualization is a prerequisite for successful embryo implantation, in which elongated fibroblast-like endometrial stromal cells differentiate into more rounded decidual cells. Accumulating evidence has stressed the important role of the defective eutopic endometrium in infertility in endometriosis patients. However, the role of arginine methylation in the process of physiological decidualization and pathological decidualization defects is not clear. Here, we observed that the expression level of PRMT5, the main type II PRMT, was decreased in the endometrium of endometriosis patients, predominantly in stromal cells. Compared with the undecidualized state, PRMT5 was increased in the stromal cells of normal secretory endometrium in humans and in the decidua of normal pregnant mice or mice with artificially induced decidualization. The inhibition of PRMT5 resulted in a significant decrease in uterine weight and decidualization-related regulator expression, including FOXO1, HOXA10 and WNT4, in mice and IGFBP1 and prolactin levels in human endometrial stromal cells. Transcriptome analysis showed that decreased PRMT5 activity led to NF-κB signaling activation by inducing p65 translocation to the nucleus, which was also observed in endometriosis patients. Finally, overexpression of PRMT5 rescued the defective expression of IGFBP1 and prolactin in primary endometrial stromal cells from endometriosis patients. Our results indicate that promotion of PRMT5 may provide novel therapeutic strategies for the treatment of decidualization defects in infertile women, such as those with endometriosis. PRMT5 NF-κB endometrial stromal cells decidualization endometriosis cell differentiation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Endometriosis is a reproductive disorder in which endometrial tissue is aberrantly located outside the uterus, which is a major cause of infertility and pelvic pain affecting nearly 10% of reproductive-age women 1 . Women with endometriosis are twice as likely to have infertility and pregnancy loss 2,3 . Accumulating evidence has stressed the important role of the defective eutopic endometrium in infertility in endometriosis patients. There is a high prevalence of endometriosis in infertile women with normal ovulation and normospermic partners 4 . Endometriosis patients receiving donor oocytes showed a reduced implantation rate and clinical pregnancy rate compared with women without endometriosis receiving sibling oocytes from the same donor 5 . Induction of endometriosis in animals has been shown to lead to embryo implantation failure due to a defective decidualization response, which is similar to the pathological phenotype found in endometriosis patients 6,7 . Decidualization occurs during the secretory phase of the menstrual cycle, which is a prerequisite for successful embryo implantation 8 . Decidualizing cells differentiate from elongated fibroblast-like endometrial stromal cells into more rounded decidual cells with increased production of secretory proteins, including prolactin (PRL) and insulin-like growth factor binding protein-1 (IGFBP1), two established decidualization markers 9 . Molecular and genetic evidence has indicated multiple regulatory pathways by which decidualization defects might arise, and many have been identified as aberrant in endometriosis, including estrogen, progesterone, FOXO1, AKT, and Notch pathways 10–13 . In addition, differential expression patterns of DNA methylation have been observed in endometriotic tissue compared with normal endometrium, and decreased expression of HOXA10 and PR due to aberrant methylation at the promoter is responsible for defective decidualization in the endometrium of endometriosis patients and induced endometriosis animals 14–17 . However, the pathophysiological significance of the posttranslational modification regulatory machinery, such as arginine methylation, in endometriosis is still not clear. Protein arginine methyltransferases (PRMTs) transfer methyl groups from S-adenosylmethionine to a guanidine nitrogen of arginine in proteins, forming three types of methylated arginine residues: monomethylarginine (MMA), asymmetric dimethylarginine (aDMA), and symmetric dimethylarginine (sDMA), which are responsible for the regulation of many biological processes, including development and cancer 18 . Depending on catalytic activity, PRMTs can be classified as a type I enzyme that catalyzes aDMA (PRMT1, PRMT2, PRMT3, PRMT4, PRMT6 and PRMT8) or a type II enzyme that generates sDMA (PRMT5, PRMT7 and PRMT9) 19 . A recent study found that aDMA content and PRMT3 expression were increased in the decidua of recurrent miscarriage patients, primarily in macrophages but not in natural killer cells or stromal cells of the decidua 20 . However, the localization and function of PRMT5, the main type II PRMT, is not clear in the endometrium. Here, we found that PRMT5 expression was decreased in the mid-secretory endometrium of endometriosis patients, predominantly in stromal cells. Inhibition of the expression and activity of PRMT5 blunted endometrial decidualization in mice. Inhibition of PRMT5 activity impaired human endometrial stromal cell decidualization partly by activating the NF-kappa B (NF-κB) signaling pathway, while overexpression of PRMT5 rescued the decidualization defect in endometrial stromal cells from endometriosis patients. Results Decreased PRMT5 expression in the endometrial stromal cells of endometriosis patients We first screened the expression levels of PRMT5 mRNA from several published gene expression profiles of endometriosis 24–26 and observed that the relative expression levels of PRMT5 were significantly decreased in the ectopic endometrium of endometriosis patients compared to the endometrium of healthy controls (Fig. 1A). We next determined PRMT5 expression in the mid-secretory phase eutopic endometrium of endometriosis patients. Our qPCR showed that the expression level of PRMT5 , but not PRMT1 or PRMT3 , was obviously decreased in the eutopic endometrium of endometriosis patients compared with that in fertile controls (Fig. 1B, Supplementary Fig. 1A, B). Western blot data further confirmed the decreased level of eutopic endometrial PRMT5 in endometriosis patients (Fig. 1C). Immunohistochemical staining (IHC) analysis revealed that the reduction in PRMT5 expression in the eutopic endometrium of endometriosis patients was observed mainly in stromal cells but not in epithelial cells (Fig. 1D). The above results indicated that PRMT5 was decreased in the eutopic endometrium of endometriosis patients, especially in stromal cells, prompting us to explore the potential role of endometrial stromal PRMT5. Endometrial stromal PRMT5 expression increases upon decidualization in mice To address the pathophysiological significance of PRMT5 in endometrial stromal cells, we first analyzed the PRMT5 expression pattern in the peri-implantation mouse uterus by IHC. PRMT5 was primarily expressed in luminal epithelial cells at 0.5 days postcoitum (dpc) but expanded to uterine luminal and glandular epithelial cells and stromal cells at 3.5 dpc when the uteri entered receptive status 27 . With the onset of embryo implantation at 4.5 dpc, PRMT5 was detected in both epithelial and stromal cells surrounding the implanting blastocysts and became more visible in the decidualizing cells on 5.5 dpc (Fig. 2. A, B). We next assessed the PRMT5 expression pattern in a mouse model of artificially stimulated decidualization. PRMT5 expression increased after decidualization was stimulated, especially in decidualizing cells (Fig. 2. C, D). All the above data indicated that PRMT5 may be involved in the process of endometrial decidualization. PRMT5 is required for endometrial decidualization in mice To clarify the role of PRMT5 in endometrial decidualization, we applied GSK591, a specific inhibitor of PRMT5 28 , to an artificial decidualization mouse model (Fig. 3A, B). After 4 days of oil stimulation, we observed impaired decidualization and decreased decidual tissue weight following GSK591 treatment (Fig. 3C, D). We also assessed the expression of FOXO1, HOXA10 and WNT4, well-known markers for uterine stromal differentiation during decidualization 9 . GSK591-treated mice showed decreased expression of FOXO1, HOXA10 and WNT4 after 4 days of oil stimulation compared with the control groups (Fig. 3E). The IHC assay also showed that FOXO1 was predominantly expressed in decidualizing stromal cells in the decidua of the control mice but was expressed in epithelial cells in the endometrium of GSK591-treated mice (Fig. 3F). In addition, we knocked down PRMT5 in mice following artificially induced decidualization (Fig. 3 G-I) and observed that knockdown of PRMT5 led to impaired decidualization and decreased decidual tissue weight (Fig. 3J). These results suggested that the expression and activity of PRMT5 were indispensable to endometrial decidualization in mice. PRMT5 activity ensures human endometrial stromal cell decidualization We next assessed the significance of PRMT5 on the decidualization of human endometrial stromal cells (hEnSCs). Immunofluorescence staining showed that PRMT5 was predominantly localized in the epithelial cells of the proliferative endometrium, while its localization was expanded to epithelial and stromal cells in the secretory endometrium (Fig. 4A). The expression of PRMT5 increased markedly upon decidualization with 8-bromo-cAMP and medroxyprogesterone acetate (8Br-cAMP+MPA) (Fig. 4B). Treatment with GSK591 obviously blocked the increased IGFBP1 expression and PRL secretion, two important decidual marker genes 9 , in 8Br-cAMP+MPA-treated hEnSCs (Fig. 4C, D). We also examined whether inhibition of PRMT5 affects cytoskeletal organization. As shown in Fig. 4E, decidualized hEnSCs displayed polygonal cell morphologies and an increased number of nuclei in the expanding cytoplasm, but GSK591 treatment impeded the transformation from a long fibroblast-like shape into a round shape in hEnSCs. These findings indicated the significant role of PRMT5 activity in human endometrial stromal cell decidualization. Inhibiting PRMT5 activates the NF-κB signaling pathway in human endometrial stromal cells To further determine the role of PRMT5 in decidualization, RNA-seq analysis was performed on control hEnSCs, GSK591-treated hEnSCs, decidualized hEnSCs and GSK591-treated decidualized hEnSCs (Fig. 5A). There were 137 genes upregulated and 148 genes downregulated in GSK591-treated decidualized hEnSCs compared with decidualized hEnSCs (Fig. 5B). Gene ontology (GO) enrichment analysis of genes that showed changes between GSK591-treated decidualized hEnSCs and decidualized hEnSCs showed abundant enrichment in immune- and inflammatory-related pathways (Fig. 5C). We next explored the decidualizing-related genes regulated by PRMT5. Forty-three out of 1374 changed genes between decidualized hEnSCs and control hEnSCs were observed in the 242 changed genes between GSK591-treated decidualized hEnSCs and decidualized hEnSCs (Fig. 5D, E). The intersection analysis of the 43 differentially expressed genes and the target genes of multiple transcription factors, including TP53, CREB1 and FOXO1, which have been shown to be closely related to endometrial function and decidualization 9 , was conducted (Fig. 5F). Among the 43 differentially expressed genes, there were 37 target genes of TP53, 33 target genes of CREB1, and 11 target genes of FOXO1 (Fig. 5G). Endometriosis patients showed decreased mRNA levels of TP53 and FOXO1, while increased mRNA level of CREB1 in the mid-secretory phase eutopic endometrium compared with the fertile controls (Fig. 5H). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and Gene Set Enrichment Analysis (GSEA) further showed an enrichment of the NF-κB signaling pathway in GSK591-treated decidualized hEnSCs compared with decidualized hEnSCs (Fig. 6A, B). Immunofluorescence staining revealed the translocation of the NF-κB subunit p65 into the nucleus in GSK591-treated decidualized hEnSCs, suggesting the activation of the NF-κB signaling pathway (Fig. 6C). Luciferase reporter assays revealed that overexpression of PRMT5 inhibited, while treatment of GSK591 promoted the transcriptional activity of NF-κB (Fig. 6D). A cluster heatmap showed the differential expression of NF-κB signaling pathway-related molecules in GSK591-treated decidualized hEnSCs (Fig. 6E). Protein–protein interaction network analysis of differentially expressed genes showed a number of inflammatory factors in GSK591-treated decidualized hEnSCs (Fig. 6F). qRT–PCR data confirmed that the mRNA levels of IL1A and IL1B were increased significantly in GSK591-treated decidualized hEnSCs (Fig. 6G), which was also observed in the endometrium of endometriosis patients (Supplementary Fig. 2). All the above results suggested that activation of the NF-κB signaling pathway may contribute to the decidualization defect in hEnSCs with inhibition of PRMT5 activity. PRMT5 rescues decidualization defects in endometrial stromal cells from endometriosis patients Due to the potential regulatory effect of PRMT5 on decidualization, we speculated that overexpression of PRMT5 may improve the decidualization of endometrial stromal cells from endometriosis patients. As expected, p65 was predominantly localized in the nucleus of stromal cells in the mid-secretory phase eutopic endometrium of endometriosis patients (Fig. 7A). Primary hEnSCs isolated from the endometrial tissues of endometriosis patients showed impaired decidualization after differentiation stimulus, as revealed by IGFBP1 mRNA expression and secreted PRL levels. However, PRMT5 supplementation obviously promoted IGFBP1 mRNA expression (31.56 vs. 91.18, P <0.05) and secreted PRL levels (85.17 vs. 115.33 ng/mL, P <0.001) (Fig. 7B, C), indicating that PRMT5 rescued the decidualization defect of endometrial stromal cells from endometriosis patients. Discussion Decidualization defects are responsible for impaired endometrial receptivity and embryo implantation failure, contributing to reproductive disorders, such as endometriosis 29,30 . Arginine methylation mediated by PRMTs has been shown to be an important posttranslational mechanism involved in various biological processes 31 . However, the role of arginine methylation in the process of physiological decidualization and pathological decidualization defects is not clear. Recently, some studies have reported increased expression of PRMT1 and PRMT3, two type I enzymes, in the endometrium of LPS-induced endometritis rats and the decidua of recurrent miscarriage patients, respectively 20,32 . By screening the expression levels of various PRMT mRNAs from several published gene expression profiles of endometriosis (GSE23339, GSE5108 and GSE7305), we observed that PRMT5, a major type II enzyme, was sed in the ectopic endometrium of endometriosis patients compared to the eutopic endometrium of healthy controls. In humans, circulating progesterone levels are increased following ovulation and maintained at elevated levels during the secretory phase to induce decidualization of hEnSCs in nonpregnant cycles 33 . Our data confirmed that the expression of PRMT5 was suppressed in the eutopic mid-secretory endometrium of endometriosis patients, especially in stromal cells. As expected, we observed an obvious increase in PRMT5 in the normal mid-secretory human endometrium and in vitro induced decidualized hEnSCs compared with normal proliferative human endometrium and undifferentiated hEnSCs, respectively. In mice, decidualization does not occur in the normal estrus cycle but is initiated by embryo attachment in normal pregnancy or elicited in hormonally sensitized mice by instillation of an irritant such as oil 34 . PRMT5 was observed in the endometrial stromal cells surrounding the implanting blastocyst at 4.5 dpc and became more visible in the decidualizing cells at 5.5 dpc. Elevated PRMT5 during decidualization was further confirmed in a mouse model of artificially stimulated decidualization. GSK591 is a substrate-competitive inhibitor of PRMT5 28 . We found that GSK591 blunted decidualization in mice with artificially stimulated decidualization and hEnSCs with in vitro stimulated decidualization, which clearly showed that stromal PRMT5 played a crucial role in endometrial decidualization. Furthermore, we confirmed that overexpression of PRMT5 rescued the decidualization defect of primary hEnSCs from endometriosis patients. The human study is limited by its retrospective nature, and a larger sample size or a prospective randomized design could be used in future studies to corroborate the potential effect of PRMT5 on decidualization defects observed in many uterine disorders. NF-κB is a family of transcription factors composed of homodimers or heterodimers of related Rel proteins, including RelA (p65), p105/p50, p100/p52, c-Rel, and RelB 35 . The upstream stimulus activates the IκB kinase (IKK) complex, which restrains inactive NF-κB in the cytoplasm, leading to the accumulation of NF-κB in the nucleus, where it binds to NF-κB DNA consensus sequences and activates target genes 36 . The functional prediction of the PRMT5 activity-regulated transcriptome via GO analysis, KEGG analysis and GSEA showed that the “NF-κB signaling pathway” was enriched in GSK591-treated decidualized hEnSCs, which was further supported by the translocation of p65 into the nucleus and increased inflammatory factors. NF-κB mediates signaling between interleukin (IL)-1α and tumor necrosis factor α (TNFα) and the expression of LIF and IL-6 in endometrial epithelial cells 37 , but the detailed regulatory mechanism of NF-κB underlying decidualization is still not clear. A previous study reported that proinflammatory signaling to NF-κB may be suppressed in early pregnancy, contributing to the immunosuppressive mechanism during embryo implantation 38 . While acute inflammation is required for implantation, chronic inflammation is disruptive for pregnancy 6 . Inflammation is the central process in endometriosis, leading to chronic pain, fibrosis and infertility 30 . Some previous studies have shown that the NF-κB signaling pathway was activated in the eutopic secretory endometrium of endometriosis patients, which was also observed in our study, indicating that the absence of decreased p65 activity in the secretory endometrium could participate in endometrial biologic alterations during the implantation window in endometriosis patients 39–41 . In addition, NF-κB inactivation by progesterone and synthetic progestin attenuated the expression of IL-8 in endometriotic stromal cells to control the growth associated with endometriosis 42,43 . In addition to being regulated by IKK, various posttranslational modifications are involved in the regulation of NF-κB, including ubiquitination, phosphorylation, acetylation, sumoylation, nitrosylation and methylation 44–48 . Previous studies have found that p65 is activated by PRMT5 via symmetric dimethylation of arginine 30 and suppressed by PRMT1 via asymmetric dimethylation of arginine 30, indicating the antagonistic relationship between PRMT1 and PRMT5 in regulating NF-κB 46 48 . Here, we found that inhibiting PRMT5 activity in hEnSCs led to p65 nuclear translocation and NF-κB signaling pathway activation. In addition, p65 nuclear translocation and increased expression of NF-κB signaling-related inflammatory factors were also observed in primary hEnSCs from endometriosis patients with reduced expression levels of PRMT5. However, the detailed mechanism by which PRMT5 symmetrically demethylates p65 to inhibit NF-κB signaling in hEnSCs needs to be further explored. In summary, we identified PRMT5 as a critical regulator in decidualization both in mice and humans, partly due to its effect on the NF-κB signaling pathway. Since several PRMT5 inhibitors are in ongoing preclinical and clinical studies for the treatment of cancer 49 , it is worth observing potential side effects on the endometrium and reproductive capacity. In addition, we confirmed that overexpression of PRMT5 rescued the decidualization defect of primary hEnSCs from endometriosis patients, suggesting that promotion of PRMT5 may provide novel therapeutic strategies for the treatment of decidualization defects in infertile women, such as those with endometriosis. Methods And Materials Sample collection Endometrial biopsy samples were taken from women undergoing treatment at the Reproductive Medicine Center of Nanjing Drum Tower Hospital (2013-408 081-01). Informed consent was signed by the patients before sample collection. The women in the study were aged between 20 and 40, and none of them had received hormone therapy for at least 3 months prior to tissue collection. The endometriosis group was comprised of women with endometriosis ovarian cysts diagnosed by ultrasound, elevated serum CA125, or endometriosis ovarian cysts confirmed by laparoscopic surgery. The normal group was comprised of women receiving assisted reproductive treatment because of male infertility factors. Mid-secretory endometria timed 6-8 days after ovulation in the natural cycle, as determined by ultrasonography, were obtained from 14 normal women and 14 women with endometriosis for qRT–PCR, western blotting and immunohistochemical staining. Proliferative endometria were obtained from 3 normal women for immunofluorescence staining. Freshly collected endometrial tissues from 11 normal women and 3 endometriosis patients were cut into fragments of approximately 1 mm 3 , digested with 0.1% collagenase, centrifuged and filtered through a screen to obtain the primary human endometrial stromal cells (hEnSCs) for in vitro decidualization experiments as described previously 21 . Detailed information on the participants in this study is summarized in Supplementary Table 1. Animals and artificially induced in vivo decidualization ICR (Institute of Cancer Research) mice (n=32) were purchased from the Lab Animal Center of Yangzhou University (Yangzhou, China). Fourteen mice were subjected to a normal pregnancy assay. To induce in vivo decidualization, 6–8-wk-old female mice were ovariectomized (n=25) with appropriate analgesics. After 14 days, the mice were injected with 100 ng E2 (Sigma-Aldrich, St Louis, MO, USA, #E2758) subcutaneously for 3 consecutive days. After 2 days of rest, the mice were injected with 1 mg P4 (Sigma-Aldrich, #P0130) and 10 ng E2 subcutaneously for 3 consecutive days. After the last hormone injection, artificial decidualization was induced in one uterine horn by injection of 20 μL of sesame oil into the lumen. The other uterine horn was left unstimulated as a control. Daily hormone treatments with 1 mg P4 and 10 ng E2 were continued for another 5 days. During this process, the mice were treated with GSK591 (n=3) (MedChem Express, Monmouth Junction, NJ, USA, #HY-100235), Ad-shPrmt5 (n=6) and vehicle (n=9) at times outlined in the procedure in Figure 3. Six hours after the last hormone injection, the mice were sacrificed, the wet weight of both uterine horns of each mouse was recorded, and uterine tissue was collected and fixed in 4% (wt/vol) paraformaldehyde for histological and immunohistochemical analyses. All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Drum Tower Hospital (No.20210510). Construction of adenoviruses An adenovirus harboring PRMT5 (Ad-PRMT5) was generated using AdMax (Microbix Biosystems, Inc., Toronto, ON, Canada) as previously described 22 . The primers used for Ad-shPrmt5 construction were purchased from Sangon Biotech (Shanghai, China) and designed to target the following cDNA sequence: GCACAGTTTGAGATGCCTTAT (Supplementary Table 2). Then, shPrmt5 was cloned into pacAd5 U6-GFP, followed by adenovirus construction. The adenoviruses were propagated in HEK293A cells and purified via CsCl 2 banding, followed by dialysis against 20 mmol/l Tris-buffered saline with 10% glycerol. Cell culture and in vitro decidualization of human endometrial stromal cells The primary endometrial stromal cells were isolated and cultured as described previously 21 . Before inducing decidual differentiation, the cells were treated with 5 μM GSK591 (MedChem Express, #HY-100235) or solvent for 24 h and then incubated in DMEM/F12 without phenol red containing 2.5% carbon-adsorbed serum. Medroxyprogesterone acetate (MPA) (1 μM) (Sigma-Aldrich, #71589) and 8-Bromo-cAMP (8-Br-cAMP) (0.5 mM) (Sigma-Aldrich, #B7880) were added to the cellular supernatant. After 48 h-72 h, the decidualization of stromal cells was assessed by evaluating decidualization marker gene expression and cell morphological analysis. For the rescue assay, cells were pretreated with Ad-PRMT5 for 24 hours and then treated with 8-Br-cAMP and MPA for 3 days and 6 days. Immunohistochemical staining The tissues were fixed in 4% paraformaldehyde and embedded in paraffin wax. After deparaffinization and rehydration, antigen unmasking was performed by heating the sections in 10 mM sodium citrate buffer (pH 6.0) at 95 °C for 10 minutes. The sections were then incubated with 3% H 2 O 2 in deionized water for 15 min to block endogenous peroxidase activity, and nonspecific binding sites were blocked with 10% normal goat serum for 30 min at room temperature. The sections were then incubated with primary antibodies against PRMT5 (Abcam, Cambridge, USA, #ab109451,) and FOXO1 (Cell Signaling Technology, MA, USA, #2880S) in a humid chamber overnight at 4 °C, followed by incubation with the corresponding biotinylated secondary antibody at 37 °C for 30 min. Next, the sections were stained with 3,3′diaminobenzidine (DAB) and counterstained with hematoxylin. Digital images were captured using a Leica DM 2000 microscope and LAS Core software (Leica Microsystems Limited, Wetzlar, Germany). Quantitative analysis of the relative protein expression levels in the epithelial cells and stromal cells of the endometrium samples were determined according to the integrated optical density (IOD) of the digital images (×400) using Image-Pro Plus System 6.0 (Media Cybernetics, Inc., Silver Spring, MD, USA) in a blinded fashion as described previously 23 . Immunofluorescence staining for PRMT5 and F-actin hEnSCs were fixed with 4% paraformaldehyde for 20 min at RT and then permeabilized with 0.1% Triton X-100 in PBS for 5 min at RT. Nonspecific sites were blocked with 1% BSA in PBS for 1 h at 37 °C. Endogenous proteins were stained with primary antibodies against PRMT5 (Abcam, #ab109451) or F-actin (Abcam, #ab112125,) at 4 °C overnight. Fluorescence-conjugated secondary antibodies were used to visualize the signal. Nuclei were stained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma–Aldrich, #9542) for 10 min. Finally, images were visualized by fluorescence confocal microscopy and processed using ImageJ software. Enzyme-linked immunosorbent assay (ELISA) After 72 h of decidualization, hEnSC culture supernatants were harvested and centrifuged to remove cell debris. PRL levels were measured using a commercially available enzyme-linked immunosorbent assay kit (R&D Systems, Minneapolis, MN, USA, #DPRL00) in collected supernatants according to the manufacturer’s instructions. Samples were assayed in duplicate, and the concentrations were expressed as ng/mL cell supernatant. Western blot analysis Protein was extracted from the tissues or cells using RIPA buffer with a phosphatase inhibitor (Sigma-Aldrich, #P5726) and protease inhibitors (Roche, Branford, CT, USA, #11697498001). The supernatant was extracted after high-speed centrifugation at 4 °C. The protein concentration was determined using the BCA Protein Assay kit (Beyotime, Jiangsu, China, #P0011). Equal amounts of protein (20 μg) were separated by SDS–PAGE and transferred to polyvinylidene difluoride membranes (Merck Millipore, Darmstadt, Germany, #03010040001). The membranes were blocked with 5% skimmed milk for 1 h and then incubated overnight at 4 °C with primary antibodies, including those against PRMT5 (Abcam, #ab109451), sDMA (Cell Signaling Technology, #13222), FOXO1 (Cell Signaling Technology, #2880S), HOXA10 (SantaCruz, CA, USA, #271953), WNT4 (Genetex, Irvine, CA, USA, #101085), PGR (SantaCruz, #SC810), NF-κB (SantaCruz, #SC372) and GAPDH (Bioworld Technology, MN, USA, #AP0063). After incubation for 1 hour with HRP-conjugated secondary antibodies, detection was performed using an enhanced chemiluminescence kit (Merck Millipore, #32106). The expression of each protein was normalized to the expression of GAPDH in the corresponding sample, and the relative abundance of the target proteins was estimated by densitometric quantification of the signal intensities using ImageJ software. RNA isolation and quantitative real-time PCR Total RNA was extracted from cells using TRIzol (Takara Bio, Shiga, Japan, #T9108) following the manufacturer's instructions. RNA purity was assessed by measuring the OD at 260 nm and 280 nm, and RNA integrity was assessed by agarose gel electrophoresis. The first strand of DNA (cDNA) was synthesized from total RNA (1 μg) using the Takara PrimeScriptTM RT reagent kit (Takara Bio, #RR037A). The expression levels of genes were analyzed by real-time PCR with SYBR Premix Ex Taq kits (Takara Bio, #RR820A) using appropriate primers (Supplementary Table 3). Relative gene expression levels were calculated with the 2-∆∆Ct method, with 18S RNA used as the internal control. RNA-seq and data analysis Primary endometrial stromal cells were cultured in 60 mm dishes and treated with GSK591 (MedChem Express, #HY-100235) or solvent for 24 h and then decidualized for another 48 h. Total RNA was extracted from cells using TRIzol (Takara Bio, #T9108). RNA-seq and data analysis were performed by OE Biotech Co., Ltd. (Shanghai, China). Clean reads were mapped to the human reference genome using HISAT2. The DESeqR software package was used to identify DEGs (the threshold was set as P value < 0.05 and |log2foldChange| > 1 for significant difference). ClusterProfiler49 was used to perform GO, KEGG and GSEA analyses. The transcription factor regulatory network was analyzed by KnockTF (http://www.licpathway.net/KnockTF/index.php). Dual-luciferase reporter assay Preconfluent (60%) hEnSCs in 24-well plates were transfected with the indicated plasmids using Lipofectamine 3000 Reagent (Invitrogen, Carlsbad, California, USA, #L3000008). NF-κB-Luc was purchased from Beyotime Biotech (#D2206). Dual Luciferase Assay System (Promega, Madison, WI, USA, #E2940) was used to analyze the luciferase activities with a luminescence counter (Berthold Technologies) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to the corresponding Renilla luciferase activity. Statistical analyses GraphPad Prism 9.0 was used for data statistics and analysis. A Student’s t test was used to compare data between two groups, and one-way ANOVA with Tukey's multiple comparisons was used to compare data from more than two groups. Two-way ANOVA with Tukey’s correction for multiple comparisons was applied for data from two groups with three time points. Data quantification was expressed as the mean ± standard error (X ± SEM), and P<0.05 indicated a significant difference in all cases. Declarations Data availability The authors provide detailed description of methods and original data upon request. RNA-seq data sets generated in this study have been deposited at the Gene Expression Omnibus (GEO) database under accession number GSE205883 (taken: evwhkaswnbsbzgl). Author Contributions G.Y. and R.J. initiated and supervised the project. X.C., M.X., H.Z. and M.Z performed the experiments, and collected the data; J.W. and J.M. contributed to the clinical samples collection and analysis. Y.Z., J.Z., X.Z., N.K., and Q.Y. contributed to the animal models and animal analysis. G.Y., R.J. and X.C. analyzed and discussed the data. R.J. and X.C. prepared the original draft manuscript, G.Y. and H.S. edited and finalized manuscript. All authors critically read and commented on the manuscript and approved the final version for submission. Finding This work was supported by the National Natural Science Foundation of China (31872846 and 82030040). Conflict of interest The authors have declared no conflict of interest. References Vercellini P, Viganò P, Somigliana E, Fedele L. Endometriosis: Pathogenesis and treatment. Nat Rev Endocrinol 2014; 10 : 261–275. Prescott J, Farland L V., Tobias DK, Gaskins AJ, Spiegelman D, Chavarro JE et al. A prospective cohort study of endometriosis and subsequent risk of infertility. Hum Reprod 2016; 31 : 1475–1482. Vercammen EE, D’Hooghe TM. Endometriosis and recurrent pregnancy loss. Semin Reprod Med 2000; 18 : 363–368. Meuleman C, Vandenabeele B, Fieuws S, Spiessens C, Timmerman D, D’Hooghe T. High prevalence of endometriosis in infertile women with normal ovulation and normospermic partners. Fertil Steril 2009; 92 : 68–74. Prapas Y, Goudakou M, Matalliotakis I, Kalogeraki A, Matalliotaki C, Panagiotidis Y et al. History of endometriosis may adversely affect the outcome in menopausal recipients of sibling oocytes. Reprod Biomed Online 2012; 25 : 543–548. Lessey BA, Kim JJ. Endometrial receptivity in the eutopic endometrium of women with endometriosis: it is affected, and let me show you why. Fertil Steril 2017; 108 : 19–27. Kim TH, Yoo J-YY, Choi K-CC, Shin J-HH, Leach RE, Fazleabas AT et al. Loss of HDAC3 results in nonreceptive endometrium and female infertility. Sci Transl Med 2019; 11 : 1–12. Bellver J, Simón C. Implantation failure of endometrial origin: What is new? Curr Opin Obstet Gynecol 2018; 30 : 229–236. Gellersen B, Brosens JJ. Cyclic decidualization of the human endometrium in reproductive health and failure. Endocr Rev 2014; 35 : 851–905. Yilmaz BD, Bulun SE. Endometriosis and nuclear receptors. Hum Reprod Update 2019; 25 : 473–485. Kim JJ, Buzzio OL, Li S, Lu Z. Role of FOXO1A in the regulation of insulin-like growth factor-binding protein-1 in human endometrial cells: Interaction with progesterone receptor. Biol Reprod 2005; 73 : 833–839. Kim TH, Yu Y, Luo L, Lydon JP, Jeong JW, Kim JJ. Activated AKT pathway promotes establishment of endometriosis. Endocrinology 2014; 155 : 1921–1930. Su RW, Strug MR, Joshi NR, Jeong JW, Miele L, Lessey BA et al. Decreased notch pathway signaling in the endometrium of women with endometriosis impairs decidualization. J Clin Endocrinol Metab 2015; 100 : E433–E442. Wu Y, Halverson G, Basir Z, Strawn E, Yan P, Guo SW. Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obs Gynecol 2005; 193 : 371–380. Kim JJ, Taylor HS, Lu Z, Ladhani O, Hastings JM, Jackson KS et al. Altered expression of HOXA10 in endometriosis: potential role in decidualization. Mol Hum Reprod 2007; 13 : 323–332. Lee B, Du H, Taylor HS. Experimental murine endometriosis induces DNA methylation and altered gene expression in eutopic endometrium. Biol Reprod 2009; 80 : 79–85. Wu Y, Strawn E, Basir Z, Halverson G, Guo S-W. Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics 2006; 1 : 106–111. Stopa N, Krebs JE, Shechter D. The PRMT5 arginine methyltransferase: Many roles in development, cancer and beyond. Cell Mol Life Sci 2015; 72 : 2041–2059. Bedford MT. Arginine methylation at a glance. J Cell Sci 2007; 120 : 4243–4246. Hao F, Tang L, Sun J, Li W, Zhao Y, Xu X et al. Decreased nitric oxide content mediated by asymmetrical dimethylarginine and protein L -arginine methyltransferase 3 in macrophages induces trophoblast apoptosis : a potential cause of recurrent miscarriage. Hum Reprod 2021; 36 : 3049–3061. Wang Z, Liu Y, Liu J, Kong N, Jiang Y, Jiang R et al. ATF3 deficiency impairs the proliferative–secretory phase transition and decidualization in RIF patients. Cell Death Dis 2021; 12 : 387. Chen M, Yi B, Sun J. Inhibition of cardiomyocyte hypertrophy by protein arginine methyltransferase 5. J Biol Chem 2014; 289 : 24325–24335. Zhang H, Zhu X, Chen J, Jiang Y, Zhang Q, Kong C et al. Krüppel-like factor 12 is a novel negative regulator of forkhead box O1 expression: a potential role in impaired decidualization. Reprod Biol Endocrinol 2015; 13 : 80. Eyster KM, Klinkova O, Kennedy V, Hansen KA. Whole genome deoxyribonucleic acid microarray analysis of gene expression in ectopic versus eutopic endometrium. Fertil Steril 2007; 88 : 1505–1533. Hever A, Roth RB, Hevezi P, Marin ME, Acosta JA, Acosta H et al. Human endometriosis is associated with plasma cells and overexpression of B lymphocyte stimulator. Proc Natl Acad Sci U S A 2007; 104 : 12451–12456. Hawkins SM, Creighton CJ, Han DY, Zariff A, Anderson ML, Gunaratne PH et al. Functional microRNA involved in endometriosis. Mol Endocrinol 2011; 25 : 821–832. Xin Q, Kong S, Yan J, Qiu J, He B, Zhou C et al. Polycomb subunit BMI1 determines uterine progesterone responsiveness essential for normal embryo implantation. J Clin Invest 2018; 128 : 175–189. Duncan KW, Rioux N, Boriack-Sjodin PA, Munchhof MJ, Reiter LA, Majer CR et al. Structure and Property Guided Design in the Identification of PRMT5 Tool Compound EPZ015666. ACS Med Chem Lett 2016; 7 : 162–166. Ng SW, Norwitz GA, Pavlicev M, Tilburgs T, Simón C, Norwitz ER. Endometrial decidualization: The primary driver of pregnancy health. Int J Mol Sci 2020; 21 : 1–20. Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S et al. Endometriosis. Endocr Rev 2019; 40 : 1048–1079. Bedford, Mark T., Clarke SG. Protein arginine methylation in mammals: who, what, and why. Mol Cell 2009; 33 : 1–13. Xiao H-B, Sui G-G, Lu X-Y, Sun Z-L. Elevated Levels of ADMA Are Associated with Lower DDAH2 and Higher PRMT1 in LPS-Induced Endometritis Rats. Inflammation 2018; 41 : 299–306. Schatz F, Guzeloglu-Kayisli O, Arlier S, Kayisli UA, Lockwood CJ. The role of decidual cells in uterine hemostasis, menstruation, inflammation, adverse pregnancy outcomes and abnormal uterine bleeding. Hum Reprod Update 2016; 22 : 497–515. Lim HJ, Wang H. Uterine disorders and pregnancy complications: Insights from mouse models. J Clin Invest 2010; 120 : 1004–1015. Hoffmann A, Baltimore D. Circuitry of nuclear factor kappaB signaling. Immunol Rev 2006; 210 : 171–186. Hayden M, Hayden MS, Ghosh S. Signaling to NF-kappaB. Genes Dev 2004; 18 : 2195–2224. Laird SM, Tuckerman EM, Cork BA, Li TC. Expression of nuclear factor κ B in human endometrium; role in the control of interleukin 6 and leukaemia inhibitory factor production. Mol Hum Reprod 2000; 6 : 34–40. King AE, Critchley HOD, Kelly RW. The NF-κB pathway in human endometrium and first trimester decidua. Mol Hum Reprod 2001; 7 : 175–183. González-Ramos R, Rocco J, Rojas C, Sovino H, Poch A, Kohen P et al. Physiologic activation of nuclear factor kappa-B in the endometrium during the menstrual cycle is altered in endometriosis patients. Fertil Steril 2012; 97 : 645–651. Ponce C, Torres M, Galleguillos C, Sovino H, Boric MA, Fuentes A et al. Nuclear factor κB pathway and interleukin-6 are affected in eutopic endometrium of women with endometriosis. Reproduction 2009; 137 : 727–737. Kim SH, Ihm HJ, Oh YS, Chae HD, Kim CH, Kang BM. Increased Nuclear Expression of Nuclear Factor Kappa-B p65 Subunit in the Eutopic Endometrium and Ovarian Endometrioma of Women with Advanced Stage Endometriosis. Am J Reprod Immunol 2013; 70 : 497–508. Horie S, Harada T, Mitsunari M, Taniguchi F, Iwabe T, Terakawa N. Progesterone and progestational compounds attenuate tumor necrosis factor alpha-induced interleukin-8 production via nuclear factor kappaB inactivation in endometriotic stromal cells. Fertil Steril 2005; 83 : 1530–1535. Hung SW, Zhang R, Tan Z, Chung JPW, Zhang T, Wang CC. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: A review. Med Res Rev 2021; 41 : 2489–2564. Bonizzi G, Karin M. The two NF-κB activation pathways and their role in innate and adaptive immunity. Trends Immunol 2004; 25 : 280–288. Lu T, Yang M, Huang D Bin, Wei H, Ozer GH, Ghosh G et al. Role of lysine methylation of NF-κB in differential gene regulation. Proc Natl Acad Sci U S A 2013; 110 : 13510–13515. Wei H, Wang B, Miyagi M, She Y, Gopalan B, Huang D-B et al. PRMT5 dimethylates R30 of the p65 subunit to activate NF-κB. Proc Natl Acad Sci U S A 2013; 110 : 13516–13521. Lu T, Stark GR. NF-κB: Regulation by methylation. Cancer Res 2015; 75 : 3692–3695. Reintjes A, Fuchs JE, Kremser L, Lindner HH, Liedl KR, Huber LA et al. Asymmetric arginine dimethylation of RelA provides a repressive mark to modulate TNFα/NF-κB response. Proc Natl Acad Sci 2016; 113 : 201522372. Yuan Y, Nie H. Protein arginine methyltransferase 5: a potential cancer therapeutic target. Cell Oncol 2021; 44 : 33–44. Additional Declarations (Not answered) Supplementary Files Graphicalabstract.jpg Graphical abstract SupplementaryFiguresandFigurelegends.pdf SupplementaryTable1.xlsx SupplementaryTable2.xlsx SupplementaryTable3.xlsx Cite Share Download PDF Status: Published Journal Publication published 04 Oct, 2022 Read the published version in Cell Death Discovery → Version 1 posted Editorial decision: revise 29 Jul, 2022 Review # 2 received at journal 25 Jul, 2022 Review # 1 received at journal 11 Jul, 2022 Reviewer # 2 agreed at journal 08 Jul, 2022 Reviewer # 1 agreed at journal 08 Jul, 2022 Reviewers invited by journal 07 Jul, 2022 Submission checks completed at journal 28 Jun, 2022 Editor assigned by journal 27 Jun, 2022 First submitted to journal 27 Jun, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-1800392\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":119223473,\"identity\":\"cb873907-7eb0-4707-9d0e-3e5103ad5737\",\"order_by\":0,\"name\":\"Guijun Yan\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIie3RsQrCMBCA4SuFuARnHYo+wkmgDorPYhE6hSK4ODgU3N1FHyKbuAUKdqm4VlwEwcUKPoCgTXFO6yaYf7kb7oNAAEymnw0JQC0EzFcrrE6o/IqoGsNilBOM99GNjuvepnmXEwp9R0j7etaSJPB7FIm3XQVDRsFnQpIuaonkLlNEnDjmJPKEpKShJYfsQ46JIq8KJOXsUpCUKiLLSTPNXGuNhImEY2eNI7aMiKsl9QNnj+y5c0ScuJhNB84inl+1pC1BPWOndoLFZ9q6+7xWCPYDYKZ2+1xybDKZTH/aG/9rSL7cU+j9AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Guijun\",\"middleName\":\"\",\"lastName\":\"Yan\",\"suffix\":\"\"},{\"id\":119223474,\"identity\":\"13118549-59f6-46b2-bef7-49cf2ac87831\",\"order_by\":1,\"name\":\"Xinyu Cai\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xinyu\",\"middleName\":\"\",\"lastName\":\"Cai\",\"suffix\":\"\"},{\"id\":119223475,\"identity\":\"61044859-f665-41d2-9922-c8a5e511dab9\",\"order_by\":2,\"name\":\"Manlin Xu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Manlin\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":119223476,\"identity\":\"0cc3863b-3688-4409-b6b3-6adb42e6af69\",\"order_by\":3,\"name\":\"Hui Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hui\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":119223477,\"identity\":\"e5c193f7-e629-4c67-8321-ebcc3f111f7d\",\"order_by\":4,\"name\":\"Mei Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Drum Tower Hospital of Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mei\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":119223478,\"identity\":\"a29b416b-0190-41b7-ae4a-267847c59666\",\"order_by\":5,\"name\":\"Junxia Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Center for Reproductive Medicine, Department of Obstetrics and Gynecology, The Affiliated Drum Tower Hospital of Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Junxia\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":119223479,\"identity\":\"3207fb0d-7258-43ec-989a-7a401a4337e7\",\"order_by\":6,\"name\":\"Jei Mei\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jei\",\"middleName\":\"\",\"lastName\":\"Mei\",\"suffix\":\"\"},{\"id\":119223480,\"identity\":\"9924a942-e174-45ab-ac51-183ca1d160e4\",\"order_by\":7,\"name\":\"Yang Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yang\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":119223481,\"identity\":\"15f77ccd-6c9e-4544-82e1-3059b252cc4f\",\"order_by\":8,\"name\":\"Jidong Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Drum Tower Hospital of Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jidong\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":119223482,\"identity\":\"4a8e09e5-c72d-412c-8310-f9b546298cbe\",\"order_by\":9,\"name\":\"Xin Zhen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Drum Tower Hospital of Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xin\",\"middleName\":\"\",\"lastName\":\"Zhen\",\"suffix\":\"\"},{\"id\":119223483,\"identity\":\"ac491668-a2b3-4c5a-8be4-a2bdfd2ceb3b\",\"order_by\":10,\"name\":\"Kang Nannan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Center for Reproductive Medicine, Department of Obstetrics and Gynecology, The Affiliated Drum Tower Hospital of Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kang\",\"middleName\":\"\",\"lastName\":\"Nannan\",\"suffix\":\"\"},{\"id\":119223484,\"identity\":\"17cecad4-4f9a-4a3f-b6b0-aee96ed8be8f\",\"order_by\":11,\"name\":\"Qiuling Yue\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qiuling\",\"middleName\":\"\",\"lastName\":\"Yue\",\"suffix\":\"\"},{\"id\":119223485,\"identity\":\"3cd5df9a-91df-4003-b88c-50d1165dd78f\",\"order_by\":12,\"name\":\"Haixiang Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Drum Tower Hospital, Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Haixiang\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":119223486,\"identity\":\"6b88db7a-b997-47c9-a3cc-db505ab4b758\",\"order_by\":13,\"name\":\"Ruiwei Jiang\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-5857-8540\",\"institution\":\"The Affiliated Drum Tower Hospital of Nanjing University Medical School\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ruiwei\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2022-06-27 15:05:32\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-1800392/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-1800392/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41420-022-01196-x\",\"type\":\"published\",\"date\":\"2022-10-04T04:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":23993837,\"identity\":\"3cfea8b1-99ae-49be-abf7-24ae815cb926\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:33:22\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1634042,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDecreased expression of PRMT5 in the endometrial stromal cells of endometriosis patients.\\u003c/p\\u003e\\u003cp\\u003e(A) The mRNA levels of PRMT5 in the ectopic endometrium from women with endometriosis (EMT) and endometrium of healthy controls from GSE23339, GSE5108 and GSE7305. (B) qRT–PCR analysis and (C) Western blot analysis of PRMT5 in the mid-secretory phase eutopic endometrium from women with (EMT: n=7) or without (normal: n=7) endometriosis. (D) IHC analysis of PRMT5 in the mid-secretory phase eutopic endometrium from women with (EMT: n=4) or without (normal: n=4) endometriosis. E, epithelium; S, stroma. Means ± SEM. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.01, \\u003csup\\u003e***\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/34965fd762425dde8f56932a.jpg\"},{\"id\":23993086,\"identity\":\"46483eeb-9fbe-432e-8bd0-819a692dad3b\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:28:22\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2546861,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEndometrial stromal PRMT5 expression increases upon decidualization in mice\\u003c/p\\u003e\\u003cp\\u003e(A) IHC analysis of PRMT5 in the uterus at 0.5-5.5 days postcoitum (dpc) of pregnancy. (B) Western blot analysis of PRMT5 expression in the uterus at 0.5–5.5 dpc of pregnancy. (C) Western blot analysis of PRMT5 expression in the stimulated and unstimulated uteri in an artificially stimulated decidualization mouse model (n=7). (D) IHC analysis of PRMT5 in the stimulated and unstimulated uteri in an artificially stimulated decidualization mouse model (n=3). LE, luminal epithelium; GE, glandular epithelium; S, stroma. Means ± SEM. \\u003csup\\u003e***\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/5ac9f3720a089b02238270c2.jpg\"},{\"id\":23992668,\"identity\":\"6f58d365-817e-4233-b459-748f18c123d7\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2449646,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePRMT5 is required for endometrial decidualization in mice\\u003c/p\\u003e\\u003cp\\u003e(A) Schematic representation of stimulated decidualization procedures with GSK591 treatment. (B) Western blot analysis of SDMA level in the stimulated uteri from the control and GSK591 groups. (C) Gross morphology of the unstimulated or stimulated uterine side and the ratio of stimulated to unstimulated uterine weight from the control (CTL) and GSK591 groups. (D) Hematoxylin-eosin staining of the stimulated uteri from the control and GSK591 groups. (E) Western blot analysis of FOXO1, HOXA10 and WNT4 expression in the stimulated uteri from the control and GSK591 groups. (F) IHC assay of FOXO1 in the stimulated uterus from the control and GSK591 groups. (G) Schematic representation of stimulated decidualization procedures with treatment by an adenovirus harboring sh-PRMT5. (H) Western blot analysis of PRMT5 expression in the stimulated uteri from the control (Ad-ctl) and Ad-shPRMT5 groups. (I) qRT–PCR analysis of PRMT5 mRNA in the stimulated uteri from the Ad-ctl and Ad-shPRMT5 groups. (J) Gross morphology of unstimulated or stimulated uterine side and the ratio of stimulated to unstimulated uterine weight from the Ad-ctl and Ad-shPRMT5 groups. i.p., intraperitoneal injection; i.u., intrauterine injection; S, stimulated; US, unstimulated.\\u003csup\\u003e *\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/bdc5f552af348401bdda5fa7.jpg\"},{\"id\":23992673,\"identity\":\"3f827dc3-ddac-4549-a2eb-617b8c44a7f5\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2048116,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePRMT5 activity ensures human endometrial stromal cell decidualization.\\u003c/p\\u003e\\u003cp\\u003e(A) Immunofluorescence staining of PRMT5 proteins in the proliferative and secretory phase endometria. (B) qRT–PCR analysis of PRMT5 mRNA in human endometrial stromal cells (hEnSCs) treated with medroxyprogesterone acetate (MPA) and 8Br-cAMP for 0, 12, 24, 48 and 72 hours. (C) qRT–PCR analysis of IGFBP1 mRNA in hEnSCs treated with or without the PRMT5 inhibitor GSK591 for 24 h before 3 days of treatment with 8Br-cAMP and MPA. (D) ELISA of PRL levels in supernatant obtained from hEnSCs decidualized for 3 and 6 days with or without the PRMT5 inhibitor GSK591. (E) Immunofluorescence staining for F-actin in hEnSCs treated with or without the PRMT5 inhibitor GSK591 before 3 days of treatment with 8Br-cAMP and MPA. Means ± SEM. \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.01, \\u003csup\\u003e***\\u003c/sup\\u003e\\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.001, One-way ANOVA with Tukey’s multiple comparisons test in B, Student’s t test in C, Two-way ANOVA with Tukey’s correction for multiple comparisons in D.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/29b7159ad707d3e6e98c93e6.jpg\"},{\"id\":23992941,\"identity\":\"dd321c5e-971d-4540-914b-b15ada94656e\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:23:22\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1956855,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAnalysis of transcriptome alterations in PRMT5 activity-inhibited hEnSCs.\\u003c/p\\u003e\\u003cp\\u003e(A) Heatmap of differentially expressed genes between GSK591-treated and solvent-treated hEnSCs (SC) or decidualized hEnSCs (dSC). (B) Volcano plot of significantly downregulated (green dots) and upregulated (red dots) genes in PRMT5 activity-inhibited dSC (GSK591_dSC) compared with dSC. (C) GO biological process enrichment analysis of differentially expressed genes between GSK591_dSC and dSC. (D) Venn diagram showing the overlap of differentially expressed genes among the two comparisons, (E) and heatmap of the 43 overlapping genes. (F) Subnetwork analysis of transcription factors and their target genes in the 43 differentially expressed genes associated with decidualization. (G) Transcription factor enrichment of the 43 differentially expressed genes associated with decidualization. (H) qRT–PCR analysis of the mRNA levels of TP53, FOXO1 and CREB1 in the mid-secretory phase eutopic endometrium from women with (EMT: n=7) or without (normal: n=7) endometriosis. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e***\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/fbcdc6f47efe47450a74b5d3.jpg\"},{\"id\":23992671,\"identity\":\"927f4cac-fe48-49a2-b668-4756cdd413a3\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1852040,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eInhibiting PRMT5 activates the NF-κB signaling pathway in human endometrial stromal cells\\u003c/p\\u003e\\u003cp\\u003e(A) The top 20 pathways enriched in differentially expressed genes between decidualized hEnSCs (dSC) and GSK591-treated decidualized hEnSCs (GSK591_dSC) in Kyoto Encyclopedia of Genes and Genomes analysis. (B) The Gene Set Enrichment Analysis revealed a significant enrichment of the NF-κB signaling pathway in GSK591_dSC. (C) Analysis of the immunofluorescence staining of p65 and PRMT5 in hEnSCs treated with or without GSK591 after 72 h of treatment with 8Br-cAMP and MPA. (D) Dual-luciferase assays of hEnSCs transfected with NF-κB-luc and Rinella after treated with GSK591, or transfected with pCMV-NF-κB or pCMV-PRMT5 for 48 h. (E) Heatmap of differentially expressed genes associated with the NF-κB signaling pathway. (E) Protein–protein interaction network based on STRING analysis of the genes shown in Panel D. (F) qRT–PCR analysis of IL1A and IL1B mRNA in GSK591_dSC and dSC. Means ± SEM, \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003ep \\u0026lt; 0.01, \\u003csup\\u003e***\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001, One-way ANOVA with Tukey’s multiple comparisons test in D, Student’s t test in G.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/711e33b510ae44582b237ea0.jpg\"},{\"id\":23992669,\"identity\":\"36eda030-871b-4253-9a0b-b53e13928121\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1758026,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePRMT5 rescues decidualization defects in endometrial stromal cells from endometriosis patients\\u003c/p\\u003e\\u003cp\\u003e(A) Analysis of the immunofluorescence staining of p65 and PRMT5 in mid-secretory phase eutopic endometrium from women with or without endometriosis. (B) qRT–PCR analysis of IGFBP1 mRNA in hEnSCs from endometriosis patients infected with Ad-PRMT5 for 24 h before 3 days of treatment with 8Br-cAMP and MPA. (D) ELISA results of PRL levels in the supernatant obtained from hEnSCs of endometriosis patients decidualized for 3 and 6 days followed by infection with Ad-PRMT5. Means ± SEM. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP \\u003c/em\\u003e\\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, \\u003csup\\u003e****\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.0001, One-way ANOVA with Tukey’s multiple comparisons test in B, Two-way ANOVA with Tukey’s correction for multiple comparisons in C.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/a93d3d255f3c04e5e9f2dc2d.jpg\"},{\"id\":27355882,\"identity\":\"b740cc3f-cd18-4378-8567-872424d101cb\",\"added_by\":\"auto\",\"created_at\":\"2022-10-05 07:07:23\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1784828,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/95d14a84-d24f-4700-9219-0bcec392daac.pdf\"},{\"id\":23992662,\"identity\":\"8da1235c-edaa-4451-89ca-769c94b156da\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":157444,\"visible\":true,\"origin\":\"\",\"legend\":\"Graphical abstract\",\"description\":\"\",\"filename\":\"Graphicalabstract.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/85bd0ea80db1b91a6cabec3c.jpg\"},{\"id\":23992667,\"identity\":\"484b33ad-7fd1-4efe-bf88-dc81d78ff8ef\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":360271,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryFiguresandFigurelegends.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/18cfffc54fa72f74e779f716.pdf\"},{\"id\":23992937,\"identity\":\"a7e03fe7-b94b-4daf-8a6f-ef58ed714879\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:23:22\",\"extension\":\"xlsx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":11065,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/ee51a90f4b4c9357868b0928.xlsx\"},{\"id\":23992664,\"identity\":\"67c60861-3eca-4e40-b876-3f47ac53ef99\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:18:22\",\"extension\":\"xlsx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10551,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable2.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/dd5644924418aa8b3e439542.xlsx\"},{\"id\":23992940,\"identity\":\"c85fc4b7-d304-4079-b1c2-9cc1df889911\",\"added_by\":\"auto\",\"created_at\":\"2022-07-18 16:23:22\",\"extension\":\"xlsx\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10053,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable3.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1800392/v1/36a7d95677a2b30cd8c32768.xlsx\"}],\"financialInterests\":\"(Not answered)\",\"formattedTitle\":\"Endometrial stromal PRMT5 plays a crucial role in decidualization by regulating NF-κB signaling in endometriosis\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eEndometriosis is a reproductive disorder in which endometrial tissue is aberrantly located outside the uterus, which is a major cause of infertility and pelvic pain affecting nearly 10% of reproductive-age women\\u0026nbsp;\\u003csup\\u003e1\\u003c/sup\\u003e. Women with endometriosis are twice as likely to have infertility and pregnancy loss\\u0026nbsp;\\u003csup\\u003e2,3\\u003c/sup\\u003e. Accumulating evidence has stressed the important role of the defective eutopic endometrium in infertility in endometriosis patients. There is a high prevalence of endometriosis in infertile women with normal ovulation and normospermic partners\\u0026nbsp;\\u003csup\\u003e4\\u003c/sup\\u003e. Endometriosis patients receiving donor oocytes showed a reduced implantation rate and clinical pregnancy rate compared with women without endometriosis receiving sibling oocytes from the same donor\\u0026nbsp;\\u003csup\\u003e5\\u003c/sup\\u003e. Induction of endometriosis in animals has been shown to lead to embryo implantation failure due to a defective decidualization response, which is similar to the pathological phenotype found in endometriosis patients\\u0026nbsp;\\u003csup\\u003e6,7\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eDecidualization occurs during the secretory phase of the menstrual cycle, which is a prerequisite for successful embryo implantation\\u0026nbsp;\\u003csup\\u003e8\\u003c/sup\\u003e. Decidualizing cells differentiate from elongated fibroblast-like endometrial stromal cells into more rounded decidual cells with increased production of secretory proteins, including prolactin (PRL) and insulin-like growth factor binding protein-1 (IGFBP1), two established decidualization markers\\u0026nbsp;\\u003csup\\u003e9\\u003c/sup\\u003e. Molecular and genetic evidence has indicated multiple regulatory pathways by which decidualization defects might arise, and many have been identified as aberrant in endometriosis, including estrogen, progesterone, FOXO1, AKT, and Notch pathways\\u0026nbsp;\\u003csup\\u003e10\\u0026ndash;13\\u003c/sup\\u003e. In addition, differential expression patterns of DNA methylation have been observed in endometriotic tissue compared with normal endometrium, and decreased expression of HOXA10 and PR due to aberrant methylation at the promoter is responsible for defective decidualization in the endometrium of endometriosis patients and induced endometriosis animals\\u0026nbsp;\\u003csup\\u003e14\\u0026ndash;17\\u003c/sup\\u003e. However, the pathophysiological significance of the posttranslational modification regulatory machinery, such as arginine methylation, in endometriosis is still not clear.\\u003c/p\\u003e\\n\\u003cp\\u003eProtein arginine methyltransferases (PRMTs) transfer methyl groups from S-adenosylmethionine to a guanidine nitrogen of arginine in proteins, forming three types of methylated arginine residues: monomethylarginine (MMA), asymmetric dimethylarginine (aDMA), and symmetric dimethylarginine (sDMA), which are responsible for the regulation of many biological processes, including development and cancer\\u0026nbsp;\\u003csup\\u003e18\\u003c/sup\\u003e. Depending on catalytic activity, PRMTs can be classified as a type I enzyme that catalyzes aDMA (PRMT1, PRMT2, PRMT3, PRMT4, PRMT6 and PRMT8) or a type II enzyme that generates sDMA (PRMT5, PRMT7 and PRMT9)\\u0026nbsp;\\u003csup\\u003e19\\u003c/sup\\u003e. A recent study found that aDMA content and PRMT3 expression were increased in the decidua of recurrent miscarriage patients, primarily in macrophages but not in natural killer cells or stromal cells of the decidua\\u0026nbsp;\\u003csup\\u003e20\\u003c/sup\\u003e. However, the localization and function of PRMT5, the main type II PRMT, is not clear in the endometrium. Here, we found that PRMT5 expression was decreased in the mid-secretory endometrium of endometriosis patients, predominantly in stromal cells. Inhibition of the expression and activity of PRMT5 blunted endometrial decidualization in mice. Inhibition of PRMT5 activity impaired human endometrial stromal cell decidualization partly by activating the NF-kappa B (NF-\\u0026kappa;B) signaling pathway, while overexpression of PRMT5 rescued the decidualization defect in endometrial stromal cells from endometriosis patients.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003ch2\\u003eDecreased PRMT5 expression in the endometrial stromal cells of endometriosis patients\\u003c/h2\\u003e\\n\\u003cp\\u003eWe first screened the expression levels of \\u003cem\\u003ePRMT5\\u0026nbsp;\\u003c/em\\u003emRNA from several published gene expression profiles of endometriosis\\u0026nbsp;\\u003csup\\u003e24\\u0026ndash;26\\u003c/sup\\u003e and observed that the relative expression levels of \\u003cem\\u003ePRMT5\\u003c/em\\u003e were significantly decreased in the ectopic endometrium of endometriosis patients compared to the endometrium of healthy controls (Fig. 1A). We next determined PRMT5 expression in the mid-secretory phase eutopic endometrium of endometriosis patients. Our qPCR showed that the expression level of \\u003cem\\u003ePRMT5\\u003c/em\\u003e, but not \\u003cem\\u003ePRMT1\\u003c/em\\u003e or \\u003cem\\u003ePRMT3\\u003c/em\\u003e, was obviously decreased in the eutopic endometrium of endometriosis patients compared with that in fertile controls (Fig. 1B, Supplementary Fig. 1A, B). Western blot data further confirmed the decreased level of eutopic endometrial PRMT5 in endometriosis patients (Fig. 1C). Immunohistochemical staining (IHC) analysis revealed that the reduction in PRMT5 expression in the eutopic endometrium of endometriosis patients was observed mainly in stromal cells but not in epithelial cells (Fig. 1D).\\u0026nbsp;The above results indicated that PRMT5 was decreased in the eutopic endometrium of endometriosis patients, especially in stromal cells,\\u0026nbsp;prompting\\u0026nbsp;us to explore the potential role of endometrial stromal PRMT5.\\u003c/p\\u003e\\n\\u003ch2\\u003eEndometrial stromal PRMT5 expression increases upon decidualization in mice\\u003c/h2\\u003e\\n\\u003cp\\u003eTo address the pathophysiological significance of PRMT5 in endometrial stromal cells, we first analyzed the PRMT5 expression pattern in the peri-implantation mouse uterus by IHC. PRMT5 was primarily expressed in luminal epithelial cells at 0.5 days postcoitum (dpc) but expanded to uterine luminal and glandular epithelial cells and stromal cells at 3.5 dpc when the uteri entered receptive status\\u0026nbsp;\\u003csup\\u003e27\\u003c/sup\\u003e.\\u0026nbsp;With the onset of embryo implantation at 4.5 dpc, PRMT5 was detected in both epithelial and stromal cells surrounding the implanting blastocysts and became more visible in the decidualizing cells on 5.5 dpc (Fig. 2. A, B). We next assessed the PRMT5 expression pattern in a mouse model of artificially stimulated decidualization. PRMT5 expression increased after decidualization was stimulated, especially in decidualizing cells (Fig. 2. C, D).\\u0026nbsp;All the above data indicated that\\u0026nbsp;PRMT5 may be involved in the process of endometrial decidualization.\\u003c/p\\u003e\\n\\u003ch2\\u003ePRMT5 is required for endometrial decidualization in mice\\u003c/h2\\u003e\\n\\u003cp\\u003eTo clarify the role of PRMT5 in endometrial decidualization, we applied GSK591, a specific inhibitor of PRMT5\\u0026nbsp;\\u003csup\\u003e28\\u003c/sup\\u003e, to an artificial decidualization mouse model (Fig. 3A, B). After 4 days of oil stimulation, we observed impaired decidualization and decreased decidual tissue weight following GSK591 treatment (Fig. 3C, D). We also assessed the expression of FOXO1, HOXA10 and WNT4, well-known markers for uterine stromal differentiation during decidualization\\u0026nbsp;\\u003csup\\u003e9\\u003c/sup\\u003e.\\u0026nbsp;GSK591-treated mice showed decreased expression of FOXO1, HOXA10 and WNT4 after 4 days of oil stimulation compared with the control groups (Fig. 3E). The IHC assay also showed that FOXO1 was predominantly expressed in decidualizing stromal cells in the decidua of the control mice but was expressed in epithelial cells in the endometrium of GSK591-treated mice (Fig. 3F). In addition, we knocked down PRMT5 in mice following artificially induced decidualization (Fig. 3 G-I) and observed that knockdown of PRMT5 led to impaired decidualization and decreased decidual tissue weight (Fig. 3J). These results suggested that the expression and activity of PRMT5 were indispensable to endometrial decidualization in mice.\\u003c/p\\u003e\\n\\u003ch2\\u003ePRMT5 activity ensures human\\u0026nbsp; endometrial stromal cell decidualization\\u003c/h2\\u003e\\n\\u003cp\\u003eWe next assessed the significance of PRMT5 on the decidualization of human endometrial stromal cells (hEnSCs). Immunofluorescence staining showed that PRMT5 was predominantly localized in the epithelial cells of the proliferative endometrium, while its localization was expanded to epithelial and stromal cells in the secretory endometrium (Fig. 4A). The expression of PRMT5 increased markedly upon decidualization with 8-bromo-cAMP and medroxyprogesterone acetate (8Br-cAMP+MPA) (Fig. 4B). Treatment with GSK591 obviously blocked the increased IGFBP1 expression and PRL secretion, two important decidual marker genes\\u0026nbsp;\\u003csup\\u003e9\\u003c/sup\\u003e, in 8Br-cAMP+MPA-treated hEnSCs (Fig. 4C, D). We also examined whether inhibition of PRMT5 affects cytoskeletal organization. As shown in Fig. 4E, decidualized hEnSCs displayed polygonal cell morphologies and an increased number of nuclei in the expanding cytoplasm, but GSK591 treatment impeded the transformation from a long fibroblast-like shape into a round shape in hEnSCs. These findings indicated the significant role of PRMT5 activity in human endometrial stromal cell decidualization.\\u003c/p\\u003e\\n\\u003ch2\\u003eInhibiting PRMT5 \\u0026nbsp;activates the NF-\\u0026kappa;B signaling pathway in human endometrial stromal cells\\u003c/h2\\u003e\\n\\u003cp\\u003eTo further determine the role of PRMT5 in decidualization, RNA-seq analysis was performed\\u0026nbsp;on\\u0026nbsp;control hEnSCs, GSK591-treated hEnSCs, decidualized hEnSCs and GSK591-treated decidualized hEnSCs (Fig. 5A). There were 137 genes\\u0026nbsp;upregulated\\u0026nbsp;and 148 genes\\u0026nbsp;downregulated\\u0026nbsp;in GSK591-treated decidualized hEnSCs compared with decidualized hEnSCs (Fig. 5B). Gene ontology (GO) enrichment analysis of\\u0026nbsp;genes that showed changes between\\u0026nbsp;GSK591-treated decidualized hEnSCs and decidualized hEnSCs\\u0026nbsp;showed\\u0026nbsp;abundant enrichment in immune-\\u0026nbsp;and inflammatory-related pathways (Fig. 5C). We next explored the decidualizing-related genes regulated by PRMT5.\\u0026nbsp;Forty-three\\u0026nbsp;out of 1374 changed genes between\\u0026nbsp;decidualized hEnSCs\\u0026nbsp;and control hEnSCs\\u0026nbsp;were\\u0026nbsp;observed in the 242 changed genes between\\u0026nbsp;GSK591-treated decidualized hEnSCs and decidualized hEnSCs (Fig. 5D, E). The intersection analysis of the 43 differentially expressed genes and the target genes of multiple transcription factors, including TP53, CREB1 and FOXO1, which have been shown to be closely related to endometrial function and decidualization\\u0026nbsp;\\u003csup\\u003e9\\u003c/sup\\u003e, was conducted (Fig. 5F). Among the 43\\u0026nbsp;differentially expressed\\u0026nbsp;genes, there were 37 target genes of TP53, 33 target genes of CREB1, and 11 target genes of FOXO1 (Fig. 5G). Endometriosis patients showed decreased mRNA levels of TP53 and FOXO1, while increased mRNA level of CREB1\\u0026nbsp;in the mid-secretory phase eutopic endometrium compared with the\\u0026nbsp;fertile controls\\u0026nbsp;(Fig. 5H).\\u003c/p\\u003e\\n\\u003cp\\u003eKyoto Encyclopedia of Genes and Genomes (KEGG) analysis and Gene Set Enrichment Analysis (GSEA) further showed an enrichment of\\u0026nbsp;the\\u0026nbsp;NF-\\u0026kappa;B signaling pathway in GSK591-treated decidualized hEnSCs compared with decidualized hEnSCs (Fig. 6A, B). Immunofluorescence staining\\u0026nbsp;revealed the\\u0026nbsp;translocation of\\u0026nbsp;the\\u0026nbsp;NF-\\u0026kappa;B subunit p65 into\\u0026nbsp;the nucleus\\u0026nbsp;in GSK591-treated decidualized hEnSCs, suggesting the activation of\\u0026nbsp;the\\u0026nbsp;NF-\\u0026kappa;B signaling pathway (Fig. 6C). Luciferase reporter assays revealed that overexpression of PRMT5 inhibited, while\\u0026nbsp;treatment of GSK591 promoted\\u0026nbsp;the transcriptional activity of NF-\\u0026kappa;B (Fig. 6D).\\u0026nbsp;A cluster\\u0026nbsp;heatmap showed the differential expression of NF-\\u0026kappa;B signaling pathway-related molecules in GSK591-treated decidualized hEnSCs (Fig. 6E). Protein\\u0026ndash;protein interaction network analysis of differentially expressed genes showed a number of inflammatory factors in GSK591-treated decidualized hEnSCs (Fig. 6F). qRT\\u0026ndash;PCR data confirmed that\\u0026nbsp;the\\u0026nbsp;mRNA levels of \\u003cem\\u003eIL1A\\u003c/em\\u003e and \\u003cem\\u003eIL1B\\u003c/em\\u003e were increased significantly in GSK591-treated decidualized hEnSCs (Fig. 6G), which was also observed in the endometrium of endometriosis patients (Supplementary\\u0026nbsp;Fig. 2). All the above results suggested that activation of\\u0026nbsp;the\\u0026nbsp;NF-\\u0026kappa;B signaling pathway may contribute to the decidualization defect in hEnSCs with inhibition of PRMT5 activity.\\u003c/p\\u003e\\n\\u003ch2\\u003ePRMT5 rescues decidualization\\u0026nbsp; defects in \\u0026nbsp;endometrial stromal cells from\\u0026nbsp; endometriosis patients\\u003c/h2\\u003e\\n\\u003cp\\u003eDue to the potential regulatory effect of PRMT5 on decidualization, we speculated that overexpression of PRMT5 may improve the decidualization of endometrial stromal cells from\\u0026nbsp;endometriosis patients. As expected, p65 was predominantly localized in the nucleus of stromal cells in the mid-secretory phase eutopic endometrium of endometriosis patients (Fig. 7A). Primary hEnSCs isolated from the endometrial tissues of endometriosis patients showed impaired decidualization after differentiation stimulus, as revealed by IGFBP1 mRNA expression and secreted PRL levels. However, PRMT5 supplementation\\u0026nbsp;obviously\\u0026nbsp;promoted IGFBP1 mRNA expression (31.56 vs. 91.18, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05) and secreted PRL levels (85.17 vs. 115.33 ng/mL, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001) (Fig. 7B, C), indicating that PRMT5 rescued the decidualization defect of endometrial stromal cells from endometriosis patients.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eDecidualization\\u0026nbsp;defects are\\u0026nbsp;responsible\\u0026nbsp;for\\u0026nbsp;impaired endometrial receptivity and embryo implantation failure, contributing to reproductive disorders, such as endometriosis\\u0026nbsp;\\u003csup\\u003e29,30\\u003c/sup\\u003e. Arginine methylation\\u0026nbsp;mediated\\u0026nbsp;by PRMTs has been shown to be an important posttranslational mechanism involved in various biological processes\\u0026nbsp;\\u003csup\\u003e31\\u003c/sup\\u003e. However, the role of arginine methylation in the process of physiological decidualization and pathological decidualization\\u0026nbsp;defects is not clear.\\u003c/p\\u003e\\n\\u003cp\\u003eRecently, some studies have reported increased expression of PRMT1 and PRMT3, two type I enzymes, in the endometrium of LPS-induced endometritis rats and the decidua of recurrent miscarriage patients,\\u0026nbsp;respectively\\u0026nbsp;\\u003csup\\u003e20,32\\u003c/sup\\u003e. By screening\\u0026nbsp;the expression levels of various \\u003cem\\u003ePRMT\\u003c/em\\u003e mRNAs from several published gene expression profiles of endometriosis\\u0026nbsp;(GSE23339, GSE5108 and GSE7305), we observed that PRMT5, a major type II enzyme, was sed\\u0026nbsp;in the ectopic endometrium of endometriosis patients compared to the eutopic endometrium of healthy controls. In humans, circulating progesterone levels are increased following ovulation and maintained at elevated levels during the secretory phase to induce decidualization of hEnSCs in nonpregnant cycles\\u0026nbsp;\\u003csup\\u003e33\\u003c/sup\\u003e. Our data confirmed that the expression of PRMT5 was suppressed in the\\u0026nbsp;eutopic mid-secretory endometrium of endometriosis patients, especially in stromal cells. As expected, we observed an obvious increase\\u0026nbsp;in\\u0026nbsp;PRMT5 in the normal mid-secretory human endometrium and \\u003cem\\u003ein vitro\\u003c/em\\u003e induced decidualized hEnSCs compared with normal proliferative human endometrium and undifferentiated hEnSCs,\\u0026nbsp;respectively.\\u0026nbsp;In mice, decidualization does not occur in\\u0026nbsp;the\\u0026nbsp;normal estrus cycle\\u0026nbsp;but is initiated by embryo attachment in normal pregnancy or elicited in hormonally sensitized mice by instillation of an irritant such as oil\\u0026nbsp;\\u003csup\\u003e34\\u003c/sup\\u003e. PRMT5 was observed in the endometrial stromal cells surrounding the implanting blastocyst at 4.5 dpc and became more visible in the decidualizing cells at 5.5 dpc. Elevated PRMT5 during decidualization was further confirmed in a mouse model of artificially stimulated decidualization.\\u0026nbsp;GSK591 is a substrate-competitive inhibitor of PRMT5\\u0026nbsp;\\u003csup\\u003e28\\u003c/sup\\u003e. We found that GSK591 blunted decidualization in\\u0026nbsp;mice with artificially stimulated decidualization and hEnSCs with \\u003cem\\u003ein vitro\\u003c/em\\u003e stimulated decidualization, which clearly showed that stromal PRMT5 played a crucial role in endometrial decidualization. Furthermore, we confirmed that overexpression of PRMT5 rescued the decidualization defect of primary hEnSCs from endometriosis patients.\\u0026nbsp;The human study is limited by its retrospective nature, and a larger sample size or a prospective randomized design could be used in future studies to corroborate the potential effect of PRMT5 on decidualization defects observed in many uterine disorders.\\u003c/p\\u003e\\n\\u003cp\\u003eNF-\\u0026kappa;B is a family of transcription factors composed of\\u0026nbsp;homodimers or heterodimers\\u0026nbsp;of related Rel proteins, including RelA (p65), p105/p50, p100/p52, c-Rel, and RelB\\u0026nbsp;\\u003csup\\u003e35\\u003c/sup\\u003e. The upstream stimulus activates\\u0026nbsp;the\\u0026nbsp;I\\u0026kappa;B kinase\\u0026nbsp;(IKK) complex, which\\u0026nbsp;restrains\\u0026nbsp;inactive NF-\\u0026kappa;B in the cytoplasm, leading to the accumulation of NF-\\u0026kappa;B in the nucleus, where it binds to NF-\\u0026kappa;B DNA consensus sequences and\\u0026nbsp;activates\\u0026nbsp;target genes\\u0026nbsp;\\u003csup\\u003e36\\u003c/sup\\u003e.\\u0026nbsp;The functional prediction of the\\u0026nbsp;PRMT5 activity-regulated\\u0026nbsp;transcriptome via GO analysis, KEGG analysis and GSEA showed\\u0026nbsp;that\\u0026nbsp;the \\u0026ldquo;NF-\\u0026kappa;B signaling pathway\\u0026rdquo; was enriched in\\u0026nbsp;GSK591-treated decidualized hEnSCs, which was further supported by the\\u0026nbsp;translocation of p65 into\\u0026nbsp;the nucleus\\u0026nbsp;and increased inflammatory factors.\\u0026nbsp;NF-\\u0026kappa;B mediates signaling between\\u0026nbsp;interleukin (IL)-1\\u0026alpha; and\\u0026nbsp;tumor\\u0026nbsp;necrosis factor \\u0026alpha; (TNF\\u0026alpha;) and the expression of LIF and IL-6 in endometrial epithelial cells\\u0026nbsp;\\u003csup\\u003e37\\u003c/sup\\u003e, but the detailed regulatory mechanism of NF-\\u0026kappa;B underlying decidualization is still not clear. A previous study reported that\\u0026nbsp;proinflammatory\\u0026nbsp;signaling to NF-\\u0026kappa;B may be suppressed in early pregnancy,\\u0026nbsp;contributing to the immunosuppressive mechanism during embryo implantation\\u0026nbsp;\\u003csup\\u003e38\\u003c/sup\\u003e. While acute inflammation is required for implantation, chronic inflammation is disruptive for pregnancy\\u0026nbsp;\\u003csup\\u003e6\\u003c/sup\\u003e. Inflammation is the central process in endometriosis, leading to chronic pain, fibrosis and infertility\\u0026nbsp;\\u003csup\\u003e30\\u003c/sup\\u003e. Some previous studies have shown that\\u0026nbsp;the\\u0026nbsp;NF-\\u0026kappa;B signaling pathway was activated in the eutopic secretory endometrium of endometriosis patients, which was also observed in our study, indicating\\u0026nbsp;that\\u0026nbsp;the absence of decreased p65 activity in\\u0026nbsp;the\\u0026nbsp;secretory endometrium could participate in endometrial biologic alterations during the implantation window in endometriosis patients\\u0026nbsp;\\u003csup\\u003e39\\u0026ndash;41\\u003c/sup\\u003e. In addition, NF-\\u0026kappa;B inactivation by\\u0026nbsp;progesterone and synthetic progestin attenuated the expression of IL-8 in endometriotic stromal cells to control the growth associated with endometriosis\\u0026nbsp;\\u003csup\\u003e42,43\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eIn addition to being\\u0026nbsp;regulated by IKK, various posttranslational modifications are involved in the regulation of NF-\\u0026kappa;B, including ubiquitination, phosphorylation, acetylation, sumoylation, nitrosylation and methylation\\u0026nbsp;\\u003csup\\u003e44\\u0026ndash;48\\u003c/sup\\u003e. Previous studies have found that p65 is activated by PRMT5 via\\u0026nbsp;symmetric dimethylation of\\u0026nbsp;arginine 30\\u0026nbsp;and\\u0026nbsp;suppressed by PRMT1 via asymmetric dimethylation\\u0026nbsp;of\\u0026nbsp;arginine 30, indicating the\\u0026nbsp;antagonistic\\u0026nbsp;relationship between PRMT1 and PRMT5 in regulating NF-\\u0026kappa;B\\u0026nbsp;\\u003csup\\u003e46\\u003c/sup\\u003e\\u003csup\\u003e48\\u003c/sup\\u003e. Here, we found that inhibiting PRMT5 activity in hEnSCs led to p65 nuclear translocation and NF-\\u0026kappa;B signaling pathway activation. In addition, p65 nuclear translocation and increased expression of NF-\\u0026kappa;B signaling-related inflammatory factors were also observed in primary hEnSCs from endometriosis patients with reduced expression\\u0026nbsp;levels\\u0026nbsp;of PRMT5. However,\\u0026nbsp;the detailed mechanism by\\u0026nbsp;which\\u0026nbsp;PRMT5 symmetrically\\u0026nbsp;demethylates\\u0026nbsp;p65 to inhibit NF-\\u0026kappa;B signaling in hEnSCs\\u0026nbsp;needs to be further explored.\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, we identified PRMT5 as a critical regulator in decidualization both in mice and\\u0026nbsp;humans, partly due to its effect on\\u0026nbsp;the\\u0026nbsp;NF-\\u0026kappa;B signaling pathway.\\u0026nbsp;Since several PRMT5 inhibitors are in ongoing preclinical and clinical studies for the treatment of cancer\\u003csup\\u003e49\\u003c/sup\\u003e, it is worth observing potential side effects on the endometrium and reproductive capacity. In addition, we confirmed that overexpression of PRMT5 rescued the decidualization defect of primary hEnSCs from endometriosis patients, suggesting that promotion of PRMT5 may provide novel therapeutic strategies for the treatment of decidualization defects in infertile women, such as those with endometriosis.\\u003c/p\\u003e\"},{\"header\":\"Methods And Materials\",\"content\":\"\\u003ch2\\u003eSample collection\\u003c/h2\\u003e\\n\\u003cp\\u003eEndometrial biopsy samples were taken from women undergoing treatment at the Reproductive Medicine Center of Nanjing Drum Tower Hospital\\u0026nbsp;(2013-408 081-01). Informed consent was signed\\u0026nbsp;by\\u0026nbsp;the patients before sample collection. The women in the study were aged between 20 and 40, and none of them had received hormone therapy for at least 3 months prior to tissue collection. The endometriosis group was comprised of women with endometriosis ovarian cysts diagnosed by ultrasound, elevated serum CA125, or endometriosis ovarian cysts confirmed by laparoscopic surgery. The normal group was comprised of women receiving assisted reproductive treatment because of male infertility factors. Mid-secretory endometria timed 6-8 days after ovulation in the natural cycle, as determined by ultrasonography, were obtained from 14 normal women and 14 women with endometriosis for qRT\\u0026ndash;PCR, western blotting and immunohistochemical staining. Proliferative endometria were obtained from 3 normal women for immunofluorescence staining.\\u0026nbsp;Freshly\\u0026nbsp;collected endometrial tissues from 11 normal women and 3 endometriosis patients were cut into fragments of approximately 1 mm\\u003csup\\u003e3\\u003c/sup\\u003e, digested with 0.1% collagenase, centrifuged and filtered through a screen to\\u0026nbsp;obtain\\u0026nbsp;the primary human endometrial stromal cells (hEnSCs) for \\u003cem\\u003ein vitro\\u003c/em\\u003e decidualization experiments as described previously\\u0026nbsp;\\u003csup\\u003e21\\u003c/sup\\u003e. Detailed information\\u0026nbsp;on the\\u0026nbsp;participants in this study is summarized in Supplementary Table 1.\\u003c/p\\u003e\\n\\u003ch2\\u003eAnimals and artificially induced \\u003cem\\u003ein vivo\\u003c/em\\u003e decidualization\\u003c/h2\\u003e\\n\\u003cp\\u003eICR (Institute of Cancer Research)\\u0026nbsp;mice (n=32) were purchased from the Lab Animal Center of Yangzhou University (Yangzhou, China).\\u0026nbsp;Fourteen\\u0026nbsp;mice were subjected to\\u0026nbsp;a\\u0026nbsp;normal pregnancy assay. To induce \\u003cem\\u003ein vivo\\u003c/em\\u003e decidualization,\\u0026nbsp;6\\u0026ndash;8-wk-old\\u0026nbsp;female mice were ovariectomized (n=25) with appropriate analgesics. After 14 days, the mice were injected with\\u0026nbsp;100 ng\\u0026nbsp;E2 (Sigma-Aldrich, St Louis, MO, USA, #E2758) subcutaneously for 3 consecutive days. After 2 days of rest, the mice were injected with\\u0026nbsp;1 mg\\u0026nbsp;P4 (Sigma-Aldrich, #P0130) and\\u0026nbsp;10 ng\\u0026nbsp;E2 subcutaneously for 3 consecutive days. After the last hormone injection,\\u0026nbsp;artificial\\u0026nbsp;decidualization was induced in one uterine horn by injection of\\u0026nbsp;20 \\u0026mu;L\\u0026nbsp;of sesame oil into the lumen. The other uterine horn was left unstimulated as a control. Daily hormone treatments with\\u0026nbsp;1 mg\\u0026nbsp;P4 and\\u0026nbsp;10 ng\\u0026nbsp;E2 were continued for another 5 days. During this process, the mice\\u0026nbsp;were\\u0026nbsp;treated with GSK591 (n=3) (MedChem Express, Monmouth Junction, NJ, USA, #HY-100235), Ad-shPrmt5 (n=6) and vehicle (n=9) at times outlined in the procedure in Figure 3.\\u0026nbsp;Six\\u0026nbsp;hours after the last hormone injection, the mice were sacrificed,\\u0026nbsp;the wet weight of both uterine horns of each mouse\\u0026nbsp;was\\u0026nbsp;recorded,\\u0026nbsp;and uterine tissue was collected and fixed in 4% (wt/vol) paraformaldehyde for histological and immunohistochemical analyses.\\u0026nbsp;All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Drum Tower Hospital (No.20210510).\\u003c/p\\u003e\\n\\u003ch2\\u003eConstruction of adenoviruses\\u003c/h2\\u003e\\n\\u003cp\\u003eAn adenovirus\\u0026nbsp;harboring\\u0026nbsp;PRMT5 (Ad-PRMT5) was generated using AdMax (Microbix Biosystems, Inc., Toronto, ON, Canada) as previously described\\u0026nbsp;\\u003csup\\u003e22\\u003c/sup\\u003e.\\u0026nbsp;The primers\\u0026nbsp;used for Ad-shPrmt5 construction were purchased from Sangon Biotech (Shanghai, China) and designed to target the following cDNA sequence: GCACAGTTTGAGATGCCTTAT (Supplementary Table 2). Then, shPrmt5 was cloned into pacAd5 U6-GFP, followed by\\u0026nbsp;adenovirus construction. The adenoviruses were propagated in HEK293A cells and purified via CsCl\\u003csub\\u003e2\\u003c/sub\\u003e banding, followed by dialysis against 20 mmol/l Tris-buffered saline with 10% glycerol.\\u003c/p\\u003e\\n\\u003ch2\\u003eCell culture and \\u003cem\\u003ein vitro\\u003c/em\\u003e decidualization of human endometrial stromal cells\\u003c/h2\\u003e\\n\\u003cp\\u003eThe primary endometrial stromal cells were isolated and cultured as described previously\\u0026nbsp;\\u003csup\\u003e21\\u003c/sup\\u003e. Before inducing decidual differentiation, the cells were treated with\\u0026nbsp;5 \\u0026mu;M\\u0026nbsp;GSK591 (MedChem Express, #HY-100235) or solvent for\\u0026nbsp;24 h and\\u0026nbsp;then incubated in DMEM/F12 without phenol red containing 2.5% carbon-adsorbed serum. Medroxyprogesterone acetate (MPA) (1 \\u0026mu;M) (Sigma-Aldrich,\\u0026nbsp;#71589) and 8-Bromo-cAMP (8-Br-cAMP) (0.5 mM) (Sigma-Aldrich,\\u0026nbsp;#B7880)\\u0026nbsp;were\\u0026nbsp;added to the cellular supernatant. After\\u0026nbsp;48\\u0026nbsp;h-72 h, the decidualization of stromal cells was assessed by\\u0026nbsp;evaluating\\u0026nbsp;decidualization marker gene expression and cell morphological analysis. For\\u0026nbsp;the\\u0026nbsp;rescue assay, cells were pretreated with Ad-PRMT5 for 24 hours and then treated with 8-Br-cAMP and MPA for 3 days and 6 days.\\u003c/p\\u003e\\n\\u003ch2\\u003eImmunohistochemical staining\\u003c/h2\\u003e\\n\\u003cp\\u003eThe tissues were fixed in 4% paraformaldehyde and embedded in paraffin wax. After\\u0026nbsp;deparaffinization\\u0026nbsp;and rehydration, antigen unmasking was performed by heating the sections in\\u0026nbsp;10 mM\\u0026nbsp;sodium citrate buffer (pH 6.0) at 95 \\u0026deg;C for\\u0026nbsp;10 minutes. The sections were then incubated with 3% H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e in deionized water for\\u0026nbsp;15 min\\u0026nbsp;to block endogenous peroxidase activity,\\u0026nbsp;and nonspecific binding sites were blocked with 10% normal goat serum for\\u0026nbsp;30 min\\u0026nbsp;at room temperature. The sections were then incubated with primary\\u0026nbsp;antibodies against\\u0026nbsp;PRMT5 (Abcam, Cambridge, USA, #ab109451,) and FOXO1 (Cell Signaling Technology, MA, USA, #2880S) in a humid chamber overnight at 4 \\u0026deg;C, followed by incubation with the corresponding biotinylated secondary antibody at 37 \\u0026deg;C for\\u0026nbsp;30 min. Next, the sections were stained with 3,3\\u0026prime;diaminobenzidine (DAB) and counterstained with hematoxylin.\\u0026nbsp;Digital images were captured using a Leica DM 2000 microscope and LAS Core software (Leica Microsystems Limited, Wetzlar, Germany). Quantitative analysis of the relative protein expression levels in the epithelial cells and stromal cells of the endometrium samples were determined according to the integrated optical density (IOD) of the digital images (\\u0026times;400) using Image-Pro Plus System 6.0 (Media Cybernetics, Inc., Silver Spring, MD, USA) in a blinded fashion as described previously\\u0026nbsp;\\u003csup\\u003e23\\u003c/sup\\u003e.\\u003c/p\\u003e\\n\\u003ch2\\u003eImmunofluorescence\\u0026nbsp;staining for\\u0026nbsp;PRMT5 and F-actin\\u003c/h2\\u003e\\n\\u003cp\\u003ehEnSCs were fixed with 4% paraformaldehyde for\\u0026nbsp;20 min at\\u0026nbsp;RT\\u0026nbsp;and\\u0026nbsp;then permeabilized with 0.1% Triton X-100 in PBS for\\u0026nbsp;5 min at\\u0026nbsp;RT.\\u0026nbsp;Nonspecific\\u0026nbsp;sites were blocked with 1% BSA in PBS for\\u0026nbsp;1 h\\u0026nbsp;at 37 \\u0026deg;C. Endogenous proteins were stained with primary antibodies against PRMT5 (Abcam, #ab109451) or F-actin (Abcam, #ab112125,) at 4 \\u0026deg;C overnight. Fluorescence-conjugated secondary antibodies were used to visualize the signal. Nuclei were stained with 4\\u0026prime;,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma\\u0026ndash;Aldrich,\\u0026nbsp;#9542) for\\u0026nbsp;10 min. Finally, images were visualized by fluorescence confocal microscopy and processed using ImageJ software.\\u003c/p\\u003e\\n\\u003ch2\\u003eEnzyme-linked immunosorbent assay (ELISA)\\u003c/h2\\u003e\\n\\u003cp\\u003eAfter\\u0026nbsp;72 h\\u0026nbsp;of decidualization,\\u0026nbsp;hEnSC\\u0026nbsp;culture supernatants were harvested and centrifuged to remove cell debris. PRL\\u0026nbsp;levels were\\u0026nbsp;measured using\\u0026nbsp;a commercially\\u0026nbsp;available enzyme-linked immunosorbent assay kit (R\\u0026amp;D Systems, Minneapolis, MN, USA, #DPRL00) in collected supernatants\\u0026nbsp;according to the manufacturer\\u0026rsquo;s instructions. Samples were assayed in\\u0026nbsp;duplicate, and\\u0026nbsp;the concentrations were expressed as ng/mL cell supernatant.\\u003c/p\\u003e\\n\\u003ch2\\u003eWestern blot analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eProtein was extracted from the tissues or cells using RIPA buffer with a phosphatase inhibitor (Sigma-Aldrich,\\u0026nbsp;#P5726) and protease inhibitors (Roche, Branford, CT, USA,\\u0026nbsp;#11697498001). The supernatant was extracted after\\u0026nbsp;high-speed\\u0026nbsp;centrifugation at 4 \\u0026deg;C.\\u0026nbsp;The protein\\u0026nbsp;concentration was determined using the BCA Protein Assay kit (Beyotime, Jiangsu, China,\\u0026nbsp;#P0011). Equal amounts of protein (20 \\u0026mu;g) were separated by SDS\\u0026ndash;PAGE and transferred to polyvinylidene difluoride membranes (Merck Millipore, Darmstadt, Germany,\\u0026nbsp;#03010040001). The membranes were blocked with 5% skimmed milk for\\u0026nbsp;1 h\\u0026nbsp;and then incubated overnight at 4 \\u0026deg;C with primary antibodies, including those against PRMT5 (Abcam, #ab109451), sDMA (Cell Signaling Technology, #13222), FOXO1 (Cell Signaling Technology, #2880S), HOXA10 (SantaCruz,\\u0026nbsp;CA, USA, #271953), WNT4 (Genetex, Irvine, CA, USA, #101085), PGR (SantaCruz, #SC810), NF-\\u0026kappa;B (SantaCruz, #SC372) and GAPDH (Bioworld Technology, MN, USA, #AP0063). After\\u0026nbsp;incubation for\\u0026nbsp;1 hour with HRP-conjugated secondary antibodies, detection was performed using an enhanced chemiluminescence kit (Merck Millipore, #32106). The expression of each protein was normalized to the expression of GAPDH in the corresponding sample,\\u0026nbsp;and the relative abundance of the target proteins was estimated by densitometric quantification of the signal intensities using ImageJ software.\\u003c/p\\u003e\\n\\u003ch2\\u003eRNA isolation\\u0026nbsp;and\\u0026nbsp;quantitative real-time PCR\\u003c/h2\\u003e\\n\\u003cp\\u003eTotal RNA was extracted from cells using TRIzol (Takara\\u0026nbsp;Bio, Shiga, Japan,\\u0026nbsp;#T9108)\\u0026nbsp;following the manufacturer\\u0026apos;s instructions. RNA purity was assessed by measuring\\u0026nbsp;the\\u0026nbsp;OD at\\u0026nbsp;260 nm\\u0026nbsp;and\\u0026nbsp;280 nm,\\u0026nbsp;and RNA integrity was assessed by agarose gel electrophoresis. The first strand of DNA (cDNA) was synthesized from total RNA (1 \\u0026mu;g) using\\u0026nbsp;the\\u0026nbsp;Takara PrimeScriptTM RT reagent kit (Takara Bio,\\u0026nbsp;#RR037A).\\u0026nbsp;The expression\\u0026nbsp;levels of genes were analyzed by real-time PCR with SYBR Premix Ex Taq kits (Takara Bio,\\u0026nbsp;#RR820A) using appropriate primers (Supplementary Table 3). Relative gene expression levels were calculated with the 2-∆∆Ct method, with 18S RNA used as the internal control.\\u003c/p\\u003e\\n\\u003ch2\\u003eRNA-seq and data analysis\\u003c/h2\\u003e\\n\\u003cp\\u003ePrimary endometrial stromal cells were cultured in\\u0026nbsp;60 mm\\u0026nbsp;dishes and treated with GSK591 (MedChem Express, #HY-100235) or solvent for\\u0026nbsp;24 h and\\u0026nbsp;then decidualized for another\\u0026nbsp;48 h. Total RNA was extracted from cells using TRIzol (Takara\\u0026nbsp;Bio,\\u0026nbsp;#T9108). RNA-seq and data analysis were performed by OE Biotech Co., Ltd.\\u0026nbsp;(Shanghai, China). Clean reads were mapped to\\u0026nbsp;the\\u0026nbsp;human reference genome using HISAT2.\\u0026nbsp;The\\u0026nbsp;DESeqR software package was used to identify DEGs (the threshold was set as P value \\u0026lt; 0.05 and |log2foldChange| \\u0026gt; 1 for\\u0026nbsp;significant\\u0026nbsp;difference). ClusterProfiler49 was used to perform GO, KEGG and GSEA\\u0026nbsp;analyses. The transcription factor regulatory network was analyzed by KnockTF (http://www.licpathway.net/KnockTF/index.php).\\u003c/p\\u003e\\n\\u003ch2\\u003eDual-luciferase reporter assay\\u003c/h2\\u003e\\n\\u003cp\\u003ePreconfluent\\u0026nbsp;(60%) hEnSCs in 24-well plates were transfected with the indicated plasmids\\u0026nbsp;using Lipofectamine 3000 Reagent (Invitrogen, Carlsbad, California, USA, #L3000008). NF-\\u0026kappa;B-Luc was purchased from Beyotime\\u0026nbsp;Biotech (#D2206). Dual Luciferase Assay System (Promega,\\u0026nbsp;Madison, WI, USA, #E2940) was used to analyze the luciferase activities with a luminescence counter (Berthold Technologies) according to the manufacturer\\u0026rsquo;s instructions. Firefly luciferase activity was normalized to the corresponding \\u003cem\\u003eRenilla\\u003c/em\\u003e luciferase activity.\\u003c/p\\u003e\\n\\u003ch2\\u003eStatistical analyses\\u003c/h2\\u003e\\n\\u003cp\\u003eGraphPad Prism 9.0 was used for data statistics and analysis. A Student\\u0026rsquo;s t test was used to compare data between two groups, and one-way ANOVA with Tukey\\u0026apos;s multiple comparisons was used to compare data from more than two groups. Two-way ANOVA with Tukey\\u0026rsquo;s correction for multiple comparisons was applied for data from two groups with three time points. Data quantification was expressed as the mean \\u0026plusmn; standard error (X \\u0026plusmn; SEM), and P\\u0026lt;0.05 indicated a significant difference in all cases.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors provide detailed description of methods and original data upon request. RNA-seq data sets generated in this study have been deposited at the Gene Expression Omnibus (GEO) database under accession number\\u0026nbsp;GSE205883 (taken: evwhkaswnbsbzgl).\\u003c/p\\u003e\\n\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eG.Y. and R.J. initiated and supervised the project. X.C., M.X., H.Z. and M.Z performed the experiments, and collected the data; J.W. and J.M. contributed to the clinical samples collection and analysis. Y.Z., J.Z., X.Z., N.K., and Q.Y. contributed to the animal models and animal analysis. G.Y., R.J. and X.C. analyzed and discussed the data. R.J. and X.C. prepared the original draft manuscript, G.Y. and H.S. edited and finalized manuscript. All authors critically read and commented on the manuscript and approved the final version for submission.\\u003c/p\\u003e\\n\\n\\u003cp\\u003e\\u003cstrong\\u003eFinding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the National Natural Science Foundation of China (31872846 and 82030040).\\u003c/p\\u003e\\n\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors have declared no\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003econflict of interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eVercellini P, Vigan\\u0026ograve; P, Somigliana E, Fedele L. Endometriosis: Pathogenesis and treatment. \\u003cem\\u003eNat Rev Endocrinol\\u003c/em\\u003e 2014; \\u003cstrong\\u003e10\\u003c/strong\\u003e: 261\\u0026ndash;275.\\u003c/li\\u003e\\n \\u003cli\\u003ePrescott J, Farland L V., Tobias DK, Gaskins AJ, Spiegelman D, Chavarro JE \\u003cem\\u003eet al.\\u003c/em\\u003e A prospective cohort study of endometriosis and subsequent risk of infertility. \\u003cem\\u003eHum Reprod\\u003c/em\\u003e 2016; \\u003cstrong\\u003e31\\u003c/strong\\u003e: 1475\\u0026ndash;1482.\\u003c/li\\u003e\\n \\u003cli\\u003eVercammen EE, D\\u0026rsquo;Hooghe TM. Endometriosis and recurrent pregnancy loss. \\u003cem\\u003eSemin Reprod Med\\u003c/em\\u003e 2000; \\u003cstrong\\u003e18\\u003c/strong\\u003e: 363\\u0026ndash;368.\\u003c/li\\u003e\\n \\u003cli\\u003eMeuleman C, Vandenabeele B, Fieuws S, Spiessens C, Timmerman D, D\\u0026rsquo;Hooghe T. High prevalence of endometriosis in infertile women with normal ovulation and normospermic partners. \\u003cem\\u003eFertil Steril\\u003c/em\\u003e 2009; \\u003cstrong\\u003e92\\u003c/strong\\u003e: 68\\u0026ndash;74.\\u003c/li\\u003e\\n \\u003cli\\u003ePrapas Y, Goudakou M, Matalliotakis I, Kalogeraki A, Matalliotaki C, Panagiotidis Y \\u003cem\\u003eet al.\\u003c/em\\u003e History of endometriosis may adversely affect the outcome in menopausal recipients of sibling oocytes. \\u003cem\\u003eReprod Biomed Online\\u003c/em\\u003e 2012; \\u003cstrong\\u003e25\\u003c/strong\\u003e: 543\\u0026ndash;548.\\u003c/li\\u003e\\n \\u003cli\\u003eLessey BA, Kim JJ. Endometrial receptivity in the eutopic endometrium of women with endometriosis: it is affected, and let me show you why. \\u003cem\\u003eFertil Steril\\u003c/em\\u003e 2017; \\u003cstrong\\u003e108\\u003c/strong\\u003e: 19\\u0026ndash;27.\\u003c/li\\u003e\\n \\u003cli\\u003eKim TH, Yoo J-YY, Choi K-CC, Shin J-HH, Leach RE, Fazleabas AT \\u003cem\\u003eet al.\\u003c/em\\u003e Loss of HDAC3 results in nonreceptive endometrium and female infertility. \\u003cem\\u003eSci Transl Med\\u003c/em\\u003e 2019; \\u003cstrong\\u003e11\\u003c/strong\\u003e: 1\\u0026ndash;12.\\u003c/li\\u003e\\n \\u003cli\\u003eBellver J, Sim\\u0026oacute;n C. Implantation failure of endometrial origin: What is new? \\u003cem\\u003eCurr Opin Obstet Gynecol\\u003c/em\\u003e 2018; \\u003cstrong\\u003e30\\u003c/strong\\u003e: 229\\u0026ndash;236.\\u003c/li\\u003e\\n \\u003cli\\u003eGellersen B, Brosens JJ. Cyclic decidualization of the human endometrium in reproductive health and failure. \\u003cem\\u003eEndocr Rev\\u003c/em\\u003e 2014; \\u003cstrong\\u003e35\\u003c/strong\\u003e: 851\\u0026ndash;905.\\u003c/li\\u003e\\n \\u003cli\\u003eYilmaz BD, Bulun SE. Endometriosis and nuclear receptors. \\u003cem\\u003eHum Reprod Update\\u003c/em\\u003e 2019; \\u003cstrong\\u003e25\\u003c/strong\\u003e: 473\\u0026ndash;485.\\u003c/li\\u003e\\n \\u003cli\\u003eKim JJ, Buzzio OL, Li S, Lu Z. Role of FOXO1A in the regulation of insulin-like growth factor-binding protein-1 in human endometrial cells: Interaction with progesterone receptor. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e 2005; \\u003cstrong\\u003e73\\u003c/strong\\u003e: 833\\u0026ndash;839.\\u003c/li\\u003e\\n \\u003cli\\u003eKim TH, Yu Y, Luo L, Lydon JP, Jeong JW, Kim JJ. Activated AKT pathway promotes establishment of endometriosis. \\u003cem\\u003eEndocrinology\\u003c/em\\u003e 2014; \\u003cstrong\\u003e155\\u003c/strong\\u003e: 1921\\u0026ndash;1930.\\u003c/li\\u003e\\n \\u003cli\\u003eSu RW, Strug MR, Joshi NR, Jeong JW, Miele L, Lessey BA \\u003cem\\u003eet al.\\u003c/em\\u003e Decreased notch pathway signaling in the endometrium of women with endometriosis impairs decidualization. \\u003cem\\u003eJ Clin Endocrinol Metab\\u003c/em\\u003e 2015; \\u003cstrong\\u003e100\\u003c/strong\\u003e: E433\\u0026ndash;E442.\\u003c/li\\u003e\\n \\u003cli\\u003eWu Y, Halverson G, Basir Z, Strawn E, Yan P, Guo SW. Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. \\u003cem\\u003eAm J Obs Gynecol\\u003c/em\\u003e 2005; \\u003cstrong\\u003e193\\u003c/strong\\u003e: 371\\u0026ndash;380.\\u003c/li\\u003e\\n \\u003cli\\u003eKim JJ, Taylor HS, Lu Z, Ladhani O, Hastings JM, Jackson KS \\u003cem\\u003eet al.\\u003c/em\\u003e Altered expression of HOXA10 in endometriosis: potential role in decidualization. \\u003cem\\u003eMol Hum Reprod\\u003c/em\\u003e 2007; \\u003cstrong\\u003e13\\u003c/strong\\u003e: 323\\u0026ndash;332.\\u003c/li\\u003e\\n \\u003cli\\u003eLee B, Du H, Taylor HS. Experimental murine endometriosis induces DNA methylation and altered gene expression in eutopic endometrium. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e 2009; \\u003cstrong\\u003e80\\u003c/strong\\u003e: 79\\u0026ndash;85.\\u003c/li\\u003e\\n \\u003cli\\u003eWu Y, Strawn E, Basir Z, Halverson G, Guo S-W. Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. \\u003cem\\u003eEpigenetics\\u003c/em\\u003e 2006; \\u003cstrong\\u003e1\\u003c/strong\\u003e: 106\\u0026ndash;111.\\u003c/li\\u003e\\n \\u003cli\\u003eStopa N, Krebs JE, Shechter D. The PRMT5 arginine methyltransferase: Many roles in development, cancer and beyond. \\u003cem\\u003eCell Mol Life Sci\\u003c/em\\u003e 2015; \\u003cstrong\\u003e72\\u003c/strong\\u003e: 2041\\u0026ndash;2059.\\u003c/li\\u003e\\n \\u003cli\\u003eBedford MT. Arginine methylation at a glance. \\u003cem\\u003eJ Cell Sci\\u003c/em\\u003e 2007; \\u003cstrong\\u003e120\\u003c/strong\\u003e: 4243\\u0026ndash;4246.\\u003c/li\\u003e\\n \\u003cli\\u003eHao F, Tang L, Sun J, Li W, Zhao Y, Xu X \\u003cem\\u003eet al.\\u003c/em\\u003e Decreased nitric oxide content mediated by asymmetrical dimethylarginine and protein L -arginine methyltransferase 3 in macrophages induces trophoblast apoptosis : a potential cause of recurrent miscarriage. \\u003cem\\u003eHum Reprod\\u003c/em\\u003e 2021; \\u003cstrong\\u003e36\\u003c/strong\\u003e: 3049\\u0026ndash;3061.\\u003c/li\\u003e\\n \\u003cli\\u003eWang Z, Liu Y, Liu J, Kong N, Jiang Y, Jiang R \\u003cem\\u003eet al.\\u003c/em\\u003e ATF3 deficiency impairs the proliferative\\u0026ndash;secretory phase transition and decidualization in RIF patients. \\u003cem\\u003eCell Death Dis\\u003c/em\\u003e 2021; \\u003cstrong\\u003e12\\u003c/strong\\u003e: 387.\\u003c/li\\u003e\\n \\u003cli\\u003eChen M, Yi B, Sun J. Inhibition of cardiomyocyte hypertrophy by protein arginine methyltransferase 5. \\u003cem\\u003eJ Biol Chem\\u003c/em\\u003e 2014; \\u003cstrong\\u003e289\\u003c/strong\\u003e: 24325\\u0026ndash;24335.\\u003c/li\\u003e\\n \\u003cli\\u003eZhang H, Zhu X, Chen J, Jiang Y, Zhang Q, Kong C \\u003cem\\u003eet al.\\u003c/em\\u003e Kr\\u0026uuml;ppel-like factor 12 is a novel negative regulator of forkhead box O1 expression: a potential role in impaired decidualization. \\u003cem\\u003eReprod Biol Endocrinol\\u003c/em\\u003e 2015; \\u003cstrong\\u003e13\\u003c/strong\\u003e: 80.\\u003c/li\\u003e\\n \\u003cli\\u003eEyster KM, Klinkova O, Kennedy V, Hansen KA. Whole genome deoxyribonucleic acid microarray analysis of gene expression in ectopic versus eutopic endometrium. \\u003cem\\u003eFertil Steril\\u003c/em\\u003e 2007; \\u003cstrong\\u003e88\\u003c/strong\\u003e: 1505\\u0026ndash;1533.\\u003c/li\\u003e\\n \\u003cli\\u003eHever A, Roth RB, Hevezi P, Marin ME, Acosta JA, Acosta H \\u003cem\\u003eet al.\\u003c/em\\u003e Human endometriosis is associated with plasma cells and overexpression of B lymphocyte stimulator. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e 2007; \\u003cstrong\\u003e104\\u003c/strong\\u003e: 12451\\u0026ndash;12456.\\u003c/li\\u003e\\n \\u003cli\\u003eHawkins SM, Creighton CJ, Han DY, Zariff A, Anderson ML, Gunaratne PH \\u003cem\\u003eet al.\\u003c/em\\u003e Functional microRNA involved in endometriosis. \\u003cem\\u003eMol Endocrinol\\u003c/em\\u003e 2011; \\u003cstrong\\u003e25\\u003c/strong\\u003e: 821\\u0026ndash;832.\\u003c/li\\u003e\\n \\u003cli\\u003eXin Q, Kong S, Yan J, Qiu J, He B, Zhou C \\u003cem\\u003eet al.\\u003c/em\\u003e Polycomb subunit BMI1 determines uterine progesterone responsiveness essential for normal embryo implantation. \\u003cem\\u003eJ Clin Invest\\u003c/em\\u003e 2018; \\u003cstrong\\u003e128\\u003c/strong\\u003e: 175\\u0026ndash;189.\\u003c/li\\u003e\\n \\u003cli\\u003eDuncan KW, Rioux N, Boriack-Sjodin PA, Munchhof MJ, Reiter LA, Majer CR \\u003cem\\u003eet al.\\u003c/em\\u003e Structure and Property Guided Design in the Identification of PRMT5 Tool Compound \\u0026nbsp;EPZ015666. \\u003cem\\u003eACS Med Chem Lett\\u003c/em\\u003e 2016; \\u003cstrong\\u003e7\\u003c/strong\\u003e: 162\\u0026ndash;166.\\u003c/li\\u003e\\n \\u003cli\\u003eNg SW, Norwitz GA, Pavlicev M, Tilburgs T, Sim\\u0026oacute;n C, Norwitz ER. Endometrial decidualization: The primary driver of pregnancy health. \\u003cem\\u003eInt J Mol Sci\\u003c/em\\u003e 2020; \\u003cstrong\\u003e21\\u003c/strong\\u003e: 1\\u0026ndash;20.\\u003c/li\\u003e\\n \\u003cli\\u003eBulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S \\u003cem\\u003eet al.\\u003c/em\\u003e Endometriosis. \\u003cem\\u003eEndocr Rev\\u003c/em\\u003e 2019; \\u003cstrong\\u003e40\\u003c/strong\\u003e: 1048\\u0026ndash;1079.\\u003c/li\\u003e\\n \\u003cli\\u003eBedford, Mark T., Clarke SG. Protein arginine methylation in mammals: who, what, and why. \\u003cem\\u003eMol Cell\\u003c/em\\u003e 2009; \\u003cstrong\\u003e33\\u003c/strong\\u003e: 1\\u0026ndash;13.\\u003c/li\\u003e\\n \\u003cli\\u003eXiao H-B, Sui G-G, Lu X-Y, Sun Z-L. Elevated Levels of ADMA Are Associated with Lower DDAH2 and Higher PRMT1 in LPS-Induced Endometritis Rats. \\u003cem\\u003eInflammation\\u003c/em\\u003e 2018; \\u003cstrong\\u003e41\\u003c/strong\\u003e: 299\\u0026ndash;306.\\u003c/li\\u003e\\n \\u003cli\\u003eSchatz F, Guzeloglu-Kayisli O, Arlier S, Kayisli UA, Lockwood CJ. The role of decidual cells in uterine hemostasis, menstruation, inflammation, adverse pregnancy outcomes and abnormal uterine bleeding. \\u003cem\\u003eHum Reprod Update\\u003c/em\\u003e 2016; \\u003cstrong\\u003e22\\u003c/strong\\u003e: 497\\u0026ndash;515.\\u003c/li\\u003e\\n \\u003cli\\u003eLim HJ, Wang H. Uterine disorders and pregnancy complications: Insights from mouse models. \\u003cem\\u003eJ Clin Invest\\u003c/em\\u003e 2010; \\u003cstrong\\u003e120\\u003c/strong\\u003e: 1004\\u0026ndash;1015.\\u003c/li\\u003e\\n \\u003cli\\u003eHoffmann A, Baltimore D. Circuitry of nuclear factor kappaB signaling. \\u003cem\\u003eImmunol Rev\\u003c/em\\u003e 2006; \\u003cstrong\\u003e210\\u003c/strong\\u003e: 171\\u0026ndash;186.\\u003c/li\\u003e\\n \\u003cli\\u003eHayden M, Hayden MS, Ghosh S. Signaling to NF-kappaB. \\u003cem\\u003eGenes Dev\\u003c/em\\u003e 2004; \\u003cstrong\\u003e18\\u003c/strong\\u003e: 2195\\u0026ndash;2224.\\u003c/li\\u003e\\n \\u003cli\\u003eLaird SM, Tuckerman EM, Cork BA, Li TC. Expression of nuclear factor \\u0026kappa; B in human endometrium; role in the control of interleukin 6 and leukaemia inhibitory factor production. \\u003cem\\u003eMol Hum Reprod\\u003c/em\\u003e 2000; \\u003cstrong\\u003e6\\u003c/strong\\u003e: 34\\u0026ndash;40.\\u003c/li\\u003e\\n \\u003cli\\u003eKing AE, Critchley HOD, Kelly RW. The NF-\\u0026kappa;B pathway in human endometrium and first trimester decidua. \\u003cem\\u003eMol Hum Reprod\\u003c/em\\u003e 2001; \\u003cstrong\\u003e7\\u003c/strong\\u003e: 175\\u0026ndash;183.\\u003c/li\\u003e\\n \\u003cli\\u003eGonz\\u0026aacute;lez-Ramos R, Rocco J, Rojas C, Sovino H, Poch A, Kohen P \\u003cem\\u003eet al.\\u003c/em\\u003e Physiologic activation of nuclear factor kappa-B in the endometrium during the menstrual cycle is altered in endometriosis patients. \\u003cem\\u003eFertil Steril\\u003c/em\\u003e 2012; \\u003cstrong\\u003e97\\u003c/strong\\u003e: 645\\u0026ndash;651.\\u003c/li\\u003e\\n \\u003cli\\u003ePonce C, Torres M, Galleguillos C, Sovino H, Boric MA, Fuentes A \\u003cem\\u003eet al.\\u003c/em\\u003e Nuclear factor \\u0026kappa;B pathway and interleukin-6 are affected in eutopic endometrium of women with endometriosis. \\u003cem\\u003eReproduction\\u003c/em\\u003e 2009; \\u003cstrong\\u003e137\\u003c/strong\\u003e: 727\\u0026ndash;737.\\u003c/li\\u003e\\n \\u003cli\\u003eKim SH, Ihm HJ, Oh YS, Chae HD, Kim CH, Kang BM. Increased Nuclear Expression of Nuclear Factor Kappa-B p65 Subunit in the Eutopic Endometrium and Ovarian Endometrioma of Women with Advanced Stage Endometriosis. \\u003cem\\u003eAm J Reprod Immunol\\u003c/em\\u003e 2013; \\u003cstrong\\u003e70\\u003c/strong\\u003e: 497\\u0026ndash;508.\\u003c/li\\u003e\\n \\u003cli\\u003eHorie S, Harada T, Mitsunari M, Taniguchi F, Iwabe T, Terakawa N. Progesterone and progestational compounds attenuate tumor necrosis factor alpha-induced interleukin-8 production via nuclear factor kappaB inactivation in endometriotic stromal cells. \\u003cem\\u003eFertil Steril\\u003c/em\\u003e 2005; \\u003cstrong\\u003e83\\u003c/strong\\u003e: 1530\\u0026ndash;1535.\\u003c/li\\u003e\\n \\u003cli\\u003eHung SW, Zhang R, Tan Z, Chung JPW, Zhang T, Wang CC. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: A review. \\u003cem\\u003eMed Res Rev\\u003c/em\\u003e 2021; \\u003cstrong\\u003e41\\u003c/strong\\u003e: 2489\\u0026ndash;2564.\\u003c/li\\u003e\\n \\u003cli\\u003eBonizzi G, Karin M. The two NF-\\u0026kappa;B activation pathways and their role in innate and adaptive immunity. \\u003cem\\u003eTrends Immunol\\u003c/em\\u003e 2004; \\u003cstrong\\u003e25\\u003c/strong\\u003e: 280\\u0026ndash;288.\\u003c/li\\u003e\\n \\u003cli\\u003eLu T, Yang M, Huang D Bin, Wei H, Ozer GH, Ghosh G \\u003cem\\u003eet al.\\u003c/em\\u003e Role of lysine methylation of NF-\\u0026kappa;B in differential gene regulation. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e 2013; \\u003cstrong\\u003e110\\u003c/strong\\u003e: 13510\\u0026ndash;13515.\\u003c/li\\u003e\\n \\u003cli\\u003eWei H, Wang B, Miyagi M, She Y, Gopalan B, Huang D-B \\u003cem\\u003eet al.\\u003c/em\\u003e PRMT5 dimethylates R30 of the p65 subunit to activate NF-\\u0026kappa;B. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e 2013; \\u003cstrong\\u003e110\\u003c/strong\\u003e: 13516\\u0026ndash;13521.\\u003c/li\\u003e\\n \\u003cli\\u003eLu T, Stark GR. NF-\\u0026kappa;B: Regulation by methylation. \\u003cem\\u003eCancer Res\\u003c/em\\u003e 2015; \\u003cstrong\\u003e75\\u003c/strong\\u003e: 3692\\u0026ndash;3695.\\u003c/li\\u003e\\n \\u003cli\\u003eReintjes A, Fuchs JE, Kremser L, Lindner HH, Liedl KR, Huber LA \\u003cem\\u003eet al.\\u003c/em\\u003e Asymmetric arginine dimethylation of RelA provides a repressive mark to modulate TNF\\u0026alpha;/NF-\\u0026kappa;B response. \\u003cem\\u003eProc Natl Acad Sci\\u003c/em\\u003e 2016; \\u003cstrong\\u003e113\\u003c/strong\\u003e: 201522372.\\u003c/li\\u003e\\n \\u003cli\\u003eYuan Y, Nie H. Protein arginine methyltransferase 5: a potential cancer therapeutic target. \\u003cem\\u003eCell Oncol\\u003c/em\\u003e 2021; \\u003cstrong\\u003e44\\u003c/strong\\u003e: 33\\u0026ndash;44.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-discovery\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddiscovery\",\"sideBox\":\"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)\",\"snPcode\":\"41420\",\"submissionUrl\":\"https://mts-cddiscovery.nature.com/\",\"title\":\"Cell Death Discovery\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"PRMT5, NF-κB, endometrial stromal cells, decidualization, endometriosis, cell differentiation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-1800392/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-1800392/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"Decidualization is a prerequisite for successful embryo implantation, in which elongated fibroblast-like endometrial stromal cells differentiate into more rounded decidual cells. Accumulating evidence has stressed the important role of the defective eutopic endometrium in infertility in endometriosis patients. However, the role of arginine methylation in the process of physiological decidualization and pathological decidualization defects is not clear. Here, we observed that the expression level of PRMT5, the main type II PRMT, was decreased in the endometrium of endometriosis patients, predominantly in stromal cells. Compared with the undecidualized state, PRMT5 was increased in the stromal cells of normal secretory endometrium in humans and in the decidua of normal pregnant mice or mice with artificially induced decidualization. The inhibition of PRMT5 resulted in a significant decrease in uterine weight and decidualization-related regulator expression, including FOXO1, HOXA10 and WNT4, in mice and IGFBP1 and prolactin levels in human endometrial stromal cells. Transcriptome analysis showed that decreased PRMT5 activity led to NF-κB signaling activation by inducing p65 translocation to the nucleus, which was also observed in endometriosis patients. Finally, overexpression of PRMT5 rescued the defective expression of IGFBP1 and prolactin in primary endometrial stromal cells from endometriosis patients. Our results indicate that promotion of PRMT5 may provide novel therapeutic strategies for the treatment of decidualization defects in infertile women, such as those with endometriosis.\",\"manuscriptTitle\":\"Endometrial stromal PRMT5 plays a crucial role in decidualization by regulating NF-κB signaling in endometriosis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2022-07-18 16:18:20\",\"doi\":\"10.21203/rs.3.rs-1800392/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"revise\",\"date\":\"2022-07-29T10:32:34+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2022-07-25T14:53:39+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2022-07-11T13:17:15+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2022-07-09T03:23:05+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2022-07-08T16:05:02+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2022-07-07T07:30:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2022-06-28T09:03:24+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2022-06-27T15:00:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Cell Death Discovery\",\"date\":\"2022-06-27T15:00:40+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-discovery\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddiscovery\",\"sideBox\":\"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)\",\"snPcode\":\"41420\",\"submissionUrl\":\"https://mts-cddiscovery.nature.com/\",\"title\":\"Cell Death Discovery\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"beadb271-17ed-40ab-a983-fd7467b25881\",\"owner\":[],\"postedDate\":\"July 18th, 2022\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2022-10-05T07:07:13+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-1800392\",\"link\":\"https://doi.org/10.1038/s41420-022-01196-x\",\"journal\":{\"identity\":\"cell-death-discovery\",\"isVorOnly\":false,\"title\":\"Cell Death Discovery\"},\"publishedOn\":\"2022-10-04 04:00:00\",\"publishedOnDateReadable\":\"October 4th, 2022\"},\"versionCreatedAt\":\"2022-07-18 16:18:20\",\"video\":\"\",\"vorDoi\":\"10.1038/s41420-022-01196-x\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41420-022-01196-x\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-1800392\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-1800392\",\"identity\":\"rs-1800392\",\"version\":[\"v1\"]},\"buildId\":\"_2-kVJe1T_tPrBINL-cwx\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC0","license_restricted":false}