{"paper_id":"86571c0c-49b8-4c5f-891b-d1c50dd13247","body_text":"Expression of insulin-like growth factor binding protein 5 in the vaginal wall tissues of older women with pelvic organ prolapse | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Expression of insulin-like growth factor binding protein 5 in the vaginal wall tissues of older women with pelvic organ prolapse Yinan Duan, Yifei Chen, Yan He, Runqi Gong, Zhijun Xia This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3900632/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Insulin-like growth factor binding protein 5 (IGFBP5) seems to be associated with aging and extracellular matrix (ECM) fibrosis, but there has been no examination of the expression and effect on vaginal wall tissues among pelvic organ prolapse (POP) patients. Objective This study aimed to investigate the expression and significance of IGFBP5 and ECM related proteins in anterior vaginal wall tissues among aged POP patients. Methods Tissues from the anterior vaginal wall were collected from 28 patients with POP and 20 patients without POP. The expression of protein and mRNA levels of IGFBP5 and ECM related proteins were evaluated in the vaginal wall tissues using immunohistochemistry, western blotting, and RT-qPCR techniques. The expression levels were then compared with clinical parameters. Results The expression levels of protein and mRNA of IGFBP5, collagen I, and collagen III were significantly lower in the POP group. Protein and mRNA expression levels of MMP2 were significantly higher in the POP group. IGFBP5 protein and mRNA expression levels were were negatively correlated with age and significantly lower in older POP patients (≥ 65 years old) compared to younger POP patients (< 65 years old). IGFBP5 protein and mRNA expression levels were also significantly lower in POP-Q stage IV patients compared to POP-Q stage III patients. Conclusion Downregulation of IGFBP5 may be related to alteration of the ECM and the IGFBP5 expression level is negatively correlated with the age and severity of prolapse. The significant decrease in IGFBP5 expression may play a crucial part in the aging process and the occurrence of POP. IGFBP5 ECM vaginal wall pelvic organ prolapse aging Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1 INTRODUCTION Pelvic organ prolapse (POP) is defined as the descent of one or more of the anterior and posterior vaginal walls, uterus (cervix), or apex of the vagina (vaginal vault or cuff scar after hysterectomy) [ 1 ] . POP occurs in both younger and elder women, the morbidity of POP increases with age [ 2 , 3 ] and the peak age of incidence of POP is70-79 years old [ 4 ] . POP is a prevalent condition of elderly women, seriously reduces their quality of life. POP rarely leads to serious illness or death, but it can result in abnormal pelvic organ position, foreign body sensation, lumbosacral pain, lumbosacral sagging sensation, and functional abnormalities, such as stress urinary incontinence, urination or defecation disorders, pain, and sexual life disorders. The pelvic organs are maintained in proper anatomical position via a complex supporting structural system that is mainly composed of connective tissue. Connective tissue is composed of fibroblasts and their secreted extracellular matrix (ECM). Fibroblasts secreted and released collagen, contributing to the stability and adaptability of the pelvic floor. The degradation of collagen is carried out by a category of proteolytic enzymes known as matrix metalloproteinases (MMPs), while the function of MMPs is hindered by a category of proteins called tissue inhibitors of metalloproteins (TIMPs). Recent researches suggest that changes in the connective tissue can cause damage to the pelvic floor support structures, thus contributing to the occurrence of POP [ 5 , 6 ] . Already identified factors of POP include but are not limited to advanced age, menopause, obesity, pregnancy, vaginal delivery, estrogen deficiency, constipation, heavy lifting, chronic cough, and diabetes [ 7 – 9 ] . These factors may contribute to abnormal metabolism and remodeling of ECM in the pelvic floor, which subsequently affect their mechanical properties. Although there have been many researches on POP, little is known about its exact etiology and pathogenesis. Early prevention and treatment can be achieved through further research on the pathogenesis of pelvic organ prolapse. Insulin-like growth factor binding proteins (IGFBPs) are secretory proteins that bind to IGFs in the circulation [ 10 ] . In vertebrates, six different types of IGFBPs can be found within cells and interact with many ligands. IGFBP5 is the most conserved among the six IGFBPs and exhibits extensive biological activities including promoting cell survival, proliferation, senescence, differentiation, and apoptosis across species [ 11 ] . The levels of IGFBP5 expression were lower in aged adults than in young adults in the serum, bone, and skeletal muscle [ 12 , 13 ] . Contrary to the downregulation of IGFBP5 due to aging, the upregulated expression of IGFBP5 is observed in aging-related vascular diseases, and the upregulation of IGFBP5 contributes to cellular senescence in both human umbilical endothelial cells and human dermal fibroblasts during replicative senescence [ 14 – 16 ] . As IGFBP5 is a secreted protein, localization of IGFBP5 within or outside of cells can influence its impact on cellular function [ 17 ] . A study has indicated that IGFBP5 can facilitate cell proliferation or apoptosis when cells undergo different contexts and conditions [ 18 ] . Nguyen’s findings suggested that IGFBP5 is both an anti-angiogenic and pro-fibrotic factor [ 19 ] . Yasuoka’s [ 20 ] findings showed that IGFBP5 protein was lower in dermal fibroblasts from healthy people when compared with dermal fibroblasts from systemic sclerosis affected patients. One study confirmed that mice expressing human IGFBP-5 exhibited increased ECM gene expression [ 21 ] . The IGFBP5 serum levels are decreased n type 1 and type 2 diabetes patients [ 22 ] and are associated with senescence [ 23 ] . There are differences between different developmental stages and species. The major objective of this research was to estimate the expression level and the possible influences of IGFBP5 in the vaginal wall among patients suffering from POP. 2. Materials and Methods 2.1 Patient selection Our investigation was performed following the Declaration of Helsinki. The protocol with code 2022PS154K was approved by the ethics committee of Shengjing Hospital of China Medical University. All the patients collected in a blinded, randomized fashion from February 2022 to August 2023. This study included 28 patients had advanced POP (stage III or IV in accordance with the POP-Q system) diagnosed by the same experienced expert and underwent pelvic floor reconstruction surgery, 20 patients without POP who had benign gynecological diseases and underwent total hysterectomy surgery. In order to rule out the impact of these diseases on the findings of this experimental, patients who had previous history of pelvic floor reconstruction surgery, connective tissue disorders, pelvic inflammatory conditions, hormone replacement therapy (HRT), gynecologic malignancies, endometriosis, and emphysema were excluded. 20 (aged 39–68 years) of the 28 (aged 39–82 years) POP patients were selected for the POP group and 20 (aged 48–73 years) patients without POP in the control group. 2.2 Tissue collection During surgery, collected full-thickness vaginal wall tissue (approximately 0.5–1 cm 2 ) from the obviously prolapsed region of the anterior vaginal wall near the vaginal apex of the POP patients and anterior vaginal wall near the vaginal apex of the control patients. Each specimen was divided into pieces. One piece was treated with formalin and embedded in 10% neutral-buffered paraffin for Masson's trichrome, HE, and immunohistochemical analyses. While the other piece was stored at -80˚C for RNA and protein analyses. Sometimes tissue was used only for one purpose due to some variability in the size of the sample. 2.3 Hematoxylin and eosin (HE) and Masson's trichrome staining The vaginal specimens from both POP and control groups were sectioned longitudinally and put in 10% neutral buffered formalin for 2 days. They were cut into slides that were 4 µm thick, and placed onto coated slides after embedded in paraffin. The slides were subjected to the temperature at 60˚C for 120 min, deparaffinized, and were gradually rehydrated utilising different concentrations of alcohol. They were then stained with HE and Masson's trichrome kit (Coolaber, SL7230, Beijing, China). 4.4 Immunohistochemistry The UltraSensitive SP IHC kit (Maixin Biotech, Kit-9710, Fuzhou, China), was employed to conduct immunochemistry. After heating for120 min at a temperature of 60˚C, deparaffinized, and rehydrated in gradient concentration alcohol. The slides were boiled in EDTA buffer for antigen retrieval in accordance with manufacturer. At room temperature, the sections were incubated for 10 min with 3% H2O2, blocked for 10 min with 5% goat serum. Subsequently, incubated with primary antibodies overnight at 4˚C. Next, sections were incubated for 10 min with biotinylated secondary antibodies at room temperature, and incubated for 10 min with streptavidin peroxidase at room temperature. After each step, specimens underwent PBS washing. Immune reaction was visualized using the DAB-ZLI-9017 kit (ZSGB-Biotech, Beijing, China). Finally, the slides underwent water washing prior to applying hematoxylin as a counterstain. Negative controls were treated with PBS instead of the primary antibody. The antibodies used are shown in Online Resource 1. Images were obtained utilizing a Nikon microscope (Nikon E100 Optical, Tokyo, Japan). The slides were examined using light microscopy at a magnification of 400×, maintaining the same camera settings. Selected five regions for every slide randomly. The positive area percentage and staining intensity were analyzed in all regions of the tissue (mean density = IOD sum/area sum) using ImageJ software (NIH, Bethesda, MD, USA). The average value of the selected five regions was utilized to quantify the level of target protein on each slide. Regions containing vessels were excluded from the analysis. 2.5 Western blotting Cutting off the mucosal and muscular layers of anterior vaginal wall, total proteins were extracted by lysing the lamina propria tissue of vaginal samples with RIPA lysis buffer (Seven Biotech, SW104, Beijing, China) as instructed by the manufacturer. Measured the proteins utilizing the Omni-Easy™ Instant BCA Protein Assay Kit (Epizyme Biomedical Technology, ZJ102, Shanghai, China). Then, same amounts of protein from each sample were separated after subjected to SDS- PAGE. The separated proteins were transferred onto PVDF membranes using a current of 200 mA at 4˚C for 1–3 h. The membranes were blocked with a solution containing 5% non-fat milk at room temperature for 2 h. Subsequently, the membranes were incubated with primary antibodies at 4˚C overnight. The primary antibodies used are shown in Online Resource 2. Afterwards, the membranes were incubated with goat anti-rabbit secondary antibodies (1:3000, SA00001-15, Proteintech, USA) at room temperature for 1 h. After each antibody incubation step, unbound antibodies underwent TBST washing five times. The enhanced chemiluminescence (ECL) (MCE, Shanghai, China) detection method was used to visualize target bands. Beta actin served as an internal control. ImageJ software was employed to determine the density of all bands. A proportion of the target protein to the internal reference protein was used to express values of target protein. 2.6 Reverse transcription and quantitative real-time PCR Total tissue RNA was obtained from the lamina propria of the anterior vaginal wall using TRIzol reagent (Seven Biotech, SM139-02, Beijing, China) as instructed by the manufacturer. The quality and quantity of total RNA were determined making use of the Nano-300 (All SHENG, Hangzhou, China) and cDNA synthesis was carried out using a reverse transcription kit (TransGen Biotech, AU341, Beijing, China) (1 µg of total RNA and in a reaction volume of 20 µl): 55°C for 5 min, 85°C for 5 s, then remained at 4°C. RT-qPCR assays were performed on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) making use of the PerfectStart® Green qPCR SuperMix kit (TransGen Biotech, AQ601, Beijing, China). Sangon Biotech (Shanghai, China) synthesized the primers. Primer sequences are provided in Table 1 . The reactions were conducted in triplicate. The reactions followed a protocol of 30 s at 94°C, followed by 40 cycles of 5 s at 94°C and 34 s at 60°C, with a melting curve in the end. Data was analyzed using the relative quantitative method and GAPDH was used as the internal control. Three replicates being performed for each sample. The relative expression of each target gene was determined using 2-ΔΔCt method. Table 1 Primer sequences of each gene Gene Primer sequences IGFBP5 Forward ACCTGAGATGAGACAGGAGTC Reverse GTAGAATCCTTTGCGGTCACAA Collagen I Forward AGGGCCAAGACGAAGACATC Reverse AGATCACGTCATCGCACAACA Collagen III Forward TGGCTACTTCTCGCTCTGCTT Reverse CGGATCCTGAGTCACAGACACA MMP2 Forward AGTTTCCATTCCGCTTCCAG Reverse CGGTCGTAGTCCTCAGTGGT TIMP1 Forward CATCACTACCTGCAGTTTTGTG Reverse TGGATAAACAGGGAAACACTGT GAPDH Forward CAGGAGGCATTGCTGATGAT Reverse GAAGGCTGGGGCTCATTT 2.7 Statistical analysis The statistical software SPSS 16.0 (SPSS, Inc., Chicago, IL, USA) was utilized for conducting the statistical analysis. Data were analyzed with independent sample t-test for continuous data with normal distributions, Mann-Whitney test for data with non-normal distributions, and chi-squared test for categorical data. Normal continuous variables were expressed as mean ± standard deviation (SD), while non-normal continuous variables were reported as median (interquartile range). Categorical variables were presented as numbers and proportions. GraphPad Prism 9.3.0 (GraphPad Software, Inc., La Jolla, CA, USA) was utilised for graphical plotting. Variations were regarded as statistically significant when P < 0.05. 3. Results 3.1 Baseline characteristics of patients In Table 2 , the baseline characteristics of the patients in control group and POP group are showed. No noteworthy disparities were noted between the two groups in the way of age, body mass index (BMI), menopausal status, cesarean rate, parity, or gravidity (P > 0.05); the two groups were comparable. Menopause is medically characterized by the absence of menstruation for a minimum duration of one year. Table 2 Patient baseline characteristics Baseline Characteristics Control group(n = 20) POP group(n = 20) P Age, mean ± SD, years 57.00 ± 7.108 61.05 ± 6.878 0.075 BMI, mean ± SD, kg/m 2 23.26 ± 3.029 24.61 ± 3.396 0.192 Gravity, mean ± SD, per child 3(2-3.75) 2(1–3) 0.066 Parity, mean ± SD, per child 1.5(1–2) 1(1-1.75) 0.130 Menopause rate, % 70(14) 90(18) 0.107 Cesarean rate, % 20(4) 5(1) 0.139 Smoking habit, % 0(0) 0(0) - Data are presented as mean ± standard deviation (SD), median (interquartile range), or percentage (n) according to the situation; p < 0.05 was considered statistically significant. BMI, body mass index. 3.2 Histologic and immunocytochemical staining Hematoxylin-eosin (HE) staining demonstrated the features of histology of the intact vagina, including four anatomical layers: stratified squamous epithelial, lamina propria, muscularis, and adventitia (as shown in Online Resource 3). Figure 1 displays representative images for each stain. The localization of the majority of collagen within the lamina propria was showed through HE, Masson's trichrome, and immunocytochemical staining. Staining revealed presence of discoloration between the muscle bundles in the layer of muscularis, while no collagen immunostaining was identified in the stratified squamous epithelial layer. In relation to the control group, the appearance of collagen fibers in the lamina propria layer were much more discontinuous, loose, and disordered in the POP group, as depicted in Fig. 1 . Immunohistochemistry results for proteins are shown in Fig. 2 . The POP group showed markedly lower expression of IGFBP5 compared to the control group (0.2949 ± 0.0045 vs. 0.2997 ± 0.0044, P < 0.01). Similarly, the POP group exhibited reduced expression of collagen I (0.3138 ± 0.0062 vs. 0.3181 ± 0.0018, P < 0.01) and collagen III (0.2687 ± 0.0076 vs. 0.2730 ± 0.0048, P < 0.05) compared to the control group. Conversely, MMP2 expression in the POP group significantly exceeded than that in the control group (0.3066 ± 0.0121 vs. 0.2806 ± 0.0093, P < 0.0001). However, TIMP1 expression in the POP group was comparable to that in the control group (0.2327 ± 0.0025 vs. 0.2329 ± 0.0025, P = 0.865). 3.3 Western Blotting Western blot analysis showed a obvious decrease expression of IGFBP5 (1.00 ± 0.8160. vs 0.45 ± 0.2333, P < 0.01) in the POP group. The expression levels of collagen I (1.00 ± 1.2045 vs. 0.16 ± 0.1626, P < 0.01), collagen III (1.00 ± 1.5584 vs. 0.18 ± 0.0815, P < 0.05) were markedly decreased in the POP group compared to the control group, as indicated by statistically significant differences. TIMP1 (1.00 ± 1.4435 vs. 0.40 ± 0.4225, P = 0.084) was lower in the POP group. Conversely, western blot analysis revealed a significant increase expression of MMP2 (1.00 ± 0.8619 vs. 3.11 ± 4.1527, P < 0.05) in the POP group. The results of western blot were corresponded to the immunohistochemical analysis (Fig. 3 ). 2.4. RT-qPCR As observed in Fig. 4 , changes in the levels of mRNA of IGFBP5, collagen I, collagen III, MMP2, and TIMP1 in the two groups were similar to the changes in their corresponding levels of protein. The mRNA level of IGFBP5 (1.00 ± 1.0543 vs. 0.43 ± 0.3842, p < 0.05) in the POP group was obviously decreased compared to that in the control group. Expression of collagen I (1 ± 1.0418 vs. 0.44 ± 0.3731, p < 0.05) and collagen III (1.00 ± 0.9924 vs. 0.50 ± 0.4926, p < 0.05) mRNA levels in the POP group were notably reduced. While MMP2 mRNA level was significantly increased (1.00 ± 0.7221 vs. 4.13 ± 3.2018, p < 0.001). The mRNA level of TIMP1, inhibitor of MMP activity, was similar in two groups (1.00 ± 0.7827 vs. 0.67 ± 0.3458, p = 0.093). 2.5. Comparison of IGFBP5 To make further efforts to validate the effect of IGFBP5 in the age and the development of POP, we compared the RT-qPCR and western blot analyses of IGFBP5 in patients with different ages and degrees of prolapse. The expression levels are presented in Table 3 . IGFBP5 mRNA expression in POP-Q stage III patients was obviously higher than POP-Q stage IV patients (1.00 ± 0.8741 vs. 0.25 ± 0.1576). Western blot analysis indicated that the IGFBP5 expression level in POP-Q stage III was also higher than that in POP-Q stage IV (1.00 ± 0.5891 vs. 0.31 ± 0.2070). Both the mRNA and protein results were statistically significantly different (P < 0.05). IGFBP5 mRNA (1.00 ± 0.8893 vs. 0.44 ± 0.3576) and protein (1.00 ± 0.6044 vs. 0.48 ± 0.2519) expression levels were obviously higher in younger POP patients (< 65 years old) when compared to older POP patients (≥ 65 years old) (P < 0.05). The correlation between age and IGFBP5 expression levels are presented in Fig. 5 . The protein (r = 0.375, P < 0.05) and mRNA (r = 0.375, P < 0.05) levels were negatively correlated with age. Table 3 Comparison of IGFBP5 expression Protein expression mRNA expression cases Relative Protein expression t p Relative mRNA expression t p POP-Q stage III 22 1.00 ± 0.5891 2.778 0.01 a 1.00 ± 0.8741 2.077 0.048 a POP-Q stage IV 6 0.31 ± 0.2070 0.25 ± 0.1576 age < 65 15 1.00 ± 0.6044 3.020 0.007 b 1.00 ± 0.8893 2.107 0.045 b age ≥ 65 13 0.48 ± 0.2519 0.44 ± 0.3576 P < 0.05, statistically significant. Results are shown as mean ± standard deviation. a, comparisons between POP-Q stage III and POP-Q stage IV. b, comparisons between age < 65 and age ≥ 65. Discussion Within our current investigation, we analyzed the different expression levels of IGFBP5 in the lamina propria tissue among two groups. Patients with POP exhibited decreased expression levels of IGFBP5 protein and mRNA in the lamina propria tissue when compared to the control group. Previous reports have examined the expression and biological activities of IGFBP5 in various tissues, however, there has been no research on the expression of IGFBP5 or its involvement in POP. IGFBP5 is overexpressed in systemic sclerosis and idiopathic pulmonary fibrosis lung tissues [ 21 ] . IGFBP5 is downregulated in head and neck squamous cell carcinoma [ 24 ] and upregulated in breast cancer and colorectal cancer [ 18 , 25 ] . IGFBP5 can act as a positive or negative regulator of cellular proliferation and apoptosis under different conditions [ 18 , 26 ] . A research study found that IGFBP5 promoted the proliferation of cardiac fibroblasts, while caused apoptosis in cardiac myocytes [ 27 ] . In primary human lung fibroblasts, the addition of exogenously recombinant IGFBP-5 and the presence of endogenous IGFBP-5 both stimulate the expression of the ECM and profibrotic factors [ 17 ] . While in osteosarcoma cells, endogenous and exogenous IGFBP-5 exhibits contrary biological effects [ 28 ] . Li et al. noticed that IGFBP5 was observed to hinder breast cancer cells proliferation through an IGF-dependent pathway in vitro [ 29 ] , whereas another study indicated that IGFBP5 facilitates breast cancer cells proliferation in an IGF-independent manner [ 18 ] . Although IGFBP5 has a wide range of biological activities, its role in POP remains uncertain. As far as we know, no previous research has examined the correlation between declined IGFBP5 and the occurrence and progression of POP. The results of our study also revealed changes in ECM composition-related proteins in POP patients compared patients without POP. Both collagen I and collagen III expression levels were obviously declined in patients with POP. The connective tissue in the lamina propria tissue of anterior vagina approximates the vaginal fornix (apex) was once believed to be a reflective component of the endopelvic fascia [ 30 ] . Type of collagen most plentiful in interstitial connective tissue are collagen I and collagen III. Collagen I is primarily accountable for the mechanical strength of connective tissue, whereas collagen III and elastin are vital in maintaining tissue elasticity [ 31 , 32 ] . As collagen I and collagen III are major constituents of ECM in connective tissue [ 33 ] , maintaining an appropriate equilibrium in the synthesis and degradation of collagen are crucial for ECM [ 34 ] . The connective tissue support structure of POP is thought to be damaged in strength rather than elasticity [ 8 ] . Considering the significant changes and important roles of MMP2 and TIMP1 in collagen degradation and ECM metabolism, we assessed the levels of MMP2 and TIMP1 expression (mRNA and protein). Both mRNA and protein expression of MMP2 was obviously upregulated, while there was no considerable alteration in TIMP1 levels among patients with POP and compared to the patients without POP. Duan et al. found the localization of IGFBP5 within ECM in tissues, as well as its ability to bind numerous ECM proteins [ 11 ] . Song et al. In a cardiac fibroblasts study, it was observed that the introduction of recombinant IGFBP5 led to an increased ERK phosphorylation, cell proliferation, and mRNA expression of collagen III, MMP2, and MMP9 [ 27 ] . Zeeh et al. found that IGFBP-5 is likely involved in the increased expression of collagen during colitis [ 35 ] . In this study, our data are partially similar to previous data [ 11 , 17 , 27 , 35 ] . ECM remodeling is associated with multiple factors. Previous researches have shown that IGFBP5 could enhance the production and accumulation of ECM proteins, as well as by promoting the expression of growth factors in lung and skin tissues [ 17 , 20 , 36 ] . This study found the IGFBP5 protein is positive associate with collagen I and collagen III proteins. These findings indicate that IGFBP5 may also be related to the metabolism of the ECM by increased MMP2.We speculate that downregulation of IGFBP5 reduced the fibrotic effect of fibroblasts in POP patients. The decreased IGFBP5 could affect the synthesis and degradation of ECM related proteins (e.g., collagen I, collagen III, and MMP2), resulting in changes protein levels. Our discovery suggest reduced expression of IGFBP5 may have an effect on the development of POP by influencing the collagen composition and metabolism of the ECM. The discovery we made establishes a foundation of IGFBP5 in the ECM of POP. In POP patients, the younger POP patients who were under 65 years old exhibited higher levels of IGFBP5 expression compared to elder patients who were over 65 years old. Various studies have provided evidence of a decrease in IGFBP5 levels in humans due to aging or certain diseases [ 12 , 13 ] . POP is an age-associated disease [ 37 ] , the age of POP patients was negatively correlated with IGFBP5 expression in this study. A research proposed that reduction of IGFBP5 during proposed that the reduction of IGFBP5 during consecutive cell passages promotes the process of replicative senescence in fibroblast cells obtained from mouse embryos [ 23 ] . The involvement of IGFBP5 is indispensable the elevation of reactive oxygen species (ROS) and premature senescence triggered by the IL 6/sIL 6R pathway in human fibroblasts [ 38 ] . Therefore, our results on the relationship between age and IGFBP5 indicate that the decreased expression of IGFBP5 with age may contribute to trigger the senescence and apoptosis of POP fibroblasts, resulting in a decline in collagen synthesis and a rise in degradation within the connective tissue of POP. Furthermore, the comparison of IGFBP5 between POP-Q stage III and IV showed that IGFBP5 is lower in severity of prolapse IV. The findings on the influence of age and severity provide additional evidence that IGFBP5 is effective in the advancement of POP. In summary, IGFBP5 may be a vital indicator for early diagnosis and predict the severity of POP. There are limitations to this study. It will be important to expand the sample number, rendering the results more reliable. It is important to identifying and addressing all potential underlying causes is crucial in the management of POP since it can be attributed to multiple factors at the same time. For the sake of comprehensively understand the impacts of various factors on POP, including inflammation, tissue damage, and metabolism, it would be crucial to conduct further research on their effects. Only differences in IGFBP5 and ECM protein expression levels were investigated; further exploration is necessary to search the function of IGFBP5 in modifying the ECM and its impact on the development and prevalence of POP. Overall, the levels of IGFBP5 and proteins related to ECM were significantly reduced in vaginal tissues of POP patients. The expression levels of IGFBP5 showed a negative correlation with both age and the severity of prolapse. The findings of our research indicate that decrease in IGFBP5 expression could contribute to the development of POP by affecting the content of collagen in the ECM, thus playing a crucial part in the aging process and the occurrence of POP. IGFBP5 may be a vital indicator for early diagnosis and development of POP. Declarations Ethics approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Shengjing Hospital of China Medical University (No. 2022PS154K). Consent to participate Informed consent is it is not necessary to obtain in this study because the tissues are abandoned in surgery. Financial support This work was supported by the National Key R&D Program of China [grant number 2021YFC2701302], the National Natural Science Foundation of China [grant number 82271613], the Project supported by the Natural Science Foundation of Liaoning Province [grant number 2022-MS-081], and Project supported by the Natural Science Foundation of Liaoning Province [grant number 2022-BS-072]. Data availability Data sets generated during the current study are available from the corresponding author on reasonable request. Credit authorship contribution statement ZX and YD assisted in concept and design. YD, YC, YHand RG carried out the studies. YD, YC, YHand RG designed, performed, and analyzed the experiments. YD performed statistical analysis. YD was involved in writing original draft preparation. ZX was involved in writing review and editing NR and MD did supervision. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work. Declaration of competing interest The authors declare they have no conflict of interest. References COLLINS S, LEWICKY-GAUPP C. Pelvic Organ Prolapse [J]. Gastroenterology clinics of North America, 2022, 51(1): 177-93. https://doi.org/10.1016/j.gtc.2021.10.011. WU J M, HUNDLEY A F, FULTON R G, et al. Forecasting the prevalence of pelvic floor disorders in U.S. Women: 2010 to 2050 [J]. Obstetrics and gynecology, 2009, 114(6): 1278-83. https://doi.org/10.1097/aog.0b013e3181c2ce96. LI Z Y, ZHU L, XU T, et al. [An epidemiologic study of pelvic organ prolapse in urban Chinese women: a population-based sample in China] [J]. Zhonghua yi xue za zhi, 2019, 99(11): 857-61. https://doi.org/10.3760/cma.j.issn.0376-2491.2019.11.012. Pelvic Organ Prolapse: ACOG Practice Bulletin, Number 214 [J]. Obstetrics and gynecology, 2019, 134(5): e126-e42. https://doi.org/10.1097/aog.0000000000003519. QIU J, QIN M, FAN B, et al. Klotho Protein Reduced the Expression of Matrix Metalloproteinase-1 (MMP-1) and Matrix Metalloproteinase-3 (MMP-3) in Fibroblasts from Patients with Pelvic Organ Prolapse (POP) by Down-Regulating the Phosphorylation of ERK1/2 [J]. Medical science monitor : international medical journal of experimental and clinical research, 2019, 25: 3815-24. https://doi.org/10.12659/msm.913623. ZENG C, LIU J, WANG H, et al. Correlation Between Autophagy and Collagen Deposition in Patients With Pelvic Organ Prolapse [J]. Female pelvic medicine & reconstructive surgery, 2018, 24(3): 213-21. https://doi.org/10.1097/spv.0000000000000455. IGLESIA C B, SMITHLING K R. Pelvic Organ Prolapse [J]. American family physician, 2017, 96(3): 179-85. WANG S, Lü D, ZHANG Z, et al. Effects of mechanical stretching on the morphology of extracellular polymers and the mRNA expression of collagens and small leucine-rich repeat proteoglycans in vaginal fibroblasts from women with pelvic organ prolapse [J]. PloS one, 2018, 13(4): e0193456. https://doi.org/10.1371/journal.pone.0193456. ECKHARDT S, LAUS K, DEANDRADE S, et al. The impact of diabetes mellitus on pelvic organ prolapse recurrence after robotic sacrocolpopexy [J]. International urogynecology journal, 2023, 34(8): 1859-66. https://doi.org/10.1007/s00192-023-05455-y. BAXTER R C. IGF binding proteins in cancer: mechanistic and clinical insights [J]. Nature reviews Cancer, 2014, 14(5): 329-41. https://doi.org/10.1038/nrc3720. DUAN C, ALLARD J B. Insulin-Like Growth Factor Binding Protein-5 in Physiology and Disease [J]. Frontiers in endocrinology, 2020, 11: 100. https://doi.org/10.3389/fendo.2020.00100. DENNIS R A, PRZYBYLA B, GURLEY C, et al. Aging alters gene expression of growth and remodeling factors in human skeletal muscle both at rest and in response to acute resistance exercise [J]. Physiological genomics, 2008, 32(3): 393-400. https://doi.org/10.1152/physiolgenomics.00191.2007. MOHAN S, FARLEY J R, BAYLINK D J. Age-related changes in IGFBP-4 and IGFBP-5 levels in human serum and bone: implications for bone loss with aging [J]. Progress in growth factor research, 1995, 6(2-4): 465-73. https://doi.org/10.1016/0955-2235(95)00027-5. KIM K S, SEU Y B, BAEK S H, et al. Induction of cellular senescence by insulin-like growth factor binding protein-5 through a p53-dependent mechanism [J]. Molecular biology of the cell, 2007, 18(11): 4543-52. https://doi.org/10.1091/mbc.e07-03-0280. YOON I K, KIM H K, KIM Y K, et al. Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology [J]. Experimental gerontology, 2004, 39(9): 1369-78. https://doi.org/10.1016/j.exger.2004.07.002. HAMPEL B, FORTSCHEGGER K, RESSLER S, et al. Increased expression of extracellular proteins as a hallmark of human endothelial cell in vitro senescence [J]. Experimental gerontology, 2006, 41(5): 474-81. https://doi.org/10.1016/j.exger.2006.03.001. NGUYEN X X, MUHAMMAD L, NIETERT P J, et al. IGFBP-5 Promotes Fibrosis via Increasing Its Own Expression and That of Other Pro-fibrotic Mediators [J]. Frontiers in endocrinology, 2018, 9: 601. https://doi.org/10.3389/fendo.2018.00601. LI X, CAO X, LI X, et al. Expression level of insulin-like growth factor binding protein 5 mRNA is a prognostic factor for breast cancer [J]. Cancer science, 2007, 98(10): 1592-6. https://doi.org/10.1111/j.1349-7006.2007.00565.x. NGUYEN X X, RENAUD L, FEGHALI-BOSTWICK C. Identification of Impacted Pathways and Transcriptomic Markers as Potential Mediators of Pulmonary Fibrosis in Transgenic Mice Expressing Human IGFBP5 [J]. International journal of molecular sciences, 2021, 22(22). https://doi.org/10.3390/ijms222212609. YASUOKA H, JUKIC D M, ZHOU Z, et al. Insulin-like growth factor binding protein 5 induces skin fibrosis: A novel murine model for dermal fibrosis [J]. Arthritis and rheumatism, 2006, 54(9): 3001-10. https://doi.org/10.1002/art.22084. NGUYEN X X, SANDERSON M, HELKE K, et al. Phenotypic Characterization of Transgenic Mice Expressing Human IGFBP-5 [J]. International journal of molecular sciences, 2020, 22(1). https://doi.org/10.3390/ijms22010335. JEHLE P M, JEHLE D R, MOHAN S, et al. Serum levels of insulin-like growth factor system components and relationship to bone metabolism in Type 1 and Type 2 diabetes mellitus patients [J]. The Journal of endocrinology, 1998, 159(2): 297-306. https://doi.org/10.1677/joe.0.1590297. NOJIMA I, HOSODA R, TODA Y, et al. Downregulation of IGFBP5 contributes to replicative senescence via ERK2 activation in mouse embryonic fibroblasts [J]. Aging, 2022, 14(7): 2966-88. https://doi.org/10.18632/aging.203999. HUNG P S, KAO S Y, SHIH Y H, et al. Insulin-like growth factor binding protein-5 (IGFBP-5) suppresses the tumourigenesis of head and neck squamous cell carcinoma [J]. The Journal of pathology, 2008, 214(3): 368-76. https://doi.org/10.1002/path.2280. DENG Y, YANG X, HUA H, et al. IGFBP5 is Upregulated and Associated with Poor Prognosis in Colorectal Cancer [J]. International journal of general medicine, 2022, 15: 6485-97. https://doi.org/10.2147/ijgm.s370576. TANNO B, NEGRONI A, VITALI R, et al. Expression of insulin-like growth factor-binding protein 5 in neuroblastoma cells is regulated at the transcriptional level by c-Myb and B-Myb via direct and indirect mechanisms [J]. The Journal of biological chemistry, 2002, 277(26): 23172-80. https://doi.org/10.1074/jbc.m200141200. SONG S E, KIM Y W, KIM J Y, et al. IGFBP5 mediates high glucose-induced cardiac fibroblast activation [J]. Journal of molecular endocrinology, 2013, 50(3): 291-303. https://doi.org/10.1530/jme-12-0194. YIN P, XU Q, DUAN C. Paradoxical actions of endogenous and exogenous insulin-like growth factor-binding protein-5 revealed by RNA interference analysis [J]. The Journal of biological chemistry, 2004, 279(31): 32660-6. https://doi.org/10.1074/jbc.m401378200. BUTT A J, DICKSON K A, MCDOUGALL F, et al. Insulin-like growth factor-binding protein-5 inhibits the growth of human breast cancer cells in vitro and in vivo [J]. The Journal of biological chemistry, 2003, 278(32): 29676-85. https://doi.org/10.1074/jbc.m301965200. DELANCEY J O. Structural support of the urethra as it relates to stress urinary incontinence: the hammock hypothesis [J]. American journal of obstetrics and gynecology, 1994, 170(6): 1713-20; discussion 20-3. https://doi.org/10.1016/s0002-9378(94)70346-9. KIM T, SRIDHARAN I, MA Y, et al. Identifying distinct nanoscopic features of native collagen fibrils towards early diagnosis of pelvic organ prolapse [J]. Nanomedicine : nanotechnology, biology, and medicine, 2016, 12(3): 667-75. https://doi.org/10.1016/j.nano.2015.11.006. GOH J T. Biomechanical and biochemical assessments for pelvic organ prolapse [J]. Current opinion in obstetrics & gynecology, 2003, 15(5): 391-4. https://doi.org/10.1097/00001703-200310000-00007. ZHU Y P, XIE T, GUO T, et al. Evaluation of extracellular matrix protein expression and apoptosis in the uterosacral ligaments of patients with or without pelvic organ prolapse [J]. International urogynecology journal, 2021, 32(8): 2273-81. https://doi.org/10.1007/s00192-020-04446-7. ELNEIL S. Complex pelvic floor failure and associated problems [J]. Best practice & research Clinical gastroenterology, 2009, 23(4): 555-73. https://doi.org/10.1016/j.bpg.2009.04.011. ZEEH J M, RILEY N E, HOFFMANN P, et al. Expression of insulin-like growth factor binding proteins and collagen in experimental colitis in rats [J]. European journal of gastroenterology & hepatology, 2001, 13(7): 851-8. https://doi.org/10.1097/00042737-200107000-00014. PILEWSKI J M, LIU L, HENRY A C, et al. Insulin-like growth factor binding proteins 3 and 5 are overexpressed in idiopathic pulmonary fibrosis and contribute to extracellular matrix deposition [J]. The American journal of pathology, 2005, 166(2): 399-407. https://doi.org/10.1016/s0002-9440(10)62263-8. BRITO L G O, PEREIRA G M V, MOALLI P, et al. Age and/or postmenopausal status as risk factors for pelvic organ prolapse development: systematic review with meta-analysis [J]. International urogynecology journal, 2022, 33(1): 15-29. https://doi.org/10.1007/s00192-021-04953-1. KOJIMA H, KUNIMOTO H, INOUE T, et al. The STAT3-IGFBP5 axis is critical for IL-6/gp130-induced premature senescence in human fibroblasts [J]. Cell cycle (Georgetown, Tex), 2012, 11(4): 730-9. https://doi.org/10.4161/cc.11.4.19172. Additional Declarations No competing interests reported. Supplementary Files ESM1.pdf ESM2.pdf ESM3.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3900632\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":271561118,\"identity\":\"ec873eca-369b-4d6b-bd64-3d54bd5554a6\",\"order_by\":0,\"name\":\"Yinan Duan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China.\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yinan\",\"middleName\":\"\",\"lastName\":\"Duan\",\"suffix\":\"\"},{\"id\":271561119,\"identity\":\"27bd74ba-5932-4e96-9a0c-e87907294129\",\"order_by\":1,\"name\":\"Yifei Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China.\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yifei\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":271561120,\"identity\":\"ed2a57df-b810-4c1b-b147-f7b5e7940d0c\",\"order_by\":2,\"name\":\"Yan He\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China.\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":271561121,\"identity\":\"a15ada7e-3d85-4364-a5cf-e007bacbcb31\",\"order_by\":3,\"name\":\"Runqi Gong\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Gynecology, Liaoning Province Hospital for Women and Children, Shenyang, Liaoning, China\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Runqi\",\"middleName\":\"\",\"lastName\":\"Gong\",\"suffix\":\"\"},{\"id\":271561122,\"identity\":\"0eb63078-d1dc-483e-a7aa-7ba974cdbe5e\",\"order_by\":4,\"name\":\"Zhijun Xia\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYDACZiCWYJCQ42dvPnDgww/itVgYS/YcSzw4s4d4uyoSN8zwMT7MwUaEWoPjzI8/WDBIMG6Q4PlwmIGHQZ5f7AB+LZLNbAYGQL8wm0v3bjhcYMFgOHN2An4t/MwMBglALWyWc85uODyDhyHB4DYBLWzM7B8OALXwGNzIeXCYh40ILfzMPIYNQC0SQC0MxGmRbOYpBsWLATCQDYCBLEHYLwbnj2/+LMFQV9/P3vz4w4cfNvL80gS0gACz5D84W4KwchBg/ECculEwCkbBKBipAADUXz5Sk/JIxAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China.\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhijun\",\"middleName\":\"\",\"lastName\":\"Xia\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-01-26 17:29:14\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3900632/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3900632/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":50937349,\"identity\":\"589ac224-ebd3-4219-940c-cdc16b797684\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:55\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6392875,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLight microscope observations of pictures. (a) HE staining in the control group. (b)HE staining in the POP group. (c) Masson trichrome staining in the control group. (d) Masson trichrome staining in the POP group. (e) Expression of IGFBP5 in the control group. (f) Expression of IGFBP5 in the POP group. (g) Expression of collagen I in the control group. (h) Expression of collagen I in the POP group. (i) Expression of collagen III in the control group. (j) Expression of collagen III in the POP group. (k) Expression of MMP2 in the control group. (l) Expression of MMP2 in the POP group. (m) Expression of TIMP1 in the control group. (n) Expression of TIMP1 in the POP group. Magnification, X400; scale bar: 100 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/1f61dd72ce15ce519fe54f1b.png\"},{\"id\":50937346,\"identity\":\"c7ba983a-33ce-40e3-8226-2d42f734dc54\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:54\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":362876,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ea–e, Immunohistochemistry quantitative analysis of (a) IGFBP5, (b) collagen I, (c) collagen III, (d) MMP2, and (e) TIMP1 in the anterior vaginal wall tissues of patients in the POP group and control group. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ****P \\u0026lt; 0.0001, ns, P \\u0026gt; 0.05.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/a817aa204b3436c8b970ea8f.png\"},{\"id\":50937353,\"identity\":\"02a832cd-6e36-4bb9-b915-e880e997953a\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:55\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":861695,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(a) Western blot analysis was used to detect IGFBP5, collagen I, collagen III, MMP2 and TIMP1 protein expression levels in the vaginal tissues of patients in the control and POP groups. (b) Western blot relative expression quantitative analysis of protein IGFBP5, (c) collagen I, (d) collagen III, (e) MMP2, and (f) TIMP1. The results represent the mean and standard deviation. *P \\u0026lt; 0.05, ***P \\u0026lt; 0.001, ns P＞0.05.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/bd10bddac0c717017e2e9694.png\"},{\"id\":50937352,\"identity\":\"1b389453-04fc-4705-92d7-c3672f592b51\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:55\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":34242,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eRT-qPCR analysis of IGFBP5, collagen I, collagen III, MMP2, and TIMP1 mRNA levels in the vaginal tissues of patients in the control and POP groups. The results represent the mean and standard deviation. *P \\u0026lt; 0.05, ***P \\u0026lt; 0.001, ns, P \\u0026gt; 0.05.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/a8b4078b684f26cc2d813f11.png\"},{\"id\":50937350,\"identity\":\"638a4f6b-4587-457f-adb6-3eb39e180e7f\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:55\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":110893,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCorrelation between IGFBP5 and age of POP, (a)relative Protein expression (b) relative mRNA expression.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/0327d7c9f0b73f05966f8767.png\"},{\"id\":50938340,\"identity\":\"aaf109e1-e1ae-4ec1-ad25-4d21d88fe00b\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:33:59\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1706346,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/6e60f497-e29a-402a-b902-fb83ca78f04a.pdf\"},{\"id\":50938071,\"identity\":\"080255df-7949-402d-a69e-1db9103c62bc\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:25:55\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":94822,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"ESM1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/cd59c17d05cb4ab15d1fb265.pdf\"},{\"id\":50937351,\"identity\":\"072de424-97f8-47dd-9394-6066418acd1f\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:55\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":95014,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"ESM2.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/b7fe73e9c653ee5faeab47db.pdf\"},{\"id\":50937354,\"identity\":\"a6662d01-4ab9-4087-bf7b-faea29831dad\",\"added_by\":\"auto\",\"created_at\":\"2024-02-09 21:17:55\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":158336,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"ESM3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3900632/v1/2215cb550af788ffa0e38934.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Expression of insulin-like growth factor binding protein 5 in the vaginal wall tissues of older women with pelvic organ prolapse\",\"fulltext\":[{\"header\":\"1 INTRODUCTION\",\"content\":\"\\u003cp\\u003ePelvic organ prolapse (POP) is defined as the descent of one or more of the anterior and posterior vaginal walls, uterus (cervix), or apex of the vagina (vaginal vault or cuff scar after hysterectomy)\\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u003c/sup\\u003e. POP occurs in both younger and elder women, the morbidity of POP increases with age\\u003csup\\u003e[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]\\u003c/sup\\u003e and the peak age of incidence of POP is70-79 years old\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. POP is a prevalent condition of elderly women, seriously reduces their quality of life. POP rarely leads to serious illness or death, but it can result in abnormal pelvic organ position, foreign body sensation, lumbosacral pain, lumbosacral sagging sensation, and functional abnormalities, such as stress urinary incontinence, urination or defecation disorders, pain, and sexual life disorders. The pelvic organs are maintained in proper anatomical position via a complex supporting structural system that is mainly composed of connective tissue. Connective tissue is composed of fibroblasts and their secreted extracellular matrix (ECM). Fibroblasts secreted and released collagen, contributing to the stability and adaptability of the pelvic floor. The degradation of collagen is carried out by a category of proteolytic enzymes known as matrix metalloproteinases (MMPs), while the function of MMPs is hindered by a category of proteins called tissue inhibitors of metalloproteins (TIMPs). Recent researches suggest that changes in the connective tissue can cause damage to the pelvic floor support structures, thus contributing to the occurrence of POP\\u003csup\\u003e[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. Already identified factors of POP include but are not limited to advanced age, menopause, obesity, pregnancy, vaginal delivery, estrogen deficiency, constipation, heavy lifting, chronic cough, and diabetes\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR8\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. These factors may contribute to abnormal metabolism and remodeling of ECM in the pelvic floor, which subsequently affect their mechanical properties. Although there have been many researches on POP, little is known about its exact etiology and pathogenesis. Early prevention and treatment can be achieved through further research on the pathogenesis of pelvic organ prolapse.\\u003c/p\\u003e \\u003cp\\u003eInsulin-like growth factor binding proteins (IGFBPs) are secretory proteins that bind to IGFs in the circulation\\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e. In vertebrates, six different types of IGFBPs can be found within cells and interact with many ligands. IGFBP5 is the most conserved among the six IGFBPs and exhibits extensive biological activities including promoting cell survival, proliferation, senescence, differentiation, and apoptosis across species\\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]\\u003c/sup\\u003e. The levels of IGFBP5 expression were lower in aged adults than in young adults in the serum, bone, and skeletal muscle\\u003csup\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e. Contrary to the downregulation of IGFBP5 due to aging, the upregulated expression of IGFBP5 is observed in aging-related vascular diseases, and the upregulation of IGFBP5 contributes to cellular senescence in both human umbilical endothelial cells and human dermal fibroblasts during replicative senescence\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR15\\\" citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e. As IGFBP5 is a secreted protein, localization of IGFBP5 within or outside of cells can influence its impact on cellular function\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. A study has indicated that IGFBP5 can facilitate cell proliferation or apoptosis when cells undergo different contexts and conditions\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e. Nguyen\\u0026rsquo;s findings suggested that IGFBP5 is both an anti-angiogenic and pro-fibrotic factor\\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e. Yasuoka\\u0026rsquo;s\\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e findings showed that IGFBP5 protein was lower in dermal fibroblasts from healthy people when compared with dermal fibroblasts from systemic sclerosis affected patients. One study confirmed that mice expressing human IGFBP-5 exhibited increased ECM gene expression\\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e. The IGFBP5 serum levels are decreased n type 1 and type 2 diabetes patients\\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e and are associated with senescence\\u003csup\\u003e[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]\\u003c/sup\\u003e. There are differences between different developmental stages and species. The major objective of this research was to estimate the expression level and the possible influences of IGFBP5 in the vaginal wall among patients suffering from POP.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Patient selection\\u003c/h2\\u003e \\u003cp\\u003eOur investigation was performed following the Declaration of Helsinki. The protocol with code 2022PS154K was approved by the ethics committee of Shengjing Hospital of China Medical University. All the patients collected in a blinded, randomized fashion from February 2022 to August 2023. This study included 28 patients had advanced POP (stage III or IV in accordance with the POP-Q system) diagnosed by the same experienced expert and underwent pelvic floor reconstruction surgery, 20 patients without POP who had benign gynecological diseases and underwent total hysterectomy surgery. In order to rule out the impact of these diseases on the findings of this experimental, patients who had previous history of pelvic floor reconstruction surgery, connective tissue disorders, pelvic inflammatory conditions, hormone replacement therapy (HRT), gynecologic malignancies, endometriosis, and emphysema were excluded. 20 (aged 39\\u0026ndash;68 years) of the 28 (aged 39\\u0026ndash;82 years) POP patients were selected for the POP group and 20 (aged 48\\u0026ndash;73 years) patients without POP in the control group.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Tissue collection\\u003c/h2\\u003e \\u003cp\\u003eDuring surgery, collected full-thickness vaginal wall tissue (approximately 0.5\\u0026ndash;1 cm\\u003csup\\u003e2\\u003c/sup\\u003e) from the obviously prolapsed region of the anterior vaginal wall near the vaginal apex of the POP patients and anterior vaginal wall near the vaginal apex of the control patients. Each specimen was divided into pieces. One piece was treated with formalin and embedded in 10% neutral-buffered paraffin for Masson's trichrome, HE, and immunohistochemical analyses. While the other piece was stored at -80˚C for RNA and protein analyses. Sometimes tissue was used only for one purpose due to some variability in the size of the sample.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Hematoxylin and eosin (HE) and Masson's trichrome staining\\u003c/h2\\u003e \\u003cp\\u003eThe vaginal specimens from both POP and control groups were sectioned longitudinally and put in 10% neutral buffered formalin for 2 days. They were cut into slides that were 4 \\u0026micro;m thick, and placed onto coated slides after embedded in paraffin. The slides were subjected to the temperature at 60˚C for 120 min, deparaffinized, and were gradually rehydrated utilising different concentrations of alcohol. They were then stained with HE and Masson's trichrome kit (Coolaber, SL7230, Beijing, China).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.4 Immunohistochemistry\\u003c/h2\\u003e \\u003cp\\u003eThe UltraSensitive SP IHC kit (Maixin Biotech, Kit-9710, Fuzhou, China), was employed to conduct immunochemistry. After heating for120 min at a temperature of 60˚C, deparaffinized, and rehydrated in gradient concentration alcohol. The slides were boiled in EDTA buffer for antigen retrieval in accordance with manufacturer. At room temperature, the sections were incubated for 10 min with 3% H2O2, blocked for 10 min with 5% goat serum. Subsequently, incubated with primary antibodies overnight at 4˚C. Next, sections were incubated for 10 min with biotinylated secondary antibodies at room temperature, and incubated for 10 min with streptavidin peroxidase at room temperature. After each step, specimens underwent PBS washing. Immune reaction was visualized using the DAB-ZLI-9017 kit (ZSGB-Biotech, Beijing, China). Finally, the slides underwent water washing prior to applying hematoxylin as a counterstain. Negative controls were treated with PBS instead of the primary antibody. The antibodies used are shown in Online Resource 1. Images were obtained utilizing a Nikon microscope (Nikon E100 Optical, Tokyo, Japan). The slides were examined using light microscopy at a magnification of 400\\u0026times;, maintaining the same camera settings. Selected five regions for every slide randomly. The positive area percentage and staining intensity were analyzed in all regions of the tissue (mean density\\u0026thinsp;=\\u0026thinsp;IOD sum/area sum) using ImageJ software (NIH, Bethesda, MD, USA). The average value of the selected five regions was utilized to quantify the level of target protein on each slide. Regions containing vessels were excluded from the analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Western blotting\\u003c/h2\\u003e \\u003cp\\u003eCutting off the mucosal and muscular layers of anterior vaginal wall, total proteins were extracted by lysing the lamina propria tissue of vaginal samples with RIPA lysis buffer (Seven Biotech, SW104, Beijing, China) as instructed by the manufacturer. Measured the proteins utilizing the Omni-Easy\\u0026trade; Instant BCA Protein Assay Kit (Epizyme Biomedical Technology, ZJ102, Shanghai, China). Then, same amounts of protein from each sample were separated after subjected to SDS- PAGE. The separated proteins were transferred onto PVDF membranes using a current of 200 mA at 4˚C for 1\\u0026ndash;3 h. The membranes were blocked with a solution containing 5% non-fat milk at room temperature for 2 h. Subsequently, the membranes were incubated with primary antibodies at 4˚C overnight. The primary antibodies used are shown in Online Resource 2. Afterwards, the membranes were incubated with goat anti-rabbit secondary antibodies (1:3000, SA00001-15, Proteintech, USA) at room temperature for 1 h. After each antibody incubation step, unbound antibodies underwent TBST washing five times. The enhanced chemiluminescence (ECL) (MCE, Shanghai, China) detection method was used to visualize target bands. Beta actin served as an internal control. ImageJ software was employed to determine the density of all bands. A proportion of the target protein to the internal reference protein was used to express values of target protein.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Reverse transcription and quantitative real-time PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal tissue RNA was obtained from the lamina propria of the anterior vaginal wall using TRIzol reagent (Seven Biotech, SM139-02, Beijing, China) as instructed by the manufacturer. The quality and quantity of total RNA were determined making use of the Nano-300 (All SHENG, Hangzhou, China) and cDNA synthesis was carried out using a reverse transcription kit (TransGen Biotech, AU341, Beijing, China) (1 \\u0026micro;g of total RNA and in a reaction volume of 20 \\u0026micro;l): 55\\u0026deg;C for 5 min, 85\\u0026deg;C for 5 s, then remained at 4\\u0026deg;C. RT-qPCR assays were performed on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) making use of the PerfectStart\\u0026reg; Green qPCR SuperMix kit (TransGen Biotech, AQ601, Beijing, China). Sangon Biotech (Shanghai, China) synthesized the primers. Primer sequences are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The reactions were conducted in triplicate. The reactions followed a protocol of 30 s at 94\\u0026deg;C, followed by 40 cycles of 5 s at 94\\u0026deg;C and 34 s at 60\\u0026deg;C, with a melting curve in the end. Data was analyzed using the relative quantitative method and GAPDH was used as the internal control. Three replicates being performed for each sample. The relative expression of each target gene was determined using 2-ΔΔCt method.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer sequences of each gene\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer sequences\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIGFBP5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward ACCTGAGATGAGACAGGAGTC\\u003c/p\\u003e \\u003cp\\u003eReverse GTAGAATCCTTTGCGGTCACAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCollagen I\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward AGGGCCAAGACGAAGACATC\\u003c/p\\u003e \\u003cp\\u003eReverse AGATCACGTCATCGCACAACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCollagen III\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward TGGCTACTTCTCGCTCTGCTT\\u003c/p\\u003e \\u003cp\\u003eReverse CGGATCCTGAGTCACAGACACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMMP2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward AGTTTCCATTCCGCTTCCAG\\u003c/p\\u003e \\u003cp\\u003eReverse CGGTCGTAGTCCTCAGTGGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTIMP1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward CATCACTACCTGCAGTTTTGTG\\u003c/p\\u003e \\u003cp\\u003eReverse TGGATAAACAGGGAAACACTGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward CAGGAGGCATTGCTGATGAT\\u003c/p\\u003e \\u003cp\\u003eReverse GAAGGCTGGGGCTCATTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe statistical software SPSS 16.0 (SPSS, Inc., Chicago, IL, USA) was utilized for conducting the statistical analysis. Data were analyzed with independent sample t-test for continuous data with normal distributions, Mann-Whitney test for data with non-normal distributions, and chi-squared test for categorical data. Normal continuous variables were expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD), while non-normal continuous variables were reported as median (interquartile range). Categorical variables were presented as numbers and proportions. GraphPad Prism 9.3.0 (GraphPad Software, Inc., La Jolla, CA, USA) was utilised for graphical plotting. Variations were regarded as statistically significant when P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Baseline characteristics of patients\\u003c/h2\\u003e \\u003cp\\u003eIn Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, the baseline characteristics of the patients in control group and POP group are showed. No noteworthy disparities were noted between the two groups in the way of age, body mass index (BMI), menopausal status, cesarean rate, parity, or gravidity (P\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05); the two groups were comparable. Menopause is medically characterized by the absence of menstruation for a minimum duration of one year.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePatient baseline characteristics\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBaseline Characteristics\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eControl group(n\\u0026thinsp;=\\u0026thinsp;20)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003ePOP group(n\\u0026thinsp;=\\u0026thinsp;20)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge, mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD, years\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e57.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.108\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e61.05\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.878\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.075\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBMI, mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD, kg/m\\u003csup\\u003e2\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e23.26\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.029\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e24.61\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.396\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.192\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGravity, mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD, per child\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e3(2-3.75)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2(1\\u0026ndash;3)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.066\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eParity, mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD, per child\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1.5(1\\u0026ndash;2)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1(1-1.75)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.130\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMenopause rate, %\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e70(14)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e90(18)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.107\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCesarean rate, %\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e20(4)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5(1)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.139\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSmoking habit, %\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0(0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0(0)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eData are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD), median (interquartile range), or percentage (n) according to the situation; p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant. BMI, body mass index.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Histologic and immunocytochemical staining\\u003c/h2\\u003e \\u003cp\\u003eHematoxylin-eosin (HE) staining demonstrated the features of histology of the intact vagina, including four anatomical layers: stratified squamous epithelial, lamina propria, muscularis, and adventitia (as shown in Online Resource 3). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e displays representative images for each stain. The localization of the majority of collagen within the lamina propria was showed through HE, Masson's trichrome, and immunocytochemical staining. Staining revealed presence of discoloration between the muscle bundles in the layer of muscularis, while no collagen immunostaining was identified in the stratified squamous epithelial layer. In relation to the control group, the appearance of collagen fibers in the lamina propria layer were much more discontinuous, loose, and disordered in the POP group, as depicted in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eImmunohistochemistry results for proteins are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. The POP group showed markedly lower expression of IGFBP5 compared to the control group (0.2949\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0045 vs. 0.2997\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0044, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). Similarly, the POP group exhibited reduced expression of collagen I (0.3138\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0062 vs. 0.3181\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0018, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) and collagen III (0.2687\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0076 vs. 0.2730\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0048, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) compared to the control group. Conversely, MMP2 expression in the POP group significantly exceeded than that in the control group (0.3066\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0121 vs. 0.2806\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0093, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001). However, TIMP1 expression in the POP group was comparable to that in the control group (0.2327\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0025 vs. 0.2329\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0025, P\\u0026thinsp;=\\u0026thinsp;0.865).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Western Blotting\\u003c/h2\\u003e \\u003cp\\u003eWestern blot analysis showed a obvious decrease expression of IGFBP5 (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.8160. vs 0.45\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.2333, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) in the POP group. The expression levels of collagen I (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.2045 vs. 0.16\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.1626, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01), collagen III (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.5584 vs. 0.18\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.0815, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) were markedly decreased in the POP group compared to the control group, as indicated by statistically significant differences. TIMP1 (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.4435 vs. 0.40\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.4225, P\\u0026thinsp;=\\u0026thinsp;0.084) was lower in the POP group. Conversely, western blot analysis revealed a significant increase expression of MMP2 (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.8619 vs. 3.11\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.1527, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) in the POP group. The results of western blot were corresponded to the immunohistochemical analysis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4. RT-qPCR\\u003c/h2\\u003e \\u003cp\\u003eAs observed in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e, changes in the levels of mRNA of IGFBP5, collagen I, collagen III, MMP2, and TIMP1 in the two groups were similar to the changes in their corresponding levels of protein. The mRNA level of IGFBP5 (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.0543 vs. 0.43\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.3842, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) in the POP group was obviously decreased compared to that in the control group. Expression of collagen I (1\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.0418 vs. 0.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.3731, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) and collagen III (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.9924 vs. 0.50\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.4926, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) mRNA levels in the POP group were notably reduced. While MMP2 mRNA level was significantly increased (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.7221 vs. 4.13\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.2018, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). The mRNA level of TIMP1, inhibitor of MMP activity, was similar in two groups (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.7827 vs. 0.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.3458, p\\u0026thinsp;=\\u0026thinsp;0.093).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. Comparison of IGFBP5\\u003c/h2\\u003e \\u003cp\\u003eTo make further efforts to validate the effect of IGFBP5 in the age and the development of POP, we compared the RT-qPCR and western blot analyses of IGFBP5 in patients with different ages and degrees of prolapse. The expression levels are presented in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. IGFBP5 mRNA expression in POP-Q stage III patients was obviously higher than POP-Q stage IV patients (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.8741 vs. 0.25\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.1576). Western blot analysis indicated that the IGFBP5 expression level in POP-Q stage III was also higher than that in POP-Q stage IV (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.5891 vs. 0.31\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.2070). Both the mRNA and protein results were statistically significantly different (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). IGFBP5 mRNA (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.8893 vs. 0.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.3576) and protein (1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.6044 vs. 0.48\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.2519) expression levels were obviously higher in younger POP patients (\\u0026lt;\\u0026thinsp;65 years old) when compared to older POP patients (\\u0026ge;\\u0026thinsp;65 years old) (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). The correlation between age and IGFBP5 expression levels are presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e. The protein (r\\u0026thinsp;=\\u0026thinsp;0.375, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) and mRNA (r\\u0026thinsp;=\\u0026thinsp;0.375, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) levels were negatively correlated with age.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eComparison of IGFBP5 expression\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"12\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c10\\\" colnum=\\\"10\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c11\\\" colnum=\\\"11\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c12\\\" colnum=\\\"12\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c7\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003eProtein expression\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c12\\\" namest=\\\"c9\\\"\\u003e \\u003cp\\u003emRNA expression\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"3\\\" nameend=\\\"c4\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003ecases\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eRelative Protein expression\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003et\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003eRelative mRNA expression\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c11\\\" namest=\\\"c10\\\"\\u003e \\u003cp\\u003et\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ep\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003ePOP-Q stage III\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.5891\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e2.778\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.01\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c10\\\" namest=\\\"c9\\\"\\u003e \\u003cp\\u003e1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.8741\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c11\\\"\\u003e \\u003cp\\u003e2.077\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e0.048\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003ePOP-Q stage IV\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.31\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.2070\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.25\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.1576\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c11\\\" namest=\\\"c10\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c12\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eage\\u0026nbsp;\\u0026lt;\\u0026nbsp;65\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.6044\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e3.020\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e0.007\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c10\\\" namest=\\\"c9\\\"\\u003e \\u003cp\\u003e1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.8893\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c11\\\"\\u003e \\u003cp\\u003e2.107\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c12\\\"\\u003e \\u003cp\\u003e0.045\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eage\\u0026nbsp;\\u0026ge;\\u0026nbsp;65\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c5\\\" namest=\\\"c4\\\"\\u003e \\u003cp\\u003e0.48\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.2519\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.3576\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c11\\\" namest=\\\"c10\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c12\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eP\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, statistically significant. Results are shown as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. a, comparisons between POP-Q stage III and POP-Q stage IV. b, comparisons between age\\u0026thinsp;\\u0026lt;\\u0026thinsp;65 and age\\u0026thinsp;\\u0026ge;\\u0026thinsp;65.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eWithin our current investigation, we analyzed the different expression levels of IGFBP5 in the lamina propria tissue among two groups. Patients with POP exhibited decreased expression levels of IGFBP5 protein and mRNA in the lamina propria tissue when compared to the control group. Previous reports have examined the expression and biological activities of IGFBP5 in various tissues, however, there has been no research on the expression of IGFBP5 or its involvement in POP. IGFBP5 is overexpressed in systemic sclerosis and idiopathic pulmonary fibrosis lung tissues\\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e. IGFBP5 is downregulated in head and neck squamous cell carcinoma\\u003csup\\u003e[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]\\u003c/sup\\u003e and upregulated in breast cancer and colorectal cancer\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]\\u003c/sup\\u003e. IGFBP5 can act as a positive or negative regulator of cellular proliferation and apoptosis under different conditions\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]\\u003c/sup\\u003e. A research study found that IGFBP5 promoted the proliferation of cardiac fibroblasts, while caused apoptosis in cardiac myocytes\\u003csup\\u003e[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]\\u003c/sup\\u003e. In primary human lung fibroblasts, the addition of exogenously recombinant IGFBP-5 and the presence of endogenous IGFBP-5 both stimulate the expression of the ECM and profibrotic factors\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. While in osteosarcoma cells, endogenous and exogenous IGFBP-5 exhibits contrary biological effects\\u003csup\\u003e[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]\\u003c/sup\\u003e. Li et al. noticed that IGFBP5 was observed to hinder breast cancer cells proliferation through an IGF-dependent pathway in vitro\\u003csup\\u003e[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]\\u003c/sup\\u003e, whereas another study indicated that IGFBP5 facilitates breast cancer cells proliferation in an IGF-independent manner\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e. Although IGFBP5 has a wide range of biological activities, its role in POP remains uncertain. As far as we know, no previous research has examined the correlation between declined IGFBP5 and the occurrence and progression of POP.\\u003c/p\\u003e \\u003cp\\u003eThe results of our study also revealed changes in ECM composition-related proteins in POP patients compared patients without POP. Both collagen I and collagen III expression levels were obviously declined in patients with POP. The connective tissue in the lamina propria tissue of anterior vagina approximates the vaginal fornix (apex) was once believed to be a reflective component of the endopelvic fascia\\u003csup\\u003e[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]\\u003c/sup\\u003e. Type of collagen most plentiful in interstitial connective tissue are collagen I and collagen III. Collagen I is primarily accountable for the mechanical strength of connective tissue, whereas collagen III and elastin are vital in maintaining tissue elasticity\\u003csup\\u003e[\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]\\u003c/sup\\u003e. As collagen I and collagen III are major constituents of ECM in connective tissue\\u003csup\\u003e[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]\\u003c/sup\\u003e, maintaining an appropriate equilibrium in the synthesis and degradation of collagen are crucial for ECM\\u003csup\\u003e[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]\\u003c/sup\\u003e. The connective tissue support structure of POP is thought to be damaged in strength rather than elasticity\\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. Considering the significant changes and important roles of MMP2 and TIMP1 in collagen degradation and ECM metabolism, we assessed the levels of MMP2 and TIMP1 expression (mRNA and protein). Both mRNA and protein expression of MMP2 was obviously upregulated, while there was no considerable alteration in TIMP1 levels among patients with POP and compared to the patients without POP. Duan et al. found the localization of IGFBP5 within ECM in tissues, as well as its ability to bind numerous ECM proteins\\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]\\u003c/sup\\u003e. Song et al. In a cardiac fibroblasts study, it was observed that the introduction of recombinant IGFBP5 led to an increased ERK phosphorylation, cell proliferation, and mRNA expression of collagen III, MMP2, and MMP9\\u003csup\\u003e[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]\\u003c/sup\\u003e. Zeeh et al. found that IGFBP-5 is likely involved in the increased expression of collagen during colitis\\u003csup\\u003e[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]\\u003c/sup\\u003e. In this study, our data are partially similar to previous data\\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]\\u003c/sup\\u003e. ECM remodeling is associated with multiple factors. Previous researches have shown that IGFBP5 could enhance the production and accumulation of ECM proteins, as well as by promoting the expression of growth factors in lung and skin tissues\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]\\u003c/sup\\u003e. This study found the IGFBP5 protein is positive associate with collagen I and collagen III proteins. These findings indicate that IGFBP5 may also be related to the metabolism of the ECM by increased MMP2.We speculate that downregulation of IGFBP5 reduced the fibrotic effect of fibroblasts in POP patients. The decreased IGFBP5 could affect the synthesis and degradation of ECM related proteins (e.g., collagen I, collagen III, and MMP2), resulting in changes protein levels. Our discovery suggest reduced expression of IGFBP5 may have an effect on the development of POP by influencing the collagen composition and metabolism of the ECM. The discovery we made establishes a foundation of IGFBP5 in the ECM of POP.\\u003c/p\\u003e \\u003cp\\u003eIn POP patients, the younger POP patients who were under 65 years old exhibited higher levels of IGFBP5 expression compared to elder patients who were over 65 years old. Various studies have provided evidence of a decrease in IGFBP5 levels in humans due to aging or certain diseases\\u003csup\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e. POP is an age-associated disease\\u003csup\\u003e[\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]\\u003c/sup\\u003e, the age of POP patients was negatively correlated with IGFBP5 expression in this study. A research proposed that reduction of IGFBP5 during proposed that the reduction of IGFBP5 during consecutive cell passages promotes the process of replicative senescence in fibroblast cells obtained from mouse embryos\\u003csup\\u003e[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]\\u003c/sup\\u003e. The involvement of IGFBP5 is indispensable the elevation of reactive oxygen species (ROS) and premature senescence triggered by the IL 6/sIL 6R pathway in human fibroblasts\\u003csup\\u003e[\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, our results on the relationship between age and IGFBP5 indicate that the decreased expression of IGFBP5 with age may contribute to trigger the senescence and apoptosis of POP fibroblasts, resulting in a decline in collagen synthesis and a rise in degradation within the connective tissue of POP. Furthermore, the comparison of IGFBP5 between POP-Q stage III and IV showed that IGFBP5 is lower in severity of prolapse IV. The findings on the influence of age and severity provide additional evidence that IGFBP5 is effective in the advancement of POP. In summary, IGFBP5 may be a vital indicator for early diagnosis and predict the severity of POP.\\u003c/p\\u003e \\u003cp\\u003eThere are limitations to this study. It will be important to expand the sample number, rendering the results more reliable. It is important to identifying and addressing all potential underlying causes is crucial in the management of POP since it can be attributed to multiple factors at the same time. For the sake of comprehensively understand the impacts of various factors on POP, including inflammation, tissue damage, and metabolism, it would be crucial to conduct further research on their effects. Only differences in IGFBP5 and ECM protein expression levels were investigated; further exploration is necessary to search the function of IGFBP5 in modifying the ECM and its impact on the development and prevalence of POP.\\u003c/p\\u003e \\u003cp\\u003eOverall, the levels of IGFBP5 and proteins related to ECM were significantly reduced in vaginal tissues of POP patients. The expression levels of IGFBP5 showed a negative correlation with both age and the severity of prolapse. The findings of our research indicate that decrease in IGFBP5 expression could contribute to the development of POP by affecting the content of collagen in the ECM, thus playing a crucial part in the aging process and the occurrence of POP. IGFBP5 may be a vital indicator for early diagnosis and development of POP.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Shengjing Hospital of China Medical University (No. 2022PS154K).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eConsent to participate\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInformed consent is it is not necessary to obtain in this study because the tissues are abandoned in surgery.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eFinancial support\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the National Key R\\u0026amp;D Program of China [grant number 2021YFC2701302], the National Natural Science Foundation of China [grant number 82271613], the Project supported by the Natural Science Foundation of Liaoning Province [grant number 2022-MS-081], and Project supported by the Natural Science Foundation of Liaoning Province [grant number 2022-BS-072].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eData availability\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData sets generated during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eCredit authorship contribution statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eZX and YD assisted in concept and design. YD, YC, YHand RG carried out the studies. YD, YC, YHand RG designed, performed, and analyzed the experiments. YD performed statistical analysis. YD was involved in writing original draft preparation. ZX was involved in writing review and editing NR and MD did supervision. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eDeclaration of competing interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare they have no conflict of\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003einterest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eCOLLINS S, LEWICKY-GAUPP C. Pelvic Organ Prolapse [J]. Gastroenterology clinics of North America, 2022, 51(1): 177-93. https://doi.org/10.1016/j.gtc.2021.10.011.\\u003c/li\\u003e\\n\\u003cli\\u003eWU J M, HUNDLEY A F, FULTON R G, et al. Forecasting the prevalence of pelvic floor disorders in U.S. Women: 2010 to 2050 [J]. Obstetrics and gynecology, 2009, 114(6): 1278-83. https://doi.org/10.1097/aog.0b013e3181c2ce96.\\u003c/li\\u003e\\n\\u003cli\\u003eLI Z Y, ZHU L, XU T, et al. [An epidemiologic study of pelvic organ prolapse in urban Chinese women: a population-based sample in China] [J]. Zhonghua yi xue za zhi, 2019, 99(11): 857-61. https://doi.org/10.3760/cma.j.issn.0376-2491.2019.11.012.\\u003c/li\\u003e\\n\\u003cli\\u003ePelvic Organ Prolapse: ACOG Practice Bulletin, Number 214 [J]. Obstetrics and gynecology, 2019, 134(5): e126-e42. https://doi.org/10.1097/aog.0000000000003519.\\u003c/li\\u003e\\n\\u003cli\\u003eQIU J, QIN M, FAN B, et al. Klotho Protein Reduced the Expression of Matrix Metalloproteinase-1 (MMP-1) and Matrix Metalloproteinase-3 (MMP-3) in Fibroblasts from Patients with Pelvic Organ Prolapse (POP) by Down-Regulating the Phosphorylation of ERK1/2 [J]. Medical science monitor : international medical journal of experimental and clinical research, 2019, 25: 3815-24. https://doi.org/10.12659/msm.913623.\\u003c/li\\u003e\\n\\u003cli\\u003eZENG C, LIU J, WANG H, et al. Correlation Between Autophagy and Collagen Deposition in Patients With Pelvic Organ Prolapse [J]. Female pelvic medicine \\u0026amp; reconstructive surgery, 2018, 24(3): 213-21. https://doi.org/10.1097/spv.0000000000000455.\\u003c/li\\u003e\\n\\u003cli\\u003eIGLESIA C B, SMITHLING K R. Pelvic Organ Prolapse [J]. American family physician, 2017, 96(3): 179-85.\\u003c/li\\u003e\\n\\u003cli\\u003eWANG S, L\\u0026uuml; D, ZHANG Z, et al. Effects of mechanical stretching on the morphology of extracellular polymers and the mRNA expression of collagens and small leucine-rich repeat proteoglycans in vaginal fibroblasts from women with pelvic organ prolapse [J]. PloS one, 2018, 13(4): e0193456. https://doi.org/10.1371/journal.pone.0193456.\\u003c/li\\u003e\\n\\u003cli\\u003eECKHARDT S, LAUS K, DEANDRADE S, et al. The impact of diabetes mellitus on pelvic organ prolapse recurrence after robotic sacrocolpopexy [J]. International urogynecology journal, 2023, 34(8): 1859-66. https://doi.org/10.1007/s00192-023-05455-y.\\u003c/li\\u003e\\n\\u003cli\\u003eBAXTER R C. IGF binding proteins in cancer: mechanistic and clinical insights [J]. Nature reviews Cancer, 2014, 14(5): 329-41. https://doi.org/10.1038/nrc3720.\\u003c/li\\u003e\\n\\u003cli\\u003eDUAN C, ALLARD J B. Insulin-Like Growth Factor Binding Protein-5 in Physiology and Disease [J]. Frontiers in endocrinology, 2020, 11: 100. https://doi.org/10.3389/fendo.2020.00100.\\u003c/li\\u003e\\n\\u003cli\\u003eDENNIS R A, PRZYBYLA B, GURLEY C, et al. Aging alters gene expression of growth and remodeling factors in human skeletal muscle both at rest and in response to acute resistance exercise [J]. Physiological genomics, 2008, 32(3): 393-400. https://doi.org/10.1152/physiolgenomics.00191.2007.\\u003c/li\\u003e\\n\\u003cli\\u003eMOHAN S, FARLEY J R, BAYLINK D J. Age-related changes in IGFBP-4 and IGFBP-5 levels in human serum and bone: implications for bone loss with aging [J]. Progress in growth factor research, 1995, 6(2-4): 465-73. https://doi.org/10.1016/0955-2235(95)00027-5.\\u003c/li\\u003e\\n\\u003cli\\u003eKIM K S, SEU Y B, BAEK S H, et al. Induction of cellular senescence by insulin-like growth factor binding protein-5 through a p53-dependent mechanism [J]. Molecular biology of the cell, 2007, 18(11): 4543-52. https://doi.org/10.1091/mbc.e07-03-0280.\\u003c/li\\u003e\\n\\u003cli\\u003eYOON I K, KIM H K, KIM Y K, et al. Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology [J]. Experimental gerontology, 2004, 39(9): 1369-78. https://doi.org/10.1016/j.exger.2004.07.002.\\u003c/li\\u003e\\n\\u003cli\\u003eHAMPEL B, FORTSCHEGGER K, RESSLER S, et al. Increased expression of extracellular proteins as a hallmark of human endothelial cell in vitro senescence [J]. Experimental gerontology, 2006, 41(5): 474-81. https://doi.org/10.1016/j.exger.2006.03.001.\\u003c/li\\u003e\\n\\u003cli\\u003eNGUYEN X X, MUHAMMAD L, NIETERT P J, et al. IGFBP-5 Promotes Fibrosis via Increasing Its Own Expression and That of Other Pro-fibrotic Mediators [J]. Frontiers in endocrinology, 2018, 9: 601. https://doi.org/10.3389/fendo.2018.00601.\\u003c/li\\u003e\\n\\u003cli\\u003eLI X, CAO X, LI X, et al. Expression level of insulin-like growth factor binding protein 5 mRNA is a prognostic factor for breast cancer [J]. Cancer science, 2007, 98(10): 1592-6. https://doi.org/10.1111/j.1349-7006.2007.00565.x.\\u003c/li\\u003e\\n\\u003cli\\u003eNGUYEN X X, RENAUD L, FEGHALI-BOSTWICK C. Identification of Impacted Pathways and Transcriptomic Markers as Potential Mediators of Pulmonary Fibrosis in Transgenic Mice Expressing Human IGFBP5 [J]. International journal of molecular sciences, 2021, 22(22). https://doi.org/10.3390/ijms222212609.\\u003c/li\\u003e\\n\\u003cli\\u003eYASUOKA H, JUKIC D M, ZHOU Z, et al. Insulin-like growth factor binding protein 5 induces skin fibrosis: A novel murine model for dermal fibrosis [J]. Arthritis and rheumatism, 2006, 54(9): 3001-10. https://doi.org/10.1002/art.22084.\\u003c/li\\u003e\\n\\u003cli\\u003eNGUYEN X X, SANDERSON M, HELKE K, et al. Phenotypic Characterization of Transgenic Mice Expressing Human IGFBP-5 [J]. International journal of molecular sciences, 2020, 22(1). https://doi.org/10.3390/ijms22010335.\\u003c/li\\u003e\\n\\u003cli\\u003eJEHLE P M, JEHLE D R, MOHAN S, et al. Serum levels of insulin-like growth factor system components and relationship to bone metabolism in Type 1 and Type 2 diabetes mellitus patients [J]. The Journal of endocrinology, 1998, 159(2): 297-306. https://doi.org/10.1677/joe.0.1590297.\\u003c/li\\u003e\\n\\u003cli\\u003eNOJIMA I, HOSODA R, TODA Y, et al. Downregulation of IGFBP5 contributes to replicative senescence via ERK2 activation in mouse embryonic fibroblasts [J]. Aging, 2022, 14(7): 2966-88. https://doi.org/10.18632/aging.203999.\\u003c/li\\u003e\\n\\u003cli\\u003eHUNG P S, KAO S Y, SHIH Y H, et al. Insulin-like growth factor binding protein-5 (IGFBP-5) suppresses the tumourigenesis of head and neck squamous cell carcinoma [J]. The Journal of pathology, 2008, 214(3): 368-76. https://doi.org/10.1002/path.2280.\\u003c/li\\u003e\\n\\u003cli\\u003eDENG Y, YANG X, HUA H, et al. IGFBP5 is Upregulated and Associated with Poor Prognosis in Colorectal Cancer [J]. International journal of general medicine, 2022, 15: 6485-97. https://doi.org/10.2147/ijgm.s370576.\\u003c/li\\u003e\\n\\u003cli\\u003eTANNO B, NEGRONI A, VITALI R, et al. Expression of insulin-like growth factor-binding protein 5 in neuroblastoma cells is regulated at the transcriptional level by c-Myb and B-Myb via direct and indirect mechanisms [J]. The Journal of biological chemistry, 2002, 277(26): 23172-80. https://doi.org/10.1074/jbc.m200141200.\\u003c/li\\u003e\\n\\u003cli\\u003eSONG S E, KIM Y W, KIM J Y, et al. IGFBP5 mediates high glucose-induced cardiac fibroblast activation [J]. Journal of molecular endocrinology, 2013, 50(3): 291-303. https://doi.org/10.1530/jme-12-0194.\\u003c/li\\u003e\\n\\u003cli\\u003eYIN P, XU Q, DUAN C. Paradoxical actions of endogenous and exogenous insulin-like growth factor-binding protein-5 revealed by RNA interference analysis [J]. The Journal of biological chemistry, 2004, 279(31): 32660-6. https://doi.org/10.1074/jbc.m401378200.\\u003c/li\\u003e\\n\\u003cli\\u003eBUTT A J, DICKSON K A, MCDOUGALL F, et al. Insulin-like growth factor-binding protein-5 inhibits the growth of human breast cancer cells in vitro and in vivo [J]. The Journal of biological chemistry, 2003, 278(32): 29676-85. https://doi.org/10.1074/jbc.m301965200.\\u003c/li\\u003e\\n\\u003cli\\u003eDELANCEY J O. Structural support of the urethra as it relates to stress urinary incontinence: the hammock hypothesis [J]. American journal of obstetrics and gynecology, 1994, 170(6): 1713-20; discussion 20-3. https://doi.org/10.1016/s0002-9378(94)70346-9.\\u003c/li\\u003e\\n\\u003cli\\u003eKIM T, SRIDHARAN I, MA Y, et al. Identifying distinct nanoscopic features of native collagen fibrils towards early diagnosis of pelvic organ prolapse [J]. Nanomedicine : nanotechnology, biology, and medicine, 2016, 12(3): 667-75. https://doi.org/10.1016/j.nano.2015.11.006.\\u003c/li\\u003e\\n\\u003cli\\u003eGOH J T. Biomechanical and biochemical assessments for pelvic organ prolapse [J]. Current opinion in obstetrics \\u0026amp; gynecology, 2003, 15(5): 391-4. https://doi.org/10.1097/00001703-200310000-00007.\\u003c/li\\u003e\\n\\u003cli\\u003eZHU Y P, XIE T, GUO T, et al. Evaluation of extracellular matrix protein expression and apoptosis in the uterosacral ligaments of patients with or without pelvic organ prolapse [J]. International urogynecology journal, 2021, 32(8): 2273-81. https://doi.org/10.1007/s00192-020-04446-7.\\u003c/li\\u003e\\n\\u003cli\\u003eELNEIL S. Complex pelvic floor failure and associated problems [J]. Best practice \\u0026amp; research Clinical gastroenterology, 2009, 23(4): 555-73. https://doi.org/10.1016/j.bpg.2009.04.011.\\u003c/li\\u003e\\n\\u003cli\\u003eZEEH J M, RILEY N E, HOFFMANN P, et al. Expression of insulin-like growth factor binding proteins and collagen in experimental colitis in rats [J]. European journal of gastroenterology \\u0026amp; hepatology, 2001, 13(7): 851-8. https://doi.org/10.1097/00042737-200107000-00014.\\u003c/li\\u003e\\n\\u003cli\\u003ePILEWSKI J M, LIU L, HENRY A C, et al. Insulin-like growth factor binding proteins 3 and 5 are overexpressed in idiopathic pulmonary fibrosis and contribute to extracellular matrix deposition [J]. The American journal of pathology, 2005, 166(2): 399-407. https://doi.org/10.1016/s0002-9440(10)62263-8.\\u003c/li\\u003e\\n\\u003cli\\u003eBRITO L G O, PEREIRA G M V, MOALLI P, et al. Age and/or postmenopausal status as risk factors for pelvic organ prolapse development: systematic review with meta-analysis [J]. International urogynecology journal, 2022, 33(1): 15-29. https://doi.org/10.1007/s00192-021-04953-1.\\u003c/li\\u003e\\n\\u003cli\\u003eKOJIMA H, KUNIMOTO H, INOUE T, et al. The STAT3-IGFBP5 axis is critical for IL-6/gp130-induced premature senescence in human fibroblasts [J]. Cell cycle (Georgetown, Tex), 2012, 11(4): 730-9. https://doi.org/10.4161/cc.11.4.19172.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"IGFBP5, ECM, vaginal wall, pelvic organ prolapse, aging\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3900632/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3900632/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eInsulin-like growth factor binding protein 5 (IGFBP5) seems to be associated with aging and extracellular matrix (ECM) fibrosis, but there has been no examination of the expression and effect on vaginal wall tissues among pelvic organ prolapse (POP) patients.\\u003c/p\\u003e\\u003ch2\\u003eObjective\\u003c/h2\\u003e \\u003cp\\u003eThis study aimed to investigate the expression and significance of IGFBP5 and ECM related proteins in anterior vaginal wall tissues among aged POP patients.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eTissues from the anterior vaginal wall were collected from 28 patients with POP and 20 patients without POP. The expression of protein and mRNA levels of IGFBP5 and ECM related proteins were evaluated in the vaginal wall tissues using immunohistochemistry, western blotting, and RT-qPCR techniques. The expression levels were then compared with clinical parameters.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eThe expression levels of protein and mRNA of IGFBP5, collagen I, and collagen III were significantly lower in the POP group. Protein and mRNA expression levels of MMP2 were significantly higher in the POP group. IGFBP5 protein and mRNA expression levels were were negatively correlated with age and significantly lower in older POP patients (\\u0026ge;\\u0026thinsp;65 years old) compared to younger POP patients (\\u0026lt;\\u0026thinsp;65 years old). IGFBP5 protein and mRNA expression levels were also significantly lower in POP-Q stage IV patients compared to POP-Q stage III patients.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eDownregulation of IGFBP5 may be related to alteration of the ECM and the IGFBP5 expression level is negatively correlated with the age and severity of prolapse. The significant decrease in IGFBP5 expression may play a crucial part in the aging process and the occurrence of POP.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Expression of insulin-like growth factor binding protein 5 in the vaginal wall tissues of older women with pelvic organ prolapse\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-02-09 21:17:50\",\"doi\":\"10.21203/rs.3.rs-3900632/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"98cc0462-abc3-45d6-82a6-247b87408f58\",\"owner\":[],\"postedDate\":\"February 9th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-02-09T21:17:52+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-02-09 21:17:50\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3900632\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3900632\",\"identity\":\"rs-3900632\",\"version\":[\"v1\"]},\"buildId\":\"zQwnuV7TCBrMSSSToR1PI\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}