{"paper_id":"8fb37598-137a-4cb5-baa8-3d4b9ebf4251","body_text":"Loss of Tuberous Sclerosis Complex 2 confers inflammation via dysregulation of Nuclear factor kappa-light-chain-enhancer of activated B cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Loss of Tuberous Sclerosis Complex 2 confers inflammation via dysregulation of Nuclear factor kappa-light-chain-enhancer of activated B cells Darius K. McPhail, Mohammad A.M. Alzahrani, Katie R. Martin, Brian L. Calver, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4569999/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Sep, 2025 Read the published version in Journal of Inflammation → Version 1 posted 5 You are reading this latest preprint version Abstract Background Aberrant activation of mTORC1 is clearly defined in TSC, causing uncontrolled cell growth. While mTORC1 inhibitors show efficacy to stabilise tumour growth in TSC, they are not fully curative. Disease facets of TSC that are not restored with mTOR inhibitors might involve NF-κB. The study aimed to characterise NF-κB in the context of TSC. Results Enrichment of NF-κB-regulated genes was observed in TSC patient tumours, SEN/SEGAs, cortical tubers and a TSC tumour-derived cell line (621 − 101). Highlighting an inflammatory component of TSC, TSC cell models showed an elevated level of NF-κB and STAT3 activation. Herein, we report a dysregulated inflammatory phenotype of TSC2 -deficient cells where NF-κB promotes autocrine signalling involving IL-6. Of importance, mTORC1 inhibition does not block this inflammatory signal to promote STAT3, while NF-κB inhibition was much more effective. Combined mTORC1 and NF-κB inhibition was potent at preventing anchorage-independent growth of TSC2 -deficient cells, and unlike mTORC1 inhibition alone was sufficient to prevent colony regrowth after cessation of treatment. Conclusion This study reveals autocrine signalling crosstalk between NF-κB and STAT3 in TSC cell models. Furthermore, the data presented indicate that NF-κB pathway inhibitors could be a viable adjunct therapy with the current mTOR inhibitors to treat TSC. TSC mTOR NF-κB STAT3 IL-6 rapamycin inflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Tuberous Sclerosis Complex (TSC) is a rare, autosomal dominant genetic condition caused by inactivating mutations in either the TSC1 or TSC2 genes. TSC patients are predisposed to kidney, skin, brain, and heart tumours (reviewed in [ 1 ]). Renal angiomyolipomas (AML) are highly vascularised benign tumours containing both smooth muscle and adipose tissue occurring in ~ 80% of adult TSC patients and are the primary cause of mortality past the age of 30 [ 2 ]. TSC-associated brain lesions include subependymal nodules (SEN) and subependymal giant cell astrocytomas (SEGA) that can result in hydrocephalus [ 3 ]. Additionally, TSC patients often present with cortical tubers, which are believed to be the epileptic foci in the majority of TSC cases [ 4 ]. White matter abnormalities are also common in TSC patients (up to 95%) and likely contribute to the onset, frequency, and severity of seizures [ 5 ]. Approximately 90% of TSC patients will experience a seizure within their lifetime. Seizures can be refractive to standard anti-epileptic medications, making seizures difficult to treat in approximately one-third of TSC patients [ 6 ]. Furthermore, 50% of TSC patients will have some degree of intellectual disability [ 7 ]. Currently, one key feature of TSC1/TSC2 biology is well understood: the ability of the TSC1/2 tumour suppressor complex to inhibit growth signalling through mechanistic target of rapamycin complex 1 (mTORC1). The small G protein Rheb, which directly activates mTORC1 kinase activity when GTP-bound, is negatively regulated by the GTPase activating protein (GAP) domain of TSC2 [ 8 ]. Consequently, inactivating mutations within either TSC1 or TSC2 favours GTP-loading of Rheb and aberrant protein kinase activity of mTORC1, leading to uncontrolled cell growth. mTORC1 inhibitors are now used worldwide to treat TSC patients to stabilise disease. Long-term treatments with mTORC1 inhibitors (> 3 years) in TSC patients was found to markedly improve seizures that were refractory to conventional antiepileptic drugs [ 9 ]. Tumour volumes are also reduced by mTORC1 inhibitors, with both angiomyolipomas and SEGAs being reduced by > 60%. While mTORC1 inhibitors alleviate many disease traits of TSC, they do not restore disease to normal (reviewed in 10]). For instance, tumours do not regress completely and grow back when therapy stops. A greater understanding of how the loss of either TSC1 or TSC2 can drive disease is required before more curative therapies can be developed for TSC. In this study, we examined differentially expressed genes in TSC patient tumours that highlighted gene sets involved in oxidative stress and inflammation. Oxidative stress is known to activate redox-sensitive transcription factors, such as nuclear factor kappa B (NF-κB). NF-κB is involved in the survival, growth, and migration of cancer cells (reviewed in [ 11 ]) and is stimulated by a variety of growth factors or cytokines (reviewed in [ 12 ]). Briefly, NF-κB subunits, RelA (p65) and RelB are expressed ubiquitously and reside in their inactive forms in the cytoplasm. The RelA and RelB subunits possess transcriptional activation domains. To activate NF-κB, NF-κB inhibitor alpha (commonly referred to as IκBα) is phosphorylated and inactivated by the IκB kinase (IKK) complex. This causes dissociation, ubiquitination, and subsequent degradation of IκBα. IKK also phosphorylates RelA at S536, promoting the transcriptional activity of NF-κB via the association of homo or heterodimers of NF-κB subunits, most commonly RelA/NF-κB1. These activator inputs unmask the nuclear localisation signals within NF-κB subunits, leading to their nuclear translocation and transcription of pro-inflammatory NF-κB genes. STAT3 is a pro-inflammatory transcription factor that promotes oncogenesis by enhancing tumour survival, motility, and cell proliferation [ 13 ]. Phosphorylation of Y705 is the most well-known mechanism of STAT3 activation, and typically occurs downstream of cytokine stimulation. For example, IL-6 stimulation results in phosphorylation of Y705-STAT3. This leads to STAT3 dimerisation and subsequent translocation to the nucleus, where STAT3 homodimers promote pro-inflammatory gene activation [ 14 ]. STAT3 possesses a phosphorylation site on S727, although the functional role of this is poorly understood. S727 phosphorylation is believed to negatively regulate Y705 STAT3 phosphorylation, thus reducing STAT3 inflammatory activity [ 15 ]. However, other studies report that S727 phosphorylation is required (alongside Y705 phosphorylation) for maximal STAT3 activation (and tumorigenic signalling) [ 16 ]. While mTOR inhibitors demonstrate significant clinical applicability, their effect is often limited and mTOR inhibitors are relatively ineffective at reducing various disease-associated signalling pathways, such as NF-κB, STAT3, and HIF-1α [ 17 ]. For this reason, investigation into inflammatory pathways may offer an alternative treatment option for TSC. Current evidence of NF-κB in TSC is limited and suggests varied dysregulation. One study reported a context-dependent role of TSC2 in NF-κB activity [ 18 ]. Small interfering RNA knockdown of TSC2 was found to increase the activity of NF-κB, however this effect was only observed in cells with non-functional PTEN. It was believed that this occurred downstream of mTORC1. Conversely, the same study reported that when PTEN was restored, TSC2 knockdown resulted in a decrease in NF-κB activation. This highlights the context-dependent role of TSC2 in the regulation of NF-κB. Another study revealed that mTORC1 inhibition impacted NF-κB activation within TSC2 -deficient immune cells [ 19 ]. Notably, in the TSC2 -deficient cells, the transactivation domain of RelA was inactivated by mTORC1-dependent phosphorylation resulting in reduced NF-κB activity. Inhibition of mTORC1 reversed the reduction of NF-κB activity and resulted in hyperactivation of NF-κB. Given the possible complex role of dysfunctional NF-κB activity in the pathophysiology of TSC, herein we sought to further elucidate NF-κB in the context of TSC. Methods Cell culture and drug treatments 621 − 101 TSC2 -deficient ( TSC2 −) cells were derived from the renal AML of a TSC patient and possess a homozygous missense mutation in TSC2 (G1832A), resulting in an R611Q amino acid substitution [ 20 ]. Wild-type human TSC2 was re-expressed to generate 621 − 103 ( TSC2 +) AML cells [ 21 ]. Tsc2 (−/−) and Tsc2 (+/+) mouse embryonic fibroblasts (MEF) are immortalised with Tp53 (−/−), which was originally derived from early-stage embryos from an interbreeding study [ 22 ]. Eker rat leiomyoma-derived Tsc2 -deficient cells (ELT3-V3) and matched controls re-expressing Tsc2 (ELT3-T3) were generated by Astrinidis et al . [ 23 ]. and was gifted by C. Walker (M.D. Anderson Cancer Center, Houston, USA). Cell lines were maintained at 37°C, 5% CO 2 in a humidified incubator. When indicated, cells were incubated under hypoxic conditions and 1% O 2 was achieved with N 2 displacement. Cells were cultured in DMEM (Gibco™, Thermo Fisher Scientific, Oxford, UK) on Techno Plastic Products™ coated tissue culture plasticware (Helena Biosciences Europe, Gateshead, UK), supplemented with fetal bovine serum (FBS) at either 10% ( v / v ) or 15% ( v / v ) for MEF and ELT3 cells or AML cells, respectively, with 50 IU/mL penicillin and streptomycin. 100 µM rapamycin and 20 mM C188-9 (Merck Life Science UK Ltd, Gillingham, UK) and 20 mM BMS-345541 (Selleck Chemicals GmBh, Munich, Germany) drug stocks were made up in dimethylsulfoxide (DMSO) and stored as single use aliquots at -80 o C. Drugs were added to the culture media at a consistent % ( v / v ) DMSO per condition, without exceeding 0.5% ( v / v ) DMSO. Tumour necrosis factor α (TNFα) and interleukin 6 (IL-6) (purchased from Abcam, Cambridge, UK) were resuspended in ddH 2 O containing 0.2% ( w / v ) bovin serum albumin (BSA) to 100 µg/mL and 50 µg/mL, respectively (stored as single use aliquots at -80 o C). Cell passage was kept < 30 in AMLs and ELT3, and < 45 in MEFs. Mycoplasma-free frozen cell stocks were used; all cells were routinely checked with Venor GeM advance mycoplasma detection kit (Minerva Biolabs, Berlin, Germany) as per manufacturers guidelines and were negative to the presence of mycoplasma spp. Western blotting Cells were seeded on 60 mm plates and grown to 70–80% confluency prior to treatments. To generate nuclear cell lysates, cells were washed in ice-cold phosphate buffer saline (PBS) before direct lysis in sample buffer (62.5 mM Tris-HCl (pH 7.6), 10% ( v / v ) glycerol, 2% ( w / v ) SDS, 50 mM fresh dithiothreitol. Samples were sonicated before boiling for 10 min at 95°C. Samples were centrifuged at 17,000 × g for 10 min. Protein concentration was determined at OD 660 using Pierce™ reagent supplemented with ionic detergent compatibility reagent (Thermo Fisher Scientific, Oxford, UK). Protein was separated by denaturing polyacrylamide gel electrophoresis using gradient Invitrogen NuPage™ protein gels (ThermoFisher Scientific, Oxford, UK). Resolved proteins were transferred to Immobilon®-P polyvinylidene difluoride membranes (Merck Life Science, Dorset, UK). Western blotting was carried out as directed by the antibody manufacturer’s protocols; primary antibodies (Cell Signaling Technology Danvers, USA) and horse radish peroxidase-conjugated secondary antibodies (Merck Life Science, Dorset, UK). Protein bands were detected by enhanced chemiluminescence using Cytiva Amersham™ ECL select™ western blotting detection reagent (Cytiva, Buckinghamshire, UK). Soft agar colony formation assay BD DIFCO™ Noble Agar (BD BioSciences, Wokingham, Berkshire, UK) was melted in PBS to 1.2% ( w / v ), then diluted in DMEM to yield 0.6% ( w / v ) agar. 2 mL of this solution was added to 6-well plates and was left at room temperature to solidify. In each well, 0.3% ( w / v ) agar DMEM solution containing 20,000 cells was overlaid on top of the 0.6% ( w / v ) agar bottom layer. After setting, media containing the relevant drugs was added and cell colonies were grown between 2–4 weeks, with the media changed every 72 h to refresh drugs. Images were taken on an EVOS XL Core camera and analysed in ImageJ. (v.53) to determine colony diameters. After drug treatment duration, the media was changed and replaced every 72 h in the absence of drugs for a further 3 weeks and further images were taken. RNA-sequencing Cells were washed in ice cold PBS and lysed in RNAprotect® Cell Reagent (Qiagen, West Sussex, UK). RNA was extracted using QIAshredder® and RNAeasy® Mini kits (Qiagen, West Sussex, UK) and were stored at -80°C. RNA library preparation and sequencing were performed through a commercial service/collaboration with Wales Gene Park (Cardiff University, UK), as described previously [ 24 ], except the Illumina® TruSeq® RNA sample preparation v2 kit (Illumina Inc, Great Abington, Cambridgeshire, UK) was used for library preparation, according to the manufacturer’s instructions. Following validation, the libraries were normalised to 8 nM and the pool was sequenced on the MiSeq with a 150 cycle, version 3, cartridge (both Illumina Inc) according to the manufacturer’s instructions. Differentially expressed transcripts were identified using the DeSeq2 package in R [ 25 ]. Analysis was carried out on all pairwise comparisons in the dataset. P-values were corrected for multiple testing using the Benjamini-Hochberg false discovery rate (FDR) method. Bioinformatic work was initially carried out by Wales Gene Park. Patient-derived TSC transcriptomic analysis and gene ontology analysis Samples of TSC patient-derived tumours ( n = 15) were collected by Prof. J. MacKeigan (Michigan State University, Grand Rapids, MI, USA). Gene expression analysis was performed as described [ 26 ]. Differentially expressed gene (DEG) analysis was performed with GeneAnalytics (LifeMap Sciences Inc., Covina, CA, USA). A similar analysis was performed with TSC patient-derived cortical tubers ( n = 15). Gene ontology analysis was used to identify dysregulated inflammatory and immune system processes in TSC patient-derived tumours. Datasets were imported into Microsoft Excel to generate volcano plots. Transcriptional activation ELISAs Cells were seeded on 6 cm plates and grown over two days until they reached 80–90% confluency. Media was replaced with serum-depleted media, including pathway inhibitors or DMSO, where applicable, for 24 h. When assaying cytokine induction, media was supplemented with TNFα or IL-6 for the final 2 or 1 h of treatment, respectively. When assaying the effect of media conditioned by TSC2 -deficient cells on wild-type cells, TSC2 -deficient MEFs or AML cells were grown until 80% confluency before the media was replaced with serum-free media. Cells remained under starved conditions for 24 h before the conditioned media was collected, briefly centrifuged, and then added to wild type cells to stimulate them. For transcription assays, cells lysates were prepared and were assayed using TransAM® STAT3 Transcription Factor ELISA Kit (Active Motif, Waterloo, Belgium) with nuclear preparations following the manufacturer instructions. Conditioned media ELISAs Secreted IL-6 and VEGF-A concentrations in the media were measured using R&D Systems Duoset ELISAs and ancillary reagent kits (Bio-Techne Ltd., Abingdon, UK) as per the manufacturer instructions. Cells were grown in 12-well plates to 90% confluency. Serum-supplemented media was replaced with serum-supplemented media containing drug treatments. Post-treatment, media was collected, centrifuged (1 min at 13,000 rpm), and stored on ice. Samples were diluted 1:10 and loaded onto plates precoated with capture antibody. Absorbance was measured at OD 450 using a BioTek Cytation 3 plate reader, with wavelength correction applied at OD 540 . Wound scratch cell migration assays Cells were seeded at a high confluency in 12-well plates (350,000 cells/well) and grown to full confluency overnight. Next, cells were scratched in a straight vertical line using a 200 µL pipette tip to form a wound within the confluent cell layer. Media was next aspirated before being replaced with serum starved media (2% (v/v) FBS) including the drug to be assayed or vehicle (DMSO). “Wounds” were immediately imaged via stereomicroscopy at 4x, and a pen marking was made for later reference of the area to be observed. At 24 and 48 h, wounds were imaged again to visualise closure of the wound over time. The area of wound scratches was calculated in ImageJ and closure was recorded as a percentage. Quantitative reverse transcription PCR (qRT-PCR) analysis TSC2 (−) or TSC2 (+) AML cells were grown to 70% confluency. Media was replaced with serum- depleted media for 24 h prior to cell collection in RNAprotect (Qiagen, West Sussex, UK) and then stored at − 80°C. RNA was isolated using the RNeasy Plus Mini Kit (Qiagen, West Sussex, UK) and cDNA was generated with the Reverse Transcriptase Core Kit (Eurogentec, Belgium). qRT-PCR was performed using TakyonTM ROX Sybr MasterMix dTTP blue (Eurogentec, Belgium). Ct values were normalised to IPO8 and TUBA1A. Primers were purchased from Integrated DNA Technologies and optimised for annealing temperature and efficiency. PDCD1LG2 forward primer GAACCCAGGACCCATCCAAC and reverse primer TTCAGATAGCACTGTTCACTTCCC and 183 bp amplicon length; IPO8 forward primer ACTGTTGCACATTGTTAGAG and reverse primer ACTTTGCCAAATATCTCAGC and 138 bp amplicon length; TUBA1A forward primer TCTTCCACCCTGAGCAACTT and reverse primer GGAAAACCAAGAAGCCCTGG and 159 bp amplicon length. Dissociation curves were carried out to verify specificity of primer sets. Statistical analysis Protein band intensities were quantified using ImageJ. (v.53). Band intensity was normalised to β-actin expression. Fold changes were normalised to the DMSO control, where applicable. Normalised data were inputted into GraphPad Prism9 (Dotmatics, Boston MA USA) and statistical analysis was carried out. Normality testing in Prism9 was carried out with a D’agostino & Pearson and Shapiro-Wilk test. Normally (Gaussian) distributed data was then analysed by an ordinary one-way ANOVA with Tukey’s multiple comparisons or two-way ANOVA with Šídák's multiple comparisons. When analysing 2 groups only, a parametric unpaired t-test was carried out. Data are presented as mean ± SEM. Non-normally distributed data were assessed by the Kruskal-Wallis test, with Dunn’s multiple comparisons tests. If the comparison was between only two groups, nonparametric Wilcoxon t-tests were instead carried out. p-values: * < 0.05, ** < 0.01, *** < 0.001, **** (or #) < 0.0001, or not significant ‘NS’. Results TSC2 loss is characterised by dysregulated expression of NF-κB genes To explore dysregulated gene expression in TSC, mRNA sequencing (RNAseq) data from 20 TSC patient SEN/SEGAs was compared to non-TSC brain tissue (as previously described [ 26 ]), and also RNAseq from TSC2 (−) AML cells (621 − 101) was compared to TSC2 (+) AML cells (621 − 103). Gene ontology analysis of differentially expressed genes indicated enrichment of inflammatory and immune response genes within TSC patient-derived tumours (supplementary data), as previously described [ 26 ]. To better understand these dysregulated inflammatory pathways in TSC, we analyzed expression of 190 regulatory and NF-κB target genes. This NF-κB-linked gene set was adapted from a list developed by the Gilmore lab (Boston University) [ 27 ]. Volcano plots of differentially expressed genes illustrate dysregulation of NF-κB-linked genes in TSC patient-derived brain tumours (Fig. 1 a), and TSC2 (−) AML cells (Fig. 1 b) when compared with their respective wild-type controls. The observed transcriptional signature suggests a redox imbalance that could create a tumour microenvironment of oxidative stress and inflammation. Within both in vivo and in vitro datasets, NF-κB-related genes were significantly dysregulated. Within SEN/SEGAs, a total of 47 significantly upregulated NF-κB regulatory and target genes was observed (over Log2 fold change of 2 and adjusted p-value < 0.05), compared to 19 significantly downregulated genes (below Log2 fold change − 2 and adjusted p-value < 0.05). This pattern of NF-κB dysregulation persisted within cortical tubers (17 NF-κB-linked genes increased and 2 decreased; supplementary data, Fig. 1 ) and TSC2 (−) AML cells (34 NF-κB-linked genes increased and 4 decreased). As we saw a greater abundance of upregulated NF-κB linked genes, we hypothesized that the NF-κB pathway was activated in TSC. To follow on from this, we next assessed the activity of the NF-κB pathway within in vitro TSC cell line models. Altered pathway regulation of NF-κB and STAT3 in TSC2 -deficient cells STAT3 is a downstream target of NF-κB, and these two pathways are closely linked [ 11 ]. Prior research indicates that STAT3 signalling is enhanced in TSC2 -deficient cells [ 19 , 28 ]. We sought to characterise the activity of NF-κB and STAT3, including cytokine responsiveness, in TSC cell models. For this, we used TSC2 (−) or TSC2 (+) AML cells as well as Tsc2 (+/+) or Tsc2 (−/−) murine embryonic fibroblasts (MEFs). We observed increased phosphorylation of S536-RelA and Y705-STAT3 in both Tsc2 (−/−) MEF and TSC2 (−) AML cells, compared to their respective TSC2-expressing controls (Fig. 2a). As these phosphorylation sites are required for activity of RelA and STAT3, this data implies that both NF-κB and STAT3 become more transcriptionally active upon loss of TSC2 . To explore potential autocrine signalling crosstalk to STAT3, the wild-type control cells were stimulated with conditioned media that was taken from their respective untreated serum-starved TSC2 -deficient cell line (Fig. 2b), and STAT3/NF-κB pathway activation was assayed by western blot. Supplementation of conditioned media (obtained from TSC2 -deficient cells) caused acute STAT3 activation within both wild-type cell lines, suggesting that TSC2 -deficient cells secrete factors that potently induce the STAT3 pathway. This was confirmed by STAT3 transcriptional activation ELISA, wherein the wild type Tsc2 (+/+) MEF and TSC2 (+) AML cells were treated with their matched TSC2 -deficient cell conditioned media for 1 h, causing a large upregulation in STAT3 nuclear activation (Fig. 2c). Next, we tested whether TSC2 expression affected the transcriptional activity of STAT3 induced by cytokines, using 2 h TNFα (30 ng/mL) or 1 h IL-6 (50 ng/mL). While STAT3 activation after TNFα and IL-6 was similar in the TSC2 (−) and TSC2 (+) AML cells, Tsc2 (−/−) MEFs had higher sensitivity to IL-6 treatment, where a 4.9-fold STAT3 induction was observed (Fig. 2d). Conversely, Tsc2 (+/+) MEFs demonstrated a 3.5-fold increase in STAT3 activity following IL-6 stimulation. Within STAT3 transcription ELISAs, Tsc2 (−/−) MEFs appeared to have a less significant response to TNFα, when compared to Tsc2 (+/+) MEFs. Based on these data, we hypothesised that the TSC2 (−) AML cells release more cytokines, which in turn enhances inflammatory autocrine signalling. Using ELISA, we confirmed a > 19-fold increase in VEGF-A in conditioned media taken from TSC2 (−) AML cells (Fig. 2e. IL-6 secretion was not detected in TSC2 (+) AML cells but was significantly increased in TSC2 (−) AML cells. Figure 2. Complex NF-κB and STAT3 signalling interplay in TSC. ( a ) Confluent cells were serum-starved for 24 h and lysed. Western blot analysis of S536-phospho RelA and Y705-phospho STAT3 was carried out in Tsc2 (−/−) MEF (top panel) and TSC2 (−) AML cells (bottom panel), respectively. b-actin was used as a loading control (western blot panel shows n = 3, unpaired t test). ( b ) Serum-starved Tsc2 (+/+) MEF or TSC2 (+) AML cells were stimulated with conditioned media from serum-starved Tsc2 (−/−) MEF or TSC2 (−) AML cells, respectively, and western blot analysis of S536-phospho RelA, Y705-phospho STAT3, S235/236-phospho rpS6 and b-actin as a loading control was assayed at 0.5, 1 and 2 h of treatment duration. Densitometry analysis of Y705-phospho STAT3 is also shown ( n = 3, one-way ANOVA). ( c ) The control and 1 h treatment condition from (b) were subjected to STAT3 transcription assays ( n = 3, unpaired t test). ( d ) Serum-starved Tsc2 (−/−) and Tsc2 (+/+) MEFs, and TSC2 (−) and TSC2 (+) AML cells were stimulated with either 30 ng/mL TNFα for 2 h or 50 ng/mL IL-6 for 1 h, as indicated. STAT3 activity assays were carried out ( n = 3, unpaired t-tests). (e) The media concentration of IL-6 and VEGFA was compared between TSC2 (+) and TSC2 (−) AML cells by ELISA ( n = 3 , unpaired t-test). NF-κB inhibition reduces STAT3 activation Next, we examined whether NF-κB inhibition could diminish the heightened activity of STAT3 in TSC2 -deficient cells. To do this, Tsc2 (−/−) MEFs and Tsc2 (+/+) MEFs were treated with 5 µM BMS345541 (an IKK complex allosteric inhibitor), and the transcriptional activity of STAT3 was measured. In Tsc2 (−/−) MEFs, STAT3 activity was reduced after 24 h of BMS345541 treatment, but not in the Tsc2 (+/+) MEFs (Fig. 3 a). As a control, we used C188-9, a STAT3 inhibitor, in both the Tsc2 (−/−) and Tsc2 (+/+) MEFs. C188-9 reduced STAT3 activity in both Tsc2 (+/+) and Tsc2 (−/−) MEFs. C188-9 and BMS345541 both reduced STAT3 activity to a similar level, demonstrating that heightened NF-κB activity in Tsc2 (−/−) MEFs may be responsible for the observed upregulation in STAT3. NF-κB inhibition with BMS345541 also blocked TNFα induced activation of STAT3 in Tsc2 (+/+) MEFs (Fig. 3 b), showing that NF-κB is required for cytokine-induced STAT3 induction. Since we previously demonstrated that TSC2 -deficient cells secrete high levels of IL-6, it is likely that STAT3 activity and IL-6 secretion are linked. Furthermore, IL-6 was recently shown to be over-expressed in TSC2-disease models, and inhibition with IL-6 antibody antagonists was shown to reduce tumour growth [ 29 ]. Therefore, we next aimed to investigate whether NF-κB inhibition could regulate IL-6 secretion. TSC2 (−) AML cells were treated with 10 µM BMS345541 or 50 nM rapamycin for 24 h, and IL-6 levels were measured by ELISA. BMS345541 reduced IL-6 secretion by approximately 4-fold, whereas rapamycin increased IL-6 secretion by approximately 3-fold (Fig. 3 c). Next, we investigated how NF-κB inhibition may reduce STAT3 phosphorylation on Tyr705 over a 48 h period of treatment, when compared to either rapamycin or a combination of both drugs. Rapamycin was used to determine the effects of mTORC1 inhibition on NF-κB and STAT3 activity. We also aimed to observe if the impact of NF-κB inhibition on STAT3 activity was mTORC1-dependent. Surprisingly, we identified a biphasic response to NF-κB inhibition in TSC2 (−) AML cells, with an initial increase in Y705-STAT3 phosphorylation that then dropped at the 24 and 48 h time points (0.8-fold and 0.6-fold, respectively) (Fig. 3 c). Rapamycin showed little effect on RelA or STAT3 phosphorylation but did ablate rpS6 phosphorylation, as expected. Meanwhile, a combinatorial treatment of BMS345541 and rapamycin dampened the increase in STAT3 phosphorylation at 6 h (3.2-fold increase for BMS345541 versus 1.58-fold increase for combinatorial treatment). Combinatorial treatment of BMS345541 and rapamycin also reduced the total levels of STAT3 at later timepoints, whereas BMS345541 treatment did not elicit this effect. At the later time points of 24 and 48 h, combinatorial treatment of BMS345541 and rapamycin was more potent at reducing STAT3 phosphorylation (supplementary data, Fig. 2). NF-κB inhibition reduces anchorage-independent growth and cell migration in TSC2 -deficient cells To explore whether NF-κB inhibition might limit tumorigenesis, in vitro colony growth assays were carried out. Colonies of TSC2 (−) AML cells were grown over 3 weeks in soft agar with increasing doses of BMS345541. BMS345541 at 10 mM was the most effective drug concentration, reducing anchorage-independent growth nearly 3-fold (Fig. 4 a). Additionally, 10 µM BMS345541 treatment reduced the number of colonies by half, when compared to DMSO (989 versus 538 colonies). As TSC patient tumours regrow after discontinuation of mTORC1 inhibitors [ 10 ], rapamycin was also compared as a single drug treatment and in combination with BMS345541 (Fig. 4 b). Anchorage-independent growth was assessed after 3-weeks of drug treatment. Overall, reduced colony growth was observed in the presence of BMS345541, and a combinatory treatment of BMS345541 and rapamycin showed a more potent effect. To explore drug recovery, anchorage-independent growth was further evaluated after removal of the drug for a further 3 weeks. Importantly, combined treatment with BMS345541 and rapamycin markedly reduced anchorage-independent growth upon discontinuation of treatment, which was more effective than treatment with rapamycin alone. Anchorage-independent growth assays were also performed with both MEF and ELT3 TSC cell models that showed a similar trend of colony growth reduction with NF-κB inhibitor (supplementary data, Fig. 3 ). Lastly, we investigated the effects of NF-κB inhibition on the cell migration of TSC2 (−) AML cells. NF-κB is known to influence migration and metastasis in cancers [ 30 ], and migration is also a key feature of lymphangioleiomyomatosis (LAM) that can occur in TSC [ 31 ]. To do this, wound scratch assays were carried out in reduced-serum media containing BMS345541 over two days. We observed a reduction in migration within cells treated with BMS345541, whereas rapamycin was ineffective at reducing migration (Fig. 4 f). 2.5. The immune checkpoint protein PD-L2 is dysregulated in TSC via inflammatory signalling Inflammatory signalling from NF-κB can influence leukocyte recruitment and modulation, which is a disease facet that has been reported in TSC patient tumours [ 26 ]. Given these connections in TSC and immune signalling, we next compared the differential expression of immune checkpoint genes in both SEN/SEGA (Fig. 5 a) and TSC2 (−) AML cells (Fig. 5 b). This set of immune checkpoint regulators was adapted from a list on ACROBiosystems [ 33 ]. Of note, we observed heightened expression of PDCD1LG2 , which is a negative regulator of T-cells that can be expressed on stromal and/or tumour cells to repress immune recognition [ 34 ]. PD-L2 protein expression was markedly enhanced in TSC2 (−) AML cells when compared to the wild-type control (Fig. 5 c) and its expression was ablated when NF-κB was inhibited with 5 µM BMS345541 (Fig. 5 d). Inhibition of mTORC1 with rapamycin was unable to reduce the high protein expression of PD-L2 in these TSC-disease cells. Similarly, gene expression of PDCD1LG2 was reduced after treatment with 5 µM BMS345541, but not after inhibition of mTORC1 with rapamycin (Fig. 5 e). Discussions The NF-κB pathway plays a key role in the progression of many cancers and inflammatory conditions via the upregulation of pro-inflammatory genes. While inflammation is a known feature of TSC-linked tumours, the role that NF-κB plays in the disease pathology of TSC is poorly understood. This study aimed to elucidate the status of NF-κB in TSC, and thus identify the potential role that NF-κB signalling has in TSC pathogenesis. Through our findings, we show that NF-κB becomes dysregulated in TSC patient tumours and cell line models. Our data implies that mTORC1 inhibitor therapies are unlikely to restore inflammation in TSC, raising the possibility that NF-κB dysregulation could contribute to the failure of current mTORC1 inhibitors to completely ablate TSC symptoms [ 10 ]. This study highlights that dysregulated NF-κB and STAT3 signalling contributes to the observed inflammatory signature found within TSC cell line models and in TSC patient tumours. Such inflammatory signals are likely linked to TSC-associated symptoms. For instance, neuroinflammation is linked to a variety of neuropsychiatric conditions, including TSC-associated neuropsychiatric disorders (TANDs) and neurodegenerative disorders. Neuroinflammation has also been characterised in schizophrenia and depression [ 35 , 36 ]. A review by Matta et al . highlights the prevalence of neuroinflammation within autism spectrum disorder [ 37 ], while a review by Aronica and Crino categorises the dominant role of neuroinflammation in epilepsy [ 38 ]. As hyperactivation of STAT3 is a known driver of epilepsy [ 39 , 40 ], STAT3 (and NF-κB) might be connected to the neurological symptoms associated with TSC. Cortical tubers are a suspected focal point of epilepsy in TSC. Inflammation through NF-κB activity may contribute to epileptogenic signalling. This is supported by enhanced NF-κB dysregulation in cortical tubers (supplementary data, Fig. 1 ). NF-κB and STAT3 are closely linked with multiple mechanisms of signalling cross talk (reviewed in [ 11 ]). The complex signalling interplay between NF-κB and STAT3 is evident and may partially explain the observed variation in the state of NF-κB activity in related TSC research studies [ 18 ]. Many cytokines are NF-κB responsive and these include IL-6 [ 41 ]. Consequently, NF-κB can indirectly activate STAT3 via a positive feedback loop, where IL-6 secretion will induce STAT3 activation via interleukin receptors. Signalling crosstalk between the NF-κB and STAT3 was apparent in cell line models of TSC, which is a feature shared in cancer [ 42 ], including glioma [ 43 ]. Potentially, inhibition of one component in this feedback loop may be sufficient to dampen down this inflammatory signal. Arguably, mTORC1 activation has been shown to contribute to NF-κB signalling, so standard therapy with mTORC1 inhibitors in TSC should have some capacity to dampen down the inappropriate activity of NF-κB [ 44 ]. In our cell line models, we showed that secreted cytokines such as IL-6 likely contribute to STAT3 activation in TSC. NF-κB inhibition could reduce STAT3 activity in TSC2 -deficient cells, and this was likely through inhibition of IL-6 signalling. Rapamycin was ineffective at reducing IL-6 secretion and STAT3 activity in TSC2 -deficient cell lines. Following on from this, combinatorial treatment of mTORC1 inhibition and NF-κB inhibition was sufficient to reduce STAT3/NF-κB and mTORC1 signalling. However, it is important to note that in the cell line studies presenting here, treatment with mTORC1 inhibitors were only carried out over short time periods (up to 3 days). It is possible that longer duration of mTORC1 inhibition would be required to reduce chronic inflammation in TSC-associated tumours and/or neuroinflammation. Supporting this line of thought, Everolimus (a rapalogue) shows greater efficacy in TSC patients to reduce seizures after longer durations of treatment, i.e., up to 3 years of treatment [ 9 ]. Rapamycin is a cytostatic drug that has potency to stabilise disease in TSC. Through anchorage-independent growth assays we demonstrate the cytostatic drug property of rapamycin. While rapamycin causes marked reduction in growth, cell colonies quickly recover and grow after the end of rapamycin treatment. While single drug inhibition of NF-κB showed little long-term effectiveness to repress anchorage-independent growth of TSC2 (−) AML cells, we observed marked reduction of colony size with combined treatment with NF-κB/mTOR inhibitors, which persisted after removal of both drugs. Lastly, we aimed to identify dysregulated targets which were insensitive to mTORC1 inhibition. A high degree of immune cell infiltration likely contributes to the disease pathology of TSC, however TSC-derived tumours appear to avoid being attacked by the immune system. This is likely due to upregulated immune checkpoint regulators that can be presented on stromal and/or tumour cells, such as PD-L2. Other studies have identified that STAT3 signalling can upregulate PD-L2 [ 45 , 46 ]. In this study, we identified that STAT3 activity was linked to NF-κB activity in TSC2 -deficient cells. Our findings indicate that PD-L2 could be downregulated with NF-κB inhibition in TSC2 -deficient cells that could be due to inhibition of STAT3. Our data show that combinatorial inhibition of NF-κB and mTORC1 is effective for inhibiting both mTORC1 sensitive and insensitive targets. Further investigation is necessary to identify whether other immune checkpoint regulators may also be regulated through dysregulated inflammatory signalling in TSC. This work implies that combination therapy to target both NF-κB and mTORC1 might have longer lasting benefits to treat tumours in TSC. Conclusions NF-κB signaling is dysregulated and likely contributes to inflammation/immune signalling in TSC. Facets of this dysregulated inflammatory/immune signalling are not directly regulated by mTORC1 but may be restored via NF-κB pathway inhibitors. Therefore, the NF-κB signalling pathway presents itself as a possible therapeutic target for the treatment of TSC, and combinatory approaches with traditional mTORC1 inhibitors may prove more effective as an adjunct therapy. Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and materials Raw data for RNAsequencing of TSC patient tumours was previously deposited in the Database of Genotypes and Phenotypes (dbGaP) under the accession code phs001357.v1.p1 [26]. All datasets generated or analyzed during this study are either included in this article or supplementary files. The data analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no competing interests. While this study is funded in part by Health and Care Research Wales, the views expressed are those of the authors and not necessarily those of Health and Care Research Wales or the Welsh Government. Funding This project was funded by Cancer Research Wales (ref:2504 to DKM, AJH, DMD and ART). King Fahd Security College/Ministry of Interior/Saudi Arabia (ref:1050795978 to MAMA and ART). The TS Association funded JC and ART (2018-S04). Funding from Health and Care Research Wales (Wales Gene Park) supported ART. JPM and KRM have research support from the National Cancer Institute (R21CA263133). Author’s contributions Conceptualisation and study design: DKM and ART designed the project. ART, MDM, and AJH supervised the project. Data acquisition: DKM generated samples and data for western blots, anchorage-independent growth assays, wound scratch assays, and ELISAs. Brain tumour samples were collected and processed by JPM and KRM, and bioinformatic analysis was performed by JPM and KRM. Further gene ontology and data analysis was performed by DKM. RNA-sequencing data was generated by BLC and MAMA. Data interpretation: DKM and ART Manuscript draft: DKM and ART. Manuscript revision and approval of manuscript: all authors. Acknowledgements We acknowledge our colleagues at Wales Gene Park for their expertise and bioinformatic support. Wales Gene Park is an infrastructure support group funded by Welsh Government by Health and Care Research Wales. References McEneaney LJ, Tee AR. Finding a cure for tuberous sclerosis complex: From genetics through to targeted drug therapies. Advances in Genetics. Academic Press Inc.; 2019. pp. 91–118. 10.1016/bs.adgen.2018.11.003 . Rentz AM, Skalicky AM, Liu Z, Dunn DW, Frost MD, Nakagawa JA, et al. Burden of renal angiomyolipomas associated with tuberous sclerosis complex: results of a patient and caregiver survey. J Patient Rep Outcomes. 2018;2. 10.1186/s41687-018-0055-4 . Chan DL, Calder T, Lawson JA, Mowat D, Kennedy SE. The natural history of subependymal giant cell astrocytomas in tuberous sclerosis complex: A review. Rev Neurosci. 2018;29:295–301. 10.1515/revneuro-2017-0027 . Mühlebner A, Van Scheppingen J, Hulshof HM, Scholl T, Iyer AM, Anink JJ, et al. Novel Histopathological Patterns in Cortical Tubers of Epilepsy Surgery Patients with Tuberous Sclerosis Complex. PLoS ONE. 2016;11. 10.1371/journal.pone.0157396 . Moavero R, Napolitano A, Cusmai R, Vigevano F, Figà-Talamanca L, Calbi G, et al. White matter disruption is associated with persistent seizures in tuberous sclerosis complex. Epilepsy Behav. 2016;60:63–7. 10.1016/j.yebeh.2016.04.026 . Miszewska D, Sugalska M, Jóźwiak S. Risk Factors Associated with Refractory Epilepsy in Patients with Tuberous Sclerosis Complex: A Systematic Review. J Clin Med. 2021;10. 10.3390/jcm10235495 . Henske EP, Józwiak S, Kingswood JC, Sampson JR, Thiele EA. Tuberous sclerosis complex. Nat Rev Dis Primers. 2016;2. 10.1038/nrdp.2016.35 . Tee AR, Manning BD, Roux PP, Cantley LC, Blenis J. Tuberous sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toward Rheb. Curr Biol. 2003;13:1259–68. 10.1016/s0960-9822(03)00506-2 . Wiegand G, May TW, Lehmann I, Stephani U, Kadish NE. Long-term treatment with everolimus in TSC-associated therapy-resistant epilepsies. Seizure. 2021;93:111–9. 10.1016/j.seizure.2021.10.011 . Bissler JJ, McCormack FX, Young LR, Elwing JM, Chuck G, Leonard JM, et al. Sirolimus for Angiomyolipoma in Tuberous Sclerosis Complex or Lymphangioleiomyomatosis. N Engl J Med. 2008;358:140. 10.1056/nejmoa063564 . Fan Y, Mao R, Yang J. NF-κB and STAT3 signaling pathways collaboratively link inflammation to cancer. Protein Cell. 2013;4:176. 10.1007/s13238-013-2084-3 . Xia L, Tan S, Zhou Y, Lin J, Wang H, Oyang L, et al. Role of the NFκB-signaling pathway in cancer. Onco Targets Ther. 2018;11:2063. 10.2147/ott.S161109 . Tolomeo M, Cascio A. The Multifaced Role of STAT3 in Cancer and Its Implication for Anticancer Therapy. Int J Mol Sci. 2021;22:1–25. 10.3390/ijms22020603 . Hillmer EJ, Zhang H, Li HS, Watowich SS. STAT3 signaling in immunity. Vol. 31, Cytokine and Growth Factor Reviews. Elsevier Ltd; 2016. pp. 1–15. 10.1016/j.cytogfr.2016.05.001 . Yang J, Kunimoto H, Katayama B, Zhao H, Shiromizu T, Wang L, et al. Phospho-Ser727 triggers a multistep inactivation of STAT3 by rapid dissociation of pY705–SH2 through C-terminal tail modulation. Int Immunol. 2020;32:73–88. 10.1093/intimm/dxz061 . Wen Z, Zhong Z, Darnell JE. Maximal activation of transcription by stat1 and stat3 requires both tyrosine and serine phosphorylation. Cell. 1995;82:241–50. 10.1016/0092-8674(95)90311-9 . Champion JD, Dodd KM, Lam HC, Alzahrani MAM, Seifan S, Rad E, et al. Drug Inhibition of Redox Factor-1 Restores Hypoxia-Driven Changes in Tuberous Sclerosis Complex 2 Deficient Cells. Cancers. 2022;14:6195. 10.3390/cancers14246195 . Gao Y, Gartenhaus RB, Lapidus RG, Hussain A, Zhang Y, Wang X, et al. Differential IKK/NF-κB Activity Is Mediated by TSC2 through mTORC1 in PTEN-Null prostate cancer and tuberous sclerosis complex tumor cells. Mol Cancer Res. 2015;13:1602–14. 10.1158/1541-7786.mrc-15-0213 . Weichhart T, Costantino G, Poglitsch M, Rosner M, Zeyda M, Stuhlmeier KM, et al. The TSC-mTOR Signaling Pathway Regulates the Innate Inflammatory Response. Immunity. 2008;29:565–77. 10.1016/j.immuni.2008.08.012 . Yu J, Astrinidis A, Howard S, Henske EP. Estradiol and tamoxifen stimulate LAM-associated angiomyolipoma cell growth and activate both genomic and nongenomic signaling pathways. Am J Physiol Lung Cell Mol Physiol. 2004;286:694–700. 10.1152/ajplung.00204.2003 . Hong F, Larrea MD, Doughty C, Kwiatkowski DJ, Squillace R, Slingerland JM. mTOR-raptor binds and activates SGK1 to regulate p27 phosphorylation. Mol Cell. 2008;30:701–11. 10.1016/j.molcel.2008.04.027 . Zhang H, Cicchetti G, Onda H, Koon HB, Asrican K, Bajraszewski N, et al. Loss of Tsc1/Tsc2 activates mTOR and disrupts PI3K-Akt signaling through downregulation of PDGFR. J Clin Invest. 2003;112:1223–33. 10.1172/jci17222 . Astrinidis A, Cash TP, Hunter DS, Walker CL, Chernoff J, Henske EP. Tuberin, the tuberous sclerosis complex 2 tumor suppressor gene product, regulates Rho activation, cell adhesion and migration. Oncogene. 2002;21:8470–6. 10.1038/sj.onc.1205962 . Johnson CE, Dunlop EA, Seifan S, McCann HD, Hay T, Parfitt GJ, et al. Loss of tuberous sclerosis complex 2 sensitizes tumors to nelfinavir – bortezomib therapy to intensify endoplasmic reticulum stress-induced cell death. Oncogene. 2018;37:5913–25. 10.1038/s41388-018-0381-2 . Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:1–21. 10.1186/s13059-014-0550-8 . Martin KR, Zhou W, Bowman MJ, Shih J, Au KS, Dittenhafer-Reed KE, et al. The genomic landscape of tuberous sclerosis complex. Nat Commun. 2017;8:15816. 10.1038/ncomms15816 . Gilmore T. NF-kB Target Genes » NF-kB Transcription Factors. Boston University. https://www.bu.edu/nf-kb/gene-resources/target-genes/ Accessed 22 Nov 2022. Goncharova EA, Goncharov DA, Damera G, Tliba O, Amrani Y, Panettieri RA, et al. Signal Transducer and Activator of Transcription 3 Is Required for Abnormal Proliferation and Survival of TSC2-Deficient Cells: Relevance to Pulmonary Lymphangioleiomyomatosis. Mol Pharmacol. 2009;76:766. 10.1124/mol.109.057042 . Wang J, Filippakis H, Hougard T, Du H, Ye C, Liu HJ, et al. Interleukin-6 mediates PSAT1 expression and serine metabolism in TSC2-deficient cells. Proc Natl Acad Sci U S A. 2021;118:e2101268118. 10.1073/pnas.2101268118 . Wu Y, Zhou BP. TNF-alpha/NF-kappaB/Snail pathway in cancer cell migration and invasion. Br J Cancer. 2010;102:639–44. 10.1038/sj.bjc.6605530 . 33, O’mahony AM, Lynn E, Murphy DJ, Fabre A, McCarthy C. Lymphangioleiomyomatosis: a clinical review. Breathe. 2020;16:1–11. 10.1183/20734735.0007-2020 . Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9:671–5. 10.1038/nmeth.2089 . Immune Checkpoint Proteins - ACROBiosystems. https://www.acrobiosystems.com/A974-Immune-Checkpoint-Proteins.html?gad_source=1&gclid=EAIaIQobChMIoZry6OrBhgMVM5FQBh29qw5nEAAYASAAEgLPzPD_BwE Accessed 04 Jun 2024. Solinas C, Aiello M, Rozali E, Lambertini M, Willard-Gallo K, Migliori E. Programmed cell death-ligand 2: A neglected but important target in the immune response to cancer? Transl Oncol. 2020;13:100811. 10.1016/j.tranon.2020.100811 . Trépanier MO, Hopperton KE, Mizrahi R, Mechawar N, Bazinet RP. Postmortem evidence of cerebral inflammation in schizophrenia: a systematic review. Mol Psychiatry. 2016;21:1009–26. 10.1038/mp.2016.90 . Felger JC, Li Z, Haroon E, Woolwine BJ, Jung MY, Hu X, et al. Inflammation is associated with decreased functional connectivity within corticostriatal reward circuitry in depression. Mol Psychiatry. 2016;21:1358–65. 10.1038/mp.2015.168 . Matta SM, Hill-Yardin EL, Crack PJ. The influence of neuroinflammation in Autism Spectrum Disorder. Brain Behav Immun. 2019;79:75–90. 10.1016/j.bbi.2019.04.037 . Aronica E, Crino PB. Inflammation in epilepsy: clinical observations. Epilepsia. 2011;52(Suppl 3):26–32. 10.1111/j.1528-1167.2011.03033.x . Xu Z, Xue T, Zhang Z, Wang X, Xu P, Zhang J, et al. Role of signal transducer and activator of transcription-3 in up-regulation of GFAP after epilepsy. Neurochem Res. 2011;36:2208–15. 10.1007/s11064-011-0576-1 . Jiang Q, Tang G, Zhong XM, Ding DR, Wang H, Li JN. Role of Stat3 in NLRP3/caspase-1-mediated hippocampal neuronal pyroptosis in epileptic mice. Synapse. 2021;75:e22221. 10.1002/syn.22221 . Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017;2:17023. 10.1038/sigtrans.2017.23 . Grivennikov SI, Karin M. Dangerous liaisons: STAT3 and NF-kappaB collaboration and crosstalk in cancer. Cytokine Growth Factor Rev. 2010;21:11–9. 10.1016/j.cytogfr.2009.11.005 . Atkinson GP, Nozell SE, Benveniste ET. NF-kappaB and STAT3 signaling in glioma: targets for future therapies. Expert Rev Neurother. 2010;10:575–86. 10.1586/ern.10.21 . Dan HC, Cooper MJ, Cogswell PC, Duncan JA, Ting JP, Baldwin AS. Akt-dependent regulation of NF-{kappa}B is controlled by mTOR and Raptor in association with IKK. Genes Dev. 2008;22:1490–500. 10.1101/gad.1662308 . Horlad H, Ma C, Yano H, Pan C, Ohnishi K, Fujiwara Y, et al. An IL-27/Stat3 axis induces expression of programmed cell death 1 ligands (PD-L1/2) on infiltrating macrophages in lymphoma. Cancer Sci. 2016;107:1696–704. 10.1111/cas.13065 . Shibahara D, Tanaka K, Iwama E, Kubo N, Ota K, Azuma K, et al. Intrinsic and Extrinsic Regulation of PD-L2 Expression in Oncogene-Driven Non-Small Cell Lung Cancer. J Thorac Oncol. 2018;13:926–37. 10.1016/j.jtho.2018.03.012 . Additional Declarations No competing interests reported. Supplementary Files FINALTSCposvsTSCnegSubmissionJI.xlsx GeneAnalyticsSENSEGATop300LogFCDESKTOP6HJ15HA.xlsx GeneAnalyticsTUBSTop150LogFC.xlsx NFkBandImmunecheckpointregulatorlist.xlsx SupplementaryFiguresFinal.pptx alluncroppedblots.pptx Cite Share Download PDF Status: Published Journal Publication published 26 Sep, 2025 Read the published version in Journal of Inflammation → Version 1 posted Editorial decision: Revision requested 18 Dec, 2024 Reviewers invited by journal 21 Oct, 2024 Editor assigned by journal 12 Jun, 2024 Submission checks completed at journal 12 Jun, 2024 First submitted to journal 12 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4569999\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":318789523,\"identity\":\"808f726d-9b84-408a-b2e0-3ae7cf776724\",\"order_by\":0,\"name\":\"Darius K. McPhail\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cardiff University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Darius\",\"middleName\":\"K.\",\"lastName\":\"McPhail\",\"suffix\":\"\"},{\"id\":318789524,\"identity\":\"f20588a0-9cb7-425d-be81-9c70ec912eb7\",\"order_by\":1,\"name\":\"Mohammad A.M. Alzahrani\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cardiff University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohammad\",\"middleName\":\"A.M.\",\"lastName\":\"Alzahrani\",\"suffix\":\"\"},{\"id\":318789525,\"identity\":\"ca284be9-422e-4633-a031-0e367534e4c4\",\"order_by\":2,\"name\":\"Katie R. Martin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Michigan State University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Katie\",\"middleName\":\"R.\",\"lastName\":\"Martin\",\"suffix\":\"\"},{\"id\":318789526,\"identity\":\"aa7c6b1f-4967-4321-afe9-60910df5774b\",\"order_by\":3,\"name\":\"Brian L. Calver\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cardiff University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Brian\",\"middleName\":\"L.\",\"lastName\":\"Calver\",\"suffix\":\"\"},{\"id\":318789527,\"identity\":\"2625a6e9-53e9-4183-99c2-b6892f0a5c74\",\"order_by\":4,\"name\":\"Adrian J. Harwood\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cardiff University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Adrian\",\"middleName\":\"J.\",\"lastName\":\"Harwood\",\"suffix\":\"\"},{\"id\":318789528,\"identity\":\"284695fb-6ee9-48e9-8c74-69a688191bfd\",\"order_by\":5,\"name\":\"Jeffrey P. MacKeigan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Michigan State University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jeffrey\",\"middleName\":\"P.\",\"lastName\":\"MacKeigan\",\"suffix\":\"\"},{\"id\":318789529,\"identity\":\"e05714ea-bf4b-43eb-849b-74d0a65f11bb\",\"order_by\":6,\"name\":\"David M. Davies\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"South West Wales Cancer Centre, Singleton Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"David\",\"middleName\":\"M.\",\"lastName\":\"Davies\",\"suffix\":\"\"},{\"id\":318789530,\"identity\":\"c1334ddd-358a-4c0a-831c-a99c9d4ce19e\",\"order_by\":7,\"name\":\"Andrew R. Tee\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYLCCDyDiMOMDMM3AQ0A1SJ5xBlgLs+EMorUwgxUdIFaLPXvzwc82NXb5fMeZGRsYauwYDM4cIGALz7Fk6ZxjyZYzD4O0HEtmMDjbQECLRI6BdG4Ds4HBYf7jDxjYDjAYnCfkF/n3n39bNtQDtYBs+UeMFgkeNmnGhsMQLYxtB4hw2Jk0M8ueY8cNJEFaEvuSeSQJeZ+9/fDjGz9qqg34zh9mbPjwzU6O70wCAZehgATCsTIKRsEoGAWjgBgAALJ8P3+I95ycAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Cardiff University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Andrew\",\"middleName\":\"R.\",\"lastName\":\"Tee\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-06-12 11:50:12\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4569999/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4569999/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12950-025-00464-8\",\"type\":\"published\",\"date\":\"2025-09-26T15:57:25+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":60344491,\"identity\":\"d3377f52-c981-4742-8a93-6566e15a0b09\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:43\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":149883,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNF-κB regulatory and target genes are differentially expressed in TSC. Volcano plots show differential expression of NF-κB-linked genes from (\\u003cstrong\\u003ea\\u003c/strong\\u003e) TSC patient-derived brain tumours (\\u003cem\\u003en\\u003c/em\\u003e = 15), and (\\u003cstrong\\u003eb\\u003c/strong\\u003e) cultured \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML lacking functional TSC2 (\\u003cem\\u003en\\u003c/em\\u003e = 6), when compared to non-TSC brain tissue and \\u003cem\\u003eTSC2\\u003c/em\\u003e-rescued \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells, respectively. The 15 most significantly dysregulated genes are labelled. Horizontal dashed lines represent adjusted p-value = 0.05; vertical dashed lines represent a Log\\u003csub\\u003e2\\u003c/sub\\u003e fold change of ±2. Sample collection, analysis, and statistics for the dataset used in volcano plots were performed by Martin \\u003cem\\u003eet al\\u003c/em\\u003e. [26].\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure111.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/81857ca40e133a3ac60ef44d.png\"},{\"id\":60344446,\"identity\":\"3bf7dc3b-1c2c-4bf1-9850-e83c4e398c2f\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:38\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":300346,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComplex\\u003cstrong\\u003e \\u003c/strong\\u003eNF-κB and STAT3 signalling interplay in TSC. (\\u003cstrong\\u003ea\\u003c/strong\\u003e) Confluent cells were serum-starved for 24 h and lysed. Western blot analysis of S536-phospho RelA and Y705-phospho STAT3 was carried out in \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−)MEF (top panel) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (bottom panel), respectively. b-actin was used as a loading control (western blot panel shows \\u003cem\\u003en \\u003c/em\\u003e= 3, unpaired t test). (\\u003cstrong\\u003eb\\u003c/strong\\u003e) Serum-starved \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEF or \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells were stimulated with conditioned media from serum-starved\\u003cem\\u003e Tsc2\\u003c/em\\u003e(−/−) MEF or \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells, respectively, and western blot analysis of S536-phospho RelA, Y705-phospho STAT3, S235/236-phospho rpS6 and b-actin as a loading control was assayed at 0.5, 1 and 2 h of treatment duration. Densitometry analysis of Y705-phospho STAT3 is also shown (\\u003cem\\u003en = \\u003c/em\\u003e3, one-way ANOVA). (\\u003cstrong\\u003ec\\u003c/strong\\u003e) The control and 1 h treatment condition from (b) were subjected to STAT3 transcription assays (\\u003cem\\u003en \\u003c/em\\u003e= 3, unpaired t test). (\\u003cstrong\\u003ed\\u003c/strong\\u003e) Serum-starved \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) and \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs, and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−)and \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells were stimulated with either 30 ng/mL TNFα for 2 h or 50 ng/mL IL-6 for 1 h, as indicated. STAT3 activity assays were carried out (\\u003cem\\u003en \\u003c/em\\u003e= 3, unpaired t-tests). (e) The media concentration of IL-6 and VEGFA was compared between \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells by ELISA\\u003cem\\u003e \\u003c/em\\u003e(\\u003cem\\u003en \\u003c/em\\u003e=\\u003cem\\u003e 3\\u003c/em\\u003e, unpaired t-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure26.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/745b719c0a52a684434bf12e.png\"},{\"id\":60344493,\"identity\":\"b37bdb1b-31b8-4f9f-901a-fb40f7bde99c\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:43\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":298807,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAutocrine signalling crosstalk between NF-κB and STAT3 in TSC cell models. STAT3 activity assays were carried out from nuclear lysates prepared from \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) and (+/+) MEFs treated with either (\\u003cstrong\\u003ea\\u003c/strong\\u003e) DMSO control, 5 μM BMS345541 or 15 μM C188-9 for 24 h or (\\u003cstrong\\u003eb\\u003c/strong\\u003e) TNFα (30 ng/mL, 2 h treatment) after pre-treatment with 5 μM BMS345541 for 24 h, as indicated (\\u003cem\\u003en\\u003c/em\\u003e =\\u003cem\\u003e 3\\u003c/em\\u003e, two-way ANOVA with Tukey’s multiple comparisons). (\\u003cstrong\\u003ec\\u003c/strong\\u003e) \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells were treated with either DMSO control, 10 μM BMS345541, or 50 nM rapamycin for 24 h. Conditioned media from these cells were subjected to IL-6 ELISAs (\\u003cem\\u003en = 3,\\u003c/em\\u003e one-way ANOVA with Tukey’s multiple comparisons). (\\u003cstrong\\u003ed\\u003c/strong\\u003e) Phosphorylation status of RelA, STAT3, and rpS6 were investigated following a time-course (0, 1, 2, 4, 6, 24, and 48 h) with either 5 μM BMS345541 or 50 nM rapamycin, as single or combination treatments (\\u003cem\\u003en\\u003c/em\\u003e=\\u003cem\\u003e 3\\u003c/em\\u003e).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure33.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/36748e35649be9b113d74088.png\"},{\"id\":60344495,\"identity\":\"7dce417e-4e13-4601-8fdb-6e983ec1b38f\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:44\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":461361,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNF-κB inhibition reduces anchorage-independent growth and migration in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells. (\\u003cstrong\\u003ea\\u003c/strong\\u003e) \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells were grown over 3 weeks in soft agar, supplemented with increasing concentrations of BMS345541 (0, 2.5, 5, and 10 μM), where indicated. 30 phase contrast images were taken per condition and diameter of all visible colonies were determined in ImageJ. (v.53) [32]. (Kruskal-Wallis test with Dunn’s multiple comparison tests.) (\\u003cstrong\\u003eb\\u003c/strong\\u003e) Same as for panel ‘a’ with the inclusion of 50 nM rapamycin as a single or combinatory treatment with BMS345541. Colony diameter was recorded before media was replaced with untreated media for a further 3 weeks in the absence of drug. (\\u003cstrong\\u003ec\\u003c/strong\\u003e) Wound scratch assays were carried out on \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells in the presence of DMSO vehicle only control, rapamycin (50 nM) and BMS345541 (5 μM). The ‘wound’ was imaged after 48 h and wound closure (%) was calculated using ImageJ. (v.53). Representative images are shown, 500 μm scale bar (two-way ANOVA with Tukey’s multiple comparison tests, \\u003cem\\u003en\\u003c/em\\u003e = 3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure42.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/7d9cb994a8346116daa30a2a.png\"},{\"id\":60344490,\"identity\":\"856418d4-6f32-4227-b23a-c732ac2a5b91\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:43\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":253855,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eImmune checkpoint genes are dysregulated in TSC. Volcano plots show differential expression of immune checkpoint genes from (\\u003cstrong\\u003ea\\u003c/strong\\u003e) TSC patient-derived brain tumours (\\u003cem\\u003en\\u003c/em\\u003e = 15), and (\\u003cstrong\\u003eb\\u003c/strong\\u003e) cultured \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML lacking functional TSC2 (\\u003cem\\u003en\\u003c/em\\u003e = 6), when compared to non-TSC brain tissue and \\u003cem\\u003eTSC2\\u003c/em\\u003e-rescued \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells, respectively. All significantly dysregulated genes are labelled. Horizontal dashed lines represent adjusted p-value = 0.05; vertical dashed lines represent a Log\\u003csub\\u003e2\\u003c/sub\\u003e fold change of ±2. Sample collection, analysis, and statistics for the dataset used in volcano plots were performed by Martin \\u003cem\\u003eet al\\u003c/em\\u003e. [26]. (\\u003cstrong\\u003ec\\u003c/strong\\u003e) PD-L2 expression was compared between \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells (western blot panel shows \\u003cem\\u003en \\u003c/em\\u003e= 3, unpaired t test). \\u0026nbsp;(\\u003cstrong\\u003ed\\u003c/strong\\u003e) Serum-starved \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells were treated with either vehicle only DMSO, BMS345541 (5 mM), rapamycin (50 nM), or a combination of both drugs for 24 h and proteins phosphorylation and expression was assessed. Densitometry analysis was performed with normalisation to β-actin (\\u003cem\\u003en \\u003c/em\\u003e= 3, one-way ANOVA with Dunn’s multiple comparison tests). (\\u003cstrong\\u003ee\\u003c/strong\\u003e) Serum-starved \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells were treated with either vehicle only DMSO, BMS345541 (5 mM), rapamycin (50 nM), or a combination of both drugs for 24 h, and \\u003cem\\u003ePDCD1LG2 \\u003c/em\\u003eexpression was analysed by RT-qPCR. Expression was normalised to \\u003cem\\u003eIPO8 \\u003c/em\\u003eand \\u003cem\\u003eTUBA1A\\u003c/em\\u003e (\\u003cem\\u003en \\u003c/em\\u003e= 3, one-way ANOVA with Dunn’s multiple comparisons).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure52.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/1fab5a3b8355942417e65486.png\"},{\"id\":92430602,\"identity\":\"219cfbaf-4e85-459d-b628-d48a39cc2b09\",\"added_by\":\"auto\",\"created_at\":\"2025-09-29 16:06:34\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2618206,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/191c17c4-ba0c-4916-a482-bfd49db3465c.pdf\"},{\"id\":60344445,\"identity\":\"6cd26bc0-5ce2-4c1e-9399-78429825d48f\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:37\",\"extension\":\"xlsx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10492542,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FINALTSCposvsTSCnegSubmissionJI.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/7e50906fcbc7c43592644c4d.xlsx\"},{\"id\":60344452,\"identity\":\"07ddaf7e-0944-4369-b923-8bbf74645169\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:41\",\"extension\":\"xlsx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":450040,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"GeneAnalyticsSENSEGATop300LogFCDESKTOP6HJ15HA.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/e166c19bb40fd886007e2135.xlsx\"},{\"id\":60344456,\"identity\":\"bd24951a-f981-40d7-ad8f-03225f0e8d4b\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:42\",\"extension\":\"xlsx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":301949,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"GeneAnalyticsTUBSTop150LogFC.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/77d2a7cfa292466b2abfc0a4.xlsx\"},{\"id\":60344494,\"identity\":\"906d0910-b07b-4cb5-b337-003dce6b423d\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:44\",\"extension\":\"xlsx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":14539,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"NFkBandImmunecheckpointregulatorlist.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/e8f575c820dea0c2cc0a2ab6.xlsx\"},{\"id\":60344449,\"identity\":\"7d99200d-47f1-4ef5-9945-41cf61cc57c5\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:22:40\",\"extension\":\"pptx\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":453535,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryFiguresFinal.pptx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/ce39d88521805c7b9fa0d6e5.pptx\"},{\"id\":60344909,\"identity\":\"37595134-6cf8-4c8e-bf37-3bb5add4c429\",\"added_by\":\"auto\",\"created_at\":\"2024-07-15 19:30:43\",\"extension\":\"pptx\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":13923435,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"alluncroppedblots.pptx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4569999/v1/750d3a5b64a70984d131d35a.pptx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Loss of Tuberous Sclerosis Complex 2 confers inflammation via dysregulation of Nuclear factor kappa-light-chain-enhancer of activated B cells\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eTuberous Sclerosis Complex (TSC) is a rare, autosomal dominant genetic condition caused by inactivating mutations in either the \\u003cem\\u003eTSC1\\u003c/em\\u003e or \\u003cem\\u003eTSC2\\u003c/em\\u003e genes. TSC patients are predisposed to kidney, skin, brain, and heart tumours (reviewed in [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]). Renal angiomyolipomas (AML) are highly vascularised benign tumours containing both smooth muscle and adipose tissue occurring in ~\\u0026thinsp;80% of adult TSC patients and are the primary cause of mortality past the age of 30 [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. TSC-associated brain lesions include subependymal nodules (SEN) and subependymal giant cell astrocytomas (SEGA) that can result in hydrocephalus [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Additionally, TSC patients often present with cortical tubers, which are believed to be the epileptic foci in the majority of TSC cases [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. White matter abnormalities are also common in TSC patients (up to 95%) and likely contribute to the onset, frequency, and severity of seizures [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Approximately 90% of TSC patients will experience a seizure within their lifetime. Seizures can be refractive to standard anti-epileptic medications, making seizures difficult to treat in approximately one-third of TSC patients [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Furthermore, 50% of TSC patients will have some degree of intellectual disability [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eCurrently, one key feature of TSC1/TSC2 biology is well understood: the ability of the TSC1/2 tumour suppressor complex to inhibit growth signalling through mechanistic target of rapamycin complex 1 (mTORC1). The small G protein Rheb, which directly activates mTORC1 kinase activity when GTP-bound, is negatively regulated by the GTPase activating protein (GAP) domain of TSC2 [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Consequently, inactivating mutations within either TSC1 or TSC2 favours GTP-loading of Rheb and aberrant protein kinase activity of mTORC1, leading to uncontrolled cell growth. mTORC1 inhibitors are now used worldwide to treat TSC patients to stabilise disease. Long-term treatments with mTORC1 inhibitors (\\u0026gt;\\u0026thinsp;3 years) in TSC patients was found to markedly improve seizures that were refractory to conventional antiepileptic drugs [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Tumour volumes are also reduced by mTORC1 inhibitors, with both angiomyolipomas and SEGAs being reduced by \\u0026gt;\\u0026thinsp;60%. While mTORC1 inhibitors alleviate many disease traits of TSC, they do not restore disease to normal (reviewed in 10]). For instance, tumours do not regress completely and grow back when therapy stops. A greater understanding of how the loss of either \\u003cem\\u003eTSC1\\u003c/em\\u003e or \\u003cem\\u003eTSC2\\u003c/em\\u003e can drive disease is required before more curative therapies can be developed for TSC.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we examined differentially expressed genes in TSC patient tumours that highlighted gene sets involved in oxidative stress and inflammation. Oxidative stress is known to activate redox-sensitive transcription factors, such as nuclear factor kappa B (NF-κB). NF-κB is involved in the survival, growth, and migration of cancer cells (reviewed in [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]) and is stimulated by a variety of growth factors or cytokines (reviewed in [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]). Briefly, NF-κB subunits, RelA (p65) and RelB are expressed ubiquitously and reside in their inactive forms in the cytoplasm. The RelA and RelB subunits possess transcriptional activation domains. To activate NF-κB, NF-κB inhibitor alpha (commonly referred to as IκBα) is phosphorylated and inactivated by the IκB kinase (IKK) complex. This causes dissociation, ubiquitination, and subsequent degradation of IκBα. IKK also phosphorylates RelA at S536, promoting the transcriptional activity of NF-κB via the association of homo or heterodimers of NF-κB subunits, most commonly RelA/NF-κB1. These activator inputs unmask the nuclear localisation signals within NF-κB subunits, leading to their nuclear translocation and transcription of pro-inflammatory NF-κB genes.\\u003c/p\\u003e \\u003cp\\u003eSTAT3 is a pro-inflammatory transcription factor that promotes oncogenesis by enhancing tumour survival, motility, and cell proliferation [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Phosphorylation of Y705 is the most well-known mechanism of STAT3 activation, and typically occurs downstream of cytokine stimulation. For example, IL-6 stimulation results in phosphorylation of Y705-STAT3. This leads to STAT3 dimerisation and subsequent translocation to the nucleus, where STAT3 homodimers promote pro-inflammatory gene activation [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. STAT3 possesses a phosphorylation site on S727, although the functional role of this is poorly understood. S727 phosphorylation is believed to negatively regulate Y705 STAT3 phosphorylation, thus reducing STAT3 inflammatory activity [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. However, other studies report that S727 phosphorylation is required (alongside Y705 phosphorylation) for maximal STAT3 activation (and tumorigenic signalling) [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eWhile mTOR inhibitors demonstrate significant clinical applicability, their effect is often limited and mTOR inhibitors are relatively ineffective at reducing various disease-associated signalling pathways, such as NF-κB, STAT3, and HIF-1α [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. For this reason, investigation into inflammatory pathways may offer an alternative treatment option for TSC.\\u003c/p\\u003e \\u003cp\\u003eCurrent evidence of NF-κB in TSC is limited and suggests varied dysregulation. One study reported a context-dependent role of TSC2 in NF-κB activity [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Small interfering RNA knockdown of TSC2 was found to increase the activity of NF-κB, however this effect was only observed in cells with non-functional PTEN. It was believed that this occurred downstream of mTORC1. Conversely, the same study reported that when PTEN was restored, \\u003cem\\u003eTSC2\\u003c/em\\u003e knockdown resulted in a decrease in NF-κB activation. This highlights the context-dependent role of TSC2 in the regulation of NF-κB. Another study revealed that mTORC1 inhibition impacted NF-κB activation within \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient immune cells [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Notably, in the \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells, the transactivation domain of RelA was inactivated by mTORC1-dependent phosphorylation resulting in reduced NF-κB activity. Inhibition of mTORC1 reversed the reduction of NF-κB activity and resulted in hyperactivation of NF-κB. Given the possible complex role of dysfunctional NF-κB activity in the pathophysiology of TSC, herein we sought to further elucidate NF-κB in the context of TSC.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture and drug treatments\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003e621\\u0026thinsp;\\u0026minus;\\u0026thinsp;101 \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient (\\u003cem\\u003eTSC2\\u003c/em\\u003e\\u0026minus;) cells were derived from the renal AML of a TSC patient and possess a homozygous missense mutation in \\u003cem\\u003eTSC2\\u003c/em\\u003e (G1832A), resulting in an R611Q amino acid substitution [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Wild-type human \\u003cem\\u003eTSC2\\u003c/em\\u003e was re-expressed to generate 621\\u0026thinsp;\\u0026minus;\\u0026thinsp;103 (\\u003cem\\u003eTSC2\\u003c/em\\u003e+) AML cells [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. \\u003cem\\u003eTsc2\\u003c/em\\u003e(\\u0026minus;/\\u0026minus;) and \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) mouse embryonic fibroblasts (MEF) are immortalised with \\u003cem\\u003eTp53\\u003c/em\\u003e(\\u0026minus;/\\u0026minus;), which was originally derived from early-stage embryos from an interbreeding study [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Eker rat leiomyoma-derived \\u003cem\\u003eTsc2\\u003c/em\\u003e-deficient cells (ELT3-V3) and matched controls re-expressing \\u003cem\\u003eTsc2\\u003c/em\\u003e (ELT3-T3) were generated by Astrinidis \\u003cem\\u003eet al\\u003c/em\\u003e. [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. and was gifted by C. Walker (M.D. Anderson Cancer Center, Houston, USA). Cell lines were maintained at 37\\u0026deg;C, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e in a humidified incubator. When indicated, cells were incubated under hypoxic conditions and 1% O\\u003csub\\u003e2\\u003c/sub\\u003e was achieved with N\\u003csub\\u003e2\\u003c/sub\\u003e displacement. Cells were cultured in DMEM (Gibco\\u0026trade;, Thermo Fisher Scientific, Oxford, UK) on Techno Plastic Products\\u0026trade; coated tissue culture plasticware (Helena Biosciences Europe, Gateshead, UK), supplemented with fetal bovine serum (FBS) at either 10% (\\u003cem\\u003ev\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) or 15% (\\u003cem\\u003ev\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) for MEF and ELT3 cells or AML cells, respectively, with 50 IU/mL penicillin and streptomycin. 100 \\u0026micro;M rapamycin and 20 mM C188-9 (Merck Life Science UK Ltd, Gillingham, UK) and 20 mM BMS-345541 (Selleck Chemicals GmBh, Munich, Germany) drug stocks were made up in dimethylsulfoxide (DMSO) and stored as single use aliquots at -80 \\u003csup\\u003eo\\u003c/sup\\u003eC. Drugs were added to the culture media at a consistent % (\\u003cem\\u003ev\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) DMSO per condition, without exceeding 0.5% (\\u003cem\\u003ev\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) DMSO. Tumour necrosis factor α (TNFα) and interleukin 6 (IL-6) (purchased from Abcam, Cambridge, UK) were resuspended in ddH\\u003csub\\u003e2\\u003c/sub\\u003eO containing 0.2% (\\u003cem\\u003ew\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) bovin serum albumin (BSA) to 100 \\u0026micro;g/mL and 50 \\u0026micro;g/mL, respectively (stored as single use aliquots at -80 \\u003csup\\u003eo\\u003c/sup\\u003eC). Cell passage was kept\\u0026thinsp;\\u0026lt;\\u0026thinsp;30 in AMLs and ELT3, and \\u0026lt;\\u0026thinsp;45 in MEFs. Mycoplasma-free frozen cell stocks were used; all cells were routinely checked with Venor GeM advance mycoplasma detection kit (Minerva Biolabs, Berlin, Germany) as per manufacturers guidelines and were negative to the presence of mycoplasma spp.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blotting\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eCells were seeded on 60 mm plates and grown to 70\\u0026ndash;80% confluency prior to treatments. To generate nuclear cell lysates, cells were washed in ice-cold phosphate buffer saline (PBS) before direct lysis in sample buffer (62.5 mM Tris-HCl (pH 7.6), 10% (\\u003cem\\u003ev\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) glycerol, 2% (\\u003cem\\u003ew\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) SDS, 50 mM fresh dithiothreitol. Samples were sonicated before boiling for 10 min at 95\\u0026deg;C. Samples were centrifuged at 17,000 \\u0026times; g for 10 min. Protein concentration was determined at OD\\u003csub\\u003e660\\u003c/sub\\u003e using Pierce\\u0026trade; reagent supplemented with ionic detergent compatibility reagent (Thermo Fisher Scientific, Oxford, UK). Protein was separated by denaturing polyacrylamide gel electrophoresis using gradient Invitrogen NuPage\\u0026trade; protein gels (ThermoFisher Scientific, Oxford, UK). Resolved proteins were transferred to Immobilon\\u0026reg;-P polyvinylidene difluoride membranes (Merck Life Science, Dorset, UK). Western blotting was carried out as directed by the antibody manufacturer\\u0026rsquo;s protocols; primary antibodies (Cell Signaling Technology Danvers, USA) and horse radish peroxidase-conjugated secondary antibodies (Merck Life Science, Dorset, UK). Protein bands were detected by enhanced chemiluminescence using Cytiva Amersham\\u0026trade; ECL select\\u0026trade; western blotting detection reagent (Cytiva, Buckinghamshire, UK).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSoft agar colony formation assay\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eBD DIFCO\\u0026trade; Noble Agar (BD BioSciences, Wokingham, Berkshire, UK) was melted in PBS to 1.2% (\\u003cem\\u003ew\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e), then diluted in DMEM to yield 0.6% (\\u003cem\\u003ew\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) agar. 2 mL of this solution was added to 6-well plates and was left at room temperature to solidify. In each well, 0.3% (\\u003cem\\u003ew\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) agar DMEM solution containing 20,000 cells was overlaid on top of the 0.6% (\\u003cem\\u003ew\\u003c/em\\u003e/\\u003cem\\u003ev\\u003c/em\\u003e) agar bottom layer. After setting, media containing the relevant drugs was added and cell colonies were grown between 2\\u0026ndash;4 weeks, with the media changed every 72 h to refresh drugs. Images were taken on an EVOS XL Core camera and analysed in ImageJ. (v.53) to determine colony diameters. After drug treatment duration, the media was changed and replaced every 72 h in the absence of drugs for a further 3 weeks and further images were taken.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA-sequencing\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eCells were washed in ice cold PBS and lysed in RNAprotect\\u0026reg; Cell Reagent (Qiagen, West Sussex, UK). RNA was extracted using QIAshredder\\u0026reg; and RNAeasy\\u0026reg; Mini kits (Qiagen, West Sussex, UK) and were stored at -80\\u0026deg;C. RNA library preparation and sequencing were performed through a commercial service/collaboration with Wales Gene Park (Cardiff University, UK), as described previously [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e], except the Illumina\\u0026reg; TruSeq\\u0026reg; RNA sample preparation v2 kit (Illumina Inc, Great Abington, Cambridgeshire, UK) was used for library preparation, according to the manufacturer\\u0026rsquo;s instructions. Following validation, the libraries were normalised to 8 nM and the pool was sequenced on the MiSeq with a 150 cycle, version 3, cartridge (both Illumina Inc) according to the manufacturer\\u0026rsquo;s instructions. Differentially expressed transcripts were identified using the DeSeq2 package in R [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Analysis was carried out on all pairwise comparisons in the dataset. P-values were corrected for multiple testing using the Benjamini-Hochberg false discovery rate (FDR) method. Bioinformatic work was initially carried out by Wales Gene Park.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePatient-derived TSC transcriptomic analysis and gene ontology analysis\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eSamples of TSC patient-derived tumours (\\u003cem\\u003en\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;15) were collected by Prof. J. MacKeigan (Michigan State University, Grand Rapids, MI, USA). Gene expression analysis was performed as described [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Differentially expressed gene (DEG) analysis was performed with GeneAnalytics (LifeMap Sciences Inc., Covina, CA, USA). A similar analysis was performed with TSC patient-derived cortical tubers (\\u003cem\\u003en\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;15). Gene ontology analysis was used to identify dysregulated inflammatory and immune system processes in TSC patient-derived tumours. Datasets were imported into Microsoft Excel to generate volcano plots.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTranscriptional activation ELISAs\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eCells were seeded on 6 cm plates and grown over two days until they reached 80\\u0026ndash;90% confluency. Media was replaced with serum-depleted media, including pathway inhibitors or DMSO, where applicable, for 24 h. When assaying cytokine induction, media was supplemented with TNFα or IL-6 for the final 2 or 1 h of treatment, respectively. When assaying the effect of media conditioned by \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells on wild-type cells, \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient MEFs or AML cells were grown until 80% confluency before the media was replaced with serum-free media. Cells remained under starved conditions for 24 h before the conditioned media was collected, briefly centrifuged, and then added to wild type cells to stimulate them. For transcription assays, cells lysates were prepared and were assayed using TransAM\\u0026reg; STAT3 Transcription Factor ELISA Kit (Active Motif, Waterloo, Belgium) with nuclear preparations following the manufacturer instructions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eConditioned media ELISAs\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eSecreted IL-6 and VEGF-A concentrations in the media were measured using R\\u0026amp;D Systems Duoset ELISAs and ancillary reagent kits (Bio-Techne Ltd., Abingdon, UK) as per the manufacturer instructions. Cells were grown in 12-well plates to 90% confluency. Serum-supplemented media was replaced with serum-supplemented media containing drug treatments. Post-treatment, media was collected, centrifuged (1 min at 13,000 rpm), and stored on ice. Samples were diluted 1:10 and loaded onto plates precoated with capture antibody. Absorbance was measured at OD\\u003csub\\u003e450\\u003c/sub\\u003e using a BioTek Cytation 3 plate reader, with wavelength correction applied at OD\\u003csub\\u003e540\\u003c/sub\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWound scratch cell migration assays\\u003c/h2\\u003e \\u003cp\\u003eCells were seeded at a high confluency in 12-well plates (350,000 cells/well) and grown to full confluency overnight. Next, cells were scratched in a straight vertical line using a 200 \\u0026micro;L pipette tip to form a wound within the confluent cell layer. Media was next aspirated before being replaced with serum starved media (2% (v/v) FBS) including the drug to be assayed or vehicle (DMSO). \\u0026ldquo;Wounds\\u0026rdquo; were immediately imaged via stereomicroscopy at 4x, and a pen marking was made for later reference of the area to be observed. At 24 and 48 h, wounds were imaged again to visualise closure of the wound over time. The area of wound scratches was calculated in ImageJ and closure was recorded as a percentage.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantitative reverse transcription PCR (qRT-PCR) analysis\\u003c/h2\\u003e \\u003cp\\u003e \\u003cem\\u003eTSC2\\u003c/em\\u003e(\\u0026minus;) or \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells were grown to 70% confluency. Media was replaced with serum- depleted media for 24 h prior to cell collection in RNAprotect (Qiagen, West Sussex, UK) and then stored at \\u0026minus;\\u0026thinsp;80\\u0026deg;C. RNA was isolated using the RNeasy Plus Mini Kit (Qiagen, West Sussex, UK) and cDNA was generated with the Reverse Transcriptase Core Kit (Eurogentec, Belgium). qRT-PCR was performed using TakyonTM ROX Sybr MasterMix dTTP blue (Eurogentec, Belgium). Ct values were normalised to IPO8 and TUBA1A. Primers were purchased from Integrated DNA Technologies and optimised for annealing temperature and efficiency. PDCD1LG2 forward primer GAACCCAGGACCCATCCAAC and reverse primer TTCAGATAGCACTGTTCACTTCCC and 183 bp amplicon length; IPO8 forward primer ACTGTTGCACATTGTTAGAG and reverse primer ACTTTGCCAAATATCTCAGC and 138 bp amplicon length; TUBA1A forward primer TCTTCCACCCTGAGCAACTT and reverse primer GGAAAACCAAGAAGCCCTGG and 159 bp amplicon length. Dissociation curves were carried out to verify specificity of primer sets.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eProtein band intensities were quantified using ImageJ. (v.53). Band intensity was normalised to β-actin expression. Fold changes were normalised to the DMSO control, where applicable. Normalised data were inputted into GraphPad Prism9 (Dotmatics, Boston MA USA) and statistical analysis was carried out. Normality testing in Prism9 was carried out with a D\\u0026rsquo;agostino \\u0026amp; Pearson and Shapiro-Wilk test. Normally (Gaussian) distributed data was then analysed by an ordinary one-way ANOVA with Tukey\\u0026rsquo;s multiple comparisons or two-way ANOVA with Š\\u0026iacute;d\\u0026aacute;k's multiple comparisons. When analysing 2 groups only, a parametric unpaired t-test was carried out. Data are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. Non-normally distributed data were assessed by the Kruskal-Wallis test, with Dunn\\u0026rsquo;s multiple comparisons tests. If the comparison was between only two groups, nonparametric Wilcoxon t-tests were instead carried out. p-values: * \\u0026lt; 0.05, ** \\u0026lt; 0.01, *** \\u0026lt; 0.001, **** (or #)\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001, or not significant \\u0026lsquo;NS\\u0026rsquo;.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eTSC2\\u003c/b\\u003e \\u003cb\\u003eloss is characterised by dysregulated expression of NF-κB genes\\u003c/b\\u003e\\u003c/p\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eTo explore dysregulated gene expression in TSC, mRNA sequencing (RNAseq) data from 20 TSC patient SEN/SEGAs was compared to non-TSC brain tissue (as previously described [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]), and also RNAseq from \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (621 − 101) was compared to \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells (621 − 103). Gene ontology analysis of differentially expressed genes indicated enrichment of inflammatory and immune response genes within TSC patient-derived tumours (supplementary data), as previously described [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. To better understand these dysregulated inflammatory pathways in TSC, we analyzed expression of 190 regulatory and NF-κB target genes. This NF-κB-linked gene set was adapted from a list developed by the Gilmore lab (Boston University) [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Volcano plots of differentially expressed genes illustrate dysregulation of NF-κB-linked genes in TSC patient-derived brain tumours (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea), and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb) when compared with their respective wild-type controls.\\u003c/p\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eThe observed transcriptional signature suggests a redox imbalance that could create a tumour microenvironment of oxidative stress and inflammation. Within both \\u003cem\\u003ein vivo\\u003c/em\\u003e and \\u003cem\\u003ein vitro\\u003c/em\\u003e datasets, NF-κB-related genes were significantly dysregulated. Within SEN/SEGAs, a total of 47 significantly upregulated NF-κB regulatory and target genes was observed (over Log2 fold change of 2 and adjusted p-value \\u0026lt; 0.05), compared to 19 significantly downregulated genes (below Log2 fold change − 2 and adjusted p-value \\u0026lt; 0.05). This pattern of NF-κB dysregulation persisted within cortical tubers (17 NF-κB-linked genes increased and 2 decreased; supplementary data, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (34 NF-κB-linked genes increased and 4 decreased). As we saw a greater abundance of upregulated NF-κB linked genes, we hypothesized that the NF-κB pathway was activated in TSC. To follow on from this, we next assessed the activity of the NF-κB pathway within \\u003cem\\u003ein vitro\\u003c/em\\u003e TSC cell line models.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cp\\u003e \\u003cb\\u003eAltered pathway regulation of NF-κB and STAT3 in\\u003c/b\\u003e \\u003cb\\u003eTSC2\\u003c/b\\u003e\\u003cb\\u003e-deficient cells\\u003c/b\\u003e\\u003c/p\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eSTAT3 is a downstream target of NF-κB, and these two pathways are closely linked [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Prior research indicates that STAT3 signalling is enhanced in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. We sought to characterise the activity of NF-κB and STAT3, including cytokine responsiveness, in TSC cell models. For this, we used \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) or \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells as well as \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) or \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) murine embryonic fibroblasts (MEFs). We observed increased phosphorylation of S536-RelA and Y705-STAT3 in both \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEF and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells, compared to their respective TSC2-expressing controls (Fig.\\u0026nbsp;2a). As these phosphorylation sites are required for activity of RelA and STAT3, this data implies that both NF-κB and STAT3 become more transcriptionally active upon loss of \\u003cem\\u003eTSC2\\u003c/em\\u003e. To explore potential autocrine signalling crosstalk to STAT3, the wild-type control cells were stimulated with conditioned media that was taken from their respective untreated serum-starved \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cell line (Fig.\\u0026nbsp;2b), and STAT3/NF-κB pathway activation was assayed by western blot. Supplementation of conditioned media (obtained from \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells) caused acute STAT3 activation within both wild-type cell lines, suggesting that \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells secrete factors that potently induce the STAT3 pathway. This was confirmed by STAT3 transcriptional activation ELISA, wherein the wild type \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEF and \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells were treated with their matched \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cell conditioned media for 1 h, causing a large upregulation in STAT3 nuclear activation (Fig.\\u0026nbsp;2c). Next, we tested whether TSC2 expression affected the transcriptional activity of STAT3 induced by cytokines, using 2 h TNFα (30 ng/mL) or 1 h IL-6 (50 ng/mL). While STAT3 activation after TNFα and IL-6 was similar in the \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells, \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEFs had higher sensitivity to IL-6 treatment, where a 4.9-fold STAT3 induction was observed (Fig.\\u0026nbsp;2d). Conversely, \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs demonstrated a 3.5-fold increase in STAT3 activity following IL-6 stimulation. Within STAT3 transcription ELISAs, \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEFs appeared to have a less significant response to TNFα, when compared to \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs. Based on these data, we hypothesised that the \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells release more cytokines, which in turn enhances inflammatory autocrine signalling. Using ELISA, we confirmed a \\u0026gt; 19-fold increase in VEGF-A in conditioned media taken from \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (Fig.\\u0026nbsp;2e. IL-6 secretion was not detected in \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells but was significantly increased in \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells.\\u003c/p\\u003e\\u003cp\\u003e \\u003cb\\u003eFigure 2.\\u003c/b\\u003e Complex NF-κB and STAT3 signalling interplay in TSC. (\\u003cb\\u003ea\\u003c/b\\u003e) Confluent cells were serum-starved for 24 h and lysed. Western blot analysis of S536-phospho RelA and Y705-phospho STAT3 was carried out in \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEF (top panel) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (bottom panel), respectively. b-actin was used as a loading control (western blot panel shows \\u003cem\\u003en\\u003c/em\\u003e = 3, unpaired t test). (\\u003cb\\u003eb\\u003c/b\\u003e) Serum-starved \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEF or \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells were stimulated with conditioned media from serum-starved \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEF or \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells, respectively, and western blot analysis of S536-phospho RelA, Y705-phospho STAT3, S235/236-phospho rpS6 and b-actin as a loading control was assayed at 0.5, 1 and 2 h of treatment duration. Densitometry analysis of Y705-phospho STAT3 is also shown (\\u003cem\\u003en =\\u003c/em\\u003e 3, one-way ANOVA). (\\u003cb\\u003ec\\u003c/b\\u003e) The control and 1 h treatment condition from (b) were subjected to STAT3 transcription assays (\\u003cem\\u003en\\u003c/em\\u003e = 3, unpaired t test). (\\u003cb\\u003ed\\u003c/b\\u003e) Serum-starved \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) and \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs, and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) AML cells were stimulated with either 30 ng/mL TNFα for 2 h or 50 ng/mL IL-6 for 1 h, as indicated. STAT3 activity assays were carried out (\\u003cem\\u003en\\u003c/em\\u003e = 3, unpaired t-tests). (e) The media concentration of IL-6 and VEGFA was compared between \\u003cem\\u003eTSC2\\u003c/em\\u003e(+) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells by ELISA (\\u003cem\\u003en\\u003c/em\\u003e = \\u003cem\\u003e3\\u003c/em\\u003e, unpaired t-test).\\u003c/p\\u003e\\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNF-κB inhibition reduces STAT3 activation\\u003c/h2\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eNext, we examined whether NF-κB inhibition could diminish the heightened activity of STAT3 in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells. To do this, \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEFs and \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs were treated with 5 µM BMS345541 (an IKK complex allosteric inhibitor), and the transcriptional activity of STAT3 was measured. In \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEFs, STAT3 activity was reduced after 24 h of BMS345541 treatment, but not in the \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). As a control, we used C188-9, a STAT3 inhibitor, in both the \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) and \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs. C188-9 reduced STAT3 activity in both \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) and \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEFs. C188-9 and BMS345541 both reduced STAT3 activity to a similar level, demonstrating that heightened NF-κB activity in \\u003cem\\u003eTsc2\\u003c/em\\u003e(−/−) MEFs may be responsible for the observed upregulation in STAT3. NF-κB inhibition with BMS345541 also blocked TNFα induced activation of STAT3 in \\u003cem\\u003eTsc2\\u003c/em\\u003e(+/+) MEFs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb), showing that NF-κB is required for cytokine-induced STAT3 induction. Since we previously demonstrated that \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells secrete high levels of IL-6, it is likely that STAT3 activity and IL-6 secretion are linked. Furthermore, IL-6 was recently shown to be over-expressed in TSC2-disease models, and inhibition with IL-6 antibody antagonists was shown to reduce tumour growth [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Therefore, we next aimed to investigate whether NF-κB inhibition could regulate IL-6 secretion. \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells were treated with 10 µM BMS345541 or 50 nM rapamycin for 24 h, and IL-6 levels were measured by ELISA. BMS345541 reduced IL-6 secretion by approximately 4-fold, whereas rapamycin increased IL-6 secretion by approximately 3-fold (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec). Next, we investigated how NF-κB inhibition may reduce STAT3 phosphorylation on Tyr705 over a 48 h period of treatment, when compared to either rapamycin or a combination of both drugs. Rapamycin was used to determine the effects of mTORC1 inhibition on NF-κB and STAT3 activity. We also aimed to observe if the impact of NF-κB inhibition on STAT3 activity was mTORC1-dependent. Surprisingly, we identified a biphasic response to NF-κB inhibition in \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells, with an initial increase in Y705-STAT3 phosphorylation that then dropped at the 24 and 48 h time points (0.8-fold and 0.6-fold, respectively) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec). Rapamycin showed little effect on RelA or STAT3 phosphorylation but did ablate rpS6 phosphorylation, as expected. Meanwhile, a combinatorial treatment of BMS345541 and rapamycin dampened the increase in STAT3 phosphorylation at 6 h (3.2-fold increase for BMS345541 versus 1.58-fold increase for combinatorial treatment). Combinatorial treatment of BMS345541 and rapamycin also reduced the total levels of STAT3 at later timepoints, whereas BMS345541 treatment did not elicit this effect. At the later time points of 24 and 48 h, combinatorial treatment of BMS345541 and rapamycin was more potent at reducing STAT3 phosphorylation (supplementary data, Fig.\\u0026nbsp;2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cp\\u003e \\u003cb\\u003eNF-κB inhibition reduces anchorage-independent growth and cell migration in\\u003c/b\\u003e \\u003cb\\u003eTSC2\\u003c/b\\u003e\\u003cb\\u003e-deficient cells\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo explore whether NF-κB inhibition might limit tumorigenesis, \\u003cem\\u003ein vitro\\u003c/em\\u003e colony growth assays were carried out. Colonies of \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells were grown over 3 weeks in soft agar with increasing doses of BMS345541. BMS345541 at 10 mM was the most effective drug concentration, reducing anchorage-independent growth nearly 3-fold (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea). Additionally, 10 µM BMS345541 treatment reduced the number of colonies by half, when compared to DMSO (989 versus 538 colonies). As TSC patient tumours regrow after discontinuation of mTORC1 inhibitors [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e], rapamycin was also compared as a single drug treatment and in combination with BMS345541 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb). Anchorage-independent growth was assessed after 3-weeks of drug treatment. Overall, reduced colony growth was observed in the presence of BMS345541, and a combinatory treatment of BMS345541 and rapamycin showed a more potent effect. To explore drug recovery, anchorage-independent growth was further evaluated after removal of the drug for a further 3 weeks. Importantly, combined treatment with BMS345541 and rapamycin markedly reduced anchorage-independent growth upon discontinuation of treatment, which was more effective than treatment with rapamycin alone. Anchorage-independent growth assays were also performed with both MEF and ELT3 TSC cell models that showed a similar trend of colony growth reduction with NF-κB inhibitor (supplementary data, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eLastly, we investigated the effects of NF-κB inhibition on the cell migration of \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells. NF-κB is known to influence migration and metastasis in cancers [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e], and migration is also a key feature of lymphangioleiomyomatosis (LAM) that can occur in TSC [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. To do this, wound scratch assays were carried out in reduced-serum media containing BMS345541 over two days. We observed a reduction in migration within cells treated with BMS345541, whereas rapamycin was ineffective at reducing migration (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ef).\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. The immune checkpoint protein PD-L2 is dysregulated in TSC via inflammatory signalling\\u003c/h2\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eInflammatory signalling from NF-κB can influence leukocyte recruitment and modulation, which is a disease facet that has been reported in TSC patient tumours [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Given these connections in TSC and immune signalling, we next compared the differential expression of immune checkpoint genes in both SEN/SEGA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea) and \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb). This set of immune checkpoint regulators was adapted from a list on ACROBiosystems [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Of note, we observed heightened expression of \\u003cem\\u003ePDCD1LG2\\u003c/em\\u003e, which is a negative regulator of T-cells that can be expressed on stromal and/or tumour cells to repress immune recognition [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. PD-L2 protein expression was markedly enhanced in \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells when compared to the wild-type control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec) and its expression was ablated when NF-κB was inhibited with 5 µM BMS345541 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ed). Inhibition of mTORC1 with rapamycin was unable to reduce the high protein expression of PD-L2 in these TSC-disease cells. Similarly, gene expression of \\u003cem\\u003ePDCD1LG2\\u003c/em\\u003e was reduced after treatment with 5 µM BMS345541, but not after inhibition of mTORC1 with rapamycin (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ee).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussions\",\"content\":\"\\u003cp\\u003eThe NF-κB pathway plays a key role in the progression of many cancers and inflammatory conditions via the upregulation of pro-inflammatory genes. While inflammation is a known feature of TSC-linked tumours, the role that NF-κB plays in the disease pathology of TSC is poorly understood. This study aimed to elucidate the status of NF-κB in TSC, and thus identify the potential role that NF-κB signalling has in TSC pathogenesis. Through our findings, we show that NF-κB becomes dysregulated in TSC patient tumours and cell line models. Our data implies that mTORC1 inhibitor therapies are unlikely to restore inflammation in TSC, raising the possibility that NF-κB dysregulation could contribute to the failure of current mTORC1 inhibitors to completely ablate TSC symptoms [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eThis study highlights that dysregulated NF-κB and STAT3 signalling contributes to the observed inflammatory signature found within TSC cell line models and in TSC patient tumours. Such inflammatory signals are likely linked to TSC-associated symptoms. For instance, neuroinflammation is linked to a variety of neuropsychiatric conditions, including TSC-associated neuropsychiatric disorders (TANDs) and neurodegenerative disorders. Neuroinflammation has also been characterised in schizophrenia and depression [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. A review by Matta \\u003cem\\u003eet al\\u003c/em\\u003e. highlights the prevalence of neuroinflammation within autism spectrum disorder [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e], while a review by Aronica and Crino categorises the dominant role of neuroinflammation in epilepsy [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. As hyperactivation of STAT3 is a known driver of epilepsy [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e], STAT3 (and NF-κB) might be connected to the neurological symptoms associated with TSC. Cortical tubers are a suspected focal point of epilepsy in TSC. Inflammation through NF-κB activity may contribute to epileptogenic signalling. This is supported by enhanced NF-κB dysregulation in cortical tubers (supplementary data, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eNF-κB and STAT3 are closely linked with multiple mechanisms of signalling cross talk (reviewed in [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]). The complex signalling interplay between NF-κB and STAT3 is evident and may partially explain the observed variation in the state of NF-κB activity in related TSC research studies [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Many cytokines are NF-κB responsive and these include IL-6 [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Consequently, NF-κB can indirectly activate STAT3 via a positive feedback loop, where IL-6 secretion will induce STAT3 activation via interleukin receptors. Signalling crosstalk between the NF-κB and STAT3 was apparent in cell line models of TSC, which is a feature shared in cancer [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e], including glioma [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Potentially, inhibition of one component in this feedback loop may be sufficient to dampen down this inflammatory signal. Arguably, mTORC1 activation has been shown to contribute to NF-κB signalling, so standard therapy with mTORC1 inhibitors in TSC should have some capacity to dampen down the inappropriate activity of NF-κB [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. In our cell line models, we showed that secreted cytokines such as IL-6 likely contribute to STAT3 activation in TSC. NF-κB inhibition could reduce STAT3 activity in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells, and this was likely through inhibition of IL-6 signalling. Rapamycin was ineffective at reducing IL-6 secretion and STAT3 activity in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cell lines. Following on from this, combinatorial treatment of mTORC1 inhibition and NF-κB inhibition was sufficient to reduce STAT3/NF-κB and mTORC1 signalling. However, it is important to note that in the cell line studies presenting here, treatment with mTORC1 inhibitors were only carried out over short time periods (up to 3 days). It is possible that longer duration of mTORC1 inhibition would be required to reduce chronic inflammation in TSC-associated tumours and/or neuroinflammation. Supporting this line of thought, Everolimus (a rapalogue) shows greater efficacy in TSC patients to reduce seizures after longer durations of treatment, i.e., up to 3 years of treatment [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eRapamycin is a cytostatic drug that has potency to stabilise disease in TSC. Through anchorage-independent growth assays we demonstrate the cytostatic drug property of rapamycin. While rapamycin causes marked reduction in growth, cell colonies quickly recover and grow after the end of rapamycin treatment. While single drug inhibition of NF-κB showed little long-term effectiveness to repress anchorage-independent growth of \\u003cem\\u003eTSC2\\u003c/em\\u003e(−) AML cells, we observed marked reduction of colony size with combined treatment with NF-κB/mTOR inhibitors, which persisted after removal of both drugs.\\u003c/p\\u003e\\u003cp\\u003eLastly, we aimed to identify dysregulated targets which were insensitive to mTORC1 inhibition. A high degree of immune cell infiltration likely contributes to the disease pathology of TSC, however TSC-derived tumours appear to avoid being attacked by the immune system. This is likely due to upregulated immune checkpoint regulators that can be presented on stromal and/or tumour cells, such as PD-L2. Other studies have identified that STAT3 signalling can upregulate PD-L2 [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]. In this study, we identified that STAT3 activity was linked to NF-κB activity in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells. Our findings indicate that PD-L2 could be downregulated with NF-κB inhibition in \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells that could be due to inhibition of STAT3. Our data show that combinatorial inhibition of NF-κB and mTORC1 is effective for inhibiting both mTORC1 sensitive and insensitive targets. Further investigation is necessary to identify whether other immune checkpoint regulators may also be regulated through dysregulated inflammatory signalling in TSC. This work implies that combination therapy to target both NF-κB and mTORC1 might have longer lasting benefits to treat tumours in TSC.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eNF-κB signaling is dysregulated and likely contributes to inflammation/immune signalling in TSC. Facets of this dysregulated inflammatory/immune signalling are not directly regulated by mTORC1 but may be restored via NF-κB pathway inhibitors. Therefore, the NF-κB signalling pathway presents itself as a possible therapeutic target for the treatment of TSC, and combinatory approaches with traditional mTORC1 inhibitors may prove more effective as an adjunct therapy.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRaw data for RNAsequencing of TSC patient tumours was previously deposited in the Database of Genotypes and Phenotypes (dbGaP) under the accession code phs001357.v1.p1 [26]. All datasets generated or analyzed during this study are either included in this article or supplementary files. The data analyzed during the current study are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests. While this study is funded in part by Health and Care Research Wales, the views expressed are those of the authors and not necessarily those of Health and Care Research Wales or the Welsh Government.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis project was funded by Cancer Research Wales (ref:2504 to\\u0026nbsp;DKM, AJH, DMD and ART).\\u0026nbsp;King Fahd Security College/Ministry of Interior/Saudi Arabia (ref:1050795978 to MAMA and ART).\\u0026nbsp;The TS Association funded JC and ART (2018-S04). Funding from Health and Care Research Wales (Wales Gene Park) supported ART. JPM and KRM have research support from the National Cancer Institute (R21CA263133).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor\\u0026rsquo;s contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualisation and study design: DKM and ART designed the project. ART, MDM, and AJH supervised the project. Data acquisition: DKM generated samples and data for western blots, anchorage-independent growth assays, wound scratch assays, and ELISAs. Brain tumour samples were collected and processed by JPM and KRM, and bioinformatic analysis was performed by JPM and KRM. Further gene ontology and data analysis was performed by DKM. RNA-sequencing data was generated by BLC and MAMA. Data interpretation: DKM and ART Manuscript draft: DKM and ART. Manuscript revision and approval of manuscript: all authors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe acknowledge our colleagues at Wales Gene Park for their expertise and bioinformatic support. Wales Gene Park is an infrastructure support group funded by Welsh Government by Health and Care Research Wales.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eMcEneaney LJ, Tee AR. Finding a cure for tuberous sclerosis complex: From genetics through to targeted drug therapies. Advances in Genetics. Academic Press Inc.; 2019. pp. 91\\u0026ndash;118. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/bs.adgen.2018.11.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/bs.adgen.2018.11.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRentz AM, Skalicky AM, Liu Z, Dunn DW, Frost MD, Nakagawa JA, et al. Burden of renal angiomyolipomas associated with tuberous sclerosis complex: results of a patient and caregiver survey. J Patient Rep Outcomes. 2018;2. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s41687-018-0055-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s41687-018-0055-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChan DL, Calder T, Lawson JA, Mowat D, Kennedy SE. The natural history of subependymal giant cell astrocytomas in tuberous sclerosis complex: A review. Rev Neurosci. 2018;29:295\\u0026ndash;301. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1515/revneuro-2017-0027\\u003c/span\\u003e\\u003cspan address=\\\"10.1515/revneuro-2017-0027\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM\\u0026uuml;hlebner A, Van Scheppingen J, Hulshof HM, Scholl T, Iyer AM, Anink JJ, et al. Novel Histopathological Patterns in Cortical Tubers of Epilepsy Surgery Patients with Tuberous Sclerosis Complex. PLoS ONE. 2016;11. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pone.0157396\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0157396\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMoavero R, Napolitano A, Cusmai R, Vigevano F, Fig\\u0026agrave;-Talamanca L, Calbi G, et al. White matter disruption is associated with persistent seizures in tuberous sclerosis complex. Epilepsy Behav. 2016;60:63\\u0026ndash;7. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.yebeh.2016.04.026\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.yebeh.2016.04.026\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiszewska D, Sugalska M, J\\u0026oacute;źwiak S. Risk Factors Associated with Refractory Epilepsy in Patients with Tuberous Sclerosis Complex: A Systematic Review. J Clin Med. 2021;10. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/jcm10235495\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/jcm10235495\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHenske EP, J\\u0026oacute;zwiak S, Kingswood JC, Sampson JR, Thiele EA. Tuberous sclerosis complex. Nat Rev Dis Primers. 2016;2. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrdp.2016.35\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrdp.2016.35\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTee AR, Manning BD, Roux PP, Cantley LC, Blenis J. Tuberous sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toward Rheb. Curr Biol. 2003;13:1259\\u0026ndash;68. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s0960-9822(03)00506-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s0960-9822(03)00506-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWiegand G, May TW, Lehmann I, Stephani U, Kadish NE. Long-term treatment with everolimus in TSC-associated therapy-resistant epilepsies. Seizure. 2021;93:111\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.seizure.2021.10.011\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.seizure.2021.10.011\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBissler JJ, McCormack FX, Young LR, Elwing JM, Chuck G, Leonard JM, et al. Sirolimus for Angiomyolipoma in Tuberous Sclerosis Complex or Lymphangioleiomyomatosis. N Engl J Med. 2008;358:140. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1056/nejmoa063564\\u003c/span\\u003e\\u003cspan address=\\\"10.1056/nejmoa063564\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFan Y, Mao R, Yang J. NF-κB and STAT3 signaling pathways collaboratively link inflammation to cancer. Protein Cell. 2013;4:176. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s13238-013-2084-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s13238-013-2084-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXia L, Tan S, Zhou Y, Lin J, Wang H, Oyang L, et al. Role of the NFκB-signaling pathway in cancer. Onco Targets Ther. 2018;11:2063. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.2147/ott.S161109\\u003c/span\\u003e\\u003cspan address=\\\"10.2147/ott.S161109\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTolomeo M, Cascio A. The Multifaced Role of STAT3 in Cancer and Its Implication for Anticancer Therapy. Int J Mol Sci. 2021;22:1\\u0026ndash;25. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/ijms22020603\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms22020603\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHillmer EJ, Zhang H, Li HS, Watowich SS. STAT3 signaling in immunity. Vol. 31, Cytokine and Growth Factor Reviews. Elsevier Ltd; 2016. pp. 1\\u0026ndash;15. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.cytogfr.2016.05.001\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cytogfr.2016.05.001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang J, Kunimoto H, Katayama B, Zhao H, Shiromizu T, Wang L, et al. Phospho-Ser727 triggers a multistep inactivation of STAT3 by rapid dissociation of pY705\\u0026ndash;SH2 through C-terminal tail modulation. Int Immunol. 2020;32:73\\u0026ndash;88. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/intimm/dxz061\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/intimm/dxz061\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWen Z, Zhong Z, Darnell JE. Maximal activation of transcription by stat1 and stat3 requires both tyrosine and serine phosphorylation. Cell. 1995;82:241\\u0026ndash;50. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/0092-8674(95)90311-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/0092-8674(95)90311-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChampion JD, Dodd KM, Lam HC, Alzahrani MAM, Seifan S, Rad E, et al. Drug Inhibition of Redox Factor-1 Restores Hypoxia-Driven Changes in Tuberous Sclerosis Complex 2 Deficient Cells. Cancers. 2022;14:6195. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/cancers14246195\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/cancers14246195\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGao Y, Gartenhaus RB, Lapidus RG, Hussain A, Zhang Y, Wang X, et al. Differential IKK/NF-κB Activity Is Mediated by TSC2 through mTORC1 in PTEN-Null prostate cancer and tuberous sclerosis complex tumor cells. Mol Cancer Res. 2015;13:1602\\u0026ndash;14. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/1541-7786.mrc-15-0213\\u003c/span\\u003e\\u003cspan address=\\\"10.1158/1541-7786.mrc-15-0213\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeichhart T, Costantino G, Poglitsch M, Rosner M, Zeyda M, Stuhlmeier KM, et al. The TSC-mTOR Signaling Pathway Regulates the Innate Inflammatory Response. Immunity. 2008;29:565\\u0026ndash;77. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.immuni.2008.08.012\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.immuni.2008.08.012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu J, Astrinidis A, Howard S, Henske EP. Estradiol and tamoxifen stimulate LAM-associated angiomyolipoma cell growth and activate both genomic and nongenomic signaling pathways. Am J Physiol Lung Cell Mol Physiol. 2004;286:694\\u0026ndash;700. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1152/ajplung.00204.2003\\u003c/span\\u003e\\u003cspan address=\\\"10.1152/ajplung.00204.2003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHong F, Larrea MD, Doughty C, Kwiatkowski DJ, Squillace R, Slingerland JM. mTOR-raptor binds and activates SGK1 to regulate p27 phosphorylation. Mol Cell. 2008;30:701\\u0026ndash;11. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.molcel.2008.04.027\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.molcel.2008.04.027\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang H, Cicchetti G, Onda H, Koon HB, Asrican K, Bajraszewski N, et al. Loss of Tsc1/Tsc2 activates mTOR and disrupts PI3K-Akt signaling through downregulation of PDGFR. J Clin Invest. 2003;112:1223\\u0026ndash;33. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1172/jci17222\\u003c/span\\u003e\\u003cspan address=\\\"10.1172/jci17222\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAstrinidis A, Cash TP, Hunter DS, Walker CL, Chernoff J, Henske EP. Tuberin, the tuberous sclerosis complex 2 tumor suppressor gene product, regulates Rho activation, cell adhesion and migration. Oncogene. 2002;21:8470\\u0026ndash;6. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/sj.onc.1205962\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/sj.onc.1205962\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJohnson CE, Dunlop EA, Seifan S, McCann HD, Hay T, Parfitt GJ, et al. Loss of tuberous sclerosis complex 2 sensitizes tumors to nelfinavir\\u0026thinsp;\\u0026ndash;\\u0026thinsp;bortezomib therapy to intensify endoplasmic reticulum stress-induced cell death. Oncogene. 2018;37:5913\\u0026ndash;25. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41388-018-0381-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41388-018-0381-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:1\\u0026ndash;21. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s13059-014-0550-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s13059-014-0550-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMartin KR, Zhou W, Bowman MJ, Shih J, Au KS, Dittenhafer-Reed KE, et al. The genomic landscape of tuberous sclerosis complex. Nat Commun. 2017;8:15816. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/ncomms15816\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/ncomms15816\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGilmore T. NF-kB Target Genes \\u0026raquo; NF-kB Transcription Factors. Boston University. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.bu.edu/nf-kb/gene-resources/target-genes/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.bu.edu/nf-kb/gene-resources/target-genes/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e Accessed 22 Nov 2022.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGoncharova EA, Goncharov DA, Damera G, Tliba O, Amrani Y, Panettieri RA, et al. Signal Transducer and Activator of Transcription 3 Is Required for Abnormal Proliferation and Survival of TSC2-Deficient Cells: Relevance to Pulmonary Lymphangioleiomyomatosis. Mol Pharmacol. 2009;76:766. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1124/mol.109.057042\\u003c/span\\u003e\\u003cspan address=\\\"10.1124/mol.109.057042\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang J, Filippakis H, Hougard T, Du H, Ye C, Liu HJ, et al. Interleukin-6 mediates PSAT1 expression and serine metabolism in TSC2-deficient cells. Proc Natl Acad Sci U S A. 2021;118:e2101268118. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1073/pnas.2101268118\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.2101268118\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu Y, Zhou BP. TNF-alpha/NF-kappaB/Snail pathway in cancer cell migration and invasion. Br J Cancer. 2010;102:639\\u0026ndash;44. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/sj.bjc.6605530\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/sj.bjc.6605530\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e33, O\\u0026rsquo;mahony AM, Lynn E, Murphy DJ, Fabre A, McCarthy C. Lymphangioleiomyomatosis: a clinical review. Breathe. 2020;16:1\\u0026ndash;11. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1183/20734735.0007-2020\\u003c/span\\u003e\\u003cspan address=\\\"10.1183/20734735.0007-2020\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9:671\\u0026ndash;5. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nmeth.2089\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nmeth.2089\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eImmune Checkpoint Proteins - ACROBiosystems. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.acrobiosystems.com/A974-Immune-Checkpoint-Proteins.html?gad_source=1\\u0026amp;gclid=EAIaIQobChMIoZry6OrBhgMVM5FQBh29qw5nEAAYASAAEgLPzPD_BwE\\u003c/span\\u003e\\u003cspan address=\\\"https://www.acrobiosystems.com/A974-Immune-Checkpoint-Proteins.html?gad_source=1\\u0026amp;gclid=EAIaIQobChMIoZry6OrBhgMVM5FQBh29qw5nEAAYASAAEgLPzPD_BwE\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e Accessed 04 Jun 2024.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSolinas C, Aiello M, Rozali E, Lambertini M, Willard-Gallo K, Migliori E. Programmed cell death-ligand 2: A neglected but important target in the immune response to cancer? Transl Oncol. 2020;13:100811. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.tranon.2020.100811\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.tranon.2020.100811\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTr\\u0026eacute;panier MO, Hopperton KE, Mizrahi R, Mechawar N, Bazinet RP. Postmortem evidence of cerebral inflammation in schizophrenia: a systematic review. Mol Psychiatry. 2016;21:1009\\u0026ndash;26. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/mp.2016.90\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/mp.2016.90\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFelger JC, Li Z, Haroon E, Woolwine BJ, Jung MY, Hu X, et al. Inflammation is associated with decreased functional connectivity within corticostriatal reward circuitry in depression. Mol Psychiatry. 2016;21:1358\\u0026ndash;65. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/mp.2015.168\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/mp.2015.168\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMatta SM, Hill-Yardin EL, Crack PJ. The influence of neuroinflammation in Autism Spectrum Disorder. Brain Behav Immun. 2019;79:75\\u0026ndash;90. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.bbi.2019.04.037\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbi.2019.04.037\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAronica E, Crino PB. Inflammation in epilepsy: clinical observations. Epilepsia. 2011;52(Suppl 3):26\\u0026ndash;32. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1528-1167.2011.03033.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1528-1167.2011.03033.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu Z, Xue T, Zhang Z, Wang X, Xu P, Zhang J, et al. Role of signal transducer and activator of transcription-3 in up-regulation of GFAP after epilepsy. Neurochem Res. 2011;36:2208\\u0026ndash;15. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s11064-011-0576-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11064-011-0576-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang Q, Tang G, Zhong XM, Ding DR, Wang H, Li JN. Role of Stat3 in NLRP3/caspase-1-mediated hippocampal neuronal pyroptosis in epileptic mice. Synapse. 2021;75:e22221. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/syn.22221\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/syn.22221\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017;2:17023. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/sigtrans.2017.23\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/sigtrans.2017.23\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGrivennikov SI, Karin M. Dangerous liaisons: STAT3 and NF-kappaB collaboration and crosstalk in cancer. Cytokine Growth Factor Rev. 2010;21:11\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.cytogfr.2009.11.005\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cytogfr.2009.11.005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAtkinson GP, Nozell SE, Benveniste ET. NF-kappaB and STAT3 signaling in glioma: targets for future therapies. Expert Rev Neurother. 2010;10:575\\u0026ndash;86. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1586/ern.10.21\\u003c/span\\u003e\\u003cspan address=\\\"10.1586/ern.10.21\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDan HC, Cooper MJ, Cogswell PC, Duncan JA, Ting JP, Baldwin AS. Akt-dependent regulation of NF-{kappa}B is controlled by mTOR and Raptor in association with IKK. Genes Dev. 2008;22:1490\\u0026ndash;500. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1101/gad.1662308\\u003c/span\\u003e\\u003cspan address=\\\"10.1101/gad.1662308\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHorlad H, Ma C, Yano H, Pan C, Ohnishi K, Fujiwara Y, et al. An IL-27/Stat3 axis induces expression of programmed cell death 1 ligands (PD-L1/2) on infiltrating macrophages in lymphoma. Cancer Sci. 2016;107:1696\\u0026ndash;704. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/cas.13065\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/cas.13065\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShibahara D, Tanaka K, Iwama E, Kubo N, Ota K, Azuma K, et al. Intrinsic and Extrinsic Regulation of PD-L2 Expression in Oncogene-Driven Non-Small Cell Lung Cancer. J Thorac Oncol. 2018;13:926\\u0026ndash;37. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jtho.2018.03.012\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jtho.2018.03.012\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"journal-of-inflammation\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"jinf\",\"sideBox\":\"Learn more about [Journal of Inflammation](http://journal-inflammation.biomedcentral.com/)\",\"snPcode\":\"12950\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12950/3\",\"title\":\"Journal of Inflammation\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"TSC, mTOR, NF-κB, STAT3, IL-6, rapamycin, inflammation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4569999/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4569999/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eAberrant activation of mTORC1 is clearly defined in TSC, causing uncontrolled cell growth. While mTORC1 inhibitors show efficacy to stabilise tumour growth in TSC, they are not fully curative. Disease facets of TSC that are not restored with mTOR inhibitors might involve NF-κB. The study aimed to characterise NF-κB in the context of TSC.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eEnrichment of NF-κB-regulated genes was observed in TSC patient tumours, SEN/SEGAs, cortical tubers and a TSC tumour-derived cell line (621\\u0026thinsp;\\u0026minus;\\u0026thinsp;101). Highlighting an inflammatory component of TSC, TSC cell models showed an elevated level of NF-κB and STAT3 activation. Herein, we report a dysregulated inflammatory phenotype of \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells where NF-κB promotes autocrine signalling involving IL-6. Of importance, mTORC1 inhibition does not block this inflammatory signal to promote STAT3, while NF-κB inhibition was much more effective. Combined mTORC1 and NF-κB inhibition was potent at preventing anchorage-independent growth of \\u003cem\\u003eTSC2\\u003c/em\\u003e-deficient cells, and unlike mTORC1 inhibition alone was sufficient to prevent colony regrowth after cessation of treatment.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eThis study reveals autocrine signalling crosstalk between NF-κB and STAT3 in TSC cell models. Furthermore, the data presented indicate that NF-κB pathway inhibitors could be a viable adjunct therapy with the current mTOR inhibitors to treat TSC.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Loss of Tuberous Sclerosis Complex 2 confers inflammation via dysregulation of Nuclear factor kappa-light-chain-enhancer of activated B cells\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-07-15 19:22:15\",\"doi\":\"10.21203/rs.3.rs-4569999/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2024-12-18T16:41:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-10-21T16:12:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-06-13T00:26:23+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-06-13T00:26:19+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Journal of Inflammation\",\"date\":\"2024-06-12T11:48:59+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"journal-of-inflammation\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"jinf\",\"sideBox\":\"Learn more about [Journal of Inflammation](http://journal-inflammation.biomedcentral.com/)\",\"snPcode\":\"12950\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12950/3\",\"title\":\"Journal of Inflammation\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"684f0279-3ef9-41a4-9038-68653b25ccea\",\"owner\":[],\"postedDate\":\"July 15th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-09-29T16:02:51+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-4569999\",\"link\":\"https://doi.org/10.1186/s12950-025-00464-8\",\"journal\":{\"identity\":\"journal-of-inflammation\",\"isVorOnly\":false,\"title\":\"Journal of Inflammation\"},\"publishedOn\":\"2025-09-26 15:57:25\",\"publishedOnDateReadable\":\"September 26th, 2025\"},\"versionCreatedAt\":\"2024-07-15 19:22:15\",\"video\":\"\",\"vorDoi\":\"10.1186/s12950-025-00464-8\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12950-025-00464-8\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4569999\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4569999\",\"identity\":\"rs-4569999\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}