{"paper_id":"7f314186-b467-4116-b974-c85d84d9b9d8","body_text":"Abstract\nObjective\nThis study aimed to investigate the mechanism of the involvement of USP33 in autophagic ferroptosis in endometriosis (EMs).\nMethods\nEndometrial stromal cells (ESCs) were isolated from 15 healthy controls and 30 patients with EMs, which were designated NESCs and EESCs, respectively. Real-time PCR and Western blotting were utilized to determine USP33 expression as well as GPX4, LC3II/LC3I, NCOA4, FTH1, LAST1, p-LAST1, YAP, and p-YAP levels. Immunofluorescence was used to detect the colocalization of ferritin and LAMP2, as well as that of LC3 and ferritin. The levels of ROS, Fe2+, MDA, and GSH were measured to assess ferroptosis. An LDH assay was performed to evaluate cell death. A co-IP assay was implemented to identify the interaction between USP33 and LAST1 and detect the level of LAST1 ubiquitination. The stability of the protein was also detected via a cycloheximide (CHX) assay.\nResults\nUSP33 was underexpressed in EMs patients. Loss of USP33 conferred resistance to ferroptosis in EESCs, as evidenced by increased proliferation; decreased levels of ROS, Fe2+, and MDA; elevated levels of GPX4 and GSH; and reduced cell death. In addition, USP33, which is localized in autophagosomes, was suggested to promote the degradation of ferritin in autophagosomes. Furthermore, USP33 repressed the Hippo–YAP pathway by suppressing LATS1 ubiquitination, thereby contributing to the reduced resistance of EESCs to ferroptosis.\nConclusion\nUSP33 impedes the ubiquitination of LAST1 and represses the Hippo/YAP pathway, thus facilitating ferritinophagy and ferroptosis in EMs.\nIntroduction\nEndometriosis (EMs), characterized by the implantation and growth of endometrial-like tissue outside the uterine cavity, is an estrogen-dependent inflammatory disorder affecting 5−10% of reproductive-aged women worldwide [Citation1]. This disorder is also considered complex and heterogeneous, occurring in various extrapelvic anatomical locations, including the diaphragm and thoracic cavity, which have cyclical chest and/or diaphragmatic manifestations such as chest and shoulder tip pain, breathing difficulties, and catamenial pneumothorax [Citation2]. EMs may induce symptoms such as pelvic pain and infertility even if they are asymptomatic in some cases [Citation3]. However, these nonspecific symptoms make EMs diagnosis challenging, particularly in early-stage cases. As an estrogen-dependent disorder, EMs have limited treatment options, and its pathogenesis remains poorly understood. Thus, in-depth investigations into the underlying molecular mechanisms are urgently needed.\nFerroptosis is a newly defined iron-dependent cell death program characterized by iron accumulation and lipid peroxidation during cell death [Citation4]. Previous studies have reported iron overload in the ectopic lesions, peritoneal fluid, and follicular fluid of patients with EMs, which induces ferroptosis in the peritoneal fluid and follicular fluid to promote the progression of EMs-associated infertility [Citation5–7]. Furthermore, autophagy-dependent ferroptosis is involved in the progression of EMs [Citation8]. However, the specific mechanism underlying autophagy-dependent ferroptosis deserves further exploration.\nUbiquitination is one of the most important posttranslational modifications and plays a crucial role in controlling protein activity in diverse cellular processes throughout nearly all aspects of eukaryotic biology [Citation9,Citation10]. It can be reversed by deubiquitinating enzymes (DUBs), a process known as deubiquitination, which is a key mechanism for maintaining cellular homeostasis [Citation11]. These deubiquitinating enzymes are increasingly recognized as potential candidates for drug discovery [Citation12]. Ubiquitin-specific protease 33 (USP33) is a highly conserved deubiquitination enzyme that has been revealed to deubiquitinate a variety of proteins involved in multiple cellular processes, such as apoptosis [Citation13,Citation14].\nThe Hippo pathway is considered a vital pathway that controls tissue growth and homeostasis as well as modulates cellular behaviors. Ubiquitination and deubiquitination have been proposed to be involved in the regulation of this pathway, thus affecting various physiological processes [Citation15,Citation16]. The regulation of the Hippo pathway via ubiquitination involves both a complex network of E3 ligases and DUBs [Citation17]. The MST1/2 and LAST1/2 kinases are the core components of the Hippo kinase cascade, and active LAST1 kinase can be phosphorylated on threonine 1079, phosphorylate YAP1 on amino acids, including serine 127, and downregulate its expression [Citation18]. From the UbiBrowser database (http://ubibrowser.bio-it.cn/ubibrowser_v3/), we found that USP33 might be involved in the deubiquitination of LAST1. Based on the above findings, we speculated that USP33 might affect the stability of LAST1 through deubiquitination and subsequently regulate the Hippo–YAP1 pathway to participate in ferritinophagy and ferroptosis in EMs. Accordingly, this study investigated whether USP33-mediated deubiquitination affects the stability of LAST1 and the Hippo–YAP1 pathway, thereby mediating ferritinophagy and ferroptosis in ectopic endometrial stromal cells (EESCs).\nMaterials and methods\nCell sample sources\nHealthy reproductive-aged women visiting the Affiliated Hospital of Zunyi Medical University were enrolled as healthy controls (n = 15, 34.77 ± 5.56 years old, with a menstrual period of 6 + 3.34 days), and patients with EMs were included in the disease group (n = 30, 33.27 ± 8.66, with a menstrual period of 7 ± 2.69 days). Written informed consent was obtained from all participants. The inclusion criteria for patients with EMs were as follows: (1) diagnosed with EMs through clinical examination and postoperative pathology accompanied by infertility symptoms; (2) infertility time <3 years; (3) menstrual regularity, normal reproductive tract without abnormalities; and (4) good treatment compliance and no history of hormone therapy. The exclusion criteria were as follows: (1) the presence of severe heart, lung, liver, kidney, or other important organ dysfunctions or failure; (2) a history of malignant tumors or suspected malignant tumors; (3) cocurrent autoimmune diseases or connective tissue diseases; and (4) allergy or intolerance to research drug ingredients. The research plan was approved by the Academic Ethics Committee of the Affiliated Hospital of Zunyi Medical University, with an ethical number of KLL−2024−683, and was in accordance with the principles of the Declaration of Helsinki.\nCell isolation and culture\nThe endometrial tissues were chopped into small pieces, separated, and digested with 4% collagenase at 37 °C for 60 min, followed by centrifugation at 500 × g for 5 min. The cell suspension was centrifuged at 3000 × g for 10 min and incubated in DMEM supplemented with 10% FBS (GIBCO) and 1% penicillin-streptomycin (Solarbio, Beijing, China) at 37 °C until passages 4−6. The medium was renewed once a day initially and then every 2−3 days. The cell morphology was observed using an optical microscope (Olympus, Tokyo, Japan). The expression of CK19 (negative) (ab76539, 1:50, Abcam) and vimentin (positive) (ab92547, 1:20, Abcam) in ESCs was detected by immunohistochemistry [Citation19].\nCell transfection\nThe cells were divided into the following groups: Blank (cultured ESCs extracted from healthy controls [NEECs]), Model (cultured EESCs), Oe-NC (oe-NC-treated EESCs), Oe-USP33 (oe-USP33-treated EESCs), Oe-USP33+si-NC (EESCs manipulated with oe-USP33 and si-NC), Oe-USP33+si-LAST1 (EESCs manipulated with oe-USP33 and si-LAST1), and Oe-USP33+DMSO (EESCs introduced with oe-USP33 and 10 µM DMSO, PY−60 solvent).\nAs per the instructions, the Lipofectamine® 2000 (11668500, Invitrogen, Carlsbad, CA, USA) was utilized for cell manipulation with LAST1 siRNA (si-LAST1; sc−35797, Santa Cruz) and its negative control scramble siRNA [Citation20,Citation21], pcDNA3.1-USP33 (oe-USP33; PPL01456-2a,bioworlde) and its control pcDNA3.1-NC (oe-NC) [Citation22].\n(1) Primer design and synthesis: Based on the PubMed search for the coding DNA sequence (CDS) region sequence of the human USP33 gene, corresponding primers were designed using the plasmid vector pcDNA3.1 (+) polyclonal sites. The forward primer sequence was 5′AAGCAGGATCATGTGGCGAA 3′, and the reverse primer sequence was 5′CTGGCAAAGAAGGCAGCAAG3′. Kpn I and BAM HI were selected as double restriction enzyme sites, and the primer sequences were synthesized by two developers. (2) USP33 gene amplification after reverse transcription, polymerase chain reaction, and plasmid construction; (3) Using Lipofectamine® 2000 according to the manufacturer's instructions, pcDNA3.1-USP33 and its control pcDNA3.1-NC were transfected into EESCs.\nqRT‒PCR\nThe total RNA extracted using TRIzol reagent (Invitrogen) was reverse-transcribed to generate cDNA via the PrimeScript RT reagent kit (Takara, Dalian, China). The TaqMan primers and probes used for detection were all from TaKaRa in Japan. Quantitative PCR was performed using the ABI PRISM 7900 system of SYBR Green II (TaKaRa). GAPDH was chosen as the internal reference, and the data were analyzed using the 2-ΔΔCt method. The primer sequences used were all synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) (USP33 [Forward 5′-3′: TGTGATGCTTAGGCAAGGAG, Reverse 5′-3′: GGCCCTCCACCATAAATAGA], GAPDH [Forward 5′-3′: ATGGGGAAGGTGAAGGTCG, Reverse 5′-3′: GGGGTCATTGATGGCAACAATA]).\nWestern blot assay\nProteins were extracted by adding lysis buffer (AR0107, Boster Biotech Co., Ltd., Wuhan, China) to the cells, followed by protein concentration determination using the BCA assay kit (AR1189, Boster Biotech). Following protein denaturation, SDS‒PAGE electrophoresis was conducted to isolate the proteins, which were then transferred onto a PVDF membrane and blocked in 3% BSA for 2 h. Primary antibodies () were added and incubated overnight at 4°C. Goat antirabbit IgG H&Amp L (HRP) was added for a 1-h incubation at room temperature in the dark. An enhanced chemiluminescence (ECL) working solution (AR1191, Boster Biotech) was used for color development. With GAPDH as the internal reference, Western blot bands were quantified using Image Pro Plus 6.0 (Media Cybernetics, USA).\nCCK‒8\nCCK−8 detection was implemented at 0, 12, 24, and 48 h after cell hypoxic exposure. In accordance with the manufacturer's protocol, the cells were treated with a CCK−8 assay kit (96992, Sigma Aldrich), and the absorbance was measured at 450 nm using Bio-Rad 680 microplate reader (Bio-Rad, Hercules, CA).\nROS detection\nAn ROS detection kit (Beyotime, S0033) was used to determine the intracellular ROS levels. In brief, cells loaded with DCFH-DA fluorescent probes were analyzed using a fluorescence spectrophotometer (Thermo Fisher) with excitation at a wavelength of 488 nm and emission at a wavelength of 525 nm [Citation23].\nMeasurement of Fe2+, MDA, and GSH levels\nThe levels of Fe2+, MDA, and GSH were measured using the iron test kit (ab83366, Abcam), an MDA determination kit (ab287797, Abcam), and a reduced GSH detection kit (ab283966, Abcam), respectively. For Fe2+ determination, the collected cells (1 × 104) were supplemented with reagents and sonicated in an ice bath. The samples were subsequently centrifuged at 10000×g and 4 °C for 10 min, after which the supernatants were placed on ice for testing. A microplate reader (Bio-Rad 680, Bio-Rad, Hercules, CA, USA) was used to measure the OD value at 593 nm.\nExperimental steps for the GSH assay kit: Cells (1 × 107) were detached with trypsin and centrifuged at 4 °C and 1000 g/min for 10 min, the supernatant was discarded, and the cell pellet was collected. The cell pellet was added to 0.2−0.3 mL of homogenate medium and sonicated in an ice–water bath. The optical density (OD) was measured at 412 nm using a microplate reader (Bio-Rad 680, Bio-Rad).\nFor the MDA assay, the following experimental operation steps were used: the cells (1 × 106) were placed in a centrifuge tube, 0.5 mL of the reagent extraction solution was added, the mixture was mixed well for 2 min, and then the mixture was crushed into a suspension. The sample (0.1 mL) was collected in a 1.5-mL centrifuge tube and mixed well, followed by incubation in a water bath at 95 °C or above for 40 min, cooling, and centrifugation at 4000 g/min for 10 min. The OD value at 530 nm in each well was measured using a microplate reader (Bio-Rad 680, Bio-Rad).\nLDH detection\nCell death was quantified using the LDH assay kit (A020-2-2, Nanjing Jiancheng Institute of Bioengineering, Nanjing, China) [Citation24]. Specific experimental procedure: Cells (1 × 107) were added with 0.3 mL of physiological saline, sonicated under ice water bath (5 s, at 15-s intervals, repeated 3−5 times), and centrifuged at 4000 g/min for 10 min. The supernatant was removed, and the proteins were detected using a reagent kit. The experiment was repeated three times.\nImmunofluorescence\nImmunostaining was conducted with an antiferritin antibody (ab313563, 1:50, Abcam), an anti-LAMP2 antibody (GTX13524, 1:100, NeBioscience) or an anti-LC3B antibody (ab192890, 1 µg/ml, Abcam). Then, goat antirabbit IgG H&L (Alexa Fluor® 647) (ab150079, 1:200, Abcam) or IgG H&L (Alexa Fluor® 488) (ab150077, 1:200, Abcam) was added to the cells and incubated for 1 h at 37 °C. Following sealing with antifading solution containing DAPI (ZSGB-Bio, Beijing, China), the stained cells were visualized under a fluorescence microscope (Olympics, Tokyo, Japan). A quantitative analysis of ferritin, lysosomes, and autophagosomes was performed using Image Pro Plus 6.0 software [Citation25].\nCo-IP\nThe cells were lysed in lysis buffer containing protease inhibitors. The anti-LAST1 antibody (ab70561, 2 µg/mg, Abcam) or anti-USP33 antibody (20445-1-AP, 0.5−4.0 µg/1.0−3.0 mg of total protein lysate, Proteintech) or IgG (ab205718, diluted to the same concentration as the aforementioned antibody, Abcam) was added to the lysate and incubated overnight at 4°C. Prewashed magnetic beads were added for another 4 h of incubation at 4°C. After 4 rinses, SDS loading buffer was added, and the mixture was boiled for 5 min. Subsequently, LAST1 and USP33 protein levels were measured via immunoblotting.\nDeubiquitination assay\nThe cells were treated with 20 μM MG132 (ab141003, Abcam) for 8 h, lysed in RIPA buffer containing 1% SDS, and subsequently sonicated. Before immunoprecipitation with the anti-LAST1 antibody (ab70561, 2 µg/mg, Abcam) at 4 °C, the obtained cell lysate was diluted to a final concentration of 0.2% SDS in SDS-free lysis buffer, followed by immunoblotting for analysis of the degree of ubiquitination.\nA deubiquitination experiment was conducted as follows: the cells were manipulated with Myc-LAST1 and His-Ub expression vectors for 24 h, followed by 8-h treatment with MG132 (20 μM). Myc-LAST1 was immunoprecipitated with Myc affinity magnetic beads. The obtained immunoprecipite was rinsed three times with washing buffer, and then Pierce™c-Myc peptide (F4799, Sigma-Aldrich) was employed to competitively elute Myc-LAST1 from magnetic beads in Pierce™IP lysis buffer (87788, Thermo Fisher Scientific). Similarly, HA synthetic peptides (ab9110, Abcam) were used to competitively elute HA-USP33. Purified HA-USP33 (200 ng) and recombinant LAST1 protein (200 ng) were incubated in deubiquitation buffer (50 mmol/L Tris HCl pH 8.0, 50 mmol/L NaCl, 1 mmol/L EDTA, 10 mmol/L DTT, and 5% glycerol) at 37°C for 2 h. Western blot analysis was used to analyze Myc-LAST1 ubiquitination levels [Citation25].\nProtein stability test\nAfter treatment with CHX (20 µg/mL), the cells were collected at 0, 4, 8, and 12 h for immunoblotting to detect protein levels in the cells at each time point [Citation26].\nStatistical analysis\nData statistical processing was implemented with GraphPad Prism (8.0.1, GraphPad software, San Diego, CA, USA). Each experiment was run independently three times. The Kolmogorov‒Smirnov test was applied to examine data normality. Normally distributed data, described as the mean ± standard deviation, were subjected to a t test for comparisons between two groups or one-way ANOVA for comparisons among multiple groups. Tukey's multiple comparisons test was utilized for post hoc tests. The level of p < 0.05 in a two-tailed test indicated a statistically significant difference.\nResults\nUSP33 is poorly expressed in EESCs and its low expression confers the resistance of EESCs to ferroptosis\nqRT‒PCR revealed a dramatic reduction in USP33 expression in the endometrial tissues of the Ectopic group (p < 0.001) (). NESCs and EESCs were acquired from corresponding endometrial tissues. The isolated EESCs exhibited typical mesenchymal morphology (). Immunohistochemistry confirmed the negative expression of CK19 and positive expression of vimentin ().\nUSP33 was markedly downregulated at the protein and mRNA levels in EESCs relative to NESCs (p < 0.001) ().\nSubsequently, EESCs were successfully manipulated with oe-USP33 (all p < 0.01) (). EESCs presented a remarkable increase in cell proliferation but a noticeable reduction in cell death relative to that of NESCs (all p < 0.001). In contrast, upon transfection with oe-USP33, cell proliferation was attenuated, while cell death was increased (all p < 0.01) (). Furthermore, EESCs exhibit increased tolerance to ferroptosis, suggesting that EESCs have a mechanism that confers ferroptosis resistance [Citation27]. Therefore, we speculate that USP33 may inhibit ferroptosis in EESCs. Consequently, the levels of ROS, MDA, and Fe2+ were significantly reduced while GSH levels were greater in EESCs than in NESCs (all p < 0.001), while transfection with oe-USP33 resulted in the opposite trends (all p < 0.01) (). Together, these results indicate that downregulation of USP33 confers ferroptosis resistance in EESCs.\nUSP33 inhibits the degradation of ferritin in lysosomes and is localized in autophagosomes\nFerritin is the main iron storage protein in the mammalian body; it is an important element for maintaining iron homeostasis and preventing the Fenton reaction, and it alters isolated iron through autophagy (ferritinophagy) [Citation25]. Therefore, we speculated that USP33 could mediate the degradation of ferritin in lysosomes (ferritinophagy) to affect ferroptosis in EESCs. The immunofluorescence method was utilized to observe the localization of ferritin in lysosomes, and immunostaining was performed using ferritin (red fluorescence) and LAMP2 (green fluorescence) antibodies. Compared with that of NESCs, the fluorescence of ferritin sharply increased in the lysosomes of EESCs (p < 0.001) (). Additionally, compared with those in NESCs, the levels of LC3II/LC3I and NCOA4 sharply decreased while the FTH1 level dramatically increased in EESCs (all p < 0.001) (). The immunofluorescence analysis revealed fewer LC3-GFP colocalized dots (green) and ferritin-LC3-GFP colocalized dots (yellow) in the EESCs than in the NESCs (both p < 0.001) (). Following oe-USP33 intervention, the fluorescence of ferritin in lysosomes was significantly reduced, the number of colocalized dots was increased, the expression levels of LC3II/LC3I and NCOA4 in cells were increased, and the expression of FTH1 was decreased (all p < 0.01) (). These results suggest that USP33 promotes ferritin degradation in lysosomes and is localized in autophagosomes.\nUSP33 regulates LAST1 ubiquitination to disrupt the Hippo‒YAP pathway\nThrough UbiBrowser (http://ubibrowser.bio-it.cn/ubibrowser_v3/), USP33 may participate in its deubiquitination. The results of Co-IP confirmed the interaction between USP33 and LAST1 in EESCs (). We subsequently cotransfected HA-USP33 and Myc-LAST1 into cells and further confirmed the interaction between USP33 and LAST1 (). Next, we found that the downregulation of the USP33 protein level by si-USP33 reduced the LAST1 level (). Moreover, in EESCs, CHX treatment similarly reduced LAST1 protein levels, and knocking down USP33 further exacerbated these changes (p < 0.001) (). In EESCs, when USP33 was knocked down, the endogenous ubiquitination level of LAST1 increased (). In contrast, transfection with HA-USP33 resulted in a decrease in the level of exogenous LAST1 ubiquitination in EESCs (). To determine whether LAST1 is a direct deubiquitinated substrate of USP33, we incubated polyubiquitinated LAST1 with purified HA-USP33 under cell-free conditions. HA-USP33 specifically removed the multiubiquitin chain of LAST1 (). In summary, these results prove that USP33 directly deubiquitinates LAST1.\nRelative to those in NESCs, the levels of p-LAST1 and p-YAP sharply increased in EESCs (both p < 0.001), while after oe-USP33 transfection, cells showed downregulated the levels of p-LAST1 and p-YAP (both p < 0.01) (). In summary, USP33 mediates the Hippo/YAP pathway by stabilizing LAST1.\nLAST1 knockdown partially reverses the impacts of USP33 on the Hippo/YAP pathway and ferritinophagy of EESCs\nEESCs were co-transfected with Oe-USP33 and si-LAST1 or their NCs. In contrast to the Oe-USP33+si-NC group, increased cell proliferation, reduced levels of ROS, MDA, and Fe2+, elevated GSH levels, and attenuated cell death were detected in the Oe-USP33+si-LAST1 group (p < 0.05) (), indicating that LAST1 knockdown partially reversed the regulatory effects of USP33 overexpression on the Hippo/YAP pathway and ferroptosis in EESCs. In addition, compared with the Oe-USP33+si-NC group, the Oe-USP33 + si-LAST1 group presented an increase in lysosomal ferritin fluorescence, a decrease in the LC3II/LC3I and NCOA4 levels, an increase in the FTH1 levels, and a decrease in the number of ferritin‒GFP colocalized dots (yellow) (all p < 0.05) (). These results suggest that LAST1 silencing partially reverses the regulatory effect of USP33 overexpression on the Hippo/YAP pathway and ferritinophagy in EESCs.\nDiscussion\nA recent study revealed 85 EMs associated with DUBs in the eutopic endometrium, 20 of which correlate with EMs severity [Citation28]. These DUBs may be utilized as potential biomarkers and therapeutic targets for EMs. Moreover, the Hippo pathway has been linked to signaling mediated by the estrogen receptor in the uterus [Citation29]. Here, we investigated the role of USP33, a DUB, in ferritinophagy and ferroptosis in EESCs. USP33 acts as a regulator of ferroptosis in EESCs and facilitates the degradation of ferritin in lysosomes. Mechanistically, USP33 deubiquitinates LAST1, inactivating the Hippo–YAP pathway and thereby promoting ferritinophagy and ferroptosis in EESCs.\nFirst, USP33 is poorly expressed in EESCs, and its low expression confers resistance to ferroptosis in EESCs. Ferroptosis is regulated mainly by iron homeostasis and oxidative stress, and iron homeostasis is partially controlled by ferritin. Ferritin can be degraded through autophagy (ferritinophagy) mediated by NCOA4, which can directly recognize and bind to FTH1, contributing to lysosomal degradation and iron release by transferring iron-bound ferritin to autophagosomes [Citation30,Citation31]. The ubiquitin‒proteasome system can degrade crucial repressors of ferroptosis, such as SLC7A11 and GPX4, while the overactivation of selective autophagy, including ferritinophagy, facilitates ferroptotic death through the degradation of ferritin [Citation32]. USP33 is a DUB that can be controlled by the ubiquitin-proteasome system [Citation33]. DUBs such as USP14 and USP8 have been reported to modulate ferritinophagy-dependent ferroptosis [Citation34,Citation35]. Although USP33 has been proven in several studies to play a regulatory role in mitophagy through the deubiquitination of mitophagy-associated proteins [Citation13,Citation36], no studies have investigated the function of USP33 in either ferritinophagy or ferritinophagy-dependent ferroptosis. In this study, we investigated the potential of USP33 to aggravate iron accumulation-induced cell damage. Consistently, the results of the CCK−8 and LDH assays supported the proferroptotic activity of USP33. Furthermore, our data demonstrated that USP33 increased ferritinophagy-dependent ferroptosis.\nAdditionally, mechanistic investigations revealed that USP33 deubiquitinated LAST1 to disrupt the Hippo–YAP pathway. Signaling pathways play important roles in the occurrence and development of EMs, among which the Hippo pathway, as a classic pathway, has also been reported to be engaged in autophagy in the context of EMs [Citation37]. In this pathway, YAP1 and the transcription coactivator TAZ are key downstream effector factors that have also been reported to target various ferroptosis regulatory factors. YAP1 can also affect the generation of autophagosomes and mediate autophagy, which is a key factor for ferritinophagy [Citation38–40]. Additionally, the Hippo pathway has been shown to play a significant role in the modulation of ferroptosis, and modulating YAP/TAZ, two key effectors in this pathway, to induce ferroptosis holds promise for overcoming therapeutic resistance [Citation41]. The therapeutic potential of Hippo/YAP modulation in ferroptosis has been suggested in various previous studies. The Hippo–YAP pathway modulates ferroptosis and plays an essential role in intestinal ischemia/reperfusion injury [Citation42]. Modulation of the Hippo/YAP pathway ameliorates cochlear hair cell injury by modulating ferroptosis [Citation43]. DUBs can reverse the process of ubiquitination by removing ubiquitin signals [Citation44], and USPs, which belong to the DUB family, are strongly linked to biological behaviors through various molecular signaling pathways [Citation45]. Several USPs have been reported to regulate the Hippo–YAP pathway. For instance, USP10 affects the stability of proteins via the regulation of the Hippo–YAP pathway, thereby affecting apoptosis and oxidative stress [Citation46,Citation47]. Some recent studies have also shown a posttranslational mechanism between USPs and Hippo pathway factors (TAZ and YAP) in the progression of cancers such as hepatocellular carcinoma [Citation48] and osteosarcoma [Citation49]. LAST1 kinase is a core component of the Hippo pathway, and active LAST1 phosphorylates YAP1 and downregulates its expression [Citation50,Citation51]. In our research, USP33 induced the deubiquitination of LAST1 and disrupted the Hippo/YAP pathway to facilitate ferritinophagy-mediated ferroptosis in EESCs.\nIn summary, this research highlights that USP33 enhances ferritinophagy-dependent ferroptosis, laying foundations for the development of targets to prevent or delay the progression of EMs, as well as the identification of diagnostic markers or treatment strategies for this process. At the molecular level, USP33 deubiquitinates LAST1 and disrupts the Hippo/YAP pathway, thereby accelerating ferritinophagy-dependent ferroptosis, which increases the understanding of Hippo/YAP pathway-associated mechanisms involved in the progression of EMs. However, this study did not investigate the relationship between this mechanism and clinical symptoms such as pain, infertility, or estrogen dependency or whether USP33 might serve as a drug target, which is one of the limitations of this study. Moreover, in vivo models (e.g. the EMs mouse model) strongly strengthened the mechanistic conclusions of this study. In vivo data from a previous study revealed that YAP inhibition pharmacologically induces cell apoptosis and attenuates the proliferation of ectopic endometrial cells [Citation52]. Nevertheless, owing to time and funding constraints, we are currently unable to conduct in vivo model validation. Studies are needed to validate the potential of targeting USP33 in the treatment of EMs in animals before its clinical application. Furthermore, owing to time and funding constraints, no confirmatory experiments have been conducted to investigate the regulation of the Hippo–YAP pathway and ferroptosis in cells. Relevant experiments will be conducted in future studies.\nConsent for publication\nNot applicable.\nEthics approval statement\nWritten informed consent was obtained from all participants, and the research plan was approved by the Academic Ethics Committee of the Affiliated Hospital of Zunyi Medical University. All procedures were strictly implemented according to the Declaration of Helsinki.\nAcknowledgements\nNot applicable.\nAuthor contributions\nLL is the guarantor of the integrity of the entire study and contributed to the study concepts, data acquisition, statistical analysis, and manuscript editing. YW contributed to the study design, clinical studies, literature research, and manuscript preparation. MZZ contributed to the definition of intellectual content, data analysis, and manuscript review. All the authors read and approved the final manuscript.\nDisclosure statement\nNo potential conflict of interest was reported by the author(s).\nFunding\nNo funding was received for this study.\nData availability statement\nAll the data generated or analyzed during this study are included in this article. Further investigations can be directed at the corresponding author.\nReferences\n- Taylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic disease: clinical challenges and novel innovations. Lancet. 2021;397:839–852. doi: 10.1016/S0140-6736(21)00389-5\n- Piccus R, Mann C, Sutcliffe RP. Diagnosis and treatment of diaphragmatic endometriosis: results of an international patient survey. Eur J Obstet Gynecol Reprod Biol. 2021;260:48–51. doi: 10.1016/j.ejogrb.2021.03.003\n- Chapron C, Marcellin L, Borghese B, et al. Rethinking mechanisms, diagnosis and management of endometriosis. Nat Rev Endocrinol. 2019;15:666–682. doi: 10.1038/s41574-019-0245-z\n- Li J, Cao F, Yin HL, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11:88. doi: 10.1038/s41419-020-2298-2\n- Defrere S, Gonzalez-Ramos R, Lousse JC, et al. Insights into iron and nuclear factor-kappa B (NF-kappaB) involvement in chronic inflammatory processes in peritoneal endometriosis. Histol Histopathol. 2011;26:1083–1092.\n- Ni C, Li D. Ferroptosis and oxidative stress in endometriosis: a systematic review of the literature. Medicine (Baltimore). 2024;103:e37421. doi: 10.1097/MD.0000000000037421\n- Li Y, He Y, Cheng W, et al. Double-edged roles of ferroptosis in endometriosis and endometriosis-related infertility. Cell Death Discov. 2023;9:306. doi: 10.1038/s41420-023-01606-8\n- Li H, Yang H, Lu S, et al. Autophagy-dependent ferroptosis is involved in the development of endometriosis. Gynecol Endocrinol. 2023;39:2242962. doi: 10.1080/09513590.2023.2242962\n- Popovic D, Vucic D, Dikic I. Ubiquitination in disease pathogenesis and treatment. Nat Med. 2014;20:1242–1253. doi: 10.1038/nm.3739\n- Swatek KN, Komander D. Ubiquitin modifications. Cell Res. 2016;26:399–422. doi: 10.1038/cr.2016.39\n- Snyder NA, Silva GM. Deubiquitinating enzymes (DUBs): regulation, homeostasis, and oxidative stress response. J Biol Chem. 2021;297:101077. doi: 10.1016/j.jbc.2021.101077\n- Harrigan JA, Jacq X, Martin NM, et al. Deubiquitylating enzymes and drug discovery: emerging opportunities. Nat Rev Drug Discov. 2018;17:57–78. doi: 10.1038/nrd.2017.152\n- Niu K, Fang H, Chen Z, et al. USP33 deubiquitinates PRKN/parkin and antagonizes its role in mitophagy. Autophagy. 2020;16:724–734. doi: 10.1080/15548627.2019.1656957\n- Guo F, Zhang C, Wang F, et al. Deubiquitinating enzyme USP33 restrains docetaxel-induced apoptosis via stabilising the phosphatase DUSP1 in prostate cancer. Cell Death Differ. 2020;27:1938–1951. doi: 10.1038/s41418-019-0473-8\n- Liu Y, Deng J. Ubiquitination‑deubiquitination in the Hippo signaling pathway (review). Oncol Rep. 2019;41:1455–1475. doi: 10.3892/or.2019.6956\n- Mussell A, Frangou C, Zhang J. Regulation of the Hippo signaling pathway by deubiquitinating enzymes in cancer. Genes Dis. 2019;6:335–341. doi: 10.1016/j.gendis.2019.06.004\n- Kim Y, Jho EH. Regulation of the Hippo signaling pathway by ubiquitin modification. BMB Rep. 2018;51:143–150. doi: 10.5483/BMBRep.2018.51.3.017\n- Blakely WJ, Hatterschide J, White EA. HPV18 E7 inhibits LATS1 kinase and activates YAP1 by degrading PTPN14. bioRxiv. 2024\n- Chen Q, Hang Y, Zhang T, et al. USP10 promotes proliferation and migration and inhibits apoptosis of endometrial stromal cells in endometriosis through activating the Raf-1/MEK/ERK pathway. Am J Physiol Cell Physiol. 2018;315:C863–C872. doi: 10.1152/ajpcell.00272.2018\n- Bao L, Yuan L, Li P, et al. A FUS-LATS1/2 Axis inhibits hepatocellular carcinoma progression via activating hippo pathway. Cell Physiol Biochem. 2018;50:437–451. doi: 10.1159/000494155\n- Yang J, Ding S. Chimeric RNA-binding protein-based killing switch targeting hepatocellular carcinoma cells. Mol Ther Nucleic Acids. 2021;25:683–695. doi: 10.1016/j.omtn.2021.08.012\n- Zietzer A, Hosen MR, Wang H, et al. The RNA-binding protein hnRNPU regulates the sorting of microRNA-30c-5p into large extracellular vesicles. J Extracell Vesicles. 2020;9:1786967. doi: 10.1080/20013078.2020.1786967\n- Zhang H, He Y, Wang JX, et al. miR-30-5p-mediated ferroptosis of trophoblasts is implicated in the pathogenesis of preeclampsia. Redox Biol. 2020;29:101402. doi: 10.1016/j.redox.2019.101402\n- Li Y, Sun X, Zhuang J, et al. Donepezil ameliorates oxygen‑glucose deprivation/reoxygenation‑induced cardiac microvascular endothelial cell dysfunction through PARP1/NF‑kappaB signaling. Mol Med Rep. 2022;25:121. doi: 10.3892/mmr.2022.12637\n- Zhang J, Zheng Y, Wang Y, et al. YAP1 alleviates sepsis-induced acute lung injury via inhibiting ferritinophagy-mediated ferroptosis. Front Immunol. 2022;13:884362. doi: 10.3389/fimmu.2022.884362\n- Zhang Z, Lu YX, Liu F, et al. lncRNA BREA2 promotes metastasis by disrupting the WWP2-mediated ubiquitination of Notch1. Proc Natl Acad Sci U S A. 2023;120:e2206694120. doi: 10.1073/pnas.2206694120\n- Kobayashi H, Yamashita Y, Iwase A, et al. The ferroimmunomodulatory role of ectopic endometriotic stromal cells in ovarian endometriosis. Fertil Steril. 2012;98:415–422. doi: 10.1016/j.fertnstert.2012.04.047\n- Yang X, Yan K, Zhan Q, et al. Exploration of diagnostic deubiquitinating enzymes in endometriosis and its immune infiltration. Biochem Genet. 2024;62:4359–4379. doi: 10.1007/s10528-023-10653-w\n- Moon S, Lee OH, Lee S, et al. STK3/4 expression is regulated in uterine endometrial cells during the estrous cycle. Cells. 2019;8:1643. doi: 10.3390/cells8121643\n- Fang Y, Chen X, Tan Q, et al. Inhibiting Ferroptosis through disrupting the NCOA4-FTH1 interaction: a new mechanism of action. ACS Cent Sci. 2021;7:980–989. doi: 10.1021/acscentsci.0c01592\n- Mancias JD, Pontano Vaites L, Nissim S, et al. Ferritinophagy via NCOA4 is required for erythropoiesis and is regulated by iron dependent HERC2-mediated proteolysis. Elife. 2015;4. doi: 10.7554/eLife.10308\n- Chen X, Yu C, Kang R, et al. Cellular degradation systems in ferroptosis. Cell Death Differ. 2021;28:1135–1148. doi: 10.1038/s41418-020-00728-1\n- Chan NC, den Besten W, Sweredoski MJ, et al. Degradation of the deubiquitinating enzyme USP33 is mediated by p97 and the ubiquitin ligase HERC2. J Biol Chem. 2014;289:19789–19798. doi: 10.1074/jbc.M114.569392\n- Liu L, Zheng B, Luo M, et al. Suppression of USP8 sensitizes cells to ferroptosis via SQSTM1/p62-mediated ferritinophagy. Protein Cell. 2023;14:230–234.\n- Li C, Sun G, Chen B, et al. Nuclear receptor coactivator 4-mediated ferritinophagy contributes to cerebral ischemia-induced ferroptosis in ischemic stroke. Pharmacol Res. 2021;174:105933. doi: 10.1016/j.phrs.2021.105933\n- Zhang F, Ye Z, Ran Y, et al. Ruthenium red alleviates post-resuscitation myocardial dysfunction by upregulating mitophagy through inhibition of USP33 in a cardiac arrest rat model. Eur J Pharmacol. 2024;974:176633. doi: 10.1016/j.ejphar.2024.176633\n- Pei T, Luo B, Huang W, et al. Increased expression of YAP inhibited the autophagy level by upregulating mTOR signal in the eutopic ESCs of endometriosis. Front Endocrinol (Lausanne). 2022;13:813165. doi: 10.3389/fendo.2022.813165\n- Panciera T, Azzolin L, Cordenonsi M, et al. Mechanobiology of YAP and TAZ in physiology and disease. Nat Rev Mol Cell Biol. 2017;18:758–770. doi: 10.1038/nrm.2017.87\n- Pavel M, Renna M, Park SJ, et al. Contact inhibition controls cell survival and proliferation via YAP/TAZ-autophagy axis. Nat Commun. 2018;9:2961. doi: 10.1038/s41467-018-05388-x\n- Mancias JD, Wang X, Gygi SP, et al. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature. 2014;509:105–109. doi: 10.1038/nature13148\n- Xiang J, Jiang M, Du X. The role of Hippo pathway in ferroptosis. Front Oncol 2022. 2023;12:1107505. doi: 10.3389/fonc.2022.1107505\n- Fan X, Ai Y, Mu G, et al. Celastrol attenuates ferroptosis-mediated intestinal ischemia/reperfusion-induced acute lung injury via Hippo-YAP signaling. Phytomedicine. 2025;143:156865. doi: 10.1016/j.phymed.2025.156865\n- Niu X, Han P, Liu J, et al. Regulation of Hippo/YAP signaling pathway ameliorates cochlear hair cell injury by regulating ferroptosis. Tissue Cell. 2023;82:102051. doi: 10.1016/j.tice.2023.102051\n- Mevissen TET, Komander D. Mechanisms of deubiquitinase specificity and regulation. Annu Rev Biochem. 2017;86:159–192. doi: 10.1146/annurev-biochem-061516-044916\n- Chen S, Liu Y, Zhou H. Advances in the development ubiquitin-specific peptidase (USP) inhibitors. Int J Mol Sci. 2021;22:4546. doi: 10.3390/ijms22094546\n- Gao Y, Zhang X, Xiao L, et al. Usp10 modulates the hippo pathway by deubiquitinating and stabilizing the transcriptional coactivator Yorkie. Int J Mol Sci. 2019;20:6013. doi: 10.3390/ijms20236013\n- Huang J, Liu Y, Wang M, et al. FoxO4 negatively modulates USP10 transcription to aggravate the apoptosis and oxidative stress of hypoxia/reoxygenation-induced cardiomyocytes by regulating the Hippo/YAP pathway. J Bioenerg Biomembr. 2021;53:541–551. doi: 10.1007/s10863-021-09910-7\n- Tian Z, Xu C, He W, et al. The deubiquitinating enzyme USP19 facilitates hepatocellular carcinoma progression through stabilizing YAP. Cancer Lett. 2023;577:216439. doi: 10.1016/j.canlet.2023.216439\n- Yuan P, Feng Z, Huang H, et al. USP1 inhibition suppresses the progression of osteosarcoma via destabilizing TAZ. Int J Biol Sci. 2022;18:3122–3136. doi: 10.7150/ijbs.65428\n- Fallahi E, O'Driscoll NA, Matallanas D. The MST/Hippo pathway and cell death: a non-canonical affair. Genes (Basel). 2016;7:28. doi: 10.3390/genes7060028\n- Su D, Li Y, Guan L, et al. Elevated MST1 leads to apoptosis via depletion of YAP1 in cardiomyocytes exposed to high glucose. Mol Med. 2021;27:13. doi: 10.1186/s10020-021-00267-6\n- Song Y, Fu J, Zhou M, et al. Activated hippo/yes-associated protein pathway promotes cell proliferation and anti-apoptosis in endometrial stromal cells of endometriosis. J Clin Endocrinol Metab. 2016;101:1552–1561. doi: 10.1210/jc.2016-1120","source_license":"CC0","license_restricted":false}