{"paper_id":"7dfe895d-fd2a-4da7-83a9-cbb6acfb8b11","body_text":"Cryo-X-ray Phase Contrast Imaging enables combined 3D structural quantification and nucleic acid analysis of myocardial biopsies | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Cryo-X-ray Phase Contrast Imaging enables combined 3D structural quantification and nucleic acid analysis of myocardial biopsies Kan Yan Chloe Li, Petros Syrris, Anne Bonnin, Thomas Treibel, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4632236/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Snap frozen biopsies serve as a valuable clinical resource of archival material for disease research, as they enable a comprehensive array of downstream analyses to be performed, including extraction and sequencing of nucleic acids. Obtaining three-dimensional (3D) structural information prior to multi-omics is more challenging but could potentially allow for better characterisation of tissues and targeting of clinically relevant cells. Conventional histological techniques are limited in this regard due to their destructive nature and the reconstruction artifacts produced by sectioning, dehydration, and chemical processing. These limitations are particularly notable in soft tissues such as the heart. In this study, we assessed the feasibility of using synchrotron-based cryo-X-ray phase contrast imaging (cryo-X-PCI) of snap frozen myocardial biopsies and 3D structure tensor analysis of aggregated myocytes, followed by nucleic acid (DNA and RNA) extraction and analysis. We show that optimal sample preparation is the key driver for successful structural and nucleic acid preservation which is unaffected by the process of cryo-X-PCI. We propose that cryo-X-PCI has clinical value for 3D tissue analysis of cardiac and potentially non-cardiac soft tissue biopsies prior to nucleic acid investigation. Biological sciences/Biological techniques/Imaging/X-ray tomography Biological sciences/Molecular biology biopsies cryo-X-ray phase contrast imaging nucleic acid analysis genomics transcriptomics Figures Figure 1 Figure 2 Figure 3 Introduction Biopsies are essential for diagnosing and determining the extent of disease in clinical practice and research 1 . To preserve tissue structure and prevent degradation, biopsies are typically placed in a fixative, such as formalin or glutaraldehyde. However, fixation can negatively impact nucleic acids through crosslinking of proteins, which in turn, can negatively affect the quality and accuracy of downstream analyses such as polymerase chain reaction (PCR) and single-cell sequencing 2 – 7 . As a result, biopsies, including myocardial biopsies, are commonly taken during clinical research and diagnosis and snap frozen, preserving the molecular and cellular integrity of biopsies’ cells in their near ‘native state’, and allowing full range downstream -omic analyses to be performed, including those involving nucleic acids. Conventional histology is considered the gold standard method for assessing the quality of ex-vivo tissue at a microscopic level. While valuable, it is destructive and can distort the true three-dimensional (3D) structure of tissues 8 . There have been dramatic advancements in 3D structural analyses using techniques such as light sheet fluorescence microscopy (LSFM) which offer higher resolution and faster acquisitions 9 . However, LSFM requires extensive sample preparation and optical clearing 10 . Advanced techniques such as micro-computed tomography (micro-CT) and synchrotron-based X-ray phase contrast imaging (X-PCI) can provide non-destructive, 3D virtual histological information at high resolution 11 – 15 . While micro-CT can achieve a resolution as low as 10 µm, X-PCI can potentially achieve below 1 µm 16 , 17 . These imaging methods are particularly useful for analysing FFPE samples 11 , 12 , 15 , 18 – 26 , which are commonly used worldwide in clinical settings and in biobanks as they are convenient for long-term storage and preserve tissue at room temperature, and allow for histology and immunohistochemical staining 27 – 30 . Traditional, laboratory-based micro-CT has limited resolution and low contrast in soft tissues, such as the heart, and typically requires contrast agents. On the other hand, X-PCI offers high resolution imaging of soft, low-absorption-contrast biological samples by detecting the phase shift as X-rays pass through matter because of the differences in refractive index and tissue density. Previous studies have shown the effectiveness of X-PCI for imaging formalin-fixed and/or paraffin-embedded myocardial biopsies from ex vivo human and animal hearts without sectioning nor staining, while providing high resolution 2D and 3D virtual histopathology 14 , 24 , 31 , thus enabling both morphological assessment 14 , 25 , 26 , 32 , 33 and the visualisation of sub(cellular) features 26 , 34 . Nucleic acid analysis is feasible for FFPE X-PCI, however, formaldehyde fixation limits the range of techniques available and can increase the rate of errors during reverse transcription, leading to incorrect sequencing results 35 – 37 . Therefore, a technique that enables 3D microstructural assessment of myocardium in its near-native state whilst maintaining DNA and RNA integrity for subsequent downstream genomics and transcriptomics applications is highly desirable. Cryo-X-PCI has been recently used to image frozen human meniscus tissue, where collagen fibre orientation could be assessed by structure tensor analysis, but nucleic acid analysis was not reported 38 . Cryogenic contrast-enhanced micro-CT has been used to non-destructively image skeletal muscle and tendon fibres in 3D, but requires prior staining which can cause tissue shrinkage 39 . Nucleic acid analysis was also not reported in their study. In this study, we propose that synchrotron-based cryo-X-PCI can overcome these limitations allowing imaging of frozen myocardial biopsies for 3D morphologic analysis while preserving DNA and RNA integrity for downstream genomics and transcriptomics analyses. Methods Sample description and preparation All tissue samples collected from this study were from excess wild-type C57BL/6 mice. The animal experiments were conducted within the terms of the UK Animals (Scientific Procedures) Act 1986 under Project Licence number PB12FFA7E. Four wild-type C57BL/6 male mice were sacrificed and their hearts were immediately collected in RNAlater™ Stabilisation Solution (Thermo Fisher Scientific) at room temperature. Two of these hearts were snap frozen using liquid nitrogen (fresh frozen). One heart was fixed in 4% paraformaldehyde (4% PFA) for 1 h. The remaining heart was fixed in 10% formaldehyde (10% F) for 30 min. After fixation, 10 small biopsies of myocardium were dissected from each heart to give a total of 40 myocardial biopsies. The myocardial biopsies were approximately 2 mm x 4 mm in dimensions. Each myocardial biopsy was carefully drawn along with OCT mounting media (VWR Chemicals) into a 1 ml syringe to avoid bubbles. The end of the syringe was positioned on the central spindle of a Magnetic CryoCap™ (Molecular Dimensions MD7-400) ( Supplementary Fig. 1a ) before snap freezing with liquid nitrogen. Myocardial biopsies were protected by Magnetic CryoVials™ (Molecular Dimensions MD7-402) and stored at -80°C until required. Synchrotron-based cryo-X-ray phase-contrast imaging (cryo-X-PCI) Thirty samples (n = 10 fresh frozen, n = 10 4% PFA, n = 10 10% F) were transported on dry ice to the Paul Scherrer Institute (Villigen, Switzerland), where synchrotron-based cryo-X-PCI was performed at the TOMCAT X02DA beamline of the Swiss Light Source using an in-house developed setup ( Supplementary Fig. 1b ). The remaining 10 fresh frozen myocardial biopsies used in this study did not undergo cryo-X-PCI and served as controls and for comparison between cryo-X-PCI versus traditional 2D histology (cryo-sectioning). Each sample was carefully positioned on a dedicated magnetic mount on the rotation stage to allow for fast sample positioning and exchange. The sample was placed under a double walled orange Kapton foil cage mounted on a cryojet nozzle and kept at -80°C. The flow of cold nitrogen gas was obtained from a Cryojet5 (Oxford-Instruments). The cage was positioned directly above the CryoVial to keep the biopsy frozen throughout the scan and avoid freeze-thaw effects ( Supplementary Fig. 1b ). After centring the sample on the rotation stage, tomographic acquisition was performed using the standard X-ray microscope setup. The microscope was composed of a LuAG:Ce scintillator screen of 20 µm, a x10 magnification objective, and a PCO.Edge 5.5 CMOS camera. The field of view was 1.7 x 1.4 mm 2 and the effective pixel size was 0.65 µm. 1000 projections were captured over 180 degrees using a 50 ms exposure time per projection, a beam energy of 21 keV, and a propagation distance of 60 mm ( Supplementary Table 1 ). Image reconstruction and visualisation After acquisition, all projections were corrected with dark and flat-field images. Phase retrieval was performed with Paganin phase retrieval filter algorithm (δ/β = 5.3e-7/9.3e-9 = 57) before reconstruction in 3D by using Gridrec algorithm 40 . Each scanned volume of interest was saved as a volumetric dataset comprised of 2160 image slices at 16-bit pixel depth. Visual inspection of myocardial morphology was performed using Fiji/ImageJ (ImageJ, version 1.51, Wayne Rasband) 42 . Datasets were reduced from 16-bit to 8-bit depth and cropped to fit the biopsy size accordingly to remove redundant data and reduce computational cost during image processing. Quantification of myocyte orientation (“myomapping”) To quantify the orientation of myocyte aggregates (“myomapping”), structure tensor (ST) analysis was used where helical angle (HA) and intrusion angle (IA) were computed with an in-house developed MATLAB script 11 , 43 – 46 . The ST was calculated at each voxel using prolate spheroidal coordinates ( \\(\\lambda\\) , \\(\\mu , \\theta\\) ), which provide more accurate representation of the 3D orientation of cardiomyocyte aggregates than Cartesian coordinates 46 . Eigen-decomposition of the ST at each voxel yielded its three eigenvalues and their eigenvectors, which represent magnitude and direction of orientation of cells, respectively. The tertiary eigenvector, which has the smallest eigenvalue, represents the vector following the orientation of myocyte aggregates in their longitudinal axis due to correspondence with lowest intensity variation ( Supplementary Fig. 2 ) 44 , 46 , 47 . HA represents the longitudinal direction of myocyte aggregates with respect to the long axis of the ventricle, while intrusion angle (also known as transverse angle) describes the angle at which the myocyte aggregates penetrate the myocardium on the cross-sectional plane. Fractional anisotropy (FA) is the degree of anisotropy or disorganisation of the local myocardium. To focus ST analysis on relevant areas and exclude background, a segmentation mask was created for each dataset using a semi-automatic pixel classification workflow in open-source software Ilastik ( Supplementary Fig. 3 ) 48 . Traditional 2D histologic assessment Eight myocardial samples were used for cryo-sectioning after cryo-X-PCI: four fresh frozen samples (fresh frozen 3, 4, 5 and 6), two 4% PFA-fixed samples (4% PFA 4 and 9), and two 10% formalin-fixed samples (10% F 4 and 8). Two fresh frozen samples that did not have cryo-X-PCI (controls 7 and 8) served as controls and underwent cryo-sectioning. Cryo-sections of 8 µm thickness were cut with a cryostat (Leica) at -20°C and collected on SuperFrost™ Plus microscope slides (VWR). A haematoxylin and eosin (H&E) frozen staining protocol was used to stain cryo-section slides via an automated system (Tissue-Tek DRS 2000 Multiple Slide Stainer, Sakura) ( Supplementary Table 2 ). Stained slides were digitised using a Nanozoomer Whole Slide Imager and viewed with NDP.View 2 software (Hamamatsu Photonics). Extraction, quality assessment and quantitation of DNA and RNA After synchrotron-based cryo-X-PCI, genomic DNA (gDNA) and total RNA were extracted from 30 mouse myocardial biopsies using AllPrep DNA/RNA/miRNA Universal Kit (catalogue number 80224, Qiagen, Germany) following the standard manufacturer’s protocol. The concentration and purity of DNA were quantified using NanoDrop™ Lite Spectrophotometer (Thermo Fisher Scientific, USA) and measured with NanoDrop spectrophotometer using A 260 /A 230 and A 260 /A 280 absorbance ratios. Quality control of extracted DNA and RNA was performed using Agilent TapeStation 2200 (UCL Genomics) to assess fragmentation and DNA integrity number (DIN) and RNA integrity number (RIN) values. DIN and RIN values range from 1 (highly degraded DNA/RNA) to 10 (highly intact DNA/RNA) 49 . The suitability of the extracted DNA to be used as template in PCR was assessed on exon 28 of the mouse myosin binding protein C3 (Mybpc3) gene using the following primer sequences: 5’ AGCTATAGTGCTCTGGACCCT 3’ (forward primer) and 5’ CCCAACCCTGAGCTTGACG 3’ (reverse primer) with AmpliTaq Gold™ DNA polymerase (Applied Biosystems™). Agilent Technologies SureCycler 8800 thermal cycler was used for PCR with the following conditions: initial hot start (96°C, 10 min) followed by 35 cycles of denaturation (96°C, 30 s), annealing (59°C, 1 min) and elongation (72°C, 1 min), and a final elongation step (72°C, 7 min). PCR products were separated using agarose gel electrophoresis (2% w/v) and the expected band at 330 base pairs (bp) was detected by an ultraviolet (UV) light transilluminator (GelDoc imaging system) following staining with GelRed (#41003, Biotium). Extracted RNA (11 µl) from myocardial biopsies was reverse transcribed with the SuperScript™ IV First-Strand Synthesis System kit (Invitrogen) using Mybpc3 exon 28 reverse primer (5’ CCCAACCCTGAGCTTGACG 3’). RNA-primer mix was heated at 65°C (5 min) then incubated on ice for at least 1 min. The reverse transcriptase reaction and RNA-primer mix were incubated at 50°C (20 min) and then inactivated at 80°C (10 min). PCR on exon 28 of Mybpc3 gene was performed with the aforementioned mouse primer sequences using 8 µl cDNA in a total reaction volume of 25 µl per sample with the following conditions: initial hot start (96°C, 10 min) followed by 40 cycles of denaturation (96°C, 1 min), annealing (58°C, 1 min) and elongation (72°C, 2.5 min), and a final elongation step (72°C, 7 min). Results Cryo-X-PCI enables 3D morphological assessment of myocardial biopsies in a non-destructive manner 30 myocardial mouse samples were investigated using a dedicated cryo-X-PCI setup at the TOMCAT beamline (Fig. 1 and Supplementary Fig. 1 ). Using the ST method, gradual changes in HA and IA from endocardium to epicardium could be clearly visualised and quantified in 16 samples (Fig. 2 , Supplementary Figs. 4–6 ). The myocyte aggregates in these biopsies were aligned in a way that showed a gradual change in HA from positive angulation in the endocardium (endo) to negative angulation in the epicardium (epi) (Fig. 2 , Supplementary Figs. 4–6 ). Spacing between myocytes was increased in the majority of samples. Of the remainder (5 fresh frozen, seven 4% PFA and two 10% F biopsies), myomapping was sub-optimal due to artefacts from large ice crystals. Ice crystal artefacts were also observed in control mouse myocardial biopsies ( Supplementary Fig. 7 ). Overall myocardial morphology was better preserved in 10% F samples, than fresh frozen biopsies ( Supplementary Fig. 4 and Supplementary Fig. 5 ). 4% PFA samples showed unusual disruption to morphology, suggestive of an interaction between RNA later and PFA, along with artefacts due to ice crystal formation ( Supplementary Fig. 6 ). Cryo-sectioning and H&E-staining of 8 cryo-X-PCI samples plus 2 control samples were feasible after cryo-X-PCI without tissue damage ( Supplementary Fig. 8 ). Fractures to myocytes were observed in regions of ice crystal formation in both cryo-X-PCI and controls ( Supplementary Fig. 8 ) along with variation in spacing between myocytes in preserved regions. Cryo-X-PCI does not affect DNA nor RNA integrity Both DNA and RNA were extracted from all samples (22 mouse myocardial samples with cryo-X-PCI and 8 control samples without cryo-X-PCI) ( Supplementary Table 3 ). DNA integrity was highest for fresh frozen samples (without fixation), with mean DIN values of 7.0 (with cryo-X-PCI) and 7.2 (control) and a range of 0.9 (cryo-X-PCI) and 1.0 (control) ( Supplementary Table 3 ). All fresh frozen samples had DIN values that exceeded the minimum cut-off (DIN > 6, Fig. 3 and Supplementary Table 3 ) 49 . In 4% PFA-fixed samples, mean DIN values were lower (mean 6.9, range 2.6), and were the lowest for 10% F samples (mean 3.0, range 1.6) (Fig. 3 and Supplementary Table 3 ). Further assessment of DNA integrity was acheived through sequence-specific PCR amplification of exon 28 of Mybpc3. All fresh frozen and 4% PFA-fixed DNA samples were of sufficient quality and integrity to amplify the exon successfully with visualisation of expected amplicon PCR product (330 base pairs, bp) ( Supplementary Fig. 9 ). In contrast, 10% F samples showed weak PCR product bands ( Supplementary Fig. 9 ). RIN values were significantly lower than corresponding DIN values. Fresh frozen samples had highest RIN values overall (mean RIN value of fresh frozen sample = 4.4; range of 5.0), followed by 4% PFA samples (mean = 3.8; range of 3.1), and 10% F samples (mean = 2.9; range of 1.6) ( Supplementary Fig. 10 and Supplementary Table 3 ). The control samples (those that did not undergo cryo-X-PCI) also had low RIN values (mean RIN value of 4.0; range of 4.4) where only one sample exceeded a RIN value of 6 (sample: control 9) ( Supplementary Fig. 10 and Supplementary Table 3 ). Further assessment of RNA integrity was performed through reverse transcription PCR of extracted RNA ( Supplementary Fig. 11 ). Despite the low RNA concentrations and RIN values, the extracted samples could still be successfully reverse transcribed to cDNA and subsequently amplified by PCR ( Supplementary Fig. 11 ). Discussion Snap frozen biopsies represent a vast resource for clinical research as they have superior molecular integrity for performing the full array of downstream nucleic acid analysis compared to formalin-fixed tissue. However, obtaining 3D structural information from frozen tissue prior to analysis is challenging. In contrast, formalin-fixed tissue is the standard for obtaining 2D structural information. Formalin-fixed tissue is less compatible with nucleic acid extraction and analysis, and tissue distortion through histologic processing still occurs, which is particularly relevant to 3D analysis of complex, soft tissues, such as myocyte arrangement in the myocardium. A procedure that can combine imaging of (snap frozen) tissue, in its near native state, and be followed by nucleic acid analysis could therefore be clinically relevant for combined in-depth characterisation and targeting of disease. In this study we demonstrate the feasibility of synchrotron-based cryo-X-PCI of frozen myocardial biopsies prepared under differing conditions. We describe, for the first time, the combination of 3D structural analysis from synchrotron-based cryo-X-PCI with assessment of nucleic acid analysis, focussing particularly on DNA and RNA integrity post-cryo-X-PCI. As a marker of high-level morphologic preservation, we demonstrate that quantification of myocyte orientation (myomapping) in frozen myocardial biopsies is feasible through structure tensor analysis and that HA, IA and FA morphologic parameters could be assessed. Myomapping showed a gradual change in HA, from positive HA in the endocardium to negative HA in the epicardium and is consistent with previously reported studies which have quantified myocyte orientation in whole heart, in both animal models and human samples 45 , 46 , 50 . With biopsies, there is an additional layer of complexity in that the orientation of the biopsy is not always known. In order to mitigate this, datasets were carefully oriented with respect to epicardium and endocardium before performing myomapping. We also compared cryo-X-PCI with 2D traditional histology through cryo-sectioning and H&E staining and confirmed similar appearances before and after imaging. The increased spacing between myocyte aggregates found in our frozen biopsies closely resemble that reported in frozen tendon tissue imaged by cryogenic contrast-enhanced micro-CT 39 suggesting that this feature is inherent to imaging tissues in their frozen state. Ice crystal artefacts were present in some biopsies, including in the control samples which is not ideal. Despite the presence of freezing artefacts, quantification of orientation of myocyte aggregates was still feasible in cryo-X-PCI samples as indicated by the myomapping results. Our study was designed to replicate the freezing process that is commonly used in clinical practice which typically involves rapid collection of biopsies in a cryogenic tube and snap freezing them in liquid nitrogen. However, other techniques for snap freezing samples could be investigated in the future. Importantly, our study also shows that DNA and RNA can be successfully extracted from cardiac biopsies following cryo-X-PCI. Fresh frozen samples had optimal recovery of DNA as indicated by the DIN values greater than 6 for all extracted DNA samples followed by lower DIN values for biopsies preserved in 4% PFA and 10% formalin. Sequence-specific (Mybpc3 exon 28) PCR was successful for all fresh frozen and 4% PFA-fixed samples which all showed the 330 bp PCR product band. The 10% F samples had the lowest integrity as indicated by the low DIN values and only one faint Mybpc3 exon 28 PCR product band could be observed. Most likely this was due to extensive crosslinking from 10% formaldehyde fixation and is in agreement with our preliminary study 25 . Low RIN values from TapeStation and Nanodrop measurements for the extracted RNA from biopsies were observed. Nonetheless, we optimised RT-PCR conditions to account for the small biopsy size and low RNA concentrations and showed that RNA could still be reverse transcribed to cDNA. The cDNA concentrations were very low and had to be re-amplified for the bands to show up clearly on the gel, but they were still viable for gene-specific PCR amplification as shown by the success of Mybpc3 exon 28 PCR. We also compared DIN and RIN values for cryo-X-PCI biopsies with control biopsies (those that did not undergo cryo-X-PCI). There were no significant differences between the mean DIN and RIN values for fresh frozen samples that had cryo-X-PCI (mean DIN = 7.0, mean RIN = 4.4) compared to the fresh frozen samples that did not undergo cryo-X-PCI (mean DIN = 7.2, mean RIN = 4.0). We found no significant differences in nucleic acid quantity and quality, suggesting again that the small size of the biopsy was the limiting factor instead of cryo-X-PCI itself. Therefore, overall, if the goal is to have high nucleic acid integrity for downstream genomics and transcriptomics applications, such as sequencing, it would be best to avoid fixing samples, and simply prepare biopsies with optimal preservation of DNA and RNA, followed by freezing. On the other hand, if the aim is to have superior myocardial morphological detail but not perform subsequent omics, then fixing the biopsies in formaldehyde and processing them into FFPE blocks would be sufficient. To conclude, cryo-X-PCI can provide non-destructive 3D assessment of myocardial morphology and can be combined with nucleic acid analysis of frozen biopsies. Synchrotron-based cryo-X-PCI does not appear to affect DNA or RNA integrity for downstream genomics and transcriptomics applications, and we recommend fresh frozen sample preparation for optimal results in both morphology and nucleic acid quality. Although we only tested cryo-X-PCI in mouse myocardial biopsies, this technique has the potential to be integrated into the clinical setting as a technique to image frozen biopsies from a range of diseases. We foresee clinical potential of cryo-X-PCI to examine further resources of snap frozen material (both cardiac and non-cardiac soft tissue) to provide 3D virtual histopathology and correlation between structural information and genetics. Limitations The current study has limitations. Snap freezing of samples was designed to replicate clinical practice but was not optimised to limit use of animal tissues and beamtime. Further studies are required to assess if this can be minimised. Our study focussed on DNA and RNA integrity as a marker of nucleic acid analysis preservation and protein integrity was not assessed. However, we have previously shown that X-PCI does not inherently affect protein epitopes as seen via immunohistochemistry 25 . Our study was limited by availability of synchrotron beamtime which is both competitive and expensive and our samples were limited to mouse myocardial biopsies which were imaged to show proof-of-concept before use of valuable human myocardial biopsies. Declarations All animal studies were approved by the University College London Biological Services Ethical Review Committee and performed with UK Home Office approval (Project Licence number PB12FFA7E). Animal work conformed to the UK Animals (Scientific Procedures) Act 1986. Acknowledgments Kan Yan Chloe Li would like to acknowledge the British Heart Foundation for funding this research which is part of a 4-Year BHF Cardiovascular Biomedicine PhD studentship (Grant No. BHF FS/4yPhD/F/20/34134). Hector Dejea acknowledges support from the Chan Zuckerberg Initiative DAF (grant 2022-316777). Thomas Treibel is supported by the British Heart Foundation [FS/19/35/34374]), and directly or indirectly supported by the UCLH and Barts NIHR Biomedical Research Centers and through a BHF Accelerator Award. We acknowledge the Paul Scherrer Institut, Villigen, Switzerland for provision of synchrotron radiation beamtime at the TOMCAT beamline X02DA of the Swiss Light Source (SLS). We acknowledge UCL Genomics for TapeStation quality control of DNA and RNA samples. We thank Professor Vishwanie Budhram-Mahadeo for providing excess wild-type C57BL/6 mice for the study (project licence number PB12FFA7E). Author contributions A.C.C., P.S., T.T., and K.Y.C.L. conceptualised the project. K.Y.C.L. performed DNA and RNA extraction from myocardial biopsies, cDNA synthesis, PCR, RT-PCR under the supervision and guidance of P.S. K.Y.C.L. performed myocyte orientation analysis under the supervision and guidance of H.D. A.B. assisted with cryo-X-PCI setup design, beamtimes and tomographic reconstructions. K.Y.C.L. wrote the manuscript under the guidance and supervision of A.C.C., H.D. and P.S. All authors assisted in reviewing and revising the manuscript. Competing interests None. References Veinot, J. P. Diagnostic endomyocardial biopsy – still useful after all these years. Can. J. Cardiol. 25 , e55–e56 (2009). Guo, Q. et al. The mutational signatures of formalin fixation on the human genome. Nat. Commun. 13 , 4487 (2022). Berrino, E. et al. Tissue Fixation with a Formic Acid-Deprived Formalin Better Preserves DNA Integrity over Time. Pathobiology 90 , 155–165 (2023). Meecham, A. et al. Alternative tissue fixation for combined histopathological and molecular analysis in a clinically representative setting. Histochem. Cell Biol. (2021). Piskorz, A. M. et al. Methanol-based fixation is superior to buffered formalin for next-generation sequencing of DNA from clinical cancer samples. Ann. Oncol. 27 , 532–539 (2016). Wong, S. Q. et al. Sequence artefacts in a prospective series of formalin-fixed tumours tested for mutations in hotspot regions by massively parallel sequencing. BMC Med. Genomics 7 , 23 (2014). Spencer, D. H. et al. Comparison of Clinical Targeted Next-Generation Sequence Data from Formalin-Fixed and Fresh-Frozen Tissue Specimens. J. Mol. Diagn. 15 , 623–633 (2013). Xu, Y. et al. A Method for 3D Histopathology Reconstruction Supporting Mouse Microvasculature Analysis. PLOS ONE 10 , e0126817 (2015). Fei, P. et al. Cardiac Light-Sheet Fluorescent Microscopy for Multi-Scale and Rapid Imaging of Architecture and Function. Sci. Rep. 6 , 22489 (2016). Ricci, P. et al. Removing striping artifacts in light-sheet fluorescence microscopy: a review. Prog. Biophys. Mol. Biol. 168 , 52–65 (2022). Gonzalez-Tendero, A. et al. Whole heart detailed and quantitative anatomy, myofibre structure and vasculature from X-ray phase-contrast synchrotron radiation-based micro computed tomography. Eur. Heart J. - Cardiovasc. Imaging 18 , 732–741 (2017). Novo Matos, J. et al. Micro-computed tomography (micro-CT) for the assessment of myocardial disarray, fibrosis and ventricular mass in a feline model of hypertrophic cardiomyopathy. Sci. Rep. 10 , 20169 (2020). Stephenson, R. S. et al. High resolution 3-Dimensional imaging of the human cardiac conduction system from microanatomy to mathematical modeling. Sci. Rep. 7 , 7188 (2017). Dejea, H. et al. Comprehensive Analysis of Animal Models of Cardiovascular Disease using Multiscale X-Ray Phase Contrast Tomography. Sci. Rep. 9 , 6996 (2019). Reichardt, M., Frohn, J., Khan, A., Alves, F. & Salditt, T. Multi-scale X-ray phase-contrast tomography of murine heart tissue. Biomed. Opt. Express 11 , 2633 (2020). Du Plessis, A., Broeckhoven, C., Guelpa, A. & Le Roux, S. G. Laboratory x-ray micro-computed tomography: a user guideline for biological samples. GigaScience 6 , 1–11 (2017). Anschuetz, L. et al. Synchrotron radiation imaging revealing the sub-micron structure of the auditory ossicles. Hear. Res. 383 , 107806 (2019). Schueth, A. et al. Efficient 3D light-sheet imaging of very large-scale optically cleared human brain and prostate tissue samples. Commun. Biol. 6 , 170 (2023). Poola, P. K., Afzal, M. I., Yoo, Y., Kim, K. H. & Chung, E. Light sheet microscopy for histopathology applications. Biomed. Eng. Lett. 9 , 279–291 (2019). Reichardt, M., Töpperwien, M., Khan, A., Alves, F. & Salditt, T. Fiber orientation in a whole mouse heart reconstructed by laboratory phase-contrast micro-CT. J. Med. Imaging 7 , 1 (2020). Scott, A. E. et al. Three Dimensional Imaging of Paraffin Embedded Human Lung Tissue Samples by Micro-Computed Tomography. PLOS ONE 10 , e0126230 (2015). Lawson, M. J. et al. Immunofluorescence-guided segmentation of three-dimensional features in micro-computed tomography datasets of human lung tissue. R. Soc. Open Sci. 8 , 211067 (2021). Frohn, J. et al. 3D virtual histology of human pancreatic tissue by multiscale phase-contrast X-ray tomography. J. Synchrotron Radiat. 27 , 1707–1719 (2020). Planinc, I. et al. Comprehensive assessment of myocardial remodeling in ischemic heart disease by synchrotron propagation based X-ray phase contrast imaging. Sci. Rep. 11 , 14020 (2021). Li, K. Y. C. et al. Feasibility and safety of synchrotron-based X-ray phase contrast imaging as a technique complementary to histopathology analysis. Histochem. Cell Biol. (2023) doi:10.1007/s00418-023-02220-6. Eckermann, M. et al. 3D virtual pathohistology of lung tissue from Covid-19 patients based on phase contrast X-ray tomography. eLife 9 , e60408 (2020). Jacobsen, S. B., Tfelt-Hansen, J., Smerup, M. H., Andersen, J. D. & Morling, N. Comparison of whole transcriptome sequencing of fresh, frozen, and formalin-fixed, paraffin-embedded cardiac tissue. PLOS ONE 18 , e0283159 (2023). Mathieson, W. & Thomas, G. A. Why Formalin-fixed, Paraffin-embedded Biospecimens Must Be Used in Genomic Medicine: An Evidence-based Review and Conclusion. J. Histochem. Cytochem. 68 , 543–552 (2020). Musetti, V. et al. Tissue Characterization in Cardiac Amyloidosis. Biomedicines 10 , 3054 (2022). Magdeldin, S. & Yamamoto, T. Toward deciphering proteomes of formalin-fixed paraffin-embedded (FFPE) tissues. Proteomics 12 , 1045–1058 (2012). Planinc, I. et al. A novel, fast, and 3d approach towards evaluating endo-myocardial biopsies for follow-up of heart transplantation: X-ray phase contrast imaging and its agreement with classical histopathology. Journal of Heart and Lung Transplantation (2021). Norvik, C. et al. Synchrotron-based phase-contrast micro-CT as a tool for understanding pulmonary vascular pathobiology and the 3-D microanatomy of alveolar capillary dysplasia. Am. J. Physiol.-Lung Cell. Mol. Physiol. 318 , L65–L75 (2020). Reichardt, M. et al. 3D virtual histopathology of cardiac tissue from Covid-19 patients based on phase-contrast X-ray tomography. eLife 10 , e71359 (2021). Dejea, H. et al. Microstructural Analysis of Cardiac Endomyocardial Biopsies with Synchrotron Radiation-Based X-Ray Phase Contrast Imaging. in Functional Imaging and Modelling of the Heart (eds. Pop, M. & Wright, G. A.) vol. 10263 23–31 (Springer International Publishing, Cham, 2017). Fungtammasan, A. et al. Reverse Transcription Errors and RNA–DNA Differences at Short Tandem Repeats. Mol. Biol. Evol. 33 , 2744–2758 (2016). Van Nostrand, E. L., Shishkin, A. A., Pratt, G. A., Nguyen, T. B. & Yeo, G. W. Variation in single-nucleotide sensitivity of eCLIP derived from reverse transcription conditions. Methods 126 , 29–37 (2017). Wang, X., Yu, L. & Wu, A. R. The effect of methanol fixation on single-cell RNA sequencing data. BMC Genomics 22 , 420 (2021). Einarsson, E. et al. Phase-contrast enhanced synchrotron micro-tomography of human meniscus tissue. Osteoarthritis Cartilage 30 , 1222–1233 (2022). Maes, A. et al. Cryogenic contrast-enhanced microCT enables nondestructive 3D quantitative histopathology of soft biological tissues. Nat. Commun. 13 , 6207 (2022). Marone, F. & Stampanoni, M. Regridding reconstruction algorithm for real-time tomographic imaging. J. Synchrotron Radiat. 19 , 1029–1037 (2012). Paganin, D., Mayo, S. C., Gureyev, T. E., Miller, P. R. & Wilkins, S. W. Simultaneous phase and amplitude extraction from a single defocused image of a homogeneous object. J. Microsc. 206 , 33–40 (2002). Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9 , 676–682 (2012). Baličević, V. et al. Assessment of Myofiber Orientation in High Resolution Phase-Contrast CT Images. in Functional Imaging and Modeling of the Heart (eds. van Assen, H., Bovendeerd, P. & Delhaas, T.) vol. 9126 111–119 (Springer International Publishing, Cham, 2015). Garcia-Canadilla, P. et al. Complex Congenital Heart Disease Associated With Disordered Myocardial Architecture in a Midtrimester Human Fetus. Circ. Cardiovasc. Imaging 11 , (2018). Garcia‐Canadilla, P. et al. Myoarchitectural disarray of hypertrophic cardiomyopathy begins pre‐birth. J. Anat. 235 , 962–976 (2019). Garcia-Canadilla, P., Mohun, T. J., Bijnens, B. & Cook, A. C. Detailed quantification of cardiac ventricular myocardial architecture in the embryonic and fetal mouse heart by application of structure tensor analysis to high resolution episcopic microscopic data. Front. Cell Dev. Biol. 10 , 1000684 (2022). Dejea, H. Multiscale and dynamic synchrotron-based tomographic microscopy for cardiovascular applications. (ETH Zurich, Switzerland, 2021). Berg, S. et al. ilastik: interactive machine learning for (bio)image analysis. Nat. Methods 16 , 1226–1232 (2019). Kong, N., Ng, W., Cai, L., Leonardo, A. & Weimer, B. C. Integrating the DNA Integrity Number (DIN) to Assess Genomic DNA (gDNA) Quality Control Using the Agilent 2200 TapeStation System. (2016). Mekkaoui, C. et al. Fiber architecture in remodeled myocardium revealed with a quantitative diffusion CMR tractography framework and histological validation. J. Cardiovasc. Magn. Reson. 14 , 70 (2012). Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryInformationfinal.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4632236\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":322339025,\"identity\":\"1c9934ea-4127-4067-8bdd-7ca69d99e580\",\"order_by\":0,\"name\":\"Kan Yan Chloe Li\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIie3RMQrCMBSA4VcKukS6vqLYKyQITqJXeSDUJYjgIjjYyS4eoOIpvEHAwUVxdnNy6pADOJjUzmlHh/xDCIGPPHgAPt8fhvZ4cWBBnplL9dZpQYjDIDwoc2lPACbdglqSOL8roBWw3rEUmmCaAKbkJH22JDsYi09yhARzkWGqnGQIkldEnOTYDBYS4CJzk6j8kdnzZsmumfSx/iUomCUXQxoGi4uSK+LIgkO6RuJXsWdvchJ8SPHSn8ksyC9nrTfbJOqm3Elsql6PiTduxefz+Xxt+gLijjgWzw/wZAAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0001-7737-2118\",\"institution\":\"UCL Institute of Cardiovascular Science\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Kan\",\"middleName\":\"Yan Chloe\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":322339026,\"identity\":\"e5b4e47d-ce53-4263-a7b6-b3db9f11384a\",\"order_by\":1,\"name\":\"Petros Syrris\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-2363-8758\",\"institution\":\"UNIVERSITY COLLEGE LONDON\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Petros\",\"middleName\":\"\",\"lastName\":\"Syrris\",\"suffix\":\"\"},{\"id\":322339027,\"identity\":\"68088e57-fdcb-4232-8560-0617e62a8e6b\",\"order_by\":2,\"name\":\"Anne Bonnin\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-5537-8682\",\"institution\":\"Paul Scherrer Institut\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Anne\",\"middleName\":\"\",\"lastName\":\"Bonnin\",\"suffix\":\"\"},{\"id\":322339028,\"identity\":\"6ca77ea8-2e9e-4cde-a054-41921aab7212\",\"order_by\":3,\"name\":\"Thomas Treibel\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University College London\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Thomas\",\"middleName\":\"\",\"lastName\":\"Treibel\",\"suffix\":\"\"},{\"id\":322339029,\"identity\":\"4acd38ec-f554-41db-a688-228f01b3fa4f\",\"order_by\":4,\"name\":\"Vishwanie Budhram-Mahadeo\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-6664-1834\",\"institution\":\"v.budhram-mahadeo@ucl.ac.uk\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Vishwanie\",\"middleName\":\"\",\"lastName\":\"Budhram-Mahadeo\",\"suffix\":\"\"},{\"id\":322339030,\"identity\":\"3719fb9e-3948-48e0-9a8a-84d7f0ae562f\",\"order_by\":5,\"name\":\"Hector Dejea\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The European Synchrotron Radiation Facility\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hector\",\"middleName\":\"\",\"lastName\":\"Dejea\",\"suffix\":\"\"},{\"id\":322339031,\"identity\":\"f57e47ef-2e9e-4805-91ec-88cde28a1682\",\"order_by\":6,\"name\":\"Andrew Cook\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-5079-7546\",\"institution\":\"UCL\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Andrew\",\"middleName\":\"\",\"lastName\":\"Cook\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-06-24 20:35:20\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4632236/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4632236/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":60703482,\"identity\":\"33016f1c-37cf-455e-b6ca-11009b799eac\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 18:52:58\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1182973,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSchematic of synchrotron-based cryo-X-PCI setup and workflow for combined 3D, non-destructive myocardial morphologic assessment, and nucleic acid analysis.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4632236/v1/b014cd1e726136bdee99b8b8.png\"},{\"id\":60703483,\"identity\":\"714ddfd0-48ff-4899-8b0c-1c7f33df09ba\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 18:52:58\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2732704,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMyomapping and DNA integrity in representative fresh frozen, 4% paraformaldehyde-fixed (4% PFA) and 10% formaldehyde-fixed (10% F) mouse myocardial biopsies after cryo-X-PCI\\u003c/strong\\u003e. An expected gradual change in HA could be observed, from positive HA in endocardium (endo) to negative HA in epicardium (epi).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4632236/v1/9e4ff5dae6ba092e0ce4d7d9.png\"},{\"id\":60704085,\"identity\":\"140b63d5-b67e-49a0-a4d1-f8a274e609b1\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 19:00:58\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":176518,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDNA quality control TapeStation gels with DNA Integrity Number (DIN) values of gDNA extracted from representative mouse myocardial biopsies after synchrotron-based cryo-X-PCI. \\u003c/strong\\u003eKey: 4% PFA = 4% PFA-fixed samples; 10% F = 10% formaldehyde-fixed samples. Control samples represent those that were collected in RNAlater solution then snap frozen in liquid nitrogen and did not have cryo-X-PCI. DIN values appropriate for downstream analysis are shown in green. DIN values unsuitable for downstream analysis are shown as red including those that could not be calculated due to very low concentrations of DNA.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4632236/v1/5d2d729de69cdac72c6b5540.png\"},{\"id\":60830236,\"identity\":\"9c9514ad-0418-4e3b-85ac-b3f876ca9830\",\"added_by\":\"auto\",\"created_at\":\"2024-07-22 14:44:05\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":4675650,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4632236/v1/382c3450-6d9c-4bdd-997b-567042a5428e.pdf\"},{\"id\":60703485,\"identity\":\"37da3ac4-db9d-4dd5-a245-16484b6ddf3d\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 18:52:58\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":38132740,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryInformationfinal.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4632236/v1/ffada47d8253526371a407f9.docx\"}],\"financialInterests\":\"There is \\u003cb\\u003eNO\\u003c/b\\u003e Competing Interest.\",\"formattedTitle\":\"Cryo-X-ray Phase Contrast Imaging enables combined 3D structural quantification and nucleic acid analysis of myocardial biopsies\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eBiopsies are essential for diagnosing and determining the extent of disease in clinical practice and research\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e. To preserve tissue structure and prevent degradation, biopsies are typically placed in a fixative, such as formalin or glutaraldehyde. However, fixation can negatively impact nucleic acids through crosslinking of proteins, which in turn, can negatively affect the quality and accuracy of downstream analyses such as polymerase chain reaction (PCR) and single-cell sequencing\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR3 CR4 CR5 CR6\\\" citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e. As a result, biopsies, including myocardial biopsies, are commonly taken during clinical research and diagnosis and snap frozen, preserving the molecular and cellular integrity of biopsies\\u0026rsquo; cells in their near \\u0026lsquo;native state\\u0026rsquo;, and allowing full range downstream -omic analyses to be performed, including those involving nucleic acids.\\u003c/p\\u003e \\u003cp\\u003eConventional histology is considered the gold standard method for assessing the quality of ex-vivo tissue at a microscopic level. While valuable, it is destructive and can distort the true three-dimensional (3D) structure of tissues\\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. There have been dramatic advancements in 3D structural analyses using techniques such as light sheet fluorescence microscopy (LSFM) which offer higher resolution and faster acquisitions\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. However, LSFM requires extensive sample preparation and optical clearing\\u003csup\\u003e\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eAdvanced techniques such as micro-computed tomography (micro-CT) and synchrotron-based X-ray phase contrast imaging (X-PCI) can provide non-destructive, 3D virtual histological information at high resolution\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR12 CR13 CR14\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. While micro-CT can achieve a resolution as low as 10 \\u0026micro;m, X-PCI can potentially achieve below 1 \\u0026micro;m\\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. These imaging methods are particularly useful for analysing FFPE samples\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e,\\u003cspan additionalcitationids=\\\"CR19 CR20 CR21 CR22 CR23 CR24 CR25\\\" citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e, which are commonly used worldwide in clinical settings and in biobanks as they are convenient for long-term storage and preserve tissue at room temperature, and allow for histology and immunohistochemical staining\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR28 CR29\\\" citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eTraditional, laboratory-based micro-CT has limited resolution and low contrast in soft tissues, such as the heart, and typically requires contrast agents. On the other hand, X-PCI offers high resolution imaging of soft, low-absorption-contrast biological samples by detecting the phase shift as X-rays pass through matter because of the differences in refractive index and tissue density. Previous studies have shown the effectiveness of X-PCI for imaging formalin-fixed and/or paraffin-embedded myocardial biopsies from ex vivo human and animal hearts without sectioning nor staining, while providing high resolution 2D and 3D virtual histopathology\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e, thus enabling both morphological assessment\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e and the visualisation of sub(cellular) features\\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e. Nucleic acid analysis is feasible for FFPE X-PCI, however, formaldehyde fixation limits the range of techniques available and can increase the rate of errors during reverse transcription, leading to incorrect sequencing results\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR36\\\" citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, a technique that enables 3D microstructural assessment of myocardium in its near-native state whilst maintaining DNA and RNA integrity for subsequent downstream genomics and transcriptomics applications is highly desirable.\\u003c/p\\u003e \\u003cp\\u003eCryo-X-PCI has been recently used to image frozen human meniscus tissue, where collagen fibre orientation could be assessed by structure tensor analysis, but nucleic acid analysis was not reported\\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. Cryogenic contrast-enhanced micro-CT has been used to non-destructively image skeletal muscle and tendon fibres in 3D, but requires prior staining which can cause tissue shrinkage\\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e. Nucleic acid analysis was also not reported in their study. In this study, we propose that synchrotron-based cryo-X-PCI can overcome these limitations allowing imaging of frozen myocardial biopsies for 3D morphologic analysis while preserving DNA and RNA integrity for downstream genomics and transcriptomics analyses.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSample description and preparation\\u003c/h2\\u003e \\u003cp\\u003eAll tissue samples collected from this study were from excess wild-type C57BL/6 mice. The animal experiments were conducted within the terms of the UK Animals (Scientific Procedures) Act 1986 under Project Licence number PB12FFA7E. Four wild-type C57BL/6 male mice were sacrificed and their hearts were immediately collected in RNAlater\\u0026trade; Stabilisation Solution (Thermo Fisher Scientific) at room temperature. Two of these hearts were snap frozen using liquid nitrogen (fresh frozen). One heart was fixed in 4% paraformaldehyde (4% PFA) for 1 h. The remaining heart was fixed in 10% formaldehyde (10% F) for 30 min. After fixation, 10 small biopsies of myocardium were dissected from each heart to give a total of 40 myocardial biopsies. The myocardial biopsies were approximately 2 mm x 4 mm in dimensions.\\u003c/p\\u003e \\u003cp\\u003eEach myocardial biopsy was carefully drawn along with OCT mounting media (VWR Chemicals) into a 1 ml syringe to avoid bubbles. The end of the syringe was positioned on the central spindle of a Magnetic CryoCap\\u0026trade; (Molecular Dimensions MD7-400) (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;1a\\u003c/b\\u003e) before snap freezing with liquid nitrogen. Myocardial biopsies were protected by Magnetic CryoVials\\u0026trade; (Molecular Dimensions MD7-402) and stored at -80\\u0026deg;C until required.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSynchrotron-based cryo-X-ray phase-contrast imaging (cryo-X-PCI)\\u003c/h2\\u003e \\u003cp\\u003eThirty samples (n\\u0026thinsp;=\\u0026thinsp;10 fresh frozen, n\\u0026thinsp;=\\u0026thinsp;10 4% PFA, n\\u0026thinsp;=\\u0026thinsp;10 10% F) were transported on dry ice to the Paul Scherrer Institute (Villigen, Switzerland), where synchrotron-based cryo-X-PCI was performed at the TOMCAT X02DA beamline of the Swiss Light Source using an in-house developed setup (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;1b\\u003c/b\\u003e). The remaining 10 fresh frozen myocardial biopsies used in this study did not undergo cryo-X-PCI and served as controls and for comparison between cryo-X-PCI versus traditional 2D histology (cryo-sectioning).\\u003c/p\\u003e \\u003cp\\u003e Each sample was carefully positioned on a dedicated magnetic mount on the rotation stage to allow for fast sample positioning and exchange. The sample was placed under a double walled orange Kapton foil cage mounted on a cryojet nozzle and kept at -80\\u0026deg;C. The flow of cold nitrogen gas was obtained from a Cryojet5 (Oxford-Instruments). The cage was positioned directly above the CryoVial to keep the biopsy frozen throughout the scan and avoid freeze-thaw effects (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;1b\\u003c/b\\u003e). After centring the sample on the rotation stage, tomographic acquisition was performed using the standard X-ray microscope setup. The microscope was composed of a LuAG:Ce scintillator screen of 20 \\u0026micro;m, a x10 magnification objective, and a PCO.Edge 5.5 CMOS camera. The field of view was 1.7 x 1.4 mm\\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e and the effective pixel size was 0.65 \\u0026micro;m. 1000 projections were captured over 180 degrees using a 50 ms exposure time per projection, a beam energy of 21 keV, and a propagation distance of 60 mm (\\u003cb\\u003eSupplementary Table\\u0026nbsp;1\\u003c/b\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImage reconstruction and visualisation\\u003c/h2\\u003e \\u003cp\\u003eAfter acquisition, all projections were corrected with dark and flat-field images. Phase retrieval was performed with Paganin phase retrieval filter algorithm (δ/β\\u0026thinsp;=\\u0026thinsp;5.3e-7/9.3e-9\\u0026thinsp;=\\u0026thinsp;57) before reconstruction in 3D by using Gridrec algorithm\\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. Each scanned volume of interest was saved as a volumetric dataset comprised of 2160 image slices at 16-bit pixel depth. Visual inspection of myocardial morphology was performed using Fiji/ImageJ (ImageJ, version 1.51, Wayne Rasband)\\u003csup\\u003e\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. Datasets were reduced from 16-bit to 8-bit depth and cropped to fit the biopsy size accordingly to remove redundant data and reduce computational cost during image processing.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantification of myocyte orientation (\\u0026ldquo;myomapping\\u0026rdquo;)\\u003c/h2\\u003e \\u003cp\\u003eTo quantify the orientation of myocyte aggregates (\\u0026ldquo;myomapping\\u0026rdquo;), structure tensor (ST) analysis was used where helical angle (HA) and intrusion angle (IA) were computed with an in-house developed MATLAB script\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e,\\u003cspan additionalcitationids=\\\"CR44 CR45\\\" citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e. The ST was calculated at each voxel using prolate spheroidal coordinates (\\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\lambda\\\\)\\u003c/span\\u003e\\u003c/span\\u003e, \\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\mu , \\\\theta\\\\)\\u003c/span\\u003e\\u003c/span\\u003e), which provide more accurate representation of the 3D orientation of cardiomyocyte aggregates than Cartesian coordinates\\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e. Eigen-decomposition of the ST at each voxel yielded its three eigenvalues and their eigenvectors, which represent magnitude and direction of orientation of cells, respectively. The tertiary eigenvector, which has the smallest eigenvalue, represents the vector following the orientation of myocyte aggregates in their longitudinal axis due to correspondence with lowest intensity variation (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;2\\u003c/b\\u003e)\\u003csup\\u003e\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e\\u003c/sup\\u003e. HA represents the longitudinal direction of myocyte aggregates with respect to the long axis of the ventricle, while intrusion angle (also known as transverse angle) describes the angle at which the myocyte aggregates penetrate the myocardium on the cross-sectional plane. Fractional anisotropy (FA) is the degree of anisotropy or disorganisation of the local myocardium. To focus ST analysis on relevant areas and exclude background, a segmentation mask was created for each dataset using a semi-automatic pixel classification workflow in open-source software Ilastik (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;3\\u003c/b\\u003e)\\u003csup\\u003e\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTraditional 2D histologic assessment\\u003c/h2\\u003e \\u003cp\\u003eEight myocardial samples were used for cryo-sectioning after cryo-X-PCI: four fresh frozen samples (fresh frozen 3, 4, 5 and 6), two 4% PFA-fixed samples (4% PFA 4 and 9), and two 10% formalin-fixed samples (10% F 4 and 8). Two fresh frozen samples that did not have cryo-X-PCI (controls 7 and 8) served as controls and underwent cryo-sectioning. Cryo-sections of 8 \\u0026micro;m thickness were cut with a cryostat (Leica) at -20\\u0026deg;C and collected on SuperFrost\\u0026trade; Plus microscope slides (VWR). A haematoxylin and eosin (H\\u0026amp;E) frozen staining protocol was used to stain cryo-section slides via an automated system (Tissue-Tek DRS 2000 Multiple Slide Stainer, Sakura) (\\u003cb\\u003eSupplementary Table\\u0026nbsp;2\\u003c/b\\u003e). Stained slides were digitised using a Nanozoomer Whole Slide Imager and viewed with NDP.View 2 software (Hamamatsu Photonics).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExtraction, quality assessment and quantitation of DNA and RNA\\u003c/h2\\u003e \\u003cp\\u003eAfter synchrotron-based cryo-X-PCI, genomic DNA (gDNA) and total RNA were extracted from 30 mouse myocardial biopsies using AllPrep DNA/RNA/miRNA Universal Kit (catalogue number 80224, Qiagen, Germany) following the standard manufacturer\\u0026rsquo;s protocol. The concentration and purity of DNA were quantified using NanoDrop\\u0026trade; Lite Spectrophotometer (Thermo Fisher Scientific, USA) and measured with NanoDrop spectrophotometer using A\\u003csub\\u003e260\\u003c/sub\\u003e/A\\u003csub\\u003e230\\u003c/sub\\u003e and A\\u003csub\\u003e260\\u003c/sub\\u003e/A\\u003csub\\u003e280\\u003c/sub\\u003e absorbance ratios. Quality control of extracted DNA and RNA was performed using Agilent TapeStation 2200 (UCL Genomics) to assess fragmentation and DNA integrity number (DIN) and RNA integrity number (RIN) values. DIN and RIN values range from 1 (highly degraded DNA/RNA) to 10 (highly intact DNA/RNA)\\u003csup\\u003e49\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe suitability of the extracted DNA to be used as template in PCR was assessed on exon 28 of the mouse myosin binding protein C3 (Mybpc3) gene using the following primer sequences: 5\\u0026rsquo; AGCTATAGTGCTCTGGACCCT 3\\u0026rsquo; (forward primer) and 5\\u0026rsquo; CCCAACCCTGAGCTTGACG 3\\u0026rsquo; (reverse primer) with AmpliTaq Gold\\u0026trade; DNA polymerase (Applied Biosystems\\u0026trade;). Agilent Technologies SureCycler 8800 thermal cycler was used for PCR with the following conditions: initial hot start (96\\u0026deg;C, 10 min) followed by 35 cycles of denaturation (96\\u0026deg;C, 30 s), annealing (59\\u0026deg;C, 1 min) and elongation (72\\u0026deg;C, 1 min), and a final elongation step (72\\u0026deg;C, 7 min). PCR products were separated using agarose gel electrophoresis (2% w/v) and the expected band at 330 base pairs (bp) was detected by an ultraviolet (UV) light transilluminator (GelDoc imaging system) following staining with GelRed (#41003, Biotium).\\u003c/p\\u003e \\u003cp\\u003eExtracted RNA (11 \\u0026micro;l) from myocardial biopsies was reverse transcribed with the SuperScript\\u0026trade; IV First-Strand Synthesis System kit (Invitrogen) using Mybpc3 exon 28 reverse primer (5\\u0026rsquo; CCCAACCCTGAGCTTGACG 3\\u0026rsquo;). RNA-primer mix was heated at 65\\u0026deg;C (5 min) then incubated on ice for at least 1 min. The reverse transcriptase reaction and RNA-primer mix were incubated at 50\\u0026deg;C (20 min) and then inactivated at 80\\u0026deg;C (10 min). PCR on exon 28 of Mybpc3 gene was performed with the aforementioned mouse primer sequences using 8 \\u0026micro;l cDNA in a total reaction volume of 25 \\u0026micro;l per sample with the following conditions: initial hot start (96\\u0026deg;C, 10 min) followed by 40 cycles of denaturation (96\\u0026deg;C, 1 min), annealing (58\\u0026deg;C, 1 min) and elongation (72\\u0026deg;C, 2.5 min), and a final elongation step (72\\u0026deg;C, 7 min).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCryo-X-PCI enables 3D morphological assessment of myocardial biopsies in a non-destructive manner\\u003c/h2\\u003e \\u003cp\\u003e30 myocardial mouse samples were investigated using a dedicated cryo-X-PCI setup at the TOMCAT beamline (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e and \\u003cb\\u003eSupplementary Fig.\\u0026nbsp;1\\u003c/b\\u003e). Using the ST method, gradual changes in HA and IA from endocardium to epicardium could be clearly visualised and quantified in 16 samples (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cb\\u003eSupplementary Figs.\\u0026nbsp;4\\u0026ndash;6\\u003c/b\\u003e). The myocyte aggregates in these biopsies were aligned in a way that showed a gradual change in HA from positive angulation in the endocardium (endo) to negative angulation in the epicardium (epi) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cb\\u003eSupplementary Figs.\\u0026nbsp;4\\u0026ndash;6\\u003c/b\\u003e). Spacing between myocytes was increased in the majority of samples.\\u003c/p\\u003e \\u003cp\\u003eOf the remainder (5 fresh frozen, seven 4% PFA and two 10% F biopsies), myomapping was sub-optimal due to artefacts from large ice crystals. Ice crystal artefacts were also observed in control mouse myocardial biopsies (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;7\\u003c/b\\u003e). Overall myocardial morphology was better preserved in 10% F samples, than fresh frozen biopsies (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;4\\u003c/b\\u003e and \\u003cb\\u003eSupplementary Fig.\\u0026nbsp;5\\u003c/b\\u003e). 4% PFA samples showed unusual disruption to morphology, suggestive of an interaction between RNA later and PFA, along with artefacts due to ice crystal formation (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;6\\u003c/b\\u003e).\\u003c/p\\u003e \\u003cp\\u003eCryo-sectioning and H\\u0026amp;E-staining of 8 cryo-X-PCI samples plus 2 control samples were feasible after cryo-X-PCI without tissue damage (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;8\\u003c/b\\u003e). Fractures to myocytes were observed in regions of ice crystal formation in both cryo-X-PCI and controls (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;8\\u003c/b\\u003e) along with variation in spacing between myocytes in preserved regions.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCryo-X-PCI does not affect DNA nor RNA integrity\\u003c/h2\\u003e \\u003cp\\u003eBoth DNA and RNA were extracted from all samples (22 mouse myocardial samples with cryo-X-PCI and 8 control samples without cryo-X-PCI) (\\u003cb\\u003eSupplementary Table\\u0026nbsp;3\\u003c/b\\u003e). DNA integrity was highest for fresh frozen samples (without fixation), with mean DIN values of 7.0 (with cryo-X-PCI) and 7.2 (control) and a range of 0.9 (cryo-X-PCI) and 1.0 (control) (\\u003cb\\u003eSupplementary Table\\u0026nbsp;3\\u003c/b\\u003e). All fresh frozen samples had DIN values that exceeded the minimum cut-off (DIN\\u0026thinsp;\\u0026gt;\\u0026thinsp;6, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e and \\u003cb\\u003eSupplementary Table\\u0026nbsp;3\\u003c/b\\u003e)\\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e\\u003c/sup\\u003e. In 4% PFA-fixed samples, mean DIN values were lower (mean 6.9, range 2.6), and were the lowest for 10% F samples (mean 3.0, range 1.6) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e and \\u003cb\\u003eSupplementary Table\\u0026nbsp;3\\u003c/b\\u003e).\\u003c/p\\u003e \\u003cp\\u003eFurther assessment of DNA integrity was acheived through sequence-specific PCR amplification of exon 28 of Mybpc3. All fresh frozen and 4% PFA-fixed DNA samples were of sufficient quality and integrity to amplify the exon successfully with visualisation of expected amplicon PCR product (330 base pairs, bp) (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;9\\u003c/b\\u003e). In contrast, 10% F samples showed weak PCR product bands (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;9\\u003c/b\\u003e).\\u003c/p\\u003e \\u003cp\\u003eRIN values were significantly lower than corresponding DIN values. Fresh frozen samples had highest RIN values overall (mean RIN value of fresh frozen sample\\u0026thinsp;=\\u0026thinsp;4.4; range of 5.0), followed by 4% PFA samples (mean\\u0026thinsp;=\\u0026thinsp;3.8; range of 3.1), and 10% F samples (mean\\u0026thinsp;=\\u0026thinsp;2.9; range of 1.6) (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;10\\u003c/b\\u003e and \\u003cb\\u003eSupplementary Table\\u0026nbsp;3\\u003c/b\\u003e). The control samples (those that did not undergo cryo-X-PCI) also had low RIN values (mean RIN value of 4.0; range of 4.4) where only one sample exceeded a RIN value of 6 (sample: control 9) (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;10\\u003c/b\\u003e and \\u003cb\\u003eSupplementary Table\\u0026nbsp;3\\u003c/b\\u003e). Further assessment of RNA integrity was performed through reverse transcription PCR of extracted RNA (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;11\\u003c/b\\u003e). Despite the low RNA concentrations and RIN values, the extracted samples could still be successfully reverse transcribed to cDNA and subsequently amplified by PCR (\\u003cb\\u003eSupplementary Fig.\\u0026nbsp;11\\u003c/b\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eSnap frozen biopsies represent a vast resource for clinical research as they have superior molecular integrity for performing the full array of downstream nucleic acid analysis compared to formalin-fixed tissue. However, obtaining 3D structural information from frozen tissue prior to analysis is challenging. In contrast, formalin-fixed tissue is the standard for obtaining 2D structural information. Formalin-fixed tissue is less compatible with nucleic acid extraction and analysis, and tissue distortion through histologic processing still occurs, which is particularly relevant to 3D analysis of complex, soft tissues, such as myocyte arrangement in the myocardium. A procedure that can combine imaging of (snap frozen) tissue, in its near native state, and be followed by nucleic acid analysis could therefore be clinically relevant for combined in-depth characterisation and targeting of disease.\\u003c/p\\u003e \\u003cp\\u003eIn this study we demonstrate the feasibility of synchrotron-based cryo-X-PCI of frozen myocardial biopsies prepared under differing conditions. We describe, for the first time, the combination of 3D structural analysis from synchrotron-based cryo-X-PCI with assessment of nucleic acid analysis, focussing particularly on DNA and RNA integrity post-cryo-X-PCI.\\u003c/p\\u003e \\u003cp\\u003eAs a marker of high-level morphologic preservation, we demonstrate that quantification of myocyte orientation (myomapping) in frozen myocardial biopsies is feasible through structure tensor analysis and that HA, IA and FA morphologic parameters could be assessed. Myomapping showed a gradual change in HA, from positive HA in the endocardium to negative HA in the epicardium and is consistent with previously reported studies which have quantified myocyte orientation in whole heart, in both animal models and human samples\\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e. With biopsies, there is an additional layer of complexity in that the orientation of the biopsy is not always known. In order to mitigate this, datasets were carefully oriented with respect to epicardium and endocardium before performing myomapping. We also compared cryo-X-PCI with 2D traditional histology through cryo-sectioning and H\\u0026amp;E staining and confirmed similar appearances before and after imaging. The increased spacing between myocyte aggregates found in our frozen biopsies closely resemble that reported in frozen tendon tissue imaged by cryogenic contrast-enhanced micro-CT\\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e suggesting that this feature is inherent to imaging tissues in their frozen state. Ice crystal artefacts were present in some biopsies, including in the control samples which is not ideal. Despite the presence of freezing artefacts, quantification of orientation of myocyte aggregates was still feasible in cryo-X-PCI samples as indicated by the myomapping results. Our study was designed to replicate the freezing process that is commonly used in clinical practice which typically involves rapid collection of biopsies in a cryogenic tube and snap freezing them in liquid nitrogen. However, other techniques for snap freezing samples could be investigated in the future.\\u003c/p\\u003e \\u003cp\\u003eImportantly, our study also shows that DNA and RNA can be successfully extracted from cardiac biopsies following cryo-X-PCI. Fresh frozen samples had optimal recovery of DNA as indicated by the DIN values greater than 6 for all extracted DNA samples followed by lower DIN values for biopsies preserved in 4% PFA and 10% formalin. Sequence-specific (Mybpc3 exon 28) PCR was successful for all fresh frozen and 4% PFA-fixed samples which all showed the 330 bp PCR product band. The 10% F samples had the lowest integrity as indicated by the low DIN values and only one faint Mybpc3 exon 28 PCR product band could be observed. Most likely this was due to extensive crosslinking from 10% formaldehyde fixation and is in agreement with our preliminary study\\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eLow RIN values from TapeStation and Nanodrop measurements for the extracted RNA from biopsies were observed. Nonetheless, we optimised RT-PCR conditions to account for the small biopsy size and low RNA concentrations and showed that RNA could still be reverse transcribed to cDNA. The cDNA concentrations were very low and had to be re-amplified for the bands to show up clearly on the gel, but they were still viable for gene-specific PCR amplification as shown by the success of Mybpc3 exon 28 PCR.\\u003c/p\\u003e \\u003cp\\u003eWe also compared DIN and RIN values for cryo-X-PCI biopsies with control biopsies (those that did not undergo cryo-X-PCI). There were no significant differences between the mean DIN and RIN values for fresh frozen samples that had cryo-X-PCI (mean DIN\\u0026thinsp;=\\u0026thinsp;7.0, mean RIN\\u0026thinsp;=\\u0026thinsp;4.4) compared to the fresh frozen samples that did not undergo cryo-X-PCI (mean DIN\\u0026thinsp;=\\u0026thinsp;7.2, mean RIN\\u0026thinsp;=\\u0026thinsp;4.0). We found no significant differences in nucleic acid quantity and quality, suggesting again that the small size of the biopsy was the limiting factor instead of cryo-X-PCI itself. Therefore, overall, if the goal is to have high nucleic acid integrity for downstream genomics and transcriptomics applications, such as sequencing, it would be best to avoid fixing samples, and simply prepare biopsies with optimal preservation of DNA and RNA, followed by freezing. On the other hand, if the aim is to have superior myocardial morphological detail but not perform subsequent omics, then fixing the biopsies in formaldehyde and processing them into FFPE blocks would be sufficient.\\u003c/p\\u003e \\u003cp\\u003eTo conclude, cryo-X-PCI can provide non-destructive 3D assessment of myocardial morphology and can be combined with nucleic acid analysis of frozen biopsies. Synchrotron-based cryo-X-PCI does not appear to affect DNA or RNA integrity for downstream genomics and transcriptomics applications, and we recommend fresh frozen sample preparation for optimal results in both morphology and nucleic acid quality. Although we only tested cryo-X-PCI in mouse myocardial biopsies, this technique has the potential to be integrated into the clinical setting as a technique to image frozen biopsies from a range of diseases. We foresee clinical potential of cryo-X-PCI to examine further resources of snap frozen material (both cardiac and non-cardiac soft tissue) to provide 3D virtual histopathology and correlation between structural information and genetics.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLimitations\\u003c/h2\\u003e \\u003cp\\u003eThe current study has limitations. Snap freezing of samples was designed to replicate clinical practice but was not optimised to limit use of animal tissues and beamtime. Further studies are required to assess if this can be minimised. Our study focussed on DNA and RNA integrity as a marker of nucleic acid analysis preservation and protein integrity was not assessed. However, we have previously shown that X-PCI does not inherently affect protein epitopes as seen via immunohistochemistry\\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e. Our study was limited by availability of synchrotron beamtime which is both competitive and expensive and our samples were limited to mouse myocardial biopsies which were imaged to show proof-of-concept before use of valuable human myocardial biopsies.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003eAll animal studies were approved by the University College London Biological Services Ethical Review Committee and performed with UK Home Office approval (Project Licence number PB12FFA7E). Animal work conformed to the UK Animals (Scientific Procedures) Act 1986.\\u003c/p\\u003e\\n\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003cbr\\u003e\\u0026nbsp;\\u003c/strong\\u003eKan Yan Chloe Li would like to acknowledge the British Heart Foundation for funding this research which is part of a 4-Year BHF Cardiovascular Biomedicine PhD studentship (Grant No. BHF FS/4yPhD/F/20/34134). Hector Dejea acknowledges support from the Chan Zuckerberg Initiative DAF (grant 2022-316777). Thomas Treibel is supported by the British Heart Foundation [FS/19/35/34374]), and directly or indirectly supported by the UCLH and Barts NIHR Biomedical Research Centers and through a BHF Accelerator Award. We acknowledge the Paul Scherrer Institut, Villigen, Switzerland for provision of synchrotron radiation beamtime at the TOMCAT beamline X02DA of the Swiss Light Source (SLS). We acknowledge UCL Genomics for TapeStation quality control of DNA and RNA samples. We thank Professor Vishwanie Budhram-Mahadeo for providing excess wild-type\\u0026nbsp;C57BL/6 mice for the study (project licence number PB12FFA7E).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003cbr\\u003e\\u0026nbsp;\\u003c/strong\\u003eA.C.C., P.S., T.T., and K.Y.C.L. conceptualised the project.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eK.Y.C.L. performed DNA and RNA extraction from myocardial biopsies, cDNA synthesis, PCR, RT-PCR under the supervision and guidance of P.S.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eK.Y.C.L. performed myocyte orientation analysis under the supervision and guidance of H.D.\\u003c/p\\u003e\\n\\u003cp\\u003eA.B. assisted with cryo-X-PCI setup design, beamtimes and tomographic reconstructions.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eK.Y.C.L. wrote the manuscript under the guidance and supervision of A.C.C., H.D. and P.S. All authors assisted in reviewing and revising the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp;\\u003c/strong\\u003eNone.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eVeinot, J. P. Diagnostic endomyocardial biopsy \\u0026ndash; still useful after all these years. \\u003cem\\u003eCan. J. Cardiol.\\u003c/em\\u003e \\u003cstrong\\u003e25\\u003c/strong\\u003e, e55\\u0026ndash;e56 (2009).\\u003c/li\\u003e\\n\\u003cli\\u003eGuo, Q. \\u003cem\\u003eet al.\\u003c/em\\u003e The mutational signatures of formalin fixation on the human genome. \\u003cem\\u003eNat. Commun.\\u003c/em\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e, 4487 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eBerrino, E. \\u003cem\\u003eet al.\\u003c/em\\u003e Tissue Fixation with a Formic Acid-Deprived Formalin Better Preserves DNA Integrity over Time. \\u003cem\\u003ePathobiology\\u003c/em\\u003e \\u003cstrong\\u003e90\\u003c/strong\\u003e, 155\\u0026ndash;165 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eMeecham, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Alternative tissue fixation for combined histopathological and molecular analysis in a clinically representative setting. \\u003cem\\u003eHistochem. Cell Biol.\\u003c/em\\u003e (2021).\\u003c/li\\u003e\\n\\u003cli\\u003ePiskorz, A. M. \\u003cem\\u003eet al.\\u003c/em\\u003e Methanol-based fixation is superior to buffered formalin for next-generation sequencing of DNA from clinical cancer samples. \\u003cem\\u003eAnn. Oncol.\\u003c/em\\u003e \\u003cstrong\\u003e27\\u003c/strong\\u003e, 532\\u0026ndash;539 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eWong, S. Q. \\u003cem\\u003eet al.\\u003c/em\\u003e Sequence artefacts in a prospective series of formalin-fixed tumours tested for mutations in hotspot regions by massively parallel sequencing. \\u003cem\\u003eBMC Med. Genomics\\u003c/em\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e, 23 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eSpencer, D. H. \\u003cem\\u003eet al.\\u003c/em\\u003e Comparison of Clinical Targeted Next-Generation Sequence Data from Formalin-Fixed and Fresh-Frozen Tissue Specimens. \\u003cem\\u003eJ. Mol. Diagn.\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 623\\u0026ndash;633 (2013).\\u003c/li\\u003e\\n\\u003cli\\u003eXu, Y. \\u003cem\\u003eet al.\\u003c/em\\u003e A Method for 3D Histopathology Reconstruction Supporting Mouse Microvasculature Analysis. \\u003cem\\u003ePLOS ONE\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, e0126817 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eFei, P. \\u003cem\\u003eet al.\\u003c/em\\u003e Cardiac Light-Sheet Fluorescent Microscopy for Multi-Scale and Rapid Imaging of Architecture and Function. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cstrong\\u003e6\\u003c/strong\\u003e, 22489 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eRicci, P. \\u003cem\\u003eet al.\\u003c/em\\u003e Removing striping artifacts in light-sheet fluorescence microscopy: a review. \\u003cem\\u003eProg. Biophys. Mol. Biol.\\u003c/em\\u003e \\u003cstrong\\u003e168\\u003c/strong\\u003e, 52\\u0026ndash;65 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eGonzalez-Tendero, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Whole heart detailed and quantitative anatomy, myofibre structure and vasculature from X-ray phase-contrast synchrotron radiation-based micro computed tomography. \\u003cem\\u003eEur. Heart J. - Cardiovasc. Imaging\\u003c/em\\u003e \\u003cstrong\\u003e18\\u003c/strong\\u003e, 732\\u0026ndash;741 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eNovo Matos, J. \\u003cem\\u003eet al.\\u003c/em\\u003e Micro-computed tomography (micro-CT) for the assessment of myocardial disarray, fibrosis and ventricular mass in a feline model of hypertrophic cardiomyopathy. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 20169 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eStephenson, R. S. \\u003cem\\u003eet al.\\u003c/em\\u003e High resolution 3-Dimensional imaging of the human cardiac conduction system from microanatomy to mathematical modeling. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e, 7188 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eDejea, H. \\u003cem\\u003eet al.\\u003c/em\\u003e Comprehensive Analysis of Animal Models of Cardiovascular Disease using Multiscale X-Ray Phase Contrast Tomography. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 6996 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eReichardt, M., Frohn, J., Khan, A., Alves, F. \\u0026amp; Salditt, T. Multi-scale X-ray phase-contrast tomography of murine heart tissue. \\u003cem\\u003eBiomed. Opt. Express\\u003c/em\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e, 2633 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eDu Plessis, A., Broeckhoven, C., Guelpa, A. \\u0026amp; Le Roux, S. G. Laboratory x-ray micro-computed tomography: a user guideline for biological samples. \\u003cem\\u003eGigaScience\\u003c/em\\u003e \\u003cstrong\\u003e6\\u003c/strong\\u003e, 1\\u0026ndash;11 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eAnschuetz, L. \\u003cem\\u003eet al.\\u003c/em\\u003e Synchrotron radiation imaging revealing the sub-micron structure of the auditory ossicles. \\u003cem\\u003eHear. Res.\\u003c/em\\u003e \\u003cstrong\\u003e383\\u003c/strong\\u003e, 107806 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eSchueth, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Efficient 3D light-sheet imaging of very large-scale optically cleared human brain and prostate tissue samples. \\u003cem\\u003eCommun. Biol.\\u003c/em\\u003e \\u003cstrong\\u003e6\\u003c/strong\\u003e, 170 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003ePoola, P. K., Afzal, M. I., Yoo, Y., Kim, K. H. \\u0026amp; Chung, E. Light sheet microscopy for histopathology applications. \\u003cem\\u003eBiomed. Eng. Lett.\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 279\\u0026ndash;291 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eReichardt, M., T\\u0026ouml;pperwien, M., Khan, A., Alves, F. \\u0026amp; Salditt, T. Fiber orientation in a whole mouse heart reconstructed by laboratory phase-contrast micro-CT. \\u003cem\\u003eJ. Med. Imaging\\u003c/em\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e, 1 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eScott, A. E. \\u003cem\\u003eet al.\\u003c/em\\u003e Three Dimensional Imaging of Paraffin Embedded Human Lung Tissue Samples by Micro-Computed Tomography. \\u003cem\\u003ePLOS ONE\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, e0126230 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eLawson, M. J. \\u003cem\\u003eet al.\\u003c/em\\u003e Immunofluorescence-guided segmentation of three-dimensional features in micro-computed tomography datasets of human lung tissue. \\u003cem\\u003eR. Soc. Open Sci.\\u003c/em\\u003e \\u003cstrong\\u003e8\\u003c/strong\\u003e, 211067 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eFrohn, J. \\u003cem\\u003eet al.\\u003c/em\\u003e 3D virtual histology of human pancreatic tissue by multiscale phase-contrast X-ray tomography. \\u003cem\\u003eJ. Synchrotron Radiat.\\u003c/em\\u003e \\u003cstrong\\u003e27\\u003c/strong\\u003e, 1707\\u0026ndash;1719 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003ePlaninc, I. \\u003cem\\u003eet al.\\u003c/em\\u003e Comprehensive assessment of myocardial remodeling in ischemic heart disease by synchrotron propagation based X-ray phase contrast imaging. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e, 14020 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eLi, K. Y. C. \\u003cem\\u003eet al.\\u003c/em\\u003e Feasibility and safety of synchrotron-based X-ray phase contrast imaging as a technique complementary to histopathology analysis. \\u003cem\\u003eHistochem. Cell Biol.\\u003c/em\\u003e (2023) doi:10.1007/s00418-023-02220-6.\\u003c/li\\u003e\\n\\u003cli\\u003eEckermann, M. \\u003cem\\u003eet al.\\u003c/em\\u003e 3D virtual pathohistology of lung tissue from Covid-19 patients based on phase contrast X-ray tomography. \\u003cem\\u003eeLife\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, e60408 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eJacobsen, S. B., Tfelt-Hansen, J., Smerup, M. H., Andersen, J. D. \\u0026amp; Morling, N. Comparison of whole transcriptome sequencing of fresh, frozen, and formalin-fixed, paraffin-embedded cardiac tissue. \\u003cem\\u003ePLOS ONE\\u003c/em\\u003e \\u003cstrong\\u003e18\\u003c/strong\\u003e, e0283159 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eMathieson, W. \\u0026amp; Thomas, G. A. Why Formalin-fixed, Paraffin-embedded Biospecimens Must Be Used in Genomic Medicine: An Evidence-based Review and Conclusion. \\u003cem\\u003eJ. Histochem. Cytochem.\\u003c/em\\u003e \\u003cstrong\\u003e68\\u003c/strong\\u003e, 543\\u0026ndash;552 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eMusetti, V. \\u003cem\\u003eet al.\\u003c/em\\u003e Tissue Characterization in Cardiac Amyloidosis. \\u003cem\\u003eBiomedicines\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 3054 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eMagdeldin, S. \\u0026amp; Yamamoto, T. Toward deciphering proteomes of formalin-fixed paraffin-embedded (FFPE) tissues. \\u003cem\\u003eProteomics\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e, 1045\\u0026ndash;1058 (2012).\\u003c/li\\u003e\\n\\u003cli\\u003ePlaninc, I. \\u003cem\\u003eet al.\\u003c/em\\u003e A novel, fast, and 3d approach towards evaluating endo-myocardial biopsies for follow-up of heart transplantation: X-ray phase contrast imaging and its agreement with classical histopathology. \\u003cem\\u003eJournal of Heart and Lung Transplantation\\u003c/em\\u003e (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eNorvik, C. \\u003cem\\u003eet al.\\u003c/em\\u003e Synchrotron-based phase-contrast micro-CT as a tool for understanding pulmonary vascular pathobiology and the 3-D microanatomy of alveolar capillary dysplasia. \\u003cem\\u003eAm. J. Physiol.-Lung Cell. Mol. Physiol.\\u003c/em\\u003e \\u003cstrong\\u003e318\\u003c/strong\\u003e, L65\\u0026ndash;L75 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eReichardt, M. \\u003cem\\u003eet al.\\u003c/em\\u003e 3D virtual histopathology of cardiac tissue from Covid-19 patients based on phase-contrast X-ray tomography. \\u003cem\\u003eeLife\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, e71359 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eDejea, H. \\u003cem\\u003eet al.\\u003c/em\\u003e Microstructural Analysis of Cardiac Endomyocardial Biopsies with Synchrotron Radiation-Based X-Ray Phase Contrast Imaging. in \\u003cem\\u003eFunctional Imaging and Modelling of the Heart\\u003c/em\\u003e (eds. Pop, M. \\u0026amp; Wright, G. A.) vol. 10263 23\\u0026ndash;31 (Springer International Publishing, Cham, 2017).\\u003c/li\\u003e\\n\\u003cli\\u003eFungtammasan, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Reverse Transcription Errors and RNA\\u0026ndash;DNA Differences at Short Tandem Repeats. \\u003cem\\u003eMol. Biol. Evol.\\u003c/em\\u003e \\u003cstrong\\u003e33\\u003c/strong\\u003e, 2744\\u0026ndash;2758 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eVan Nostrand, E. L., Shishkin, A. A., Pratt, G. A., Nguyen, T. B. \\u0026amp; Yeo, G. W. Variation in single-nucleotide sensitivity of eCLIP derived from reverse transcription conditions. \\u003cem\\u003eMethods\\u003c/em\\u003e \\u003cstrong\\u003e126\\u003c/strong\\u003e, 29\\u0026ndash;37 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eWang, X., Yu, L. \\u0026amp; Wu, A. R. The effect of methanol fixation on single-cell RNA sequencing data. \\u003cem\\u003eBMC Genomics\\u003c/em\\u003e \\u003cstrong\\u003e22\\u003c/strong\\u003e, 420 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eEinarsson, E. \\u003cem\\u003eet al.\\u003c/em\\u003e Phase-contrast enhanced synchrotron micro-tomography of human meniscus tissue. \\u003cem\\u003eOsteoarthritis Cartilage\\u003c/em\\u003e \\u003cstrong\\u003e30\\u003c/strong\\u003e, 1222\\u0026ndash;1233 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eMaes, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Cryogenic contrast-enhanced microCT enables nondestructive 3D quantitative histopathology of soft biological tissues. \\u003cem\\u003eNat. Commun.\\u003c/em\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e, 6207 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eMarone, F. \\u0026amp; Stampanoni, M. Regridding reconstruction algorithm for real-time tomographic imaging. \\u003cem\\u003eJ. Synchrotron Radiat.\\u003c/em\\u003e \\u003cstrong\\u003e19\\u003c/strong\\u003e, 1029\\u0026ndash;1037 (2012).\\u003c/li\\u003e\\n\\u003cli\\u003ePaganin, D., Mayo, S. C., Gureyev, T. E., Miller, P. R. \\u0026amp; Wilkins, S. W. Simultaneous phase and amplitude extraction from a single defocused image of a homogeneous object. \\u003cem\\u003eJ. Microsc.\\u003c/em\\u003e \\u003cstrong\\u003e206\\u003c/strong\\u003e, 33\\u0026ndash;40 (2002).\\u003c/li\\u003e\\n\\u003cli\\u003eSchindelin, J. \\u003cem\\u003eet al.\\u003c/em\\u003e Fiji: an open-source platform for biological-image analysis. \\u003cem\\u003eNat. Methods\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 676\\u0026ndash;682 (2012).\\u003c/li\\u003e\\n\\u003cli\\u003eBaličević, V. \\u003cem\\u003eet al.\\u003c/em\\u003e Assessment of Myofiber Orientation in High Resolution Phase-Contrast CT Images. in \\u003cem\\u003eFunctional Imaging and Modeling of the Heart\\u003c/em\\u003e (eds. van Assen, H., Bovendeerd, P. \\u0026amp; Delhaas, T.) vol. 9126 111\\u0026ndash;119 (Springer International Publishing, Cham, 2015).\\u003c/li\\u003e\\n\\u003cli\\u003eGarcia-Canadilla, P. \\u003cem\\u003eet al.\\u003c/em\\u003e Complex Congenital Heart Disease Associated With Disordered Myocardial Architecture in a Midtrimester Human Fetus. \\u003cem\\u003eCirc. Cardiovasc. Imaging\\u003c/em\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e, (2018).\\u003c/li\\u003e\\n\\u003cli\\u003eGarcia‐Canadilla, P. \\u003cem\\u003eet al.\\u003c/em\\u003e Myoarchitectural disarray of hypertrophic cardiomyopathy begins pre‐birth. \\u003cem\\u003eJ. Anat.\\u003c/em\\u003e \\u003cstrong\\u003e235\\u003c/strong\\u003e, 962\\u0026ndash;976 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eGarcia-Canadilla, P., Mohun, T. J., Bijnens, B. \\u0026amp; Cook, A. C. Detailed quantification of cardiac ventricular myocardial architecture in the embryonic and fetal mouse heart by application of structure tensor analysis to high resolution episcopic microscopic data. \\u003cem\\u003eFront. Cell Dev. Biol.\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 1000684 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eDejea, H. Multiscale and dynamic synchrotron-based tomographic microscopy for cardiovascular applications. (ETH Zurich, Switzerland, 2021).\\u003c/li\\u003e\\n\\u003cli\\u003eBerg, S. \\u003cem\\u003eet al.\\u003c/em\\u003e ilastik: interactive machine learning for (bio)image analysis. \\u003cem\\u003eNat. Methods\\u003c/em\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e, 1226\\u0026ndash;1232 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eKong, N., Ng, W., Cai, L., Leonardo, A. \\u0026amp; Weimer, B. C. Integrating the DNA Integrity Number (DIN) to Assess Genomic DNA (gDNA) Quality Control Using the Agilent 2200 TapeStation System. (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eMekkaoui, C. \\u003cem\\u003eet al.\\u003c/em\\u003e Fiber architecture in remodeled myocardium revealed with a quantitative diffusion CMR tractography framework and histological validation. \\u003cem\\u003eJ. Cardiovasc. Magn. Reson.\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 70 (2012).\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"biopsies, cryo-X-ray phase contrast imaging, nucleic acid analysis, genomics, transcriptomics\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4632236/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4632236/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eSnap frozen biopsies serve as a valuable clinical resource of archival material for disease research, as they enable a comprehensive array of downstream analyses to be performed, including extraction and sequencing of nucleic acids. Obtaining three-dimensional (3D) structural information prior to multi-omics is more challenging but could potentially allow for better characterisation of tissues and targeting of clinically relevant cells. Conventional histological techniques are limited in this regard due to their destructive nature and the reconstruction artifacts produced by sectioning, dehydration, and chemical processing. These limitations are particularly notable in soft tissues such as the heart. In this study, we assessed the feasibility of using synchrotron-based cryo-X-ray phase contrast imaging (cryo-X-PCI) of snap frozen myocardial biopsies and 3D structure tensor analysis of aggregated myocytes, followed by nucleic acid (DNA and RNA) extraction and analysis. We show that optimal sample preparation is the key driver for successful structural and nucleic acid preservation which is unaffected by the process of cryo-X-PCI. We propose that cryo-X-PCI has clinical value for 3D tissue analysis of cardiac and potentially non-cardiac soft tissue biopsies prior to nucleic acid investigation.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Cryo-X-ray Phase Contrast Imaging enables combined 3D structural quantification and nucleic acid analysis of myocardial biopsies\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-07-19 18:52:53\",\"doi\":\"10.21203/rs.3.rs-4632236/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"bbc76f06-18b2-40f9-b098-66e9011c782d\",\"owner\":[],\"postedDate\":\"July 19th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":34085435,\"name\":\"Biological sciences/Biological techniques/Imaging/X-ray tomography\"},{\"id\":34085436,\"name\":\"Biological sciences/Molecular biology\"}],\"tags\":[],\"updatedAt\":\"2024-07-26T10:41:13+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-07-19 18:52:53\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4632236\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4632236\",\"identity\":\"rs-4632236\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}