{"paper_id":"807b80f9-cff0-4e98-8220-50b17f4573ab","body_text":"miR-424-5p Combined with miR-17-5p Has High Diagnostic Efficacy for Endometriosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article miR-424-5p Combined with miR-17-5p Has High Diagnostic Efficacy for Endometriosis Chunli Lin, Saili Zeng, Miaojie Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1116541/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Apr, 2022 Read the published version in Archives of Gynecology and Obstetrics → Version 1 posted 5 You are reading this latest preprint version Abstract Purpose: Endometriosis (EMT) is a chronic benign disease with high prevalence. This study investigated the diagnostic value of serum miR-17-5p, miR-424-5p, and their combined expressions for EMT. Methods: A total of 80 EMT patients of reproductive age were included as the study subjects, and another 80 healthy women of reproductive age were selected as the control group. The whole blood samples of enrolled subjects were collected and clinical characteristics were recorded. The miR-17-5p, miR-424-5p, VEGFA, IL-4, and IL-6 levels in the serum were measured. ROC curve was used to evaluate the diagnostic efficacy of miR-17-5p and miR-424-5p expressions for EMT. Pearson correlation was performed to analyze the correlation of miR-17-5p and miR-424-5p with clinical indexes in EMT patients. Results: miR-17-5p and miR-424-5p were significantly downregulated in EMT patients. For the diagnosis of EMT, the AUC of miR-17-5p was 0.865 and cutoff value was 0.890 (91.3% sensitivity and 85% specificity), the AUC of miR-424-5p was 0.737 and cutoff value was 0.915 (98.8% sensitivity and 61.2% specificity), the AUC of miR-424-5p combined with miR-17-5p was 0.938 and cutoff value was 2.205 (93.8% sensitivity and 88.7% specificity), with the diagnostic efficacy higher than miR-424-5p or miR-17-5p alone. The expressions of miR-17-5p and miR-424-5p were negatively correlated with dysmenorrhea, infertility, pelvic pain, and rASRM stage, but not with age, BMI, menstrual disorder, and nulliparity. VEGFA, IL-4, and IL-6 were remarkably increased in EMT patients, and both were inversely associated with miR-17-5p and miR-424-5p. Conclusion: miR-424-5p combined with miR-17-5p has high diagnostic efficacy for EMT. Obstetrics & Gynecology Endometriosis miR-424-5p miR-17-5p Combined diagnosis Receiver operating characteristic curve VEGFA Inflammatory cytokines Figures Figure 1 Figure 2 Figure 3 Introduction Endometriosis (EMT) is a commonly diagnosed, chronic, and hormone-dependent gynecological disease featured by the endometrial stroma and glands in the outside of the uterine cavity [ 1 , 2 ]. Since various inflammatory biomarkers such as interleukin (IL)-4, IL-6, IL-8, C-reactive protein, and tumor necrosis factor-α are increased in the serum of women with EMT, EMT is also regarded as an inflammatory disorder [ 3 ]. EMT affects 6–10% of reproductive women and 1–4% of postmenopausal women [ 4 ]. About 3.8–37% among the EMT patients will suffer from bowel involvement, mainly the rectosigmoid colon [ 5 ]. Chronic pelvic pain, dysmenorrhea, dyspareunia, and infertility are common symptoms [ 6 ]. Advanced EMT may cause gynecological malignancies, including ovarian cancer [ 7 ]. Diagnosis is a great challenge in EMT, whose diagnostic time is prolonged by an average of 6 to 12 years due to the lack of specific symptoms and noninvasive diagnostic tests [ 8 ]. EMT not only affects the physical and mental health of patients and their spouses but also brings great economic and medical burdens to society [ 9 ]. Therefore, it is extremely important to find effective diagnostic markers with strong specificity and high sensitivity for EMT. microRNAs (miRNAs) are small, single-stranded, and non-coding RNAs, with a length of 20 to 24 nucleotides, which mediate the level of messenger RNA in numerous eukaryotic lineages [ 10 , 11 ]. Abnormal miRNA expression is linked with various human disorders, including cardiovascular diseases, cancer, inflammatory diseases, and gynecologic pathology [ 12 ]. The differentially expressed miRNAs are key players in the occurrence of EMT and the associated infertility, with miR-17-5p being downregulated in the plasma from women with EMT [ 13 ]. The expression of miR-424-5p is reduced in the endometriotic mesenchymal cells, indicating its potential regulatory effect on EMT [ 14 ]. Since the sensitivity and specificity of a single miRNA as a biomarker to distinguish EMT patients from healthy women are relatively low [ 15 ], a combined diagnosis of miR-17-5p and miR-424-5p for EMT were investigated in this study. Angiogenesis is an important step in the development of endometriotic lesions, hence EMT is also regarded as an angiogenic disease [ 16 ]. Vascular endothelial growth factor A (VEGFA) is described as an essential mediator of angiogenesis, which refers to the occurrence of new vessels from pre-existent ones [ 17 ]. VEGFA plays a pivotal effect on the pathogenesis of EMT [ 18 ]. miR-17-5p can promote angiogenesis and inversely modulates the expression of VEGFA in EMT [ 19 , 20 ]. miR-424-5p negatively targets VEGFA and lowers the angiogenic activity of VEGFA protein [ 21 ]. However, there is no report about the diagnostic value of miR-17-5p combined with miR-424-5p for EMT. This study therein explored their combined diagnosis of EMT to improve diagnostic accuracy and efficacy. Methods Ethics statement This study was approved by the academic ethics committee of Hunan Province Maternal and Child Health care Hospital. All participants were fully informed and voluntarily signed the informed consent before sampling. Study subjects This study included 80 patients with EMT of reproductive age confirmed by pathology in the Department of Gynecology in Hunan Province Maternal and Child Health care Hospital from January 2019 to December 2020 as the experimental group (EMT group). Another 80 women of reproductive age with the healthy physical examination at the same period were selected as the control group. The whole blood samples of all enrolled subjects were collected, and the clinical characteristics were recorded, including age, body mass index (BMI), dysmenorrhea, menstrual disorder, infertility, parity, pelvic pain, and revised American Society for Reproductive Medicine (rASRM) stage (I/II or III/IV). The diagnostic criteria referred to the Specifications for the Diagnosis and Treatment of Endometriosis [ Chinese Journal of Obstetrics and Gynecology , 2015(3)] issued by Obstetrics and Gynecology Branch of Chinese Medical Association. Endometriosis was classified as mild (stages I and II), moderate to severe (stages III and IV) according to the ASRM staging criteria. Inclusion criteria included: women of reproductive age, aged 24-46 years, not using hormonal drugs within 3 months and without other inflammatory diseases. Exclusion criteria referred to the women: with adenomyosis, endometrial carcinoma, endometrial hyperplasia or polyps, chronic or acute inflammation, infectious diseases, malignancy, autoimmune diseases, and cardiovascular diseases. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) RT-qPCR was used to determine the expressions of miR-17-5p and miR-424-5p in the serum of the study population. The whole blood sample was placed in the 1.5 mL microcentrifuge tube without RNase, centrifuged at 3000 rpm for 20 minutes, and then the supernatant was stored in a 1.5 mL microcentrifuge tube without RNase and placed in a freezer at -80°C. Total RNA was extracted from samples according to the instructions of the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized using the PrimeScript RT reagent kit (Takara, Tokyo, Japan). RT-qPCR was performed using the SYBR PCR Green Master Mix kit (Qiagen, Hilden, Germany) under the following reaction conditions: at 95°C for 10 minutes, and then 40 cycles of 95°C for 15 seconds, 55°C for 30 seconds, and 70°C for 30 seconds. U6 was used as an internal reference. The relative levels of miR-17-5p and miR-424-5p after normalization to U6 were calculated using the 2 −ΔΔCt method. The primer sequences were shown in Table 1 . Table 1 Primer sequences Gene Forward 5’-3’ Reverse 5’-3’ miR-17-5p GCGGCCAAAGTGCTTACAGTG CAGCCACAAAAGAGCACAAT miR-424-5p GGCTAGTCAGCAGCAATTCATGT GTGCAGGGTCCGAGGT U6 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT Note: miR-17-5p , microRNA-17-5p; miR-424-5p , microRNA-424-5p. Enzyme-linked immunosorbent assay (ELISA) The corresponding Quantikine ELISA kits of VEGFA (ab119566, Abcam, Cambridge, UK), IL-4 (ab215089, Abcam), and IL-6 (EK0410, Boster, Pleasanton, CA, USA) were employed to quantify their concentrations in serum samples. Dual-luciferase assay The binding sites of miR-17-5p or miR-424-5p with VEGFA were predicted by the online database ( http://www.targetscan.org/vert_71/ ). The wild type (WT) or mutant (MUT) of VEGFA 3'-UTR were constructed and cloned into the pMIR vector (RiboBio, Guangzhou, China). HEK293T cells (CL-0005, Procell, Wuhan, China) were seeded into 48-well plates, and the constructed luciferase reporter vectors were co-transfected with miR-424-5p mimics, miR-17-5p mimics or mimics NC using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 48 hours of transfection, cells were collected and detected using the dual-luciferase assay kit (Promega, Madison, WI, USA). Statistical analysis SPSS 21.0 statistical software (IBM Corp. Armonk, NY, USA) and GraphPad Prism 8.0.1 software (GraphPad Software Inc., San Diego, CA, USA) were employed for the statistical analysis and mapping. Shapiro-Wilk test was used to verify the normal distribution. Measurement data of normal distribution were expressed as mean ± standard deviation (SD) and independent sample t test was adopted for comparisons between groups. Measurement data of non-normal distribution were presented as quartile and Mann-Whitney U test was used for comparisons between groups. The enumeration data were exhibited as cases and percentages, and Chi-square test was performed for comparisons between groups. Receiver operating characteristic (ROC) curve was used to evaluate the diagnostic efficacy of miRNAs and obtain the cutoff values. MedCalc was introduced to compare and analyze the differences of area under the curve (AUC). The correlation between the expressions of miRNAs and indexes was analyzed using Pearson correlation. Results Comparative analysis of general data and characteristics of participants A total of 160 subjects were included in this study, including 80 healthy controls and 80 EMT patients. We compared and analyzed the general data and clinicopathological characteristics of EMT patients and healthy controls. The results showed no statistical differences in age, BMI, menstrual disorder, nulliparity, and rASRM stage between EMT patients and healthy controls (all P > 0.05), while the proportions of dysmenorrhea, infertility and pelvic pain were remarkably increased in EMT patients ( P < 0.05) (Table 2 ). Table 2 Comparisons of general data and characteristics Control (N = 80) EMT (N = 80) P Age (years) 32.40 ± 2.67 31.50 ± 4.73 0.140 BMI (kg/m 2 ) 26.76 ± 6.25 27.39 ± 5.63 0.504 Dysmenorrhea 8 (10.00%) 36 (45.00%) < 0.001 Menstrual disorder 16 (20.00%) 21 (26.25%) 0.454 Infertility 12 (15.00%) 53 (66.25%) < 0.001 Nulliparity 39 (48.75%) 42 (52.50%) 0.752 Pelvic pain 25 (31.25%) 47 (58.75%) 0.001 rASRM stage Stage I/II / 32 (40.00%) / Stage III/IV / 48 (60.00%) / Note: EMT, endometriosis; BMI, body mass index; rASRM, revised American Society for Reproductive Medicine. miR-17-5p and miR-424-5p were downregulated in the serum of EMT patients In this study, RT-qPCR was used to determine the expressions of miR-17-5p and miR-424-5p in the serum of healthy controls and EMT patients, and revealed that the miR-17-5p and miR-424-5p levels in EMT patients were markedly lower than those of healthy controls (Figure 1 A-B, all P < 0.05). miR-17-5p combined with miR-424-5p had a high diagnostic value for EMT To further explore the clinical diagnostic efficacy of miR-17-5p and miR-424-5p in EMT, the ROC curve was plotted to distinguish EMT patients from healthy controls by the expression of miR-17-5p, miR-424-5p, or miR-17-5p combined with miR-424-5p. The results suggested that for the diagnosis of EMT, the AUC of miR-17-5p was 0.865 and the cutoff value was 0.890 (91.3% sensitivity and 85% specificity) (Figure 2 A); the AUC of miR-424-5p was 0.737 and the cutoff value was 0.915 (98.8% sensitivity and 61.2% specificity) (Figure 2 B). The diagnostic efficacy of miR-17-5p combined with miR-424-5p for EMT was further evaluated, and the results indicated an AUC of 0.939 and a cutoff value of 2.205 (93.8% sensitivity and 88.7% specificity) for combined diagnosis (Figure 2 C). MedCalc was employed to compare and analyze the AUC, and the results illustrated that miR-17-5p combined with miR-424-5p had prominently higher diagnostic efficacy than miR-424-5p or miR-17-5p alone (Figure 2 D) (all P < 0.05). Altogether, serum miR-17-5p and miR-424-5p could be used as biomarkers for EMT diagnosis, and their combination had a high diagnostic efficacy for EMT. Correlation analysis of serum miR-17-5p and miR-424-5p expressions with clinical indexes in EMT patients To investigate the correlation of serum miR-17-5p and miR-424-5p levels with clinical indicators of EMT patients, Pearson correlation analysis was performed and it demonstrated that the serum expressions of miR-17-5p and miR-424-5p were significantly inversely correlated with dysmenorrhea, infertility, pelvic pain, and rASRM stage in EMT patients (all P < 0.05), but not associated with age, BMI, menstrual disorder, and nulliparity (Table 3 ). Table 3 Correlation analysis of serum miR-17-5p and miR-424-5p expressions with clinical indexes in EMT patients EMT miR-17-5p miR-424-5p (N = 80) r P r P Age (years) 31.5 ± 4.73 0.086 0.447 0.124 0.274 BMI (kg/m 2 ) 27.39 ± 5.63 0.045 0.692 0.015 0.892 Dysmenorrhea 36 (45.00%) -0.334 0.003 -0.295 0.008 Menstrual disorder 21 (26.25%) 0.068 0.552 0.080 0.479 Infertility 53 (66.25%) -0.301 0.007 -0.271 0.015 Nulliparity 42 (52.50%) 0.108 0.340 0.119 0.292 Pelvic pain 47 (58.75%) -0.541 < 0.001 -0.534 < 0.001 rASRM stage Stage I/II 32 (40.00%) Stage III/IV 48 (60.00%) -0.601 < 0.001 -0.585 < 0.001 Note: miR-17-5p, microRNA-17-5p; miR-424-5p, microRNA-424-5p; EMT, endometriosis; BMI, body mass index; rASRM, revised American Society for Reproductive Medicine. miR-17-5p and miR-424-5p were negatively correlated with VEGFA, IL-4, and IL-6 in the serum of EMT patients EMT is an inflammatory disease and the levels of inflammatory cytokines IL-4 and IL-6 are increased in the serum and tissues of EMT patients [ 22 ]. Therefore, we subsequently validated the correlation of miR-17-5p and miR-424-5p with VEGFA, IL-4, and IL-6 in the serum of EMT patients. Firstly, the expressions of VEGFA, IL-4, and IL-6 in the serum were measured using ELISA, and the results unveiled remarkably increased levels of VEGFA, IL-4, and IL-6 in EMT patients compared with healthy controls (all P < 0.05) (Figure 3 A). Next, the correlations of miR-17-5p and miR-424-5p expressions with VEGFA, IL-4, and IL-6 concentrations were assessed. Pearson correlation scatter plot showed a negative correlation of miR-17-5p expression with VEGFA ( P < 0.0001; r = -0.8853), IL-4 ( P < 0.0001; r = -0.6552), and IL-6 (P < 0.0001; r = -0.7438) concentrations (Figure 3 B). Similarly, miR-424-5p expression was negatively related with VEGFA ( P < 0.0001; r = -0.8314), IL-4 ( P < 0.0001; r = -0.6167), and IL-6 ( P < 0.0001; r = -0.6870) concentrations (Figure 3 C). The binding sites of miR-17-5p or miR-424-5p with VEGFA were predicted respectively through the online database ( http://www.targetscan.org/vert_71/ ). The constructed VEGFA 3'-UTR vector (WT or MUT) was co-transfected with miRNA or NC to verify the targeted inhibitory relationship of miR-17-5p and miR-424-5p with VEGFA. The dual-luciferase assay suggested that the cell luciferase activities of miR-17-5p mimics or miR-424-5p mimics co-transfection with VEGFA-WT were markedly lowered relative to the mimics NC group (all P < 0.05), while the cell luciferase activities of co-transfection with VEGFA-MUT expressed no apparent change (Figure 3 D-E), confirming the targeted relationship of miR-17-5p and miR-424-5p with VEGFA. Collectively, both miR-17-5p and miR-424-5p might play a regulatory role in EMT by targeting VEGFA. Discussion EMT emerges as a common gynecologic disease with complicated pathogenesis, which mainly impacts women of reproductive age [ 23 ]. miRNAs are implicated in the nosogenesis of EMT and can be proposed as potential markers in EMT [ 9 ]. This study evaluated the diagnostic efficacy of miR-17-5p and miR-424-5p for EMT. Aberrant levels of miRNAs are implicated in the occurrence and progression of EMT [ 24 ] and proposed as biomarkers for early diagnosis and prediction of EMT [ 25 ]. First, the RT-qPCR revealed decreased expressions of miR-17-5p and miR-424-5p in women with EMT. Consistently, increasing reports unveil that miR-17-5p is weakly expressed in EMT patients, indicating its potential utility in clinical diagnosis of EMT [ 26 , 27 ]. miR-424-5p is involved in the development of EMT and is lowered in EMT lesions [ 14 , 28 ]. Thus, weak expressions of miR-17-5p and miR-424-5p in EMT patients may be potential biomarkers. Next, we further investigated the diagnostic value of miR-17-5p and miR-424-5p for EMT. For the diagnosis of EMT, the AUC of miR-17-5p was 0.865 and the cutoff value was 0.890 (91.3% sensitivity and 85% specificity). The AUC of miR-424-5p was 0.737 and the cutoff value was 0.915 (98.8% sensitivity and 61.2% specificity). AUC was 0.939 and the cutoff value was 2.205 (93.8% sensitivity and 88.7% specificity) for combined diagnosis of miR-17-5p and miR-424-5p. Previous studies also elicit that the combination of several different miRNAs, with improved sensitivity and specificity, has elevated diagnostic accuracy relative to individual miRNA [ 15 , 29 ]. Altogether, miR-17-5p and miR-424-5p both could be considered as biomarkers for EMT, and their combination had amplified this diagnostic efficacy. Infertility, chronic pelvic pain, and dysmenorrhea are primary symptoms of EMT [ 30 ]. Initially, the analysis of general data and clinic characteristics of EMT patients and healthy women unraveled the elevated proportions of dysmenorrhea, infertility, and pelvic pain in EMT patients. EMT individuals usually have a prolonged history of dysmenorrhea [ 31 ], and 30–50% of women with EMT also suffer from pelvic pain and infertility [ 32 ]. These clinical parameters could assist the diagnosis of EMT. Moreover, Pearson correlation analysis demonstrated a remarkable inverse correlation between miR-17-5p and miR-424-5p expressions with dysmenorrhea, infertility, pelvic pain, and rASRM stage in women with EMT. miR-17-5p is related to tubal factor infertility [ 33 ]. miR-424 is involved in the human estrogen receptor and progesterone receptor pathways [ 34 ]. There are limited studies about the relationship of miR-17-5p and miR-424-5p levels with clinical indicators in EMT patients. Our results initially identified the strong association of miR-17-5p and miR-424-5p with EMT. EMT is also defined as a chronic inflammatory disorder, and EMT-related pain often results from inflammation [ 35 ]. The abnormal expression of inflammatory factor IL-4 occurs in EMT patients [ 36 ]. IL-6 is a potential indicator for EMT and is positively related to the disease stage [ 37 ]. Angiogenesis is of great importance for the engraftment and development of endometriotic lesions [ 38 ]. VEGFA is an effective angiogenic factor and is regarded as a leading element in uterine angiogenesis [ 39 ]. Hence, we investigated the relationship of miR-17-5 and miR-424-5p with VEGFA, IL-4, and IL-6. Firstly, the ELISA unveiled the increased expressions of VEGFA, IL-4, and IL-6 in the serum of EMT patients. Similarly, VEGFA is also enhanced in the peritoneal fluid of EMT patients [ 40 ]. The previous studies have illustrated the increased concentration of IL-4 and IL-6, and the levels will increase as the disease progression [ 41 – 43 ]. Later, Pearson analysis revealed that miR-17-5p and miR-424-5p were negatively related with VEGFA, IL-4, and IL-6 respectively in EMT. Furthermore, the binding relationship of miR-17-5p and miR-424-5p with VEGFA was identified. miR-17-5p is an inflammation-associated miRNA and its overexpression can suppress the lipopolysaccharide-induced inflammatory response, including IL-6 level [ 44 ]. Consistently, there is a negative correlation between miR-17 level with IL-4 and IL-6 in EMT [ 22 ]. VEGFA is a target of miR-17-5p and miR-17-5p can repress cell migration, proliferation, and invasion in EMT by directly inhibiting VEGFA expression [ 20 ]. miR-424-5p upregulation leads to the reduced IL-6 level [ 45 ]. miR-424 is inversely linked with the levels of serum Il-4 and IL-6 [ 46 ]. miR-424-5p can bind to the VEGFA mRNA and miR-424-5p overexpression significantly reduces the expression of VEGFA protein in primary cells cultured from EMT patients [ 47 ]; PMID: 24608518). Briefly, miR-17-5p and miR-424-5p could regulate EMT by targeting VEGFA. In conclusion, this study first determined the expression of miR-424-5p in the serum of EMT patients and explored the diagnostic efficacy of miR-17-5p combined with miR-424-5p expressions for EMT using the ROC curve. Moreover, we analyzed the correlation of miR-17-5p and miR-424-5p levels with clinical indicators in EMT patients by Pearson correlation to provide a new entry point for clinical judgment. However, this study only investigated these two miRNAs. In addition, our study included a small number of cases and events. Addressing these deficiencies requires us to carry out the study of multiple miRNAs with significant expression differences, and expand the sample size to enhance the reliability of results. Furthermore, prognostic studies can be continued to further clarify the diagnostic value of miR-17-5p and miR-424-5p. The regulatory mechanism of miR-17-5p and miR-424-5p to target VEGFA in EMT is also worth exploring. Declarations Ethics statement This study was approved by the academic ethics committee of Hunan Province Maternal and Child Health care Hospital and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. All participants were fully informed and voluntarily signed the informed consent before sampling. Informed consent Informed consent was obtained from all individual participants included in the study. Acknowledgements Not applicable. Funding Not applicable. Declaration of competing interest The authors declare that they have no conflicts of interest. Availability of data and materials All the data generated or analyzed during this study are included in this published article. Authors’ contribution CLL is the guarantor of integrity of the entire study; CLL contributed to the study concepts, study design, definition of intellectual content, literature research, clinical studies, experimental studies, data acquisition, data analysis, statistical analysis, manuscript preparation, manuscript editing and manuscript review; SLZ contributed to the study concepts,study design, definition of intellectual content, literature research, clinical studies, data acquisition, data analysis, manuscript preparation, manuscript editing and manuscript review; MJL contributed to the study design, d clinical studies, experimental studies, data acquisition, data analysis, statistical analysis, manuscript preparation, manuscript editing and manuscript review; All authors read and approved the final manuscript. References Garcia-Ibanez P, Yepes-Molina L, Ruiz-Alcaraz AJ, Martinez-Esparza M, Moreno DA, Carvajal M et al (2020) Brassica Bioactives Could Ameliorate the Chronic Inflammatory Condition of Endometriosis.Int J Mol Sci21 Golabek A, Kowalska K, Olejnik A (2021) Polyphenols as a Diet Therapy Concept for Endometriosis-Current Opinion and Future Perspectives.Nutrients13 Anastasiu CV, Moga MA, Elena Neculau A, Balan A, Scarneciu I, Dragomir RM et al (2020) Biomarkers for the Noninvasive Diagnosis of Endometriosis: State of the Art and Future Perspectives.Int J Mol Sci21 Wang D, Yang Q, Wang H, Liu C (2021) Malignant transformation of hepatic endometriosis: a case report and literature review. BMC Womens Health 21:249 Hur C, Falcone T (2021) Robotic treatment of bowel endometriosis. Best Pract Res Clin Obstet Gynaecol 71:129–143 Greenbaum H, Galper BL, Decter DH, Eisenberg VH (2021) Endometriosis and autoimmunity: Can autoantibodies be used as a non-invasive early diagnostic tool? Autoimmun Rev 20:102795 Samimi M, Pourhanifeh MH, Mehdizadehkashi A, Eftekhar T, Asemi Z (2019) The role of inflammation, oxidative stress, angiogenesis, and apoptosis in the pathophysiology of endometriosis: Basic science and new insights based on gene expression. J Cell Physiol 234:19384–19392 Bjorkman S, Taylor HS (2019) MicroRNAs in endometriosis: biological function and emerging biomarker candidatesdagger. Biol Reprod 100:1135–1146 Agrawal S, Tapmeier T, Rahmioglu N, Kirtley S, Zondervan K, Becker C (2018) The miRNA Mirage: How Close Are We to Finding a Non-Invasive Diagnostic Biomarker in Endometriosis? A Systematic Review.Int J Mol Sci19 Fridrich A, Hazan Y, Moran Y (2019) Too Many False Targets for MicroRNAs: Challenges and Pitfalls in Prediction of miRNA Targets and Their Gene Ontology in Model and Non-model Organisms. BioEssays 41:e1800169 Mirna M, Paar V, Rezar R, Topf A, Eber M, Hoppe UC et al (2019) MicroRNAs in Inflammatory Heart Diseases and Sepsis-Induced Cardiac Dysfunction: A Potential Scope for the Future? Cells 8 Cho S, Mutlu L, Grechukhina O, Taylor HS (2015) Circulating microRNAs as potential biomarkers for endometriosis. Fertil Steril 103:1252–1260e1251 Cosar E, Mamillapalli R, Ersoy GS, Cho S, Seifer B, Taylor HS (2016) Serum microRNAs as diagnostic markers of endometriosis: a comprehensive array-based analysis. Fertil Steril 106:402–409 Huan Q, Cheng SC, Du ZH, Ma HF, Li C (2021) LncRNA AFAP1-AS1 regulates proliferation and apoptosis of endometriosis through activating STAT3/TGF-beta/Smad signaling via miR-424-5p. J Obstet Gynaecol Res 47:2394–2405 Papari E, Noruzinia M, Kashani L, Foster WG (2020) Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril 113:1232–1241 Hsu CY, Hsieh TH, Tsai CF, Tsai HP, Chen HS, Chang Y et al (2014) miRNA-199a-5p regulates VEGFA in endometrial mesenchymal stem cells and contributes to the pathogenesis of endometriosis. J Pathol 232:330–343 Bourhis M, Palle J, Galy-Fauroux I, Terme M (2021) Direct and Indirect Modulation of T Cells by VEGF-A Counteracted by Anti-Angiogenic Treatment. Front Immunol 12:616837 Ma Y, Huang YX, Chen YY (2017) miRNA34a5p downregulation of VEGFA in endometrial stem cells contributes to the pathogenesis of endometriosis. Mol Med Rep 16:8259–8264 Braza-Boils A, Gilabert-Estelles J, Ramon LA, Gilabert J, Mari-Alexandre J, Chirivella M et al (2013) Peritoneal fluid reduces angiogenesis-related microRNA expression in cell cultures of endometrial and endometriotic tissues from women with endometriosis. PLoS ONE 8:e62370 Pang QX, Liu Z (2020) miR-17-5p mitigates endometriosis by directly regulating VEGFA.J Biosci45 Braza-Boils A, Mari-Alexandre J, Gilabert J, Sanchez-Izquierdo D, Espana F, Estelles A et al (2014) MicroRNA expression profile in endometriosis: its relation to angiogenesis and fibrinolytic factors. Hum Reprod 29:978–988 Wang F, Wang H, Jin D, Zhang Y (2018) Serum miR-17, IL-4, and IL-6 levels for diagnosis of endometriosis. Med (Baltim) 97:e10853 Bazot M, Kermarrec E, Bendifallah S, Darai E (2021) MRI of intestinal endometriosis. Best Pract Res Clin Obstet Gynaecol 71:51–63 Zhao L, Gu C, Ye M, Zhang Z, Li L, Fan W et al (2018) Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis. Reprod Biol Endocrinol 16:4 Pateisky P, Pils D, Szabo L, Kuessel L, Husslein H, Schmitz A et al (2018) hsa-miRNA-154-5p expression in plasma of endometriosis patients is a potential diagnostic marker for the disease. Reprod Biomed Online 37:449–466 Jia SZ, Yang Y, Lang J, Sun P, Leng J (2013) Plasma miR-17-5p, miR-20a and miR-22 are down-regulated in women with endometriosis. Hum Reprod 28:322–330 Wu J, Cui SH, Li HZ, Li QH, Yuan R, Zhang YP et al (2016) Ultrasound diagnosis in gynecological acute abdomen. J Biol Regul Homeost Agents 30:211–217 Wang S, Yi M, Zhang X, Zhang T, Jiang L, Cao L et al (2021) Effects of CDKN2B-AS1 on cellular proliferation, invasion and AKT3 expression are attenuated by miR-424-5p in a model of ovarian endometriosis. Reprod Biomed Online 42:1057–1066 Xu SL, Tian YY, Zhou Y, Liu LQ (2020) Diagnostic value of circulating microRNAs in thyroid carcinoma: A systematic review and meta-analysis. Clin Endocrinol (Oxf) 93:489–498 Wu XG, Chen JJ, Zhou HL, Wu Y, Lin F, Shi J et al (2021) Identification and Validation of the Signatures of Infiltrating Immune Cells in the Eutopic Endometrium Endometria of Women With Endometriosis. Front Immunol 12:671201 Knox B, Ong YC, Bakar MA, Grover SR (2019) A longitudinal study of adolescent dysmenorrhoea into adulthood. Eur J Pediatr 178:1325–1332 Esfandiari F, Chitsazian F, Jahromi MG, Favaedi R, Bazrgar M, Aflatoonian R et al (2021) HOX cluster and their cofactors showed an altered expression pattern in eutopic and ectopic endometriosis tissues. Reprod Biol Endocrinol 19:132 Li J, Ren L, Li M, Yang C, Chen J, Chen Q (2021) Screening of Potential Key Genes Related to Tubal Factor Infertility Based on Competitive Endogenous RNA Network. Genet Test Mol Biomarkers 25:325–333 Feng Y, Zou S, Weijdegard B, Chen J, Cong Q, Fernandez-Rodriguez J et al (2014) The onset of human ectopic pregnancy demonstrates a differential expression of miRNAs and their cognate targets in the Fallopian tube. Int J Clin Exp Pathol 7:64–79 Wei Y, Liang Y, Lin H, Dai Y, Yao S (2020) Autonomic nervous system and inflammation interaction in endometriosis-associated pain. J Neuroinflammation 17:80 Zhou WJ, Yang HL, Shao J, Mei J, Chang KK, Zhu R et al (2019) Anti-inflammatory cytokines in endometriosis. Cell Mol Life Sci 76:2111–2132 Mosbah A, Nabiel Y, Khashaba E (2016) Interleukin-6, intracellular adhesion molecule-1, and glycodelin A levels in serum and peritoneal fluid as biomarkers for endometriosis. Int J Gynaecol Obstet 134:247–251 Korbel C, Gerstner MD, Menger MD, Laschke MW (2018) Notch signaling controls sprouting angiogenesis of endometriotic lesions. Angiogenesis 21:37–46 Delbandi AA, Mahmoudi M, Shervin A, Heidari S, Kolahdouz-Mohammadi R, Zarnani AH (2020) Evaluation of apoptosis and angiogenesis in ectopic and eutopic stromal cells of patients with endometriosis compared to non-endometriotic controls. BMC Womens Health 20:3 Danastas K, Miller EJ, Hey-Cunningham AJ, Murphy CR, Lindsay LA (2018) Expression of vascular endothelial growth factor A isoforms is dysregulated in women with endometriosis. Reprod Fertil Dev 30:651–657 Jiang J, Jiang Z, Xue M (2019) Serum and peritoneal fluid levels of interleukin-6 and interleukin-37 as biomarkers for endometriosis. Gynecol Endocrinol 35:571–575 Malutan AM, Drugan C, Drugan T, Ciortea R, Mihu D (2016) The association between interleukin-4 -590C/T genetic polymorphism, IL-4 serum level, and advanced endometriosis. Cent Eur J Immunol 41:176–181 Volpato LK, Horewicz VV, Bobinski F, Martins DF, Piovezan AP (2018) Annexin A1, FPR2/ALX, and inflammatory cytokine expression in peritoneal endometriosis. J Reprod Immunol 129:30–35 Yang S, Shi F, Du Y, Wang Z, Feng Y, Song J et al (2020) Long non-coding RNA CTBP1-AS2 enhances cervical cancer progression via up-regulation of ZNF217 through sponging miR-3163. Cancer Cell Int 20:343 Li C, Zhang M, Dai Y, Xu Z (2020) MicroRNA-424-5p regulates aortic smooth muscle cell function in atherosclerosis by blocking APOC3-mediated nuclear factor-kappaB signalling pathway. Exp Physiol 105:1035–1049 Zhang YZ, Wang J, Xu F (2017) Circulating miR-29b and miR-424 as Prognostic Markers in Patients with Acute Cerebral Infarction. Clin Lab 63:1667–1674 Braza-Boils A, Salloum-Asfar S, Mari-Alexandre J, Arroyo AB, Gonzalez-Conejero R, Barcelo-Molina M et al (2015) Peritoneal fluid modifies the microRNA expression profile in endometrial and endometriotic cells from women with endometriosis. Hum Reprod 30:2292–2302 Cite Share Download PDF Status: Published Journal Publication published 03 Apr, 2022 Read the published version in Archives of Gynecology and Obstetrics → Version 1 posted Reviews received at journal 22 Dec, 2021 Reviewers invited by journal 22 Dec, 2021 Editor invited by journal 22 Dec, 2021 Editor assigned by journal 02 Dec, 2021 First submitted to journal 25 Nov, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-1116541\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":71994595,\"identity\":\"5fb8f7af-b4c1-4e18-a2fc-98bebbef7b3c\",\"order_by\":0,\"name\":\"Chunli Lin\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYDACCQbGAw8MbHj42RsbH34gUgvDgYSKNDnJnsPNxhLEazlz2NhgRnqbAA8xOvhn9xgcSGxLS9wg+bANqN9OTreBkCV3zoC02CRul05se1DAkGxsdoCAFgOJHIgtO2cnthtIMBxI3EaklsOJG24ebJPgIVoL2Ps3GInUInEjrQAayInAQDYgwi/8M5I3PvgAjsrjDx9+qLCTI6gF3Z2kKR8Fo2AUjIJRgAMAANuDSPONQp6aAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0002-8918-2044\",\"institution\":\"Hunan Province Maternal and Child Health care Hospital\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Chunli\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":71994596,\"identity\":\"c406378c-46af-4493-bae0-242cbb459f6f\",\"order_by\":1,\"name\":\"Saili Zeng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Hospital of University of South China\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Saili\",\"middleName\":\"\",\"lastName\":\"Zeng\",\"suffix\":\"\"},{\"id\":71994597,\"identity\":\"88d13da2-8539-4797-8fda-fb780425afe5\",\"order_by\":2,\"name\":\"Miaojie Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"People's Hospital of Yuxi City\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Miaojie\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-11-26 09:27:26\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-1116541/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-1116541/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s00404-022-06492-6\",\"type\":\"published\",\"date\":\"2022-04-03T10:53:08+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":16832764,\"identity\":\"54b1f842-6a69-4aef-9a4b-a08384b11817\",\"added_by\":\"auto\",\"created_at\":\"2021-12-29 15:15:53\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":82910,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003emiR-17-5p and miR-424-5p were downregulated in the serum of EMT patients. (A) RT-qPCR was used to determine the expression of serum miR-17-5p; (B) RT-qPCR was adopted to measure the expression of serum miR-424-5p. Independent sample \\u003cem\\u003et\\u003c/em\\u003e test was employed to analyze panel A and B. ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1116541/v1/ac83c1221218c060f3af7968.png\"},{\"id\":16832767,\"identity\":\"c12dffd6-9bd4-46c4-bbcd-3c4c2a2bd2c0\",\"added_by\":\"auto\",\"created_at\":\"2021-12-29 15:15:54\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":398568,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eROC curve of miR-17-5p and miR-424-5p. (A) ROC curve of miR-17-5p; (B) ROC curve of miR-424-5p; (C) ROC curve of miR-17-5p combined with miR-424-5p; (D) The differences of AUC were compared and analyzed using MedCalc.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1116541/v1/5eb082b74bda3d082efb9b32.png\"},{\"id\":16832766,\"identity\":\"3cfa2f4d-2ba4-4a91-854d-07a8c0d45a5c\",\"added_by\":\"auto\",\"created_at\":\"2021-12-29 15:15:53\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":321454,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003emiR-17-5p and miR-424-5p were negatively correlated with VEGFA, IL-4, and IL-6 in the serum of EMT patients. (A) The expressions of serum VEGFA, IL-4, and IL-6 were measured using ELISA; (B) The correlation of miR-17-5p with serum VEGFA, IL-4, and IL-6 in EMT patients was assessed by Person analysis; (C) The association of miR-424-5p with serum VEGFA, IL-4, and IL-6 in EMT patients was evaluated by Person analysis; (D) The targeted inhibitory relationship of miR-17-5p and VEGFA was verified using the dual-luciferase reporter assay; (E) The targeted relationship of miR-424-5p and VEGFA was elucidated by the dual-luciferase assay. Independent sample \\u003cem\\u003et\\u003c/em\\u003e test was performed for comparisons between panels D and E. **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1116541/v1/db62460ef861ee72bede158e.png\"},{\"id\":19903387,\"identity\":\"895f6973-50f1-41d7-b126-5abe923b2562\",\"added_by\":\"auto\",\"created_at\":\"2022-04-03 10:53:16\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1275173,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1116541/v1/f0ebf2a5-4a87-476f-8d1e-773e8ab6f555.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"\\u003cp\\u003emiR-424-5p Combined with miR-17-5p Has High Diagnostic Efficacy for Endometriosis\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eEndometriosis (EMT) is a commonly diagnosed, chronic, and hormone-dependent gynecological disease featured by the endometrial stroma and glands in the outside of the uterine cavity [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Since various inflammatory biomarkers such as interleukin (IL)-4, IL-6, IL-8, C-reactive protein, and tumor necrosis factor-α are increased in the serum of women with EMT, EMT is also regarded as an inflammatory disorder [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. EMT affects 6\\u0026ndash;10% of reproductive women and 1\\u0026ndash;4% of postmenopausal women [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. About 3.8\\u0026ndash;37% among the EMT patients will suffer from bowel involvement, mainly the rectosigmoid colon [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Chronic pelvic pain, dysmenorrhea, dyspareunia, and infertility are common symptoms [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Advanced EMT may cause gynecological malignancies, including ovarian cancer [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Diagnosis is a great challenge in EMT, whose diagnostic time is prolonged by an average of 6 to 12 years due to the lack of specific symptoms and noninvasive diagnostic tests [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. EMT not only affects the physical and mental health of patients and their spouses but also brings great economic and medical burdens to society [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Therefore, it is extremely important to find effective diagnostic markers with strong specificity and high sensitivity for EMT.\\u003c/p\\u003e \\u003cp\\u003emicroRNAs (miRNAs) are small, single-stranded, and non-coding RNAs, with a length of 20 to 24 nucleotides, which mediate the level of messenger RNA in numerous eukaryotic lineages [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Abnormal miRNA expression is linked with various human disorders, including cardiovascular diseases, cancer, inflammatory diseases, and gynecologic pathology [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. The differentially expressed miRNAs are key players in the occurrence of EMT and the associated infertility, with miR-17-5p being downregulated in the plasma from women with EMT [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. The expression of miR-424-5p is reduced in the endometriotic mesenchymal cells, indicating its potential regulatory effect on EMT [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Since the sensitivity and specificity of a single miRNA as a biomarker to distinguish EMT patients from healthy women are relatively low [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], a combined diagnosis of miR-17-5p and miR-424-5p for EMT were investigated in this study.\\u003c/p\\u003e \\u003cp\\u003eAngiogenesis is an important step in the development of endometriotic lesions, hence EMT is also regarded as an angiogenic disease [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Vascular endothelial growth factor A (VEGFA) is described as an essential mediator of angiogenesis, which refers to the occurrence of new vessels from pre-existent ones [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. VEGFA plays a pivotal effect on the pathogenesis of EMT [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. miR-17-5p can promote angiogenesis and inversely modulates the expression of VEGFA in EMT [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. miR-424-5p negatively targets VEGFA and lowers the angiogenic activity of VEGFA protein [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. However, there is no report about the diagnostic value of miR-17-5p combined with miR-424-5p for EMT. This study therein explored their combined diagnosis of EMT to improve diagnostic accuracy and efficacy.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEthics statement\\u003c/h2\\u003e \\u003cp\\u003e This study was approved by the academic ethics committee of Hunan Province Maternal and Child Health care Hospital. All participants were fully informed and voluntarily signed the informed consent before sampling.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStudy subjects\\u003c/h2\\u003e \\u003cp\\u003e This study included 80 patients with EMT of reproductive age confirmed by pathology in the Department of Gynecology in Hunan Province Maternal and Child Health care Hospital from January 2019 to December 2020 as the experimental group (EMT group). Another 80 women of reproductive age with the healthy physical examination at the same period were selected as the control group. The whole blood samples of all enrolled subjects were collected, and the clinical characteristics were recorded, including age, body mass index (BMI), dysmenorrhea, menstrual disorder, infertility, parity, pelvic pain, and revised American Society for Reproductive Medicine (rASRM) stage (I/II or III/IV). The diagnostic criteria referred to the \\u003cem\\u003eSpecifications for the Diagnosis and Treatment of Endometriosis\\u003c/em\\u003e [\\u003cem\\u003eChinese Journal of Obstetrics and Gynecology\\u003c/em\\u003e, 2015(3)] issued by Obstetrics and Gynecology Branch of Chinese Medical Association. Endometriosis was classified as mild (stages I and II), moderate to severe (stages III and IV) according to the ASRM staging criteria.\\u003c/p\\u003e \\u003cp\\u003eInclusion criteria included: women of reproductive age, aged 24-46 years, not using hormonal drugs within 3 months and without other inflammatory diseases.\\u003c/p\\u003e \\u003cp\\u003eExclusion criteria referred to the women: with adenomyosis, endometrial carcinoma, endometrial hyperplasia or polyps, chronic or acute inflammation, infectious diseases, malignancy, autoimmune diseases, and cardiovascular diseases.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eReverse transcription quantitative polymerase chain reaction (RT-qPCR)\\u003c/h2\\u003e \\u003cp\\u003eRT-qPCR was used to determine the expressions of miR-17-5p and miR-424-5p in the serum of the study population. The whole blood sample was placed in the 1.5 mL microcentrifuge tube without RNase, centrifuged at 3000 rpm for 20 minutes, and then the supernatant was stored in a 1.5 mL microcentrifuge tube without RNase and placed in a freezer at -80\\u0026deg;C. Total RNA was extracted from samples according to the instructions of the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized using the PrimeScript RT reagent kit (Takara, Tokyo, Japan). RT-qPCR was performed using the SYBR PCR Green Master Mix kit (Qiagen, Hilden, Germany) under the following reaction conditions: at 95\\u0026deg;C for 10 minutes, and then 40 cycles of 95\\u0026deg;C for 15 seconds, 55\\u0026deg;C for 30 seconds, and 70\\u0026deg;C for 30 seconds. U6 was used as an internal reference. The relative levels of miR-17-5p and miR-424-5p after normalization to U6 were calculated using the 2\\u003csup\\u003e\\u0026minus;ΔΔCt\\u003c/sup\\u003e method. The primer sequences were shown in Table \\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer sequences\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward 5\\u0026rsquo;-3\\u0026rsquo;\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse 5\\u0026rsquo;-3\\u0026rsquo;\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003emiR-17-5p\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCGGCCAAAGTGCTTACAGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAGCCACAAAAGAGCACAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003emiR-424-5p\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGCTAGTCAGCAGCAATTCATGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTGCAGGGTCCGAGGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eU6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTTCGGCAGCACATATACTAAAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGCTTCACGAATTTGCGTGTCAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"3\\\"\\u003eNote: \\u003cem\\u003emiR-17-5p\\u003c/em\\u003e, microRNA-17-5p; \\u003cem\\u003emiR-424-5p\\u003c/em\\u003e, microRNA-424-5p.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEnzyme-linked immunosorbent assay (ELISA)\\u003c/h2\\u003e \\u003cp\\u003eThe corresponding Quantikine ELISA kits of VEGFA (ab119566, Abcam, Cambridge, UK), IL-4 (ab215089, Abcam), and IL-6 (EK0410, Boster, Pleasanton, CA, USA) were employed to quantify their concentrations in serum samples.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDual-luciferase assay\\u003c/h2\\u003e \\u003cp\\u003eThe binding sites of miR-17-5p or miR-424-5p with VEGFA were predicted by the online database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.targetscan.org/vert_71/\\u003c/span\\u003e\\u003c/span\\u003e\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e).\\u003c/span\\u003e The wild type (WT) or mutant (MUT) of VEGFA 3'-UTR were constructed and cloned into the pMIR vector (RiboBio, Guangzhou, China). HEK293T cells (CL-0005, Procell, Wuhan, China) were seeded into 48-well plates, and the constructed luciferase reporter vectors were co-transfected with miR-424-5p mimics, miR-17-5p mimics or mimics NC using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 48 hours of transfection, cells were collected and detected using the dual-luciferase assay kit (Promega, Madison, WI, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eSPSS 21.0 statistical software (IBM Corp. Armonk, NY, USA) and GraphPad Prism 8.0.1 software (GraphPad Software Inc., San Diego, CA, USA) were employed for the statistical analysis and mapping. Shapiro-Wilk test was used to verify the normal distribution. Measurement data of normal distribution were expressed as mean \\u0026plusmn; standard deviation (SD) and independent sample \\u003cem\\u003et\\u003c/em\\u003e test was adopted for comparisons between groups. Measurement data of non-normal distribution were presented as quartile and Mann-Whitney U test was used for comparisons between groups. The enumeration data were exhibited as cases and percentages, and Chi-square test was performed for comparisons between groups. Receiver operating characteristic (ROC) curve was used to evaluate the diagnostic efficacy of miRNAs and obtain the cutoff values. MedCalc was introduced to compare and analyze the differences of area under the curve (AUC). The correlation between the expressions of miRNAs and indexes was analyzed using Pearson correlation.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eComparative analysis of general data and characteristics of participants\\u003c/h2\\u003e \\u003cp\\u003eA total of 160 subjects were included in this study, including 80 healthy controls and 80 EMT patients. We compared and analyzed the general data and clinicopathological characteristics of EMT patients and healthy controls. The results showed no statistical differences in age, BMI, menstrual disorder, nulliparity, and rASRM stage between EMT patients and healthy controls (all \\u003cem\\u003eP\\u003c/em\\u003e \\u0026gt; 0.05), while the proportions of dysmenorrhea, infertility and pelvic pain were remarkably increased in EMT patients (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05) (Table \\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eComparisons of general data and characteristics\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eControl (N = 80)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eEMT (N = 80)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge (years)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e32.40 \\u0026plusmn; 2.67\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e31.50 \\u0026plusmn; 4.73\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.140\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBMI (kg/m\\u003csup\\u003e2\\u003c/sup\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e26.76 \\u0026plusmn; 6.25\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e27.39 \\u0026plusmn; 5.63\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.504\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eDysmenorrhea\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e8 (10.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e36 (45.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt; 0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMenstrual disorder\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16 (20.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e21 (26.25%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.454\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eInfertility\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e12 (15.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e53 (66.25%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt; 0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNulliparity\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e39 (48.75%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e42 (52.50%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.752\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePelvic pain\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e25 (31.25%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e47 (58.75%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003erASRM stage\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eStage I/II\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e32 (40.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eStage III/IV\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e48 (60.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"4\\\"\\u003eNote: EMT, endometriosis; BMI, body mass index; rASRM, revised American Society for Reproductive Medicine.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003emiR-17-5p and miR-424-5p were downregulated in the serum of EMT patients\\u003c/h2\\u003e \\u003cp\\u003eIn this study, RT-qPCR was used to determine the expressions of miR-17-5p and miR-424-5p in the serum of healthy controls and EMT patients, and revealed that the miR-17-5p and miR-424-5p levels in EMT patients were markedly lower than those of healthy controls (Figure \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA-B, all \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003emiR-17-5p combined with miR-424-5p had a high diagnostic value for EMT\\u003c/h2\\u003e \\u003cp\\u003eTo further explore the clinical diagnostic efficacy of miR-17-5p and miR-424-5p in EMT, the ROC curve was plotted to distinguish EMT patients from healthy controls by the expression of miR-17-5p, miR-424-5p, or miR-17-5p combined with miR-424-5p. The results suggested that for the diagnosis of EMT, the AUC of miR-17-5p was 0.865 and the cutoff value was 0.890 (91.3% sensitivity and 85% specificity) (Figure \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA); the AUC of miR-424-5p was 0.737 and the cutoff value was 0.915 (98.8% sensitivity and 61.2% specificity) (Figure \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). The diagnostic efficacy of miR-17-5p combined with miR-424-5p for EMT was further evaluated, and the results indicated an AUC of 0.939 and a cutoff value of 2.205 (93.8% sensitivity and 88.7% specificity) for combined diagnosis (Figure \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). MedCalc was employed to compare and analyze the AUC, and the results illustrated that miR-17-5p combined with miR-424-5p had prominently higher diagnostic efficacy than miR-424-5p or miR-17-5p alone (Figure \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD) (all \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05). Altogether, serum miR-17-5p and miR-424-5p could be used as biomarkers for EMT diagnosis, and their combination had a high diagnostic efficacy for EMT.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCorrelation analysis of serum miR-17-5p and miR-424-5p expressions with clinical indexes in EMT patients\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the correlation of serum miR-17-5p and miR-424-5p levels with clinical indicators of EMT patients, Pearson correlation analysis was performed and it demonstrated that the serum expressions of miR-17-5p and miR-424-5p were significantly inversely correlated with dysmenorrhea, infertility, pelvic pain, and rASRM stage in EMT patients (all \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05), but not associated with age, BMI, menstrual disorder, and nulliparity (Table \\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eCorrelation analysis of serum miR-17-5p and miR-424-5p expressions with clinical indexes in EMT patients\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"6\\\"\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eEMT\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c4\\\" namest=\\\"c3\\\"\\u003e \\u003cp\\u003emiR-17-5p\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c6\\\" namest=\\\"c5\\\"\\u003e \\u003cp\\u003emiR-424-5p\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e(N = 80)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003er\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003er\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge (years)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e31.5 \\u0026plusmn; 4.73\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.086\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.447\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.124\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.274\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBMI (kg/m\\u003csup\\u003e2\\u003c/sup\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e27.39 \\u0026plusmn; 5.63\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.045\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.692\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.015\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.892\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eDysmenorrhea\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e36 (45.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.334\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.003\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-0.295\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.008\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMenstrual disorder\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e21 (26.25%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.068\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.552\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.080\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.479\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eInfertility\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e53 (66.25%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.301\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.007\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-0.271\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.015\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNulliparity\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e42 (52.50%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.108\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.340\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.119\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.292\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePelvic pain\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e47 (58.75%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.541\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt; 0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-0.534\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u0026lt; 0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003erASRM stage\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eStage I/II\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e32 (40.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eStage III/IV\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e48 (60.00%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.601\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026lt; 0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-0.585\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u0026lt; 0.001\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"6\\\"\\u003eNote: miR-17-5p, microRNA-17-5p; miR-424-5p, microRNA-424-5p; EMT, endometriosis; BMI, body mass index; rASRM, revised American Society for Reproductive Medicine.\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003emiR-17-5p and miR-424-5p were negatively correlated with VEGFA, IL-4, and IL-6 in the serum of EMT patients\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eEMT is an inflammatory disease and the levels of inflammatory cytokines IL-4 and IL-6 are increased in the serum and tissues of EMT patients [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Therefore, we subsequently validated the correlation of miR-17-5p and miR-424-5p with VEGFA, IL-4, and IL-6 in the serum of EMT patients. Firstly, the expressions of VEGFA, IL-4, and IL-6 in the serum were measured using ELISA, and the results unveiled remarkably increased levels of VEGFA, IL-4, and IL-6 in EMT patients compared with healthy controls (all \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05) (Figure \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Next, the correlations of miR-17-5p and miR-424-5p expressions with VEGFA, IL-4, and IL-6 concentrations were assessed. Pearson correlation scatter plot showed a negative correlation of miR-17-5p expression with VEGFA (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.0001; r = -0.8853), IL-4 (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.0001; r = -0.6552), and IL-6 (P \\u0026lt; 0.0001; r = -0.7438) concentrations (Figure \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Similarly, miR-424-5p expression was negatively related with VEGFA (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.0001; r = -0.8314), IL-4 (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.0001; r = -0.6167), and IL-6 (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.0001; r = -0.6870) concentrations (Figure \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). The binding sites of miR-17-5p or miR-424-5p with VEGFA were predicted respectively through the online database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.targetscan.org/vert_71/\\u003c/span\\u003e\\u003c/span\\u003e). The constructed VEGFA 3'-UTR vector (WT or MUT) was co-transfected with miRNA or NC to verify the targeted inhibitory relationship of miR-17-5p and miR-424-5p with VEGFA. The dual-luciferase assay suggested that the cell luciferase activities of miR-17-5p mimics or miR-424-5p mimics co-transfection with VEGFA-WT were markedly lowered relative to the mimics NC group (all \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05), while the cell luciferase activities of co-transfection with VEGFA-MUT expressed no apparent change (Figure \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD-E), confirming the targeted relationship of miR-17-5p and miR-424-5p with VEGFA. Collectively, both miR-17-5p and miR-424-5p might play a regulatory role in EMT by targeting VEGFA.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eEMT emerges as a common gynecologic disease with complicated pathogenesis, which mainly impacts women of reproductive age [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. miRNAs are implicated in the nosogenesis of EMT and can be proposed as potential markers in EMT [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. This study evaluated the diagnostic efficacy of miR-17-5p and miR-424-5p for EMT.\\u003c/p\\u003e \\u003cp\\u003eAberrant levels of miRNAs are implicated in the occurrence and progression of EMT [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e] and proposed as biomarkers for early diagnosis and prediction of EMT [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. First, the RT-qPCR revealed decreased expressions of miR-17-5p and miR-424-5p in women with EMT. Consistently, increasing reports unveil that miR-17-5p is weakly expressed in EMT patients, indicating its potential utility in clinical diagnosis of EMT [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. miR-424-5p is involved in the development of EMT and is lowered in EMT lesions [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Thus, weak expressions of miR-17-5p and miR-424-5p in EMT patients may be potential biomarkers.\\u003c/p\\u003e \\u003cp\\u003eNext, we further investigated the diagnostic value of miR-17-5p and miR-424-5p for EMT. For the diagnosis of EMT, the AUC of miR-17-5p was 0.865 and the cutoff value was 0.890 (91.3% sensitivity and 85% specificity). The AUC of miR-424-5p was 0.737 and the cutoff value was 0.915 (98.8% sensitivity and 61.2% specificity). AUC was 0.939 and the cutoff value was 2.205 (93.8% sensitivity and 88.7% specificity) for combined diagnosis of miR-17-5p and miR-424-5p. Previous studies also elicit that the combination of several different miRNAs, with improved sensitivity and specificity, has elevated diagnostic accuracy relative to individual miRNA [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Altogether, miR-17-5p and miR-424-5p both could be considered as biomarkers for EMT, and their combination had amplified this diagnostic efficacy.\\u003c/p\\u003e \\u003cp\\u003eInfertility, chronic pelvic pain, and dysmenorrhea are primary symptoms of EMT [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Initially, the analysis of general data and clinic characteristics of EMT patients and healthy women unraveled the elevated proportions of dysmenorrhea, infertility, and pelvic pain in EMT patients. EMT individuals usually have a prolonged history of dysmenorrhea [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e], and 30\\u0026ndash;50% of women with EMT also suffer from pelvic pain and infertility [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. These clinical parameters could assist the diagnosis of EMT. Moreover, Pearson correlation analysis demonstrated a remarkable inverse correlation between miR-17-5p and miR-424-5p expressions with dysmenorrhea, infertility, pelvic pain, and rASRM stage in women with EMT. miR-17-5p is related to tubal factor infertility [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. miR-424 is involved in the human estrogen receptor and progesterone receptor pathways [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. There are limited studies about the relationship of miR-17-5p and miR-424-5p levels with clinical indicators in EMT patients. Our results initially identified the strong association of miR-17-5p and miR-424-5p with EMT.\\u003c/p\\u003e \\u003cp\\u003eEMT is also defined as a chronic inflammatory disorder, and EMT-related pain often results from inflammation [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. The abnormal expression of inflammatory factor IL-4 occurs in EMT patients [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. IL-6 is a potential indicator for EMT and is positively related to the disease stage [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Angiogenesis is of great importance for the engraftment and development of endometriotic lesions [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. VEGFA is an effective angiogenic factor and is regarded as a leading element in uterine angiogenesis [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. Hence, we investigated the relationship of miR-17-5 and miR-424-5p with VEGFA, IL-4, and IL-6. Firstly, the ELISA unveiled the increased expressions of VEGFA, IL-4, and IL-6 in the serum of EMT patients. Similarly, VEGFA is also enhanced in the peritoneal fluid of EMT patients [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. The previous studies have illustrated the increased concentration of IL-4 and IL-6, and the levels will increase as the disease progression [\\u003cspan additionalcitationids=\\\"CR42\\\" citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Later, Pearson analysis revealed that miR-17-5p and miR-424-5p were negatively related with VEGFA, IL-4, and IL-6 respectively in EMT. Furthermore, the binding relationship of miR-17-5p and miR-424-5p with VEGFA was identified. miR-17-5p is an inflammation-associated miRNA and its overexpression can suppress the lipopolysaccharide-induced inflammatory response, including IL-6 level [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. Consistently, there is a negative correlation between miR-17 level with IL-4 and IL-6 in EMT [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. VEGFA is a target of miR-17-5p and miR-17-5p can repress cell migration, proliferation, and invasion in EMT by directly inhibiting VEGFA expression [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. miR-424-5p upregulation leads to the reduced IL-6 level [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. miR-424 is inversely linked with the levels of serum Il-4 and IL-6 [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]. miR-424-5p can bind to the VEGFA mRNA and miR-424-5p overexpression significantly reduces the expression of VEGFA protein in primary cells cultured from EMT patients [\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]; PMID: 24608518). Briefly, miR-17-5p and miR-424-5p could regulate EMT by targeting VEGFA.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, this study first determined the expression of miR-424-5p in the serum of EMT patients and explored the diagnostic efficacy of miR-17-5p combined with miR-424-5p expressions for EMT using the ROC curve. Moreover, we analyzed the correlation of miR-17-5p and miR-424-5p levels with clinical indicators in EMT patients by Pearson correlation to provide a new entry point for clinical judgment. However, this study only investigated these two miRNAs. In addition, our study included a small number of cases and events. Addressing these deficiencies requires us to carry out the study of multiple miRNAs with significant expression differences, and expand the sample size to enhance the reliability of results. Furthermore, prognostic studies can be continued to further clarify the diagnostic value of miR-17-5p and miR-424-5p. The regulatory mechanism of miR-17-5p and miR-424-5p to target VEGFA in EMT is also worth exploring.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was approved by the academic ethics committee of\\u0026nbsp;Hunan Province Maternal and Child Health care Hospital and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. All participants were fully informed and voluntarily signed the informed consent before sampling.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInformed consent\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInformed consent was obtained from all individual participants included in the study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of competing interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no conflicts of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll the data generated or analyzed during this study are included in this published article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026rsquo; contribution\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCLL is the guarantor of integrity of the entire study; CLL contributed to the study concepts, study design, definition of intellectual content, literature research, clinical studies, experimental studies, data acquisition, data analysis, statistical analysis, manuscript preparation, manuscript editing and manuscript review; SLZ contributed to the study concepts,study design, definition of intellectual content, literature research, clinical studies, data acquisition, data analysis, manuscript preparation, manuscript editing and manuscript review; MJL contributed to the study design, d clinical studies, experimental studies, data acquisition, data analysis, statistical analysis, manuscript preparation, manuscript editing and manuscript review; All authors read and approved the final manuscript.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eGarcia-Ibanez P, Yepes-Molina L, Ruiz-Alcaraz AJ, Martinez-Esparza M, Moreno DA, Carvajal M et al (2020) Brassica Bioactives Could Ameliorate the Chronic Inflammatory Condition of Endometriosis.Int J Mol Sci21\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGolabek A, Kowalska K, Olejnik A (2021) Polyphenols as a Diet Therapy Concept for Endometriosis-Current Opinion and Future Perspectives.Nutrients13\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAnastasiu CV, Moga MA, Elena Neculau A, Balan A, Scarneciu I, Dragomir RM et al (2020) Biomarkers for the Noninvasive Diagnosis of Endometriosis: State of the Art and Future Perspectives.Int J Mol Sci21\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang D, Yang Q, Wang H, Liu C (2021) Malignant transformation of hepatic endometriosis: a case report and literature review. BMC Womens Health 21:249\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHur C, Falcone T (2021) Robotic treatment of bowel endometriosis. Best Pract Res Clin Obstet Gynaecol 71:129\\u0026ndash;143\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGreenbaum H, Galper BL, Decter DH, Eisenberg VH (2021) Endometriosis and autoimmunity: Can autoantibodies be used as a non-invasive early diagnostic tool? Autoimmun Rev 20:102795\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSamimi M, Pourhanifeh MH, Mehdizadehkashi A, Eftekhar T, Asemi Z (2019) The role of inflammation, oxidative stress, angiogenesis, and apoptosis in the pathophysiology of endometriosis: Basic science and new insights based on gene expression. J Cell Physiol 234:19384\\u0026ndash;19392\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBjorkman S, Taylor HS (2019) MicroRNAs in endometriosis: biological function and emerging biomarker candidatesdagger. Biol Reprod 100:1135\\u0026ndash;1146\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAgrawal S, Tapmeier T, Rahmioglu N, Kirtley S, Zondervan K, Becker C (2018) The miRNA Mirage: How Close Are We to Finding a Non-Invasive Diagnostic Biomarker in Endometriosis? A Systematic Review.Int J Mol Sci19\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFridrich A, Hazan Y, Moran Y (2019) Too Many False Targets for MicroRNAs: Challenges and Pitfalls in Prediction of miRNA Targets and Their Gene Ontology in Model and Non-model Organisms. BioEssays 41:e1800169\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMirna M, Paar V, Rezar R, Topf A, Eber M, Hoppe UC et al (2019) MicroRNAs in Inflammatory Heart Diseases and Sepsis-Induced Cardiac Dysfunction: A Potential Scope for the Future? Cells 8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCho S, Mutlu L, Grechukhina O, Taylor HS (2015) Circulating microRNAs as potential biomarkers for endometriosis. Fertil Steril 103:1252\\u0026ndash;1260e1251\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCosar E, Mamillapalli R, Ersoy GS, Cho S, Seifer B, Taylor HS (2016) Serum microRNAs as diagnostic markers of endometriosis: a comprehensive array-based analysis. Fertil Steril 106:402\\u0026ndash;409\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuan Q, Cheng SC, Du ZH, Ma HF, Li C (2021) LncRNA AFAP1-AS1 regulates proliferation and apoptosis of endometriosis through activating STAT3/TGF-beta/Smad signaling via miR-424-5p. J Obstet Gynaecol Res 47:2394\\u0026ndash;2405\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePapari E, Noruzinia M, Kashani L, Foster WG (2020) Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril 113:1232\\u0026ndash;1241\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHsu CY, Hsieh TH, Tsai CF, Tsai HP, Chen HS, Chang Y et al (2014) miRNA-199a-5p regulates VEGFA in endometrial mesenchymal stem cells and contributes to the pathogenesis of endometriosis. J Pathol 232:330\\u0026ndash;343\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBourhis M, Palle J, Galy-Fauroux I, Terme M (2021) Direct and Indirect Modulation of T Cells by VEGF-A Counteracted by Anti-Angiogenic Treatment. Front Immunol 12:616837\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa Y, Huang YX, Chen YY (2017) miRNA34a5p downregulation of VEGFA in endometrial stem cells contributes to the pathogenesis of endometriosis. Mol Med Rep 16:8259\\u0026ndash;8264\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBraza-Boils A, Gilabert-Estelles J, Ramon LA, Gilabert J, Mari-Alexandre J, Chirivella M et al (2013) Peritoneal fluid reduces angiogenesis-related microRNA expression in cell cultures of endometrial and endometriotic tissues from women with endometriosis. PLoS ONE 8:e62370\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePang QX, Liu Z (2020) miR-17-5p mitigates endometriosis by directly regulating VEGFA.J Biosci45\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBraza-Boils A, Mari-Alexandre J, Gilabert J, Sanchez-Izquierdo D, Espana F, Estelles A et al (2014) MicroRNA expression profile in endometriosis: its relation to angiogenesis and fibrinolytic factors. Hum Reprod 29:978\\u0026ndash;988\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang F, Wang H, Jin D, Zhang Y (2018) Serum miR-17, IL-4, and IL-6 levels for diagnosis of endometriosis. Med (Baltim) 97:e10853\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBazot M, Kermarrec E, Bendifallah S, Darai E (2021) MRI of intestinal endometriosis. Best Pract Res Clin Obstet Gynaecol 71:51\\u0026ndash;63\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao L, Gu C, Ye M, Zhang Z, Li L, Fan W et al (2018) Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis. Reprod Biol Endocrinol 16:4\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePateisky P, Pils D, Szabo L, Kuessel L, Husslein H, Schmitz A et al (2018) hsa-miRNA-154-5p expression in plasma of endometriosis patients is a potential diagnostic marker for the disease. Reprod Biomed Online 37:449\\u0026ndash;466\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJia SZ, Yang Y, Lang J, Sun P, Leng J (2013) Plasma miR-17-5p, miR-20a and miR-22 are down-regulated in women with endometriosis. Hum Reprod 28:322\\u0026ndash;330\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu J, Cui SH, Li HZ, Li QH, Yuan R, Zhang YP et al (2016) Ultrasound diagnosis in gynecological acute abdomen. J Biol Regul Homeost Agents 30:211\\u0026ndash;217\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang S, Yi M, Zhang X, Zhang T, Jiang L, Cao L et al (2021) Effects of CDKN2B-AS1 on cellular proliferation, invasion and AKT3 expression are attenuated by miR-424-5p in a model of ovarian endometriosis. Reprod Biomed Online 42:1057\\u0026ndash;1066\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu SL, Tian YY, Zhou Y, Liu LQ (2020) Diagnostic value of circulating microRNAs in thyroid carcinoma: A systematic review and meta-analysis. Clin Endocrinol (Oxf) 93:489\\u0026ndash;498\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu XG, Chen JJ, Zhou HL, Wu Y, Lin F, Shi J et al (2021) Identification and Validation of the Signatures of Infiltrating Immune Cells in the Eutopic Endometrium Endometria of Women With Endometriosis. Front Immunol 12:671201\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKnox B, Ong YC, Bakar MA, Grover SR (2019) A longitudinal study of adolescent dysmenorrhoea into adulthood. Eur J Pediatr 178:1325\\u0026ndash;1332\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEsfandiari F, Chitsazian F, Jahromi MG, Favaedi R, Bazrgar M, Aflatoonian R et al (2021) HOX cluster and their cofactors showed an altered expression pattern in eutopic and ectopic endometriosis tissues. Reprod Biol Endocrinol 19:132\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi J, Ren L, Li M, Yang C, Chen J, Chen Q (2021) Screening of Potential Key Genes Related to Tubal Factor Infertility Based on Competitive Endogenous RNA Network. Genet Test Mol Biomarkers 25:325\\u0026ndash;333\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFeng Y, Zou S, Weijdegard B, Chen J, Cong Q, Fernandez-Rodriguez J et al (2014) The onset of human ectopic pregnancy demonstrates a differential expression of miRNAs and their cognate targets in the Fallopian tube. Int J Clin Exp Pathol 7:64\\u0026ndash;79\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWei Y, Liang Y, Lin H, Dai Y, Yao S (2020) Autonomic nervous system and inflammation interaction in endometriosis-associated pain. J Neuroinflammation 17:80\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhou WJ, Yang HL, Shao J, Mei J, Chang KK, Zhu R et al (2019) Anti-inflammatory cytokines in endometriosis. Cell Mol Life Sci 76:2111\\u0026ndash;2132\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMosbah A, Nabiel Y, Khashaba E (2016) Interleukin-6, intracellular adhesion molecule-1, and glycodelin A levels in serum and peritoneal fluid as biomarkers for endometriosis. Int J Gynaecol Obstet 134:247\\u0026ndash;251\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKorbel C, Gerstner MD, Menger MD, Laschke MW (2018) Notch signaling controls sprouting angiogenesis of endometriotic lesions. Angiogenesis 21:37\\u0026ndash;46\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDelbandi AA, Mahmoudi M, Shervin A, Heidari S, Kolahdouz-Mohammadi R, Zarnani AH (2020) Evaluation of apoptosis and angiogenesis in ectopic and eutopic stromal cells of patients with endometriosis compared to non-endometriotic controls. BMC Womens Health 20:3\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDanastas K, Miller EJ, Hey-Cunningham AJ, Murphy CR, Lindsay LA (2018) Expression of vascular endothelial growth factor A isoforms is dysregulated in women with endometriosis. Reprod Fertil Dev 30:651\\u0026ndash;657\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang J, Jiang Z, Xue M (2019) Serum and peritoneal fluid levels of interleukin-6 and interleukin-37 as biomarkers for endometriosis. Gynecol Endocrinol 35:571\\u0026ndash;575\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMalutan AM, Drugan C, Drugan T, Ciortea R, Mihu D (2016) The association between interleukin-4 -590C/T genetic polymorphism, IL-4 serum level, and advanced endometriosis. Cent Eur J Immunol 41:176\\u0026ndash;181\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVolpato LK, Horewicz VV, Bobinski F, Martins DF, Piovezan AP (2018) Annexin A1, FPR2/ALX, and inflammatory cytokine expression in peritoneal endometriosis. J Reprod Immunol 129:30\\u0026ndash;35\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang S, Shi F, Du Y, Wang Z, Feng Y, Song J et al (2020) Long non-coding RNA CTBP1-AS2 enhances cervical cancer progression via up-regulation of ZNF217 through sponging miR-3163. Cancer Cell Int 20:343\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi C, Zhang M, Dai Y, Xu Z (2020) MicroRNA-424-5p regulates aortic smooth muscle cell function in atherosclerosis by blocking APOC3-mediated nuclear factor-kappaB signalling pathway. Exp Physiol 105:1035\\u0026ndash;1049\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang YZ, Wang J, Xu F (2017) Circulating miR-29b and miR-424 as Prognostic Markers in Patients with Acute Cerebral Infarction. Clin Lab 63:1667\\u0026ndash;1674\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBraza-Boils A, Salloum-Asfar S, Mari-Alexandre J, Arroyo AB, Gonzalez-Conejero R, Barcelo-Molina M et al (2015) Peritoneal fluid modifies the microRNA expression profile in endometrial and endometriotic cells from women with endometriosis. Hum Reprod 30:2292\\u0026ndash;2302\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":true,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"archives-of-gynecology-and-obstetrics\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"arch\",\"sideBox\":\"Learn more about [Archives of Gynecology and Obstetrics](https://www.springer.com/journal/404)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/arch/default.aspx\",\"title\":\"Archives of Gynecology and Obstetrics\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Endometriosis, miR-424-5p, miR-17-5p, Combined diagnosis, Receiver operating characteristic curve, VEGFA, Inflammatory cytokines\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-1116541/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-1116541/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003ePurpose: \\u003c/strong\\u003eEndometriosis (EMT) is a chronic benign disease with high prevalence. This study investigated the diagnostic value of serum miR-17-5p, miR-424-5p, and their combined expressions for EMT.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eMethods:\\u003c/strong\\u003e A total of 80 EMT patients of reproductive age were included as the study subjects, and another 80 healthy women of reproductive age were selected as the control group. The whole blood samples of enrolled subjects were collected and clinical characteristics were recorded. The miR-17-5p, miR-424-5p, VEGFA, IL-4, and IL-6 levels in the serum were measured. ROC curve was used to evaluate the diagnostic efficacy of miR-17-5p and miR-424-5p expressions for EMT. Pearson correlation was performed to analyze the correlation of miR-17-5p and miR-424-5p with clinical indexes in EMT patients.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eResults:\\u003c/strong\\u003e miR-17-5p and miR-424-5p were significantly downregulated in EMT patients. For the diagnosis of EMT, the AUC of miR-17-5p was 0.865 and cutoff value was 0.890 (91.3% sensitivity and 85% specificity), the AUC of miR-424-5p was 0.737 and cutoff value was 0.915 (98.8% sensitivity and 61.2% specificity), the AUC of miR-424-5p combined with miR-17-5p was 0.938 and cutoff value was 2.205 (93.8% sensitivity and 88.7% specificity), with the diagnostic efficacy higher than miR-424-5p or miR-17-5p alone. The expressions of miR-17-5p and miR-424-5p were negatively correlated with dysmenorrhea, infertility, pelvic pain, and rASRM stage, but not with age, BMI, menstrual disorder, and nulliparity. VEGFA, IL-4, and IL-6 were remarkably increased in EMT patients, and both were inversely associated with miR-17-5p and miR-424-5p.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eConclusion:\\u003c/strong\\u003e miR-424-5p combined with miR-17-5p has high diagnostic efficacy for EMT.\\u003c/p\\u003e\",\"manuscriptTitle\":\"miR-424-5p Combined with miR-17-5p Has High Diagnostic Efficacy for Endometriosis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-12-29 15:15:51\",\"doi\":\"10.21203/rs.3.rs-1116541/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2021-12-22T19:27:12+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2021-12-22T17:33:19+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"Archives of Gynecology and Obstetrics\",\"date\":\"2021-12-22T14:52:03+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2021-12-02T14:42:25+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Archives of Gynecology and Obstetrics\",\"date\":\"2021-11-26T04:22:55+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"archives-of-gynecology-and-obstetrics\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"arch\",\"sideBox\":\"Learn more about [Archives of Gynecology and Obstetrics](https://www.springer.com/journal/404)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/arch/default.aspx\",\"title\":\"Archives of Gynecology and Obstetrics\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"0833dfb8-d80b-4221-9df1-18271f9fa8a1\",\"owner\":[],\"postedDate\":\"December 29th, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":9373436,\"name\":\"Obstetrics \\u0026 Gynecology\"}],\"tags\":[],\"updatedAt\":\"2022-04-03T10:53:08+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-1116541\",\"link\":\"https://doi.org/10.1007/s00404-022-06492-6\",\"journal\":{\"identity\":\"archives-of-gynecology-and-obstetrics\",\"isVorOnly\":false,\"title\":\"Archives of Gynecology and Obstetrics\"},\"publishedOn\":\"2022-04-03 10:53:08\",\"publishedOnDateReadable\":\"April 3rd, 2022\"},\"versionCreatedAt\":\"2021-12-29 15:15:51\",\"video\":\"\",\"vorDoi\":\"10.1007/s00404-022-06492-6\",\"vorDoiUrl\":\"https://doi.org/10.1007/s00404-022-06492-6\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-1116541\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-1116541\",\"identity\":\"rs-1116541\",\"version\":[\"v1\"]},\"buildId\":\"WvIrzKhiLBfengagbw6Ux\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC0","license_restricted":false}