{"paper_id":"94b01c3e-7701-4671-be32-5d0b178c85ea","body_text":"Research Article\nClinical Obstetrics, Gynecology and Reproductive Medicine\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 1-11\nISSN: 2059-4828\nA new strategy against endometriosis: Oral probiotic \ntreatments\nChouzenoux S1,3‡, Jeljeli M1-4‡ , Bourdon M2,3,5, Doridot L1,3, Thomas M1,3, Barbeito A6, Daniel C6, Mousset PY7, Batteux F1-4‡ and Nicco C1,3‡*\n‡The authors consider that the first two and the last two authors should be regarded as joint authors\n1Université de Paris, Faculté de Médecine, Paris, France \n2Assistance Publique–Hôpitaux de Paris (AP–HP), Hôpital universitaire Paris Centre (HUPC)\n3Department 3I « Infection, Immunité et inflammation”, Institut Cochin, INSERM U1016\n4Department of immunology, Centre Hospitalier Universitaire (CHU) Cochin, Paris, France \n5Department of gynecology, Centre Hospitalier Universitaire (CHU) Cochin, Paris, France\n6Laboratoires Iprad, 174 quai de Jemmapes 75010, Paris, France\n7Gynov, 11 rue du Commandant Arnould - 33000 Bordeaux, France\nAbstract\nPurpose: Endometriosis is a chronic, estrogen-dependent, benign disease characterized by the presence of endometrial tissue outside the uterus. The benefit of \nnutritive complements on endometriosis-associated symptoms has been described. The purpose of this study was to evaluate in vivo the effect of probiotics on the \ndevelopment and pain due to endometriosis. \nMethod: We used a mouse model of endometriosis orally treated with one (P1: Saccharomyces Boulardii) or two probiotics (P2: Saccharomyces Boulardii + Lactobacillus \nAcidophilus), during 4 or 12 weeks. We followed the lesions growth by ultrasonography, the pain suffered by the mice with behavioral and qRT-PCR tests and their \nimmune status by FACS and ELISA techniques.\nResults: After 4 and 12 weeks of treatments, we observed that volume and size of the lesions were significantly lower. Clinically, heat sensitivity is decreased only \nby P1-treated at W4 while tactile sensitivity is higher in P2-treated mice. The levels of AOPP in the sera, reflect of the oxidation of proteins, is significantly reduced \nby all the treatments at W12. The serum levels of zonulin, a marker of the intestinal barrier permeability, and pro-inflammatory cytokines IL-6 and TNF-α were \nsignificantly reduced by the P1 and the P2 treatments.\nConclusion: Treatment with one or two probiotics, have different but both favorable effects on clinical, immune and physiologic parameters in endometriosis. Because \nof its better results on pain and a greater ease of handling, Saccharomyces boulardii seems to be more suited to be used as a new therapeutic strategy for endometriosis.\n*Correspondence to: Carole Nicco, Institut Cochin, U1016 Allanore / Batteux \nteam, Cochin Hospital – Pavillon Roussy 4th floor - 22 rue Méchain - 75014 \nParis, E-mail : carole.nicco@inserm.fr\nKey words: endometriosis, probiotics, inflammation, pain, saccharomyces \nboulardii, lactobacillus acidophilus\nReceived: January 26, 2021; Accepted: February 09, 2021; Published: February \n15, 2021\nIntroduction\nEndometriosis is a chronic, estrogen-dependent, benign disease \ncharacterized by the presence of endometrial tissue outside the uterus. \nThe ectopic tissue is composed of the endometrial epithelium and \nstroma, and its growth is hormone-dependent and responds to the \nsame cyclic variations as the eutopic endometrium. The prevalence \nof endometriosis varies from 6 to 10% in the general population of \nwomen of childbearing age and from 35 to 50% in women consulting \nfor pelvic pain and / or infertility [1]. Its frequency makes it a real public \nhealth issue. The pathogenesis notably involves chronic inflammation, \noxidative stress and fibrosis. The most accepted mechanism for the \netiology of endometriosis is a dissemination of endometrial tissues \nfrom the uterus to the peritoneal cavity by retrograde menstrual flow. \nAs the phenomenon of retrograde menstruations concerns a majority \nof cycling women, it suggests that individual susceptibilities are \nimplicated. For example, intrinsic specific alterations of eutopic and/\nor ectopic endometrium gaining high survival capacity, invasive and \nproliferative capability [2], as well as defective immune clearance of \nectopic cells have been described. Recently, it has been suggested that \nthe ectopic implantation seen in endometriosis could be promoted by \nincreased inflammation and priming of adaptive T regulatory cells, \nresulting in impaired cytotoxicity and en hanced immune suppression \n[3]. The pathophysiology of endometriosis is complex and still poorly \nunderstood [4]. Medical treatments based on hormonal therapies are \nneither always effective nor free of side effects [5]. The radical surgical \ntreatment of endometriosis lesions has shown its effectiveness but \npresents a real risk of complications [6]. Patients with endometriosis \nare at high risk of several chronic diseases, such as autoimmune \ndiseases, cancer, asthma/atopic diseases, cardiovascular diseases [7] \nand inflammatory bowel diseases [8].  A better understanding of the \nmechanisms of endometriosis would pave the way for new medical \ntreatments.\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 2-11\nMaterial and methods\nMice model of endometriosis\nThe model of endometriosis performed for the study has already \nbeen described elsewhere [23,24]. This model is a syngeneic graft of \nuterine horns in immunocompetent mice to generate endometriosis \nlike lesions. 6-week-old female Balb/C Jrj mice were purchased from the \nsupplier Janvier Labs (Route du Genest, 53940 Le Genest-Saint-Isle). \nThe mice are housed in a conventional animal facility (N ° C75-14-05 / \nDTPP 2014-208), with 12-hour automated day/night cycles, drink (tap \nwater) and food (Teklad, Envigo, Gannat, France, # T.2016MI.12) ad \nlibitum. This project is in strict compliance with the European guidelines \nfor animal experimentation. The endometriotic mouse model by \nimplantation (suturing) of syngeneic intraperitoneal horn is a model \nvalidated and published in our laboratory. Implantation of uterine \nhorns intraperitoneally is performed under isoflurane anesthesia (3.5%, \nunder oxygen 2.5 l / min) and post-operative analgesic (Buprecare, 10 \nµg / kg, sc). A laparotomy is performed, and a fragment is fixed on \neach side of the opening, on the internal wall of the peritoneum, by two \nstitches made with 5/0 absorbable surgical thread.\nProbiotic treatments\nThe molecules and products used for the treatments are: Zinc-\nBisglycinate Chelate (ALBION Laboratories, Clearfield, USA, # 03506), \nGomme Acacia Seygal (Nexira Food, Rouen, France, #FibregumB), \nTrans-reseveratrol (Active Inside, Beychac and Caillau, France, # \nPR-0018), Curcumin (Wacker, Eddyville, IA, USA, # 60072151), \nSaccharomyces Boulardii (LHC Lesaffre Bio Springer, Maison Alfort, \nFrance, # VI1700368), Lactobacillus Acidophilus (Danisco US, \nMadison, WI, USA, #MSAMPHRUDOPH). The exact composition is a \npatented formula of Gynov Society (Bordeaux, France). \nThe vehicle without probiotics, P0, (31.89% Zinc-Bisglycinate, \n32.52% Acacia-Seygal Gum, 14.24% Trans-reseveratrol, 21.35% \nCurcumin) and probiotic (s), P1 or P2, are administered per os 5 \ndays a week in 200µl, during 4 (4W) or 12 weeks (12W). The groups \nof control or treated mice were the following: mice without implants \nwithout treatment (Sham), mice with implants and treated with the \nvehicle (group P0) or the vehicle + 1 probiotic (group P1: 18mg / kg \nSaccharomyces Boulardii), or the vehicle + 2 probiotics (group P2: 18mg \n/ kg Saccharomyces Boulardii + 9mg / kg Lactobacillus Acidophilus). \nFour or 12 weeks after implantation, animals were sacrificed by \ncervical dislocation. Blood, both endometriotic lesions and spleen were \nretrieved for further analysis. \nAt the beginning of the experiment the number of mice per group \nwere: Sham, n = 8 – P0, n = 11 - P1, n = 15 - P2, n = 15. For the first \nsacrifice at W4 we used: Sham, n = 5 – P0, n = 5 - P1, n = 10 - P2, n = 10. \nFor the second sacrifice at W12 we used: Sham, n = 3 – P0, n = 6 - P1, \nn = 5 - P2, n = 5.\nUltrasonography monitoring\nThe evolution of the volume of lesions is monitored by \nultrasonography under general anesthesia to confirm the viability of \nthe implant and to measure its size as previously described [25]. The \nhigh-resolution ultrasound (40mHz) allows to follow the evolution \nof the size of the uterine horn implants in a precise, non-invasive way \nand to quickly assess the progression of endometriosis. This procedure \nwas performed at PIV (Small Animal Imaging, Cochin Institute, Paris, \nA recent review [9] described the benefit of additional intake of \nfatty acids, antioxidants and a combination of vitamins and minerals \non endometriosis-associated symptoms. More studies are necessary \nto gain evidence on food products or nutrients efficacy to alleviate \nendometriosis syndromes, with an attention to their relative amounts \n[9]. The animal gut is a complex ecosystem of host cells, microbiota, and \navailable nutrients, and the microbiota prevents several degenerative \ndiseases in humans and animals via immunomodulation. Probiotics are \nmicrobial strains that are beneficial to health, and their potential has \nrecently led to a significant increase in research interest in their use to \nmodulate the gut microbiota [10]. The gut microbiota is involved in \nseveral immune, metabolic, and nutrients absorption functions that are \ncrucial for the host homeostasis [11,12]. The gut microbiota contributes \nto innate and adaptive immunity [13,14]. Gut microbial metabolites \nplay key roles in inflammatory signaling, interacting both directly \nand indirectly with host immune cells. They prevent colonization \nby opportunistic pathogens and participate to the maintenance of \nintestinal epithelial barrier [15]. \nA bidirectional interaction between the gut and vaginal \nmicroenvironments is evidenced but not well studied. Some \nmicroorganisms colonize both the gastrointestinal and the reproductive \ntracts proving the interaction between these microbiomes. Ingestion of \nlactobacillus probiotics has been shown to induce changes in the vaginal \nbacterial community, as well as an inflammatory response [16]. This \nprovides evidence of interaction between the vaginal and gastrointestinal \nmicrobiomes, and supports the proposition that oral probiotics may \nreduce some vaginal infection and bacterial vaginosis [17,18]. Oral \nprobiotics can moderate pro-inflammatory cytokine expression in the \nvagina, which can subsequently alter the inflammatory status in the gut \nby acting on bacteria and immune mediators including macrophages, \nlymphocytes and dendritic cells. Both the gut and the female genital \ntract microbiota produce fermentation by-products that can influence \nlocal immunological responses with systemic implications.\nThe purpose of this study was to evaluate in vivo  the effect of oral \nprobiotics on the development of endometriosis, but also on the pain \ncaused by the lesions. The pain that occurs during endometriosis \npathology may be nociceptive, inflammatory, neuropathic or a mix \nof these [19].  The experience of pain is complex involving many \nmechanisms and interactions between the periphery and the central \nnervous system [20]. Recent work has shown alterations in both \nthe peripheral and CNS of women with endometriosis-associated \npain [20,21]. Oral administration of specific  Lactobacillus  strains \ncan mediate analgesic functions in the gut, similar to the effects of \nmorphine [22]. The microbiology of the intestinal tract could influence \nvisceral perception and could be used for the treatment of abdominal \npain occurring in endometriosis.\nTherefore, we used a mouse model of endometriosis (syngeneic \nuterine horn peritoneal graft model). We assessed the effects of \nSaccharomyces Boulardii  and Saccharomyces Boulardii/Lactobacillus \nAcidophilus per os on the evolution of endometriosis in mice. Studies \nhave been previously conducted with these two probiotics to determine \ntheir effects on endometrial cells in vitro . However, their influence \non intraperitoneal endometriotic lesions require a study in a whole \norganism, to evaluate the effect in vivo  of probiotic ingestion on the \nintraperitoneal lesions’ growth, pain and immune reaction. Ultimately, \nthe goal of this project is to be able to propose new therapeutic strategies \nfor endometriosis using probiotics.\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 3-11\nFrance) at W1, W3, W8, W11 after the implantation of the horn’s \nfragments.\nImmunohistology\nThe validation of the endometriosis model is confirmed by \nhistologic evaluation of the endometriotic lesion. The presence of \nglandular and stromal cells validated the endometriosis model. \nEndometriotic implants were surgically removed at sacrifice and \nweighed, then half of it was being fixed with 10% formaldehyde and \nset in paraffin. The samples are sliced into sections of 5µm thick and \nstained with H&E. This method was performed at the Histim (Platform \nof immunohistlogy, Cochin Institute, Paris, France). \nIn vivo hot hyperesthesia\nHot hyperesthesia was evaluated in the model of endometriotic \nmice every week and averaged over 2 weeks, during the 4- or 12-weeks \nprobiotic treatment period. Each mouse is placed on a metal surface [26] \n(cold/hot plate from BIOSEB) maintained at a constant temperature, \nset at + 50 ° C ± 0.2 ° C. The mice were used to being manipulated by the \nexperimenters during the week preceding the endometriosis induction \nsurgeries. Before each test session, the mice are left for 10 min in the \nenvironment of the experiment structure to be acclimated before \nbeing placed individually on the hot metal surface of the plate inside a \nplexiglass enclosure. A maximum of 1 min exposure of the mice to the \nhot plate was decided in order not to degrade their nerve sensitivity. \nThe response latency, which is the time until the investigator observes \na positive nocifensive behavior, is recorded. Nocifensive behaviors \ninclude forepaw withdrawal or licking, hind paw withdrawal or licking, \nstamping, leaning posture and jumping. This reaction is compared to \nthe one of the sham group mice and considered positive when the delay \nfor the mouse to raises its foot or frantically licks its paw to cool it is \nsignificantly different.\nIn vivo tactile hypoesthesia\nThe abdominal tactile sensitivity is evaluated every two weeks on \nendometriotic mice by a manual Von Frey test. Punctate mechanical \nallodynia and hyperalgesia can be assessed by the application of \nvon Frey filaments of varying forces. A synthetic monofilament is \napplied perpendicularly to the tested surface, delivering a constant \npre-determined force (typically 0.2–13.7 mN for mice) for 2–5 s. A \nresponse is considered positive if the animal exhibits any nocifensive \nbehaviors, including brisk paw withdrawal, licking, or shaking of the \npaw, either during application of the stimulus or immediately after the \nfilament is removed. While the plantar surface of the hind paw is the \nmost commonly used area for testing, other areas of the body, including \nthe abdomen can also be used [27]. We used the “ascending stimulus” \nmethod to determine mechanical sensitivity using manual Von Frey.\nThe mean of the monofilaments sizes that induce a nocifensive \nreaction for a group of mice is compared to the one of the sham group \nmice and considered positive when there is a significant difference.\nqRT-PCR\nAfter surgical resection, half of the lesions were immediately \nfrozen in liquid nitrogen. Total RNA was extracted from mouse tissue \n(endometriosis-like lesions) using the Trizol reagent (Invitrogen, \nCarlsbad, USA), according to the manufacturer's instructions. \nThe amplified genes are: col1 (collagen 1) [28], Ptgs2/cox2 \n(cyclooxygenase 2), nrf (Nerve growth factor), igf1 (Insulin Growth \nFactor 1), Pecam1/cd31. The cDNA was synthesized using the Maxima \nH Minus cDNA Synthesis Master Mix kit (Thermo Fisher Scientific). \nThe qPCR was performed using the SensiFAST SYBR No-ROX kit \n(Bioline). The transcription levels of the selected genes were quantified \nin a LightCycler480® (Roche, San Francisco, CA) thanks to calibration \nsamples (serial dilution) and normalized to two reference genes (Actinb \nand Tbp) in the LightCycler480 software. The primer sequences used \nfor qPCR are as follows (Ptgs2 = Cox2, Pecam1 = Cd31):\nmm-Col1a1_F CCGAACCCCAAGGAAAAGA\nmm-Col1a1_R CTGTTGCCTTCGCCTCTGA\nmPtgs2-F TGAGCAACTATTCCAAACCAGC\nmPtgs2-R GCACGTAGTCTTCGATCACTATC\nmPecam1-F CTGCCAGTCCGAAAATGGAAC\nmPecam1-R CTTCATCCACCGGGGCTATC\nmTbp-F AGAACAATCCAGACTAGCAGCA\nmTbp-R GGGAACTTCACATCACAGCTC\nm-bActin-F ACCACCATGTACCCAGGCATT\nm-bActin-R CCACACAGAGTACTTGCGCTCA\nm-Ngf-F CCAGTGAAATTAGGCTCCCTG\nm-Ngf-R CCTTGGCAAAACCTTTATTGGG\nm-Igf1-F CTGGACCAGAGACCCTTTGC\nm-Igf1-R GGACGGGGACTTCTGAGTCTT\nFlow cytometry\nSpleen cell suspensions from each mouse were incubated for 20 \nmin with 10 µg/mL anti-CD16/CD32 antibody (clone 93, eBiosciences) \nfor Fc receptor saturation and then stained with the appropriate labeled \nantibody at 4°C for 30 min in the dark in PBS with 2% FBS. The FACS \nFortessa II flow cytometer (BD Biosciences) was used to perform flow \ncytometry according to standard techniques. For spleen characterization \nof immune cells, two cocktails of monoclonal antibodies were used: \nPanel A for T and B cells characterization: B220-APC, CD69-PE, CD8-\nBV605, CD40-PerCP/Cy5.5, MHCII-FITC, CD4-BV510. Panel B for \nmacrophage phenotyping and M1/M2 characterization: CD206-AF647, \nCD86-BV510, Ly6C PE-Cy770, CD11b-APC-Cy7, F4/80-BV711, \npurchased from BioLegend, Ozyme (Montigny-le-Bretonneux, France). \nM1 macrophages were defined as B220− F4/80+CD11b+Ly6CHighCD206- \nand M2 macrophages as B220 − F4/80+CD11b+Ly6cLowCD206+. Data \nwere analyzed with FlowJo software (Tree Star, Ashland, OR).\nStatistical study of the different results\nThe comparative statistical analysis of the different groups of mice \nwas carried out by two-way ANOV A if the measured values followed \na normal distribution, Kruskal-Wallis test otherwise. with multiple \ncomparisons Bonferroni and Dunn’s tests respectively. \nResults\nEndometriosis-like lesions evolution and related symptoms \nin mice with probiotic treatments\nThe vehicle without probiotics, P0, (31.89% Zinc-Bisglycinate, \n32.52% Acacia-Seygal Gum, 14.24% Trans-reseveratrol, 21.35% \nCurcumin) and probiotic (s), P1 or P2, are administered per os 5 days \na week in 200µl for 4 (4W) or 12 weeks (12W). The groups following: \nmice without implants without treatment (Sham), mice with implants \nand treated with the vehicle (group P0) or the vehicle + 1 probiotic \n(group P1: Saccharomyces Boulardii ), or the vehicle + 2 probiotics \n(group P2: Saccharomyces Boulardii + Lactobacillus Acidophilus). \n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 4-11\nThe implanted fragments of horn have been weighed before surgery \n(W0) and at the sacrifices (W4 and W12). The weights and volumes \nof the lesions were homogeneous at implantation (P0, n = 10 - P1, n \n= 20 - P2, n = 20). There is a significant growth of the implants with \nno difference between P0, P1 and P2 treatment groups concerning the \nlesions weight at W4 and W12. Nevertheless, the ultrasound imaging \nanalysis of the implants showed that the lesions sizes are significantly \ndecreased by the 2 treatments at W3 and even more at W11 (p<0.0001 \nfor P0 42.03±1.28 vs P1 31.57±1.46 and P2 33.55±0.94 at W3 - P0 \n49.36±2.86 vs P1 31.82±2.51 and P2 17.41±1.90 at W12). P2 treatment \nis more efficient than P1 on the evolution of the volume of the lesions.\nFurthermore, animals submitted to the probiotic treatment had \nsmaller and less active implants (no fresh blood, no angiogenesis and \nfew glands), whereas control P0 group showed persistent, larger and \nmore active lesions through macroscopic (Figure 1C) evaluation.\nPain and sensitivity tests induced by murine endometriosis \nlesions\nThe von Frey tactile sensitivity test is a time efficient and sensitive \nmethod which can be used together with other established tests to \nevaluate pain outcome in the mouse. Most pathological pain conditions \nin patients and rodent pain models result in marked alterations in \nmechano-sensation and the gold standard way to measure this is by \nuse of von Frey fibers. These graded monofilaments are used to gauge \nthe level of stimulus-evoked sensitivity present in the affected dermal \nregion. Higher is the size of the filament lower is the sensitivity. \nAt W7, and until the end of the experiments, the abdominal tactile \nsensitivity (Figure 2A) of endometriotic mice starts to be significantly \ndecreased under the effect of P2 (W7: P0 vs P2, p=0.0080; W12: P0 vs \nP2; p=0.0039) but not with P1 treatment, when compared to P0. At W3 \nand W7 the sensitivity to heat (Figure 2B) is significantly lower in mice \ntreated with P1 compared to P0 alone (W3: P0 vs P , p=0.05; W7: P0 vs \nP1; p=0.0066) but the difference is no longer observable at W11.\nGene expression change in the endometriosis-like lesions \nwith probiotic treatments\nIn order to evaluate characteristics of the endometriosis-like \nlesions, gene expression for markers related to growth (Igf1 ), to pain \n(Ngf)(29), to angiogenesis (Pecam1/Cd31), to inflammation (Ptgs2/\nCox2) and to fibrosis (ColI) were evaluated by RT-qPCR at week 4 and \nweek 12. At 4 weeks (Figure 3A), there were no significant differences \nFigure 1. Effects of probiotic P1 and P2 treatments on endometriotic lesion development in mice (A) Weight of the endometriosis lesions on W4 and W12 (B) V olume of the endometriotic \nlesions on W3 and W11 obtained with measurements on ultrasonographic images of peritoneal implants in mice (C) Coloration with H&E of lesions at W4 and W12. Data are expressed \nas the mean ± SEM. The scale represents 200µm. Statistical analysis of the different groups of mice was carried out by one-way ANOV A followed by a Bonferroni test. The W3-W12 \ncomparison by ANOV A followed by a Bonferroni test. NS, non-significant; *P ≤ 0.05; **P ≤ 0.01; **P ≤ 0.001. Scale bar, 200 μm\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 5-11\nbetween P0 and P1 or P2 for these markers. The mRNA level for ColI \nwas lower in P1 than in P2 (p=0.0187). At 12 weeks (Fig 3B), there \nwere no significant differences for Igf1 , Ptgs2/Cox2 and ColI  between \nthe groups. There was a significant reduction of Ngf in P2 compared to \nP1. For Pecam1/Cd31, there is a significant effect within the 3 groups \n(significant Kruskal Wallis test) with a tendency for a reduced level with \nP1 (p=0.11) and P2 (p=0.06) compared to P0, indicating a potential \nbeneficial effect of the probiotic treatment to limit angiogenesis within \nthe endometriosis like lesions. \nProbiotic treatments affect the splenic immune cells’ \nphenotype and activation in endometriotic mice \nAs endometriosis is characterized by an alteration of the systemic \nimmune response [2], we investigated the impact of probiotic \ntreatments on splenic immune cells frequency and activation. The \nfrequency of CD4+ and CD8+ T-cells remained unchanged (Figure 4) \nin the different groups at W4 and W12. Interestingly, mice receiving \nthe vehicle P0 and the P2 treatment exhibited a significant reduction \nof CD8+ T cell activation compared to the sham group at W4, and the \ndifference is extended to the probiotic treatment P1 at W12.\nNeither the treatments nor the vehicle affected the frequency of B \ncells (Figure 4). Activation of B cells were significantly reduced by P2 \nprobiotics at W4 and by all the treatments at W12. At W4, the frequency \nof splenic NK cells was significantly reduced while their activation was \nincreased in mice receiving the probiotic treatments compared to the \nSham. At W12, a tendency to an increased activation of the NK cells by \nthe probiotic treatments is observed, though not significantly.\nWe analyzed the impact of the different treatments on the \nmacrophage’s polarization into the pro-inflammatory M1 or the anti-\ninflammatory/profibrotic M2 profile. The frequency of the splenic \nmacrophages remained globally unchanged. At W4, the probiotic \ntreatment P2 significantly increased the ratio M1/M2 and this tendency \nwas maintained and extended to the P1 treatment at W12. (Figure 5).\nProbiotic treatment influences the serum markers of inflammation, \nintestinal permeability and protein oxidation in mice with endometriosis\nIt has been reported that probiotic treatment is associated with \nmodifications of the intestinal permeability and the systemic markers \nof inflammation and oxidative stress [30,31].\nAt W4, the serum level of zonulin, a marker of the intestinal barrier \npermeability, remained unchanged by P0, while it was significantly \nreduced by the P1 and the P2 probiotic treatments (p<0.001, Figure \n6A). At W12, a drop of the zonulin concentration in the sera of P0, P1 \nand P2 treated mice was observed (p<0.0001). \nSimilar tendencies were observed for the pro-inflammatory \ncytokines IL-6 and TNF-α, with a significant decrease or a non-\ndetection respectively at W4 by P1 and P2 treatments only. At W12, \nIL-6 cytokine level was significantly reduced in all the tested conditions \nand TNF-α was only detected in Sham mice (Figures 6B and 6C).\nThe levels of AOPP in the sera (Figure 6D), that reflect the oxidation \nof serum proteins, are significantly reduced by the vehicle at W4 and by \nall the treatments at W12 (Figure 6D).\nDiscussion\nEndometriosis is an hormone-dependent inflammatory disease in \nwhich local and systemic altered immune response are participating \nto the survival and growth of displaced endometrial tissue in affected \nwomen [32]. The role of microbiota in the pathogenesis of endometriosis \nhas been recently highlighted [33]. The microbiota represents all the \nmicroorganisms that exist in a particular environment, including \nbacteria, viruses, fungi and protozoa, that live within the host and \nregulate several physiological functions [34]. Indeed, a crosstalk exist \nbetween the microbiota and the immune system. The influence of the \nmicrobiome on the immunomodulation and the development of several \ninflammatory diseases is well established [35]. It acts by maintaining \nthe integrity of the gastrointestinal epithelial lining, regulating immune \nhomeostasis, preventing bacterial translocation, which can create a \nsystemic low tone inflammation [14,36]. The activation and the function \nof the immune system are largely influenced by the microbiota [14] and \nin turn, an altered immune response can induce a modification of the \ncomposition and the diversity of the commensal bacteria. Conversely, \nFigure 2. In vivo effects of P0, P1 and P2 treatments on sensitivity and pain evaluated through mice abdominal sensitivity and hot hyperalgesia. Mice received P0, P1 or P2 administered \nper os 5 days a week in 200µl all along the experiment. (A) Nociception was evaluated using iterative von Frey tests. Measurements were realized every week and averaged over 2 weeks, \nduring the 4- or 12-weeks probiotic treatment period. (Sham, n = 3 - M, n = 6 - P1, n = 5 - P2, n = 5) (B) Hot hyperalgesia was evaluated using a hot plate set at + 50°C ± 0.2°C. (Sham, n = \n3 - M, n = 6 - P1, n = 5 - P2, n = 5). Data are expressed as the means ± SEM. Statistical analysis of the different groups of mice was carried out by one-way ANOV A followed by a Bonferroni \ntest. The W3-W12 comparison by ANOV A followed by a Bonferroni test. NS, non-significant; *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 6-11\nFigure 3. (A) Relative mRNA level of Igf1, Ngf, Pecam1, Ptgs2 and ColI by RT-qPCR in endometriosis-like lesions removed at W4 and W12 (B) from each endometriotic mouse (W4, n=5 \nfor P0, n=10 for P1 and P2; W12, n=6 for P0, n=5 for P1 and P2). Data are expressed as the mean ± SEM of relative mRNA level normalized to 2 reference genes for each sample. Kruskal \nWallis tests were used for the 3 groups comparison and when significant, Dunn's multiple comparisons tests were done. NS, non-significant; *P ≤ 0.05; **P ≤ 0.01\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 7-11\nFigure 4. Probiotic treatments influence on T lymphocytes. Flow cytometric characterization \nof splenic CD4+ T and CD8+ T cells activated or not, at week 4 or week 12. Data represent \nthe absolute count for T CD4+/ T CD8+ and percentage of activated cells (Expression of \nCD69) with SEM from independent samples. The ANOV A test with Bonferroni correction \nwas used to detect significant differences between the groups. NS: Non-significant; *p ≤ \n0.05; **p ≤ 0.01; ***p ≤ 0.001\nFigure 5. Probiotic treatments influence on B cells, NK cells and macrophages. Flow \ncytometric characterization of splenic B cell activation, macrophages frequency \nand polarization and NK cell frequency and activation, at week 4 or week 12. Data \nrepresent either the absolute count, the mean florescence intensity of CD69 expression \non activated cells or the ratio of M1/M2 macrophages frequency. M1 macrophages \nwere defined as B220 −F4/80+CD11b+Ly6CHighCD206- and M2 macrophages as B220 −\nF4/80+CD11b+Ly6cLowCD206+. The ANOV A test with Bonferroni correction was used to \ndetect significant differences between the groups. NS: Non-significant; *p ≤ 0.05; **p ≤ \n0.01; ***p ≤ 0.001\nlittle is known about the presence and composition of the microbiome \nalong the female reproductive tract and its role in the development \nof endometriosis or other gynecological pathologies. Endometriosis \nis developed in an inflammatory gound. Moreover, the microbiome \ninfluences estrogen metabolism and estrogen influences the gut \nmicrobiota [37]. Postulating that the microbiome could influence \nendometriosis development is logical. The benefit of probiotics in \nprevention and treatment of gastrointestinal as well as extraintestinal \ndisorders [38-40] is now established.\nHere, we show that probiotic treatments can be effective to alleviate \nthe clinical severity of the endometriosis lesions in a surgically induced \nendometriosis mouse model. Saccharomyces boulardii   is a probiotic \nyeast often used for the treatment of gastrointestinal tract disorders such \nas diarrhea symptoms. It presents phenotypic traits and physiological \nproperties that underlie its success as probiotic, such as optimal growth \ntemperature, resistance to the gastric environment and viability at low \npH. Saccharomyces boulardii probiotic activity has been elucidated \nas a conjunction of multiple pathways, ranging from improvement \nof gut barrier function, pathogen competitive exclusion, production \nof antimicrobial peptides, immune modulation, and trophic effects \n[41]. Lactobacillus acidophilus is a lactic acid bacteria able to exert \nneuroprotective effects that may be associated with gut microbiota \nremodeling in traumatic brain injury mice [42]. Lactobacillus has a long \nhistory of being safely added to dairy products, and it is particularly \nrecognized for enhancing intestinal barrier function and regulating the \ngut microbiota [43,44]. Disruptions of the gut microbiota contribute \nto intestinal barrier impairment, inducing bacterial translocation, \nsystemic inflammatory response, and sepsis [45,46].\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 8-11\nFigure 6. Effects of the probiotic treatment on the serum markers of inflammation, intestinal \npermeability and protein oxidation in mice with endometriosis. ELISA quantified levels of \n(A) Zonulin (B) IL6 (C) TNFα in sera from mice treated for 4 weeks or 12 weeks. (D) AOPP \nlevels in sera from mice treated for 4 or 12 weeks. Data are expressed as the mean ± SEM. \nStatistical analysis of the different groups of mice was carried out by one-way ANOV A \nfollowed by a Bonferroni test. The W3-W12 comparison by two way-ANOV A followed \nby a multiple comparison test. NS, non-significant; *P ≤ 0.05;  **P ≤ 0.01;  ***P ≤ 0.001\nIn our mice model of endometriosis, after 4 and 12 weeks of \nprobiotic treatments P1 (18 mg/kg Saccharomyces Boulardii) or P2 (18 \nmg/kg Saccharomyces Boulardii + 9 mg/kg Lactobacillus Acidophilus ), \nwe observed that volume and size of the lesions are significantly lower \nthan in P0 untreated mice. Clinically, heat sensitivity is significantly \nlower in P1-treated mice from W4 while tactile sensitivity is decreased \nby P2 treatment. Nevertheless, the expression of the Nerve Growth \nFactor (NGF), a potent regulator of growth, maintenance, proliferation, \nand survival of certain target neurons [47,48] was significantly increased \nby P1 treatment at W12. In women with cul-de-sac/uterosacral \nendometriosis, NGF has been associated with deep dyspareunia and \nsexual pain. COX-2/PGE2 axis is believed to mediate this association \nmay be mediated by increased nerve bundle density and by COX-2/\nPGE2 stimulation via NGF/Trk receptor [49]. \nAt the histological level, the glandular aspect, a hallmark of active \nendometriotic lesions, was markedly attenuated in mice receiving P1 \nor P2 treatment. In endometriosis, the glands observed in the tissue \nare hormone-sensitive, responds to the same cyclic variations as the \neutopic endometrium and are responsible for the pain [20]. Probiotics \nhave been tested successfully to alleviate the hyperplasia of glandular \nstructure associated with gastric Helicobacter pylori infection and to \nreduce the overexpression of COX-2, which is also involved in the \npathogeny of endometriosis [50,51]. \nImmunologically, we observed a substantial decrease of the \nactivation of CD4+ and CD8+ T-cells subsets and B-lymphocytes in \nendometriotic mice treated with probiotics. It has been previously \nreported that there is a greater frequency of activated T-cells in \nthe ectopic endometrium of women with endometriosis [52]. This \nobservation is less clear in peripheral blood of endometriosis patients, \nwhere some studies showed an increase, while others presented a \nreduction of the frequency and the activation of the T-cells [53]. B cells, \nwhich are important players of the immune system, are increased in \nthe blood and peritoneal cavity of women with endometriosis [54]. A \npolyclonal activation of B cells and the presence of anti-endometrial \nautoantibodies [55,56] have been described. Here, the probiotic \ntreatment reduced the activation of B cells in mice with endometriosis. \nInterestingly, it has been reported that inactivation of the B cells by \nIbrutinib, a Bruton’s tyrosine kinase inhibitor, prevents endometriosis \nprogression in mice [57].\nLocal and systemic changes in NK cell phenotype and function \nhave been reported in women with endometriosis (Wilson TJ, et \nal: Decreased natural killer cell activity in endometriosis patients: \nrelationship to disease pathogenesis. Fertil Steril 1994; 62:1086–1088). \nIndeed, several studies have reported an altered NK cell phenotype \nand function with a decreased expression of the activation markers \nCD69 and CD107a whereas the inhibitory receptors are upregulated. \nInterestingly, it has been established that probiotics increase NK cell \nactivation and enhance their cytotoxicity [58]. In our mouse model, \nthe probiotic treatment induced an increase of NK cells activation at \nW4. An improvement of the NK cell capacity of the detection and the \nclearance of abnormal cells, early upon the surgery, may contribute \nto the immunological control of the endometriotic fragments in our \nmodel.\nProbiotic treatment was accompanied by a disbalance in M1 and \nM2 macrophages phenotype with an important increase of the M1/\nM2 ratio in mice with endometriosis treated by the probiotics. Studies \nin human and mice evidenced the key role of M2 macrophages in \nthe pathogenesis of endometriosis lesions establishment and growth. \nIndeed, it was shown an elevation of the proportion of M2 macrophages \nin the peritoneal fluid of women with endometriosis, compared with \ncontrols [59]. In addition, adoptive intraperitoneal transfer of M2 \nmacrophages enhanced lesion growth and neovascularization in \nmice [60]. The probiotics can exert an immunomodulatory effect \non macrophage polarization [61]. Lactobacillus Acidophilus that is \ncontained in our P2 probiotic treatment has been shown to promote \nthe production of the IL-12 cytokine that favors the M1 polarization \nthrough a shift toward Th1 T cells response [62,63]. Moreover, it has been \nshown that Lactobacillus acidophilus inhibits nitric oxide and TNF-α \nproduction while it stimulates the IL-10 production in the macrophages \nline RAW264.7 cells [64]. TNF-α is a potent pro-inflammatory cytokine \nmainly produced by the macrophages, monocytes, and activated T \ncells. It has been involved in the pathophysiology of endometriosis [65]. \nIts level is increased in peritoneal fluid of women with endometriosis \n[66], correlated with the disease severity [67,68]. Serum TNFα level \nis also increased, and monocytes from patients with endometriosis \nrelease more TNF-α  in vitro  compared with monocytes from control \nwomen [69]. The anti-inflammatory effect of blocking TNF-α by \nmonoclonal antibodies (e.g. infliximab) or by soluble TNF-α receptors \n(e.g. etanercept) has been demonstrated  in vivo in animal models and \nin women. In baboons with laparoscopically confirmed endometriosis, \nTNF-α blockade with p55 soluble TNF-α receptors results in inhibition \nof the development and growth of endometriotic implants [70]. The size \nof peritoneal red lesions was decreased in comparison with a control \ngroup [71]. As well in rats with ectopically transplanted endometrial \ntissue, the administration of recombinant human TNF-α binding \nprotein-1 resulted in defective development of implants compared \nwith controls [72]. A decrease of serum TNF-α level with our probiotic \ntreatments is of major interest. Indeed, it has been reported that the \nexpression of TNF-α is modulated by probiotics in a strain-dependent \nmanner as they can inhibit its production by normal and inflamed \nmucosa [73].\nAs endometriosis is characterized by a disrupted immune \nfunction, we believe that the probiotic treatment may exert potent \n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 9-11\nimmunomodulatory effects to dampen the excess of inflammation \nas reflected by a drop of the serum TNF-α and IL-6 levels, to modify \nthe subsets ratio of M1/M2 macrophages and to reduce the B-cells \nactivation\nZonulin, is a marker of permeability of the intestinal barrier. A \ngrowing number of publications focused on human genetics, the gut \nmicrobiome, and proteomics, suggesting that loss of mucosal barrier \nfunction, particularly in the gastrointestinal tract, may substantially \naffect antigen trafficking, ultimately causing chronic inflammation, \nincluding autoimmunity, in genetically predisposed individuals [74]. \nThe gut mucosa works as a semipermeable barrier in that it permits \nnutrient absorption and regulates immune surveillance while retaining \npotentially harmful microbes and environmental antigens within \nthe intestinal lumen.  Enteric infections have been implicated in the \npathogenesis of several pathological conditions, including allergic, \nautoimmune, and inflammatory diseases, by increasing the paracellular \npermeability of the intestinal barrier [75]. In our hands Zonuline is \nsignificantly reduced in sera by P1 and P2 at W4 and by M, P1 and P2 \nat W12, sign of a preserved intestinal barrier. \nIt has been demonstrated that the alteration of the gut mucosal \nbarrier is associated with a neuro-endocrine dysfunction and an \nincreased expression of the NGF protein in the rectosigmoid tissue [21-\n23]. In our experiment, an alteration of the intestinal permeability as \nreflected by the increased zonulin level in the sera of the endometriotic \nmice treated with probiotics may explain the variations we observed in \nthe Nfg mRNA expression.\nThe decrease rate of oxidation of serum proteins (AOPP) by P0 \nat W4 and by P0, P1 and P2 at W12 is thus not a surprise. Previous \nstudies have implicated reactive oxygen species (ROS) and cytokines \nin the regulation of permeability. The vascular endothelium regulates \nthe passage of fluids, solutes, and cells from blood into tissues. \nDisruption of vascular permeability contributes to the pathogenesis of \na wide range of diseases, including atherosclerosis, inflammatory tissue \ninjury, and acute respiratory distress syndrome. Three cytokines have \nbeen implicated in the regulation of barrier function in inflammatory \nstates. Tumor necrosis factor-α (TNF-α), interleukin (IL)-1, and IL-6 \nare increased in blood [76,77] after tissue injury.  Pro-inflammatory \ncytokines could contribute to the reversible changes in endothelial \npermeability observed during periods of prolonged hypoxia. Studies \nhave begun to implicate reactive oxygen species (ROS) in the cellular \nresponses to inflammatory cytokines [78,79], whereas other works have \ndemonstrated that ROS directly participate in the intracellular signaling \ninitiated during physiological hypoxia [80,81]. The involvement \nof ROS in both suggests that cytokines and hypoxia may interact in \nthe regulation of endothelial barrier function during inflammation. \nA major functional consequence of ROS production during hypoxia \nis the increase in IL-6 secretion, which contributes to the changes in \nendothelial permeability [82]. \nIn our study, even though t here is no significant difference in the \nexpression of inflammation, fibrosis, and angiogenesis markers (cox \n2, col1 and cd31 respectively) they presented a tendency to decrease \nwith the P2 treatment on W12. P1 reduces significantly Igf1 after a \nW12 treatment. COX-2 is an inducible enzyme that catalyzes \nthe production of prostaglandin E2 as a cellular response to \ninflammation. COX-2 overexpression has a pleiotropic and \nmultifaceted role in inflammation and carcinogenesis. It shapes \nthe structure and function of the extracellular matrix in primary and \nmetastatic breast tumors [83]. It is now recognized that endometriotic \nlesions have high COX-2 and COX-2-derived prostaglandin \nE   biosynthesis compared with the normal endometrium. COX-2 \ndownregulation in a triple negative breast cancer cells induce decreased \nCol1 fiber density [83].\nAll together, these results evidence that probiotics are beneficial \nnonpathogenic bacteria that have been used as a nutritional approach \nfor the prevention or treatment of some diseases [84,85].  Treatment \nwith one (P1) or two (P2) probiotics, have both favorable effects on \nclinical, immune, and physiologic parameters in endometriosis. \nBecause of its greater ease of handlin and its effects observed on pain, \nSaccharomyces boulardii (P1) seems to be more suited to be used as a \nnew therapeutic strategy for endometriosis. Nevertheless, P2 treatment \nremains also an interesting alternative because of the potential effects of \nLactobacillus acidophilus on peripheric neuronal functions and thus on \npain, described in patients.\nFunding\nThis work was supported by GYNOV and Iprad society\nAcknowledgments\nThe authors would like to thank the PIV and Histim facilities of \nCochin Institute, Paris, for ultrasonography monitoring and histology \ntechniques. \nReferences\n1. Scheerer C, Bauer P, Chiantera V , Sehouli J, Kaufmann A, et al. (2016) Characterization \nof endometriosis-associated immune cell infiltrates (EMaICI). Arch Gynecol Obstet \n294: 657-664. \n2. Ahn SH, Monsanto SP, Miller C, Singh SS, Thomas R, et al. (2015) Pathophysiology \nand immune dysfunction in endometriosis. BioMed Res Int 2015: 795976. [Crossref]\n3. Björk E, Vinnars MT, Nagaev I, Nagaeva O, Lundin E, et al. (2020) Enhanced local \nand systemic inflammatory cytokine mRNA expression in women with endometriosis \nevokes compensatory adaptive regulatory mRNA response that mediates immune \nsuppression and impairs cytotoxicity. Am J Reprod Immunol 84: e13298. [Crossref]\n4. Gmyrek GB, Sieradzka U, Goluda M, Gabrys M, Sozanski R, et al. (2008) Flow \ncytometric evaluation of intracellular cytokine synthesis in peripheral mononuclear \ncells of women with endometriosis. Immunol Invest 37: 43-61. [Crossref]\n5. Nishimura H, Honjo T (2001) PD-1: an inhibitory immunoreceptor involved in \nperipheral tolerance. Trends Immunol 22: 265-268. \n6. Chen L (2004) Co-inhibitory molecules of the B7-CD28 family in the control of T-cell \nimmunity. Nat Rev Immunol 4: 336-347. [Crossref]\n7. Kvaskoff M, Mu F, Terry KL, Harris HR, Poole EM, et al. (2015) Endometriosis: a \nhigh-risk population for major chronic diseases? Hum Reprod Update 21: 500-516. \n8. Jess T, Frisch M, Jørgensen KT, Pedersen BV , Nielsen NM (2012) Increased risk of \ninflammatory bowel disease in women with endometriosis: a nationwide Danish cohort \nstudy. Gut 61: 1279-1283. \n9. Huijs E, Nap A (2020) The effects of nutrients on symptoms in women with \nendometriosis: a systematic review. Reprod Biomed Online 41: 317-328. [Crossref]\n10. Azad MAK, Sarker M, Li T, Yin J (2018) Probiotic species in the modulation of gut \nmicrobiota: An overview. BioMed Res Int 2018: 9478630. [Crossref]\n11. Carding S, Verbeke K, Vipond DT, Corfe BM, Owen LJ (2015) Dysbiosis of the gut \nmicrobiota in disease. Microb Ecol Health Dis 26: 26191. [Crossref]\n12. Scarpellini E, Ianiro G, Attili F, Bassanelli C, De Santis A, et al. (2015) The human \ngut microbiota and virome: Potential therapeutic implications. Dig Liver Dis 47: \n1007-1012. [Crossref]\n13. Yoo JY , Groer M, Dutra SVO, Sarkar A, McSkimming DI (2020) Gut microbiota and \nimmune system interactions. Microorganisms 8: 1587. [Crossref]\n14. Belkaid Y , Hand T (2014) Role of the microbiota in immunity and inflammation. Cell \n157: 121-41. [Crossref]\n15. Rinninella E, Raoul P, Cintoni M, Franceschi F, Miggiano GAD, et al. (2019) \nWhat is the healthy gut microbiota composition? A changing ecosystem across age, \nenvironment, diet, and diseases. Microorganisms 7: 14. [Crossref]\n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 10-11\n16. Solt I (2015) The human microbiome and the great obstetrical syndromes: A new \nfrontier in maternal–fetal medicine. Best Pract Res Clin Obstet Gynaecol 29: 165-175. \n[Crossref]\n17. Hilton E, Isenberg HD, Alperstein P, France K, Borenstein MT (1992) Ingestion of \nyogurt containing lactobacillus acidophilus as prophylaxis for candidal vaginitis. Ann \nIntern Med 116: 353-357. [Crossref]\n18. Reid G, Bruce AW, Fraser N, Heinemann C, Owen J, et al. (2001) Oral probiotics \ncan resolve urogenital infections. FEMS Immunol Med Microbiol 30: 49-52. [Crossref]\n19. Morotti M, Vincent K, Brawn J, Zondervan KT, Becker CM (2014) Peripheral changes \nin endometriosis-associated pain. Hum Reprod Update 20: 717-736. \n20. Stratton P, Berkley KJ (2011) Chronic pelvic pain and endometriosis: translational \nevidence of the relationship and implications. Hum Reprod Update 17: 327-346. \n[Crossref]\n21. As-Sanie S, Harris RE, Napadow V , Kim J, Neshewat G, et al. (2012) Changes in \nregional gray matter volume in women with chronic pelvic pain: a voxel-based \nmorphometry study. Pain 153: 1006-1014. [Crossref]\n22. Rousseaux C, Thuru X, Gelot A, Barnich N, Neut C, et al. (2007) Lactobacillus \nacidophilus modulates intestinal pain and induces opioid and cannabinoid receptors. \nNat Med 13: 35-37. \n23. Ngô C, Chéreau C, Nicco C, Weill B, Chapron C, et al. (2009) Reactive oxygen species \ncontrols endometriosis progression. Am J Pathol 175: 225-234. [Crossref]\n24. Marcellin L, Santulli P, Chouzenoux S, Cerles O, Nicco C, et al. (2017) Alteration \nof Nrf2 and Glutamate Cysteine Ligase expression contribute to lesions growth and \nfibrogenesis in ectopic endometriosis. Free Radic Biol Med 110: 1-10. [Crossref]\n25. Santulli P, Marcellin L, Chouzenoux S, Boulard V , Just PA, et al. (2016) Role of the \nprotein kinase BRAF in the pathogenesis of endometriosis. Expert Opin Ther Targets \n20: 1017-1029. \n26. Deuis JR, Dvorakova LS, Vetter I (2017) Methods used to evaluate pain behaviors in \nrodents. Front Mol Neurosci 10: 284. [Crossref] \n27. Minett MS, Eijkelkamp N, Wood JN (2014) Significant determinants of mouse pain \nbehaviour. PloS One 9: e104458. \n28. Szóstek-Mioduchowska AZ, Baclawska A, Okuda K, Skarzynski DJ (2019) Effect of \nproinflammatory cytokines on endometrial collagen and metallopeptidase expression \nduring the course of equine endometrosis. Cytokine 123: 154767. [Crossref]\n29. Fusco R, D’amico R, Cordaro M, Gugliandolo E, Siracusa R, et al. (2018) Absence of \nformyl peptide receptor 1 causes endometriotic lesion regression in a mouse model of \nsurgically-induced endometriosis. Oncotarget 9: 31355-31366. [Crossref]\n30. Rao RK, Samak G (2013) Protection and restitution of gut barrier by probiotics: \nNutritional and clinical implications. Curr Nutr Food Sci 9: 99-107. [Crossref]\n31. Mohammadi AA, Jazayeri S, Khosravi-Darani K, Solati Z, Mohammadpour N, et al. \n(2015) Effects of probiotics on biomarkers of oxidative stress and inflammatory factors \nin petrochemical workers: A randomized, double-blind, placebo-controlled trial. Int J \nPrev Med 6: 82. [Crossref]\n32. Herington JL, Bruner-Tran KL, Lucas JA, Osteen KG (2011) Immune interactions in \nendometriosis. Expert Rev Clin Immunol 7: 611-626. \n33. Leonardi M, Hicks C, El-Assaad F, El-Omar E, Condous G (2020) Endometriosis and \nthe microbiome: a systematic review. BJOG 127: 239-249. [Crossref]\n34. Cani PD (2018) Human gut microbiome: hopes, threats and promises. Gut 67: \n1716-1725. [Crossref]\n35. Blaser MJ (2014) The microbiome revolution. J Clin Invest 124: 4162-4165. [Crossref]\n36. Wu HJ, Wu E (2012) The role of gut microbiota in immune homeostasis and \nautoimmunity. Gut Microbes 3: 4-14. [Crossref]\n37. Baker JM, Al-Nakkash L, Herbst-Kralovetz MM (2017) Estrogen–gut microbiome \naxis: Physiological and clinical implications. Maturitas 103: 45-53. [Crossref]\n38. Hajela N, Ramakrishna BS, Nair GB, Abraham P, Gopalan S, et al. (2015) Gut \nmicrobiome, gut function, and probiotics: Implications for health. Indian J \nGastroenterol 34: 93-107. [Crossref]\n39. Hori T, Matsuda K, Oishi K (2020) Probiotics: A dietary factor to modulate the gut \nmicrobiome, host immune system, and gut–brain interaction. Microorganisms 8: 1401. \n40. Quigley EMM, Gajula P (2020) Recent advances in modulating the microbiome. \nF1000Res.\n41. Pais P, Almeida V , Yılmaz M, Teixeira MC (2020) Saccharomyces boulardii: What \nmakes it tick as successful probiotic? J Fungi Basel Switz. \n42. Ma Y , Liu T, Fu J, Fu S, Hu C, et al. (2019) Lactobacillus acidophilus exerts \nneuroprotective effects in mice with traumatic brain injury. J Nutr 149: 1543-1552. \n[Crossref]\n43. Lépine AFP, de Wit N, Oosterink E, Wichers H, Mes J, et al. (2018) Lactobacillus \nacidophilus attenuates salmonella-induced stress of epithelial cells by modulating tight-\njunction genes and cytokine responses. Front Microbiol 9:1439. [Crossref]\n44. Wu D, Lewis ED, Pae M, Meydani SN (2018) Nutritional modulation of immune \nfunction: analysis of evidence, mechanisms, and clinical relevance. Front Immunol 9: \n3160. [Crossref]\n45. Stevens BR, Goel R, Seungbum K, Richards EM, Holbert RC, et al. (2018) Increased \nhuman intestinal barrier permeability plasma biomarkers zonulin and FABP2 correlated \nwith plasma LPS and altered gut microbiome in anxiety or depression. Gut 67: \n1555-1557. [Crossref]\n46. Lee S, Keirsey KI, Kirkland R, Grunewald ZI, Fischer JG, et al. (2018) Blueberry \nsupplementation influences the gut microbiota, inflammation, and insulin resistance in \nhigh-fat-diet-fed rats. J Nutr 148: 209-219. [Crossref]\n47. Denk F, Bennett DL, McMahon SB (2017) Nerve growth factor and pain mechanisms. \nAnnu Rev Neurosci 40: 307-325. [Crossref]\n48. Sørensen LB, Gazerani P, Sluka KA, Graven-Nielsen T (2020) Repeated injections \nof low-dose nerve growth factor (NGF) in healthy humans maintain muscle pain and \nfacilitate ischemic contraction-evoked pain. Pain Med 21: 3488-3498. [Crossref]\n49. Peng B, Zhan H, Alotaibi F, Alkusayer GM, Bedaiwy MA, et al. (2018) Nerve growth \nfactor is associated with sexual pain in women with endometriosis. Reprod Sci 25: \n540-549. \n50. Brzozowski T, Konturek PC, Mierzwa M, Drozdowicz D, Bielanski W, et al. (2006) \nEffect of probiotics and triple eradication therapy on the cyclooxygenase (COX)-\n2 expression, apoptosis, and functional gastric mucosal impairment in helicobacter \npylori-infected mongolian gerbils. Helicobacter 11: 10-20. [Crossref]\n51. Lai ZZ, Yang HL, Ha SY , Chang KK, Mei J, et al. (2019) Cyclooxygenase-2 in \nendometriosis. Int J Biol Sci 15: 2783-2797. [Crossref]\n52. Witz CA, Montoya IA, Dey TD, Schenken RS (1994) Characterization of lymphocyte \nsubpopulations and T cell activation in endometriosis. Am J Reprod Immunol 32: \n173-179. [Crossref]\n53. Riccio L da GC, Santulli P, Marcellin L, Abrão MS, Batteux F, et al. (2018) Immunology \nof endometriosis. Best Pract Res Clin Obstet Gynaecol 50: 39-49. \n54. Riccio LGC, Baracat EC, Chapron C, Batteux F, Abrão MS (2017) The role of the B \nlymphocytes in endometriosis: A systematic review. J Reprod Immunol 123: 29-34. \n[Crossref]\n55. Wild RA, Shivers CA (1985) Antiendometrial antibodies in patients with endometriosis. \nAm J Reprod Immunol Microbiol 8: 84-86. [Crossref]\n56. Fernàndez-Shaw S, Hicks BR, Yudkin PL, Kennedy S, Barlow DH, et al. (1993) Anti-\nendometrial and anti-endothelial auto-antibodies in women with endometriosis. Hum \nReprod 8: 310-315. \n57. Riccio LGC, Jeljeli M, Santulli P, Chouzenoux S, Doridot L, et al. (2019) B \nlymphocytes inactivation by Ibrutinib limits endometriosis progression in mice. Hum \nReprod 34: 1225-1234. \n58. Jeung I, Cheon K, Kim MR (2016) Decreased cytotoxicity of peripheral and peritoneal \nnatural killer cell in endometriosis. BioMed Res Int.\n59. Hudson QJ, Ashjaei K, Perricos A, Kuessel L, Husslein H, et al. (2020) Endometriosis \npatients show an increased M2 response in the peritoneal CD14+low/CD68+low \nmacrophage subpopulation coupled with an increase in the T-helper 2 and T-regulatory \ncells. Reprod Sci 27: 1920-1931. [Crossref]\n60. Bacci M, Capobianco A, Monno A, Cottone L, Di Puppo F, et al. (2009) Macrophages \nare alternatively activated in patients with endometriosis and required for growth and \nvascularization of lesions in a mouse model of disease. Am J Pathol  175: 547-556. \n[Crossref]\n61. Wang Y , Liu H, Zhao J (2020) Macrophage polarization induced by probiotic bacteria: \na concise review. Probiotics Antimicrob Proteins 12: 798-808. [Crossref]\n62. Quinteiro-Filho WM, Brisbin JT, Hodgins DC, Sharif S (2015) Lactobacillus and \nLactobacillus cell-free culture supernatants modulate chicken macrophage activities. \nRes Vet Sci 103: 170-175. \n\nChouzenoux S (2021) A new strategy against endometriosis: Oral probiotic treatments\nClin Obstet Gynecol Reprod Med, 2021        doi: 10.15761/COGRM.1000324\n Volume 7: 11-11\n63. Amar Y , Rizzello V , Cavaliere R, Campana S, De Pasquale C, et al. (2015) Divergent \nsignaling pathways regulate IL-12 production induced by different species of \nLactobacilli in human dendritic cells. Immunol Lett 166: 6-12. [Crossref]\n64. Kim DH, Kim S, Lee JH, Kim JH, Che X, et al. (2019) Lactobacillus acidophilus \nsuppresses intestinal inflammation by inhibiting endoplasmic reticulum stress. J \nGastroenterol Hepatol 34: 178-185. [Crossref]\n65. Agic A, Xu H, Finas D, Banz C, Diedrich K, et al. (2006) Is endometriosis associated \nwith systemic subclinical inflammation? Gynecol Obstet Invest 62: 139-147. \n66. Bedaiwy MA, Falcone T, Sharma RK, Goldberg JM, Attaran M, et al. (2002) Prediction \nof endometriosis with serum and peritoneal fluid markers: a prospective controlled trial. \nHum Reprod 17: 426-431. [Crossref]\n67. Richter ON, Dorn C, Rösing B, Flaskamp C, Ulrich U (2005) Tumor necrosis factor \nalpha secretion by peritoneal macrophages in patients with endometriosis. Arch \nGynecol Obstet 271: 143-147. [Crossref]\n68. Bullimore DW (2003) Endometriosis is sustained by tumour necrosis factor-alpha. Med \nHypotheses 60: 84-88. \n69. Braun DP, Gebel H, House R, Rana N, Dmowski NP (1996) Spontaneous and induced \nsynthesis of cytokines by peripheral blood monocytes in patients with endometriosis. \nFertil Steril 65: 1125-1129. [Crossref]\n70. D’Hooghe TM, Nugent NP, Cuneo S, Chai DC, Deer F, et al. (2006) Recombinant \nhuman TNFRSF1A (r-hTBP1) inhibits the development of endometriosis in baboons: a \nprospective, randomized, placebo- and drug-controlled study. Biol Reprod 74: 131-136. \n[Crossref]\n71. Barrier BF, Bates GW, Leland MM, Leach DA, Robinson RD, et al. (2004) Efficacy \nof anti-tumor necrosis factor therapy in the treatment of spontaneous endometriosis in \nbaboons. Fertil Steril 81 Suppl 1: 775-779. [Crossref]\n72. D’Antonio M, Martelli F, Peano S, Papoian R, Borrelli F (2000) Ability of recombinant \nhuman TNF binding protein-1 (r-hTBP-1) to inhibit the development of experimentally-\ninduced endometriosis in rats. J Reprod Immunol 48: 81-98. [Crossref]\n73. Habil N, Al-Murrani W, Beal J, Foey A (2011) Probiotic bacterial strains differentially \nmodulate macrophage cytokine production in a strain-dependent and cell subset-\nspecific manner. Benef Microbes 2: 283-293. \n74. Valitutti F, Fasano A (2019) Breaking down barriers: How understanding celiac \ndisease pathogenesis informed the development of novel treatments. Dig Dis Sci 64: \n1748-1758. \n75. El Asmar R, Panigrahi P, Bamford P, Berti I, Not T, et al. (2002) Host-dependent \nzonulin secretion causes the impairment of the small intestine barrier function after \nbacterial exposure. Gastroenterology 123: 1607-1615. [Crossref]\n76. Ertel W, Morrison MH, Ayala A, Chaudry IH (1995) Hypoxemia in the absence of \nblood loss or significant hypotension causes inflammatory cytokine release. Am J \nPhysiol-Regul Integr Comp Physiol 269: R160-R166. [Crossref]\n77. Schütte H, Lohmeyer J, Rosseau S, Ziegler S, Siebert C, et al. (1996) Bronchoalveolar \nand systemic cytokine profiles in patients with ARDS, severe pneumonia and \ncardiogenic pulmonary oedema. Eur Respir J 9: 1858-1867. [Crossref]\n78. Chua CC, Hamdy RC, Chua BHL (1998) Upregulation of vascular endothelial growth \nfactor by H2O2 in rat heart endothelial cells. Free Radic Biol Med 25: 891-897. \n[Crossref]\n79. Simon AR, Rai U, Fanburg BL, Cochran BH (1998) Activation of the JAK-STAT \npathway by reactive oxygen species. Am J Physiol-Cell Physiol 275: C1640-C1652. \n80. Chandel NS, Maltepe E, Goldwasser E, Mathieu CE, Simon MC, et al. (1998) \nMitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proc \nNatl Acad Sci U S A 95: 11715-11720. [Crossref]\n81. Duranteau J, Chandel NS, Kulisz A, Shao Z, Schumacker PT (1998) Intracellular \nsignaling by reactive oxygen species during hypoxia in cardiomyocytes. J Biol Chem \n273: 11619-11624. \n82. Ali MH, Schlidt SA, Chandel NS, Hynes KL, Schumacker PT, et al. (1999)  Endothelial \npermeability and IL-6 production during hypoxia: role of ROS in signal transduction. \nAm J Physiol 277: L1057-L1065. \n83. Krishnamachary B, Stasinopoulos I, Kakkad S, Penet MF, Jacob D, et al. (2017) Breast \ncancer cell cyclooxygenase-2 expression alters extracellular matrix structure and \nfunction and numbers of cancer associated fibroblasts. Oncotarget 8: 17981-17994. \n84. Bruce-Keller AJ, Salbaum JM, Berthoud HR (2018) Harnessing gut microbes for \nmental health: Getting from here to there. Biol Psychiatry 83: 214-223. [Crossref]\n85. Shen NT, Maw A, Tmanova LL, Pino A, Ancy K, et al. (2017) Timely use of probiotics \nin hospitalized adults prevents clostridium difficile infection: A systematic review with \nmeta-regression analysis. Gastroenterology 152: 1889-1900. [Crossref]\nCopyright: ©2021 Chouzenoux S. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted \nuse, distribution, and reproduction in any medium, provided the original author and source are credited.","source_license":"CC0","license_restricted":false}