{"paper_id":"7b2c4b73-0293-4eed-b315-072868f7edf2","body_text":"Abstract\nDicer encodes a riboendonuclease required for microRNA biosynthesis. Dicer was inactivated in Müllerian duct mesenchyme-derived tissues of the reproductive tract of the mouse, using an Amhr2-Cre allele. Although Amhr2-Cre; Dicer conditional mutant males appeared normal and were fertile, mutant females were infertile. In adult mutant females, there was a reduction in the size of the oviducts and uterine horns. The oviducts were less coiled compared to controls and cysts formed at the isthmus near the uterotubal junction. Unfertilized, degenerate oocytes were commonly found within these cysts, indicating a defect in embryo transit. Beads transferred into the mutant oviduct failed to migrate into the uterus. In addition, blastocysts transferred directly into the mutant uterus did not result in pregnancy. Histological analysis demonstrated that the mutant uterus contained less glandular tissue and often the few glands that remained were found within the myometrium, an abnormal condition known as adenomyosis. In adult mutants, there was ectopic expression of Wnt4 and Wnt5a in the luminal epithelium (LE) and glandular epithelium (GE) of the uterus, and Wnt11 was ectopically expressed in GE. These results demonstrate that Dicer is necessary for postnatal differentiation of Müllerian duct mesenchyme-derived tissues of the female reproductive tract, suggesting that microRNAs are important regulators of female reproductive tract development and fertility.\nKeywords: uterus, oviduct, microRNA, tissue-specific knockout, Wnt, adenomyosis\nIntroduction\nSmall silencing ribonucleic acids are short single-stranded RNAs that bind to complementary nucleotide sequences found in the 3′ untranslated regions (3′ UTR) of messenger RNA (mRNA) (Lee et al. 1993; Wightman et al. 1993). This binding can lead to repression of mRNA translation and/or degradation of target transcripts. One major type of small silencing RNAs is the microRNA (miRNA). MicroRNAs form when RNA polymerase II transcribes a primary transcript containing a hairpin-loop structure (pri-miRNA). The pri-miRNA is processed inside the nucleus by Drosha into a double-stranded RNA (dsRNA) stem-loop of ∼70 nucleotides (pre-miRNA) (Lee et al. 2003). The pre-miRNA is transported out of the nucleus by Exportin-5 in a Ran-GTP-dependent manner, where it is furthered cleaved in the cytoplasm by the riboendonuclease Dicer into 19-25 nucleotide dsRNA fragments (Yi et al. 2003). In the final step of miRNA maturation, the dsRNAs are separated into guide and passenger strands. The guide strand is bound to the RNA-induced silencing complex (RISC) while the passenger strand is degraded. Once incorporated into the RISC complex, the guide strand binds to a complementary sequence found in the 3′ UTR of target mRNA, inhibiting translation (Bernstein et al. 2001).\nDicer is found in nearly all organisms, suggesting that it has been conserved throughout evolution. Its essential role in animal development has been well established. Dicer-null mice die at embryonic day (E) 7.5, demonstrating that Dicer is essential for early mouse embryo viability (Bernstein et al. 2003). In addition, target-selected inactivation of the Dicer in zebrafish resulted in developmental arrest around 8 days post-fertilization, demonstrating an essential role in fish development (Wienholds et al. 2003). It is known that microRNAs are required to inhibit gene expression in a tissue-specific manner. Therefore, the inactivation of Dicer in specific tissues can be used to indirectly assess the role of microRNAs during tissue and organ development and differentiation.\nThe female reproductive tract, composed of the oviducts, uterus, cervix, and vagina, is essential for the propagation of all mammalian species. These organs develop from the Müllerian duct, a tube formed by specification of surface epithelial cells of the rostral mesonephros around embryonic day (E) 11.5. These cells invaginate towards the Wolfian duct and elongate adjacent to it until reaching the urogenital sinus by ∼E13.5 (Orvis and Behringer 2007). In females, the Müllerian duct differentiates into the female reproductive tract, however in males the Müllerian duct is eliminated due to the action of anti-Müllerian Hormone (AMH) secreted by the Sertoli cells of the fetal testis (Josso 2008). AMH, a member of the Transforming Growth Factor-β (TGF-β) superfamily, signals through type I receptors (Bone morphogenetic protein receptor type 1A and activin A receptor type 1), a type II receptor (AMH receptor type 2, AMHR2), and Smad1, Smad5, and Smad8 to induce Müllerian duct regression (Jamin et al. 2002; Mishina et al. 1996; Orvis et al. 2008; Visser et al. 2001).\nThe forming Müllerian duct consists of two types of cells, an inner mesoepithelial tube with a surrounding mesenchyme. The mesopithelial layer most likely differentiates into the luminal epithelium (LE) and the glandular epithelium (GE) while the mesenchyme likely differentiates into the endometrial stroma, and the inner circular and outer longitudinal myometrium of the uterus. At birth, the mouse female reproductive tract is not fully developed but requires further patterning and cytodifferentiation to complete development by postnatal day 14 (P14). The oviducts lengthen and coil and differentiate into three regions: the infundibulum, the ampulla and the isthmus. The uterotubal junction connects the oviducts to the uterine horns. Embryo implantation in the uterus and subsequent development requires nutrients from the mother. Uterine glands deliver necessary factors and nutrients to the developing embryo (Bazer 1975). The formation of uterine glands in mammals is referred as adenogenesis, a process believed to originate when a single cell of the LE is specified to undertake a GE fate. Once specified, these monoclonal epithelial cells will bud out from the LE and invaginate as a tubular extension into the stroma and later coil and branch (Gray et al. 2001a). In mice, uterine adenogenesis initiates around postnatal day 4 and completed by day 14 (Hu et al. 2004).\nTo assess the role of small silencing RNAs in the development of the mouse female reproductive tract, we utilized a Dicer conditional null allele (Harfe et al. 2005). In the Dicer conditional null allele, exon 23 that encodes the active site of an RNaseIII domain, is flanked by loxP sites (fx) for Cre-mediated deletion. Deletion of exon 23 appears to completely inactivate Dicer processing activity of pre-miRNAs (Harfe et al., 2005). Dicer fx/fx mice are normal and fertile. Amhr2-Cre knock-in mice express Cre recombinase along the entire length of the mesenchyme of the forming Müllerian duct (Jamin et al. 2002). Therefore, we examined the consequences of inactivating Dicer in cells derived from the mesenchyme of the Müllerian duct for female reproductive tract development.\nResults\nAmhr2-Cre; Dicer conditional mutant females are infertile\nTo establish the breeding pairs to produce Amhr2-Cre; Dicer fx/fx females, we also generated Amhr2-Cre; Dicer fx/fx males (see Materials and Methods). Amhr2-Cre; Dicer fx/fx males appeared normal and proved to be fertile. Therefore, we used these males in crosses with Dicer fx/fx females to generate Amhr2-Cre; Dicer fx/fx females and Dicer fx/fx littermate controls. Amhr2-Cre; Dicer fx/fx females were obtained at the predicted Mendelian ratios, appeared normal, but when bred with wild-type males (n = 6) and vaginal plugs were found, they did not become pregnant. In addition, when these mutant females were left with wild-type males for 4-6 months, they produced no progeny. Another group of mutant females (n=4) was mated with wild-type males, vaginal plugs obtained, and then sacrificed on E14.5. No embryos were observed inside the uterus. These results suggest that Dicer expression in Müllerian duct mesenchyme-derived tissues of the female reproductive tract is required for fertility.\nCurrently, there is no antibody that is available for immunohistochemistry against Dicer to demonstrate that Dicer is lost only in Müllerian duct mesenchyme-derived tissues of the conditional mutants. Therefore, to confirm that Amhr2-cre was able to delete exon 23 in the Dicer fx allele, PCR amplification of was performed (Fig. 1A). DNA was extracted from the uterus and oviducts of control and mutant females and amplified using Dicer-specific primers. PCR amplification of the DNA resulted in ∼600-bp product, confirming that exon 23 of Dicer had been deleted in cells of the female reproductive tract (Fig. 1B). The same DNA was also amplified using Dicer primers specific for the fx allele, resulting in a 420-bp product from tissue without the deletion. (i.e. epithelial-derived). As controls, DNA was extracted from Dicer fx/fx females that did not inherit the Cre allele. Dicer deletion-specific primer amplification could not be detected while Dicer fx-specific amplification resulted in the predicted 420-bp product.\nMorphological and histological abnormalities in Amhr2-Cre; Dicer conditional mutant female reproductive tract\nThe reproductive organs of adult control and mutant females and males were dissected. No gross abnormalities were observed in the mutant male reproductive organs. Mutant males were fertile and bred with Dicer fx/fx females to increase the probability of generating Amhr2-cre; Dicer fx/fx mice. In mutant males, no Müllerian remnants (uterus and oviducts) were observed, indicating that the Müllerian ducts regressed normally. However, abnormal phenotypes were observed in the mutant female reproductive tract. In adult mutant females, all the components of the female reproductive tract were present, including ovaries, oviducts, uterine horns, a cervix and the vagina. No gross morphological abnormalities were observed in the ovary. However, the uterine horns appeared shorter and thinner when compared to control littermates (Fig. 2A, B). The oviducts also had several abnormalities; they were shorter in length and less coiled (Fig. 2C, D). In the majority of the mutant females, the oviducts had spheroidal expansions near the uterotubal junction, resembling cysts (Fig. 3A). These cysts were found unilaterally (n=9, 11%) and bilaterally (n=9, 89%). The cysts were found in the isthmus, the region of the oviduct that connects the ampulla to the uterus. These were observed to develop from a transparent fluid-filled cyst into a large cyst filled with a yellowish soft mass that filled the entire oviduct (Fig. 3A, B). Histologically, the mass inside the oviduct contained immune/inflammatory cells (Fig. 3E-H). The mutant oviducts also showed a deficiency of smooth muscle (Fig. 3C, D, and F) perhaps causing a weakening in the oviductal wall, leading to cyst formation. In many unmated mutant females, oocytes were found inside the cysts (Fig. 3I). The oocytes were isolated and observed under the microscope. Most of the oocytes appear to retain the zona pellucida, the acellular surrounding membrane of the oocyte, however the cytoplasm appeared fragmented and crystalline structures where found inside the zona (Fig. 3J). These findings demonstrate that the mutant ovaries can ovulate.\nThe female reproductive tract of control and mutant females were dissected at various times after birth to determine when the phenotypic differences were first apparent in the mutant females. On postnatal day 4 there were no significant differences observed in the length of the uterus of mutant females when compared to control females (Fig. 2E, F). However, the mutant uterus appeared thinner and the oviducts were less coiled than the control littermates (Fig. 2G, H). Similar phenotypes were observed on postnatal day 8 (data not shown). On postnatal day 21, there was a marked difference in the size of mutant reproductive tract when compared to control littermates. Expansion of the isthmus, forming oviductal cysts was first observed around postnatal day 28 (Fig. 3A). At this stage, small yellow masses, apparently the onset of an inflammatory response were observed (Fig. 3A). To determine the progression of the cysts and the extent of their growth, 8 week (8 control, 8 mutant), 4 month (3 control, 4 mutant), and 8 month-old (2 control, 2 mutant) females were sacrificed. The cysts were present at all three time points in the mutants. However, at 8 weeks the inflammation appeared to be more prominent than at 4 and 8 months because the cysts were generally smaller. Interestingly, in two 8 week-old mutant females with cysts, the uterus was apparently fused to the abdominal wall and intestines.\nHistological analysis of Amhr2-Cre; Dicer conditional mutant female reproductive tract\nTo assess the cytological differences between control and mutant female reproductive tracts, a histological analysis initially using hematoxylin and eosin (H&E) staining was performed. Tissue sections of the control and mutant female reproductive tracts collected from postnatal day 4 and day 8 mice, showed no differences in uterine cytoarchitecture or in the amount of endometrial gland tissue. However, on postnatal day 21, less endometrial gland tissue was observed in the mutant female uterus when compared to controls (Fig. 4). The reduced amount of uterine gland tissue in the mutants was found at all later time points examined (Fig. 5).\nOn postnatal day 28, in the oviduct of mutant females, epithelial cells in the ampulla region appeared morphologically normal compared to controls. However, the epithelial cells lining the lumen of the cysts that developed in the isthmus region of mutant females appeared morphologically abnormal (Fig. 3D). Epithelial cells of the expanded isthmus contained a large number of vacuoles inside the cytoplasm, known as intracellular edema, there was a loss of typical columnar epithelium morphology, and epithelial folds were absent (Fig. 3D). Furthermore, inside the lumen of the isthmus a large number of white blood cells clumps were observed.\nTissue sections collected after 6 weeks of age showed the same major differences between control and mutant female reproductive tracts. There was an expanded isthmus with intracellular edema, loss of mucosal folding of the epithelial cells, an immune/inflammatory response inside the oviduct, and lower amount of glandular tissue in the uterus. Interestingly, in older females (> 4 month of age), many times the glands that were present in the mutant uterus were found within the myometrium (Fig. 4G, H).\nE-cadherin is a convenient marker expressed in both the LE and GE of the uterus and epithelial component of the oviduct, therefore control and mutant female reproductive tracts were immunostained for E-cadherin and analyzed by fluorescent microscopy. This analysis confirmed the H&E results, showing that mutant females had significantly lower amount of endometrial gland tissue in the uterus compared to controls (Fig. 4C-F). No differences in LE morphology were detected between controls and mutants.\nThe Dicer mutant females should also express Cre in granulosa cells of the postnatal ovary (Jorgez et al. 2004), thus hormone produced by granulosa cells could potentially be altered, affecting the female reproductive tract. Serum estradiol and progesterone levels were measured. The data showed a slight difference between control and mutant females but was not significantly different between the two groups (Fig. 6). Although there was a high degree of variability in these hormone measurements, we can conclude that estradiol and progesterone levels in the mutants were not dramatically different from controls.\nAbnormal function of the conditional mutant oviduct, uterotubal junction, and uterus\nIn most of the mutant females, oocytes were found inside the cystoid expansions of the oviduct. Normally, oocytes are fertilized inside the ampulla, then peristaltic contractions and the cilia of the epithelial folds move the oocytes into the uterus, where they implant in the endometrium. If this transport mechanism is disrupted or the path is obstructed the embryos will be unable to reach the uterus. In most of the mutant oviducts collected at 6 week, 8 week and 4 months, there was obvious inflammation blocking the path of the oocytes (and embryos if sperm could reach the ampulla). However, mutant females sometimes also had an oviduct that was free of inflammation. Therefore, to test if the oviduct transport mechanism was disrupted in the mutants, known numbers of Affi-Gel Blue affinity chromatography beads that are similar in size to mouse preimplantation embryos (75-150 mm), were transferred into oviducts. For these experiments, 5 week-old females (2 control, 3 mutant) were selected because at this age the inflammatory response is at an early stage that might not interfere with embryo movements. 1-4 days after bead transfer the reproductive tracts were examined. Most of the beads transferred inside control oviducts had moved into the uterus or were located at the uterotubal junction, whereas beads transferred into mutant females remained in a clump at about the same position of the initial transfer inside the oviduct near the ampulla (Fig. 7A-D).\nImpaired ciliogenesis or unidirectional flow created by cilia pulsation was also examined. The oviducts of 5 week-old females, both control and mutant, were dissected and placed in tissue culture medium. A longitudinal incision was made along the wall of the oviduct, and the oviducts were placed in a glass bottomed Petri dish. Both control and mutant oviducts contained cilia, thus ciliogenesis was not impaired (data not shown). To test for unidirectional flow by cilia, a small drop of concentrated dye solution was added and the direction of the flow of dye was recorded using time-lapse imaging. Control and mutant cilia showed unidirectional flow as indicated by the dye, thus cilia of the oviductal epithelium appear to be functional in both control and mutant females (data not shown).\nThe uterotubal junction regulates embryo movement into the uterus and retrograde flow from the uterus into the oviduct (Newbold et al. 1983).To examine the uterotubal junction, the rostral reproductive tract separated from the cervix of 2 week and 4 month-old females was isolated and a blue dye was injected into the caudal uterine lumen. In control reproductive tracts, the injected dye moved up to the most rostral end of the uterine horn but did not enter the oviduct (Fig. 7E). In mutant reproductive tracts, the dye also flowed up to the most posterior part of the uterine horn, however, it was able to move past the uterotubal junction and enter the oviduct (Fig. 7F). Thus there is a defect in the uterotubal junction of the mutant females such that retrograde flow into the oviduct is not regulated.\nAlthough the infertility of the mutant females is likely due to abnormal embryo transit in the oviduct, we also tested the function of the uterus to support embryo development by embryo transfer. Wild-type blastocyst stage (E3.5) embryos were collected from Swiss matings. Approximately 10-12 embryos were transferred into the most rostral part of the uterus of pseudopregnant (E2.5) surrogate mutant females (n=3). The reproductive tracts of the surrogate mice were dissected 11 days after embryo transfer but none were observed to be pregnant nor were there embryo reabsorption sites.\nAbnormal Wnt gene expression in Amhr2-Cre; Dicer conditional mutants\nWnt4, Wnt5a, and Wnt7a are expressed in the developing Müllerian duct and adult female reproductive tract (Miller et al. 1998b). Wnt5a and Wnt7a knockout mice lack endometrial glands and show and array of defects in the reproductive tract (Mericskay et al. 2004; Miller and Sassoon 1998). In sheep, downregulation of Wnt11 by estrogens appears to inhibit adenogenesis (Hayashi and Spencer 2006). Therefore, we performed in situ hybridization using probes against the mRNA of Wnt4, Wnt5a, Wnt7a, and Wnt11. On postnatal day 4, both control and mutant females expressed Wnt4 and Wnt5a in the uterine and oviduct mesenchyme and uterine LE, whereas Wnt7a was expressed in the LE (Suppl. Fig. 1). On postnatal day 14, in both control and mutant females, expression of Wnt5a was restricted to the uterine stroma and oviduct mesenchyme, while Wnt7a was expressed in the LE (Fig. 8A-D). However, by 8 weeks of age, mutant females exhibited abnormal spatial expression of Wnt genes in the uterus. Normally, Wnt4 is expressed in the stratified epithelium of the cervix and the vagina, however, in mutant females, Wnt4 was ectopically expressed in the LE and GE (Fig. 8E, F). In the control uterus, Wnt5a was restricted to the stroma, whereas in the mutant uterus, Wnt5a was ectopically expressed in the LE and GE (Fig. 8G, H). In the control uterus, Wnt11 expression was restricted to the LE and was absent in the GE, however in the mutant uterus, Wnt11 was expressed in the LE and ectopically expressed in the GE (Fig. 8I, J).\nHoxa genes are involved in patterning the female reproductive tract (Taylor et al. 1997). Hoxa9 is expressed in the oviduct and anterior part of the uterine horns, Hoxa10 and Hoxa11 are expressed in the uterine horn, and Hoxa13 is expressed in the cervix and vagina (Taylor et al. 1997). Hoxa gene expression was examined in tissue sections, from both control and mutant females, collected on postnatal day 14. In controls and mutants, Hoxa9 gene expression was detected in the oviduct and anterior stroma of the uterine horns (Suppl. Fig. 2A, B). In controls and mutants, Hoxa10 expression was detected in the uterine stroma adjacent to the LE (Suppl. Fig. 2C, D). Thus, on postnatal day 14, no difference Hoxa9 and Hoxa10 gene expression was detected between control and mutant females.\nDiscussion\nDicer is essential for processing pre-miRNA into miRNAs that regulate gene expression and tissue differentiation (Alvarez-Garcia and Miska 2005; Stefani and Slack 2008). Therefore, loss of Dicer should lead to a deficiency of miRNA production (Harfe et al. 2005). Epithelial-mesenchymal interactions are required for proper formation and development of the female reproductive tract in the mouse (Kurita et al. 2001). By taking advantage of the Cre/loxP system, Dicer was conditionally inactivated in the mesenchyme of the Müllerian duct and its tissue derivatives of the female reproductive tract by Cre recombinase expressed from the endogenous Amhr2 locus (Jamin et al. 2002). Tissue-specific inactivation of Dicer resulted in a wide range of female reproductive tract abnormalities not limited to mesenchyme-derived tissues (i.e. epithelial tissues). Thus, the abnormalities in the epithelial compartments of the mutant female reproductive tracts must be an indirect consequence of Dicer inactivation in mesenchymal tissues. These abnormal phenotypes suggest that small silencing RNAs acting within tissues derived from the Müllerian duct mesenchyme are necessary for mesenchymal and epithelial development of the female reproductve tract.\nFemale infertility in Dicer mutants\nFertilization, embryo transit, implantation and development require an elaborate synchrony of physiological processes (Guzeloglu-Kayisli et al. 2007). Synchronized epithelial-mesenchymal, epithelial-epithelial interactions, in conjunction with endocrine factors are all essential for a successful pregnancy. Reduction of Dicer expression using a hypomorphic gene trap allele resulted in female mouse infertility, showing impaired corpus luteum angiogenesis that led to low progesterone production (Otsuka et al. 2008). Alterations in systemic hormone levels could lead to the abnormal phenotypes observed in the Amhr2-Cre, Dicer mutant female reproductive tract. However, serum estradiol and progesterone levels in the Dicer mutants although quite variable were not significantly different from controls, suggesting that systemic hormones may not be the cause of the infertility.\nThe infertility of the Dicer conditional mutant females appears to be due to several oviduct and uterine abnormalities. Cilia in the oviduct are important for the movement of preimplantation embryos to the uterus (Halbert et al. 1976). Ciliogenesis and cilia function in the oviducts of the mutant females did not seem to be impaired, however blue beads transferred inside the ampulla failed to move into the uterus, suggesting a defect in the transport mechanism for oviductal movement of preimplantation embryos. Peristaltic contractions caused by oviductal smooth muscle also contribute to the movements of preimplantation embryos (Maistrello 1971). Interestingly, we observed regions of the mutant oviducts that were deficient in smooth muscle. The Müllerian duct mesenchyme is likely the progenitor tissue of the oviduct smooth muscle and uterine myometrium (Arango et al. 2008). Therefore, Dicer may be important for the generation of miRNAs that regulate smooth muscle differentiation or maintenance. Interestingly, Müllerian duct mesenchyme-specific knockout of beta-catenin results in smaller uteri and a deficiency of myometrium that is replaced by adipose tissue (Arango et al. 2005). These findings are consistent with the idea that miRNAs may be important for maintaining correct Wnt signaling for myometrial differentiation. The abnormalities in oviduct smooth muscle could also explain the development of the cysts because a weakness in the oviduct wall caused by smooth muscle abnormalities could lead to a weakness in the oviduct wall. Although the Dicer mutant females were successfully mated as judged by the presence of a vaginal plug, no pregnancies occurred. This could be due in part to the oviductal inflammation perhaps blocking access of the sperm to the oocytes. Finally, the mutant females had defects in the uterotubal junction. This structure functions to regulate embryo transit into the uterus and retrograde flow from the uterus into the oviduct (Newbold et al. 1983). Abnormalities in these uterotubal junction functions may also contribute to the infertility.\nAbnormalities in the uterus of the Dicer mutant females also lead to female infertility. We showed that there are fewer endometrial glands in the mutant uterus. Endometrial glands are required for secretion and transport of nutrients, including leukemia inhibitory factor, necessary for embryo implantation and survival (Gray et al. 2001a). In a sheep uterine gland knockout model, embryos do not elongate and fail to implant (Gray et al. 2001b). Therefore, the reduced amount of endometrial gland tissue observed in our Dicer mice probably hinders embryo implantation and survival. Although the primary cause of the infertility in the mutant females remains to be determined, it is clear that Dicer regulates several aspects of oviduct and uterine development that are essential for fertility.\nSmall silencing RNA regulation of female reproductive tract development\nAMH-induced Müllerian duct regression is mediated by AMH interactions with AMH receptors expressed in the Müllerian duct mesenchyme (Kobayashi and Behringer 2003; Orvis et al. 2008; Visser et al. 2001). The Müllerian ducts appeared to regress normally in the Dicer mutant males. Therefore, small silencing RNAs do not appear to regulate AMH signaling in the Müllerian duct mesenchyme for Müllerian duct regression. Furthermore, mutant males did not show abnormal virilization and were fertile, suggesting that Leydig cell function necessary for virilization and spermatogenesis was normal. Amhr2-Cre has been shown to be active in postnatal Leydig cells (Jeyasuria et al. 2004). Our results suggest that small silencing RNAs may not have major roles in regulating gene expression in Leydig cells for virilizing hormone production. The efficacy of the Amhr2-Cre allele in Sertoli cells is unclear, therefore the role of small silencing RNAs in Sertoli cells remains an open question (Jamin et al. 2002; Jeyasuria et al. 2004; Pangas et al. 2008).\nIn females, all the components of the female reproductive derived from the Müllerian duct were present (i.e. oviduct, uterine horns, cervix and upper vagina). Histological analysis revealed abnormal cytoarchitecture in smooth muscle, luminal epithelium and glandular epithelium of mutant females when compared to controls. The phenotypic defects and the cytoarchitectural abnormalities observed in mutant females resembled previously published reports on Wnt gene disruption and prenatal diethylstilbestrol (DES) exposure (Mericskay et al. 2004; Miller et al. 1998a; Miller and Sassoon 1998). Wnt5a, Wnt7a gene knockouts and prenatally DES-treated mice lacked endometrial glands in the uterus, suggesting that improper spatial-temporal signaling during the development of the uterus leads to a complete disruption of adenogenesis (Miller et al. 1998a). In Dicer mutant females, endometrial glands initiate formation normally but ultimately the amount of glandular tissue was significantly lower compared to controls. In situ hybridization using probes against Wnt5a and Wnt7a demonstrated that there was proper spatial expression of Wnt5a and Wnt7a in the uterus and oviduct on postnatal day 8 and 14, the time period when endometrial glands form in the mouse (Hu et al. 2004). Therefore, the reduced amount of endometrial glandular tissue observed in the mutant uterus as early as P14 appears to be independent of Wnt5a and Wnt7a. Dicer is inactivated in Müllerian duct mesenchyme-derived cells not epithelial cells, therefore paracrine signals from the mesenchyme, other than Wnt signals, could be the cause of the reduction of endometrial glandular tissue.\nIn control females, after differentiation of the uterus is complete, Wnt4 becomes restricted to the cervix and vagina, whereas Wnt5a is detected in the uterine stroma (Miller et al. 1998b). In situ hybridization of 8 week-old Dicer mutant female uteri revealed that Wnt4 and Wnt5a are ectopically expressed in the uterine LE and GE, correlating with the observed abnormal cytoarchitectural differences. These results suggest that there appears to be a defect in the repression of Wnt4, Wnt5a and Wnt11 transcription or message stability in endometrial glands. This ectopic expression of Wnt genes in the remaining glands could be the cause of the overgrowth observed, that in many cases are penetrating into the myometrium. In humans (women 35-50 years old), there is a rare medical condition similar to what we observed in our mutant mice called adenomyosis, were ectopic endometrium is found within the myometrium (Ferenczy 1998). This condition is found most commonly in multiparous women whereas the Dicer mutant female mice in this study were nulliparous because they were infertile. Mice treated with different selective estrogen receptor modulators developed adenomyosis, thus increased estrogen signaling could lead to the adenomyosis observed in the Dicer mutants (Parrott et al. 2001). However, serum levels of estradiol were not significantly different between controls and mutants.\nConditionally inactivating Dicer in the mesenchyme of the fetal Müllerian duct appears to recreate the malformations found when developing fetuses were exposed to DES (Haney et al. 1984). Females born from pregnant mice exposed to 100 μg/kg DES during pregnancy had a “developmentally arrested oviduct”, a complete absence of endometrial glands in adult uterus, and were infertile (Miller et al. 1998a). Furthermore, when dye was injected into the caudal uterus, it was able to flow into the oviduct, thus DES treatment causes malformation or malfunction of the uterotubal junction similar to the Dicer mutant females. However, there was no statistical difference in the levels of estradiol or progesterone between adult control and Dicer mutant females. Thus, the reduced amount of endometrial glandular tissue found in adult mutant females appears to be hormone independent. Due to the similarity of the Dicer mutant phenotype and those of Wnt7a knockout mice and prenatal mice treated with DES, we suggest that small silencing RNAs in mesenchyme-derived tissues appear to play a role downstream of systemic hormones but upstream of Wnt signaling.\nIn the uterus, paracrine signals from the mesenchyme are necessary for specification and growth of endometrial glands from the luminal epithelium (Gray et al. 2001a). Small silencing RNAs appear to inhibit a signaling pathway that would be predicted to negatively regulate adenogeneis. In Dicer mutant females, this inhibitor(s) is not regulated, thus normal uterine adenogenesis is reduced. Perhaps small silencing RNAs are required to restrict the overgrowth of endometrial glands during their formation in prepubertal females. What are the identities of these microRNAs? Recently, there were two reports on the role of Dicer in Amhr2-Cre, Dicer conditional mutant mice with phenotypes similar to the ones reported here (Hong et al. 2008; Nagaraja et al. 2008). In one study, sequencing of small RNAs from the oviduct identified a set of genes that were altered in the mutants (Nagaraja et al. 2008). Interestingly, they found that Wnt5a expression was significantly down-regulated but Wnt4 expression was unchanged. Our study shows that in addition to quantitative differences in Wnt gene expression, Dicer loss also causes alterations in tissue-specific expression. In summary, small silencing RNAs in the mesenchyme-derived tissues of the female reproductive tract appear to regulate genes autonomously in mesenchyme-derived tissues (oviduct smooth muscle) and non-cell autonomously in epithelial tissues (oviduct epithelium and uterine LE and GE).\nMaterials and Methods\nMice\nAmhr2-Cre knock-in mice were maintained on a C57BL/6J × 129/SvEv mixed background (Jamin et al. 2002). Dicer conditional null (fx) mice were obtained from Dr. Cliff Tabin (Harvard Medical School). Dicer conditional null mice were maintained as a fx/fx stock on a C57BL/6J × “129” mixed genetic background (Jamin et al. 2002). Amhr2-Cre mice were genotyped by PCR using Cre primers, Cre forward: 5′ GGACATGTTCAGGGATCGCCAGGC 3′, Cre reverse: 5′ CGACGATGAAGCATGTTTAGCTG 3′ that yield a 219-bp DNA fragment. Dicer flox mice were genotyped by PCR as described (Harfe et al., 2005).\nInitially, Amhr2-Cre heterozygotes were bred with Dicer fx/fx mice. The resulting Amhr2-Cre; Dicer fx/+ mice were bred to Dicer fx/fx mice to generate Amrh2-Cre; Dicer flox/flox males and females. Amrh2-Cre; Dicer fx/fx males were normal and fertile. Therefore, for the final cross, Amrh2-Cre; Dicer fx/fx males were bred with Dicer fx/fx females to generate Amrh2-Cre; Dicer fx/fx females. Dicer fx/fx female littermates served as controls.\nHistology and immunofluorescence\nReproductive tracts were dissected and fixed in 4% paraformaldehyde overnight at 4°C. Paraffin-embedded tissues were sectioned at 6 μm, and stained with Harris hematoxylin (Statlab) and 0.5% eosin Y (Sigma) (H&E). For tracts at P35 and earlier, the entire tract was serially-sectioned through the oviduct to the cervix. For later ages, the entire oviduct was serially-section and ∼300 μm into the anterior uterus. Histological sampling of the more posterior uterus showed phenotypes similar to the anterior uterus. Paraffin sections were immunostained for E-cadherin, using a mouse anti-E-cadherin monoclonal antibody (BD Biosciences) at a 1:200 dilution. The secondary antibody was an Alexa Fluor goat anti-mouse IgG (Molecular Probes) used at a dilution of 1:800. Slides were mounted with Vectashield mounting media containing DAPI (Vector Laboratories). The amount of endometrial gland tissue in the uterus was estimated by counting the number of glandular duct cross sections in each uterine section. Statistical analysis was performed using a two-sample t test.\nOviduct transfer, dye injections, and uterine transfer\n10-15 Affi-Gel Blue affinity chromatography beads (75-150 mm) were transferred into the ampulla of the oviducts of control (n=2) and mutant (n=3) females (Nagy et al., 2003). The females were sacrificed 1 to 4 days after transfer and their reproductive tracts isolated to visualize the movement of the beads through the oviduct. To examine the function of the uterotubal junction, adult reproductive tracts were dissected and 0.25% bromophenol blue was injected using a 23-gauge needle into the posterior uterine horn. Blastocysts generated from Swiss × Swiss mouse crosses were transferred into the uterine horns of E2.5 pseudopregnant control (n=3) and mutant (n=3) females (Nagy et al. 2003). 11 days after embryo transfer the females were examined for pregnancy.\nNon-radioactive in situ hybridization\n8 mm thick paraffin sections were hybridized with digoxygenin-labeled RNA probes as described (Xu and Wilkinson 1999). A Wnt7a sense probe was used as a control.\nSerum estradiol and progesterone measurements\nSerum was collected from individual mice, frozen, and sent to the University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core (Charlottesville) for measurement of estradiol and progesterone levels by radioimmunoassay.\nSupplementary Material\nAcknowledgments\nWe thank Hao Chang and Chuan-Wei Jang for assistance with oviduct transfers, C. Allison Stewart for assistance with in situ hybridization, Grant Orvis for initial guidance, and C. Allison Stewart for helpful comments on the manuscript. We thank Clifford Tabin for Dicer fx mice. Probes for in situ hybridization were obtained from Andrew McMahon, Kanako Hayashi, and the American Type Culture Collection. Supported by National Institutes of Health grant HD30284 and the Ben F. Love Endowment to R.R.B. Veterinary resources were supported by the National Institutes of Health (NIH) Cancer Center Support Grant CA16672.\nReferences\n- Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease. Development (Cambridge, England) 2005;132(21):4653–4662. doi: 10.1242/dev.02073. [DOI] [PubMed] [Google Scholar]\n- Arango NA, Kobayashi A, Wang Y, Jamin SP, Lee HH, Orvis GD, Behringer RR. A mesenchymal perspective of Mullerian duct differentiation and regression in Amhr2-lacZ mice. Molecular reproduction and development. 2008;75(7):1154–1162. doi: 10.1002/mrd.20858. [DOI] [PubMed] [Google Scholar]\n- Arango NA, Szotek PP, Manganaro TF, Oliva E, Donahoe PK, Teixeira J. Conditional deletion of beta-catenin in the mesenchyme of the developing mouse uterus results in a switch to adipogenesis in the myometrium. Developmental biology. 2005;288(1):276–283. doi: 10.1016/j.ydbio.2005.09.045. [DOI] [PubMed] [Google Scholar]\n- Bazer FW. Uterine protein secretions: Relationship to development of the conceptus. Journal of animal science. 1975;41(5):1376–1382. doi: 10.2527/jas1975.4151376x. [DOI] [PubMed] [Google Scholar]\n- Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409(6818):363–366. doi: 10.1038/35053110. [DOI] [PubMed] [Google Scholar]\n- Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA, Elledge SJ, Anderson KV, Hannon GJ. Dicer is essential for mouse development. Nature genetics. 2003;35(3):215–217. doi: 10.1038/ng1253. [DOI] [PubMed] [Google Scholar]\n- Ferenczy A. Pathophysiology of adenomyosis. Human reproduction update. 1998;4(4):312–322. doi: 10.1093/humupd/4.4.312. [DOI] [PubMed] [Google Scholar]\n- Gray CA, Bartol FF, Tarleton BJ, Wiley AA, Johnson GA, Bazer FW, Spencer TE. Developmental biology of uterine glands. Biology of reproduction. 2001a;65(5):1311–1323. doi: 10.1095/biolreprod65.5.1311. [DOI] [PubMed] [Google Scholar]\n- Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE. Endometrial glands are required for preimplantation conceptus elongation and survival. Biology of reproduction. 2001b;64(6):1608–1613. doi: 10.1095/biolreprod64.6.1608. [DOI] [PubMed] [Google Scholar]\n- Guzeloglu-Kayisli O, Basar M, Arici A. Basic aspects of implantation. Reproductive biomedicine online. 2007;15(6):728–739. doi: 10.1016/s1472-6483(10)60541-x. [DOI] [PubMed] [Google Scholar]\n- Halbert SA, Tam PY, Adams RJ, Blandau RJ. An analysis of the mechanisms of egg transport in the ampulla of the rabbit oviduct. Gynecologic investigation. 1976;7(5):306–320. doi: 10.1159/000301391. [DOI] [PubMed] [Google Scholar]\n- Haney AF, Newbold RR, McLachlan JA. Prenatal diethylstilbestrol exposure in the mouse: effects on ovarian histology and steroidogenesis in vitro. Biology of reproduction. 1984;30(2):471–478. doi: 10.1095/biolreprod30.2.471. [DOI] [PubMed] [Google Scholar]\n- Harfe BD, McManus MT, Mansfield JH, Hornstein E, Tabin CJ. The RNaseIII enzyme Dicer is required for morphogenesis but not patterning of the vertebrate limb. Proceedings of the National Academy of Sciences of the United States of America. 2005;102(31):10898–10903. doi: 10.1073/pnas.0504834102. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Hayashi K, Spencer TE. WNT pathways in the neonatal ovine uterus: potential specification of endometrial gland morphogenesis by SFRP2. Biology of reproduction. 2006;74(4):721–733. doi: 10.1095/biolreprod.105.049718. [DOI] [PubMed] [Google Scholar]\n- Hong X, Luense LJ, McGinnis LK, Nothnick WB, Christenson LK. Dicer1 is essential for female fertility and normal development of the female reproductive system. Endocrinology. 2008 doi: 10.1210/en.2008-0294. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Hu J, Gray CA, Spencer TE. Gene expression profiling of neonatal mouse uterine development. Biology of reproduction. 2004;70(6):1870–1876. doi: 10.1095/biolreprod.103.026336. [DOI] [PubMed] [Google Scholar]\n- Jamin SP, Arango NA, Mishina Y, Hanks MC, Behringer RR. Requirement of Bmpr1a for Mullerian duct regression during male sexual development. Nature genetics. 2002;32(3):408–410. doi: 10.1038/ng1003. [DOI] [PubMed] [Google Scholar]\n- Jeyasuria P, Ikeda Y, Jamin SP, Zhao L, De Rooij DG, Themmen AP, Behringer RR, Parker KL. Cell-specific knockout of steroidogenic factor 1 reveals its essential roles in gonadal function. Molecular endocrinology (Baltimore, Md. 2004;18(7):1610–1619. doi: 10.1210/me.2003-0404. [DOI] [PubMed] [Google Scholar]\n- Jorgez CJ, Klysik M, Jamin SP, Behringer RR, Matzuk MM. Granulosa cell-specific inactivation of follistatin causes female fertility defects. Molecular endocrinology (Baltimore, Md. 2004;18(4):953–967. doi: 10.1210/me.2003-0301. [DOI] [PubMed] [Google Scholar]\n- Josso N. Professor Alfred Jost: the builder of modern sex differentiation. Sex Dev. 2008;2(2):55–63. doi: 10.1159/000129690. [DOI] [PubMed] [Google Scholar]\n- Kobayashi A, Behringer RR. Developmental genetics of the female reproductive tract in mammals. Nature reviews. 2003;4(12):969–980. doi: 10.1038/nrg1225. [DOI] [PubMed] [Google Scholar]\n- Kurita T, Cooke PS, Cunha GR. Epithelial-stromal tissue interaction in paramesonephric (Mullerian) epithelial differentiation. Developmental biology. 2001;240(1):194–211. doi: 10.1006/dbio.2001.0458. [DOI] [PubMed] [Google Scholar]\n- Lee KY, Jeong JW, Tsai SY, Lydon JP, DeMayo FJ. Mouse models of implantation. Trends in endocrinology and metabolism: TEM. 2007;18(6):234–239. doi: 10.1016/j.tem.2007.06.002. [DOI] [PubMed] [Google Scholar]\n- Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75(5):843–854. doi: 10.1016/0092-8674(93)90529-y. [DOI] [PubMed] [Google Scholar]\n- Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S, Kim VN. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003;425(6956):415–419. doi: 10.1038/nature01957. [DOI] [PubMed] [Google Scholar]\n- Maistrello I. Extraluminal recording of oviductal contractions in the unanesthetized rabbit. Journal of applied physiology. 1971;31(5):768–771. doi: 10.1152/jappl.1971.31.5.768. [DOI] [PubMed] [Google Scholar]\n- Mericskay M, Kitajewski J, Sassoon D. Wnt5a is required for proper epithelial-mesenchymal interactions in the uterus. Development (Cambridge, England) 2004;131(9):2061–2072. doi: 10.1242/dev.01090. [DOI] [PubMed] [Google Scholar]\n- Miller C, Degenhardt K, Sassoon DA. Fetal exposure to DES results in de-regulation of Wnt7a during uterine morphogenesis. Nature genetics. 1998a;20(3):228–230. doi: 10.1038/3027. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Miller C, Pavlova A, Sassoon DA. Differential expression patterns of Wnt genes in the murine female reproductive tract during development and the estrous cycle. Mechanisms of development. 1998b;76(1-2):91–99. doi: 10.1016/s0925-4773(98)00112-9. [DOI] [PubMed] [Google Scholar]\n- Miller C, Sassoon DA. Wnt-7a maintains appropriate uterine patterning during the development of the mouse female reproductive tract. Development (Cambridge, England) 1998;125(16):3201–3211. doi: 10.1242/dev.125.16.3201. [DOI] [PubMed] [Google Scholar]\n- Mishina Y, Rey R, Finegold MJ, Matzuk MM, Josso N, Cate RL, Behringer RR. Genetic analysis of the Mullerian-inhibiting substance signal transduction pathway in mammalian sexual differentiation. Genes & development. 1996;10(20):2577–2587. doi: 10.1101/gad.10.20.2577. [DOI] [PubMed] [Google Scholar]\n- Nagaraja AK, Andreu-Vieyra C, Franco HL, Ma L, Chen R, Han DY, Zhu H, Agno JE, Gunaratne PH, DeMayo FJ, Matzuk MM. Deletion of Dicer in somatic cells of the female reproductive tract causes sterility. Molecular endocrinology (Baltimore, Md. 2008;22(10):2336–2352. doi: 10.1210/me.2008-0142. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Nagy A, Gertsenstein M, Vintersten K, Behringer RR. Manipulating the Mouse Embryo: A Laboratory Manual. 3rd. Cold Spring Harbor, NY: Cold Spring Harbor Press; 2003. [Google Scholar]\n- Newbold RR, Tyrey S, Haney AF, McLachlan JA. Developmentally arrested oviduct: a structural and functional defect in mice following prenatal exposure to diethylstilbestrol. Teratology. 1983;27(3):417–426. doi: 10.1002/tera.1420270316. [DOI] [PubMed] [Google Scholar]\n- Orvis GD, Behringer RR. Cellular mechanisms of Mullerian duct formation in the mouse. Developmental biology. 2007;306(2):493–504. doi: 10.1016/j.ydbio.2007.03.027. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Orvis GD, Jamin SP, Kwan KM, Mishina Y, Kaartinen VM, Huang S, Roberts AB, Umans L, Huylebroeck D, Zwijsen A, Wang D, Martin JF, Behringer RR. Functional redundancy of TGF-beta family type I receptors and receptor-Smads in mediating anti-Mullerian hormone-induced Mullerian duct regression in the mouse. Biology of reproduction. 2008;78(6):994–1001. doi: 10.1095/biolreprod.107.066605. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Otsuka M, Zheng M, Hayashi M, Lee JD, Yoshino O, Lin S, Han J. Impaired microRNA processing causes corpus luteum insufficiency and infertility in mice. The Journal of clinical investigation. 2008;118(5):1944–1954. doi: 10.1172/JCI33680. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Pangas SA, Li X, Umans L, Zwijsen A, Huylebroeck D, Gutierrez C, Wang D, Martin JF, Jamin SP, Behringer RR, Robertson EJ, Matzuk MM. Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Molecular and cellular biology. 2008;28(1):248–257. doi: 10.1128/MCB.01404-07. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Parrott E, Butterworth M, Green A, White IN, Greaves P. Adenomyosis--a result of disordered stromal differentiation. The American journal of pathology. 2001;159(2):623–630. doi: 10.1016/S0002-9440(10)61733-6. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- Stefani G, Slack FJ. Small non-coding RNAs in animal development. Nat Rev Mol Cell Biol. 2008;9(3):219–230. doi: 10.1038/nrm2347. [DOI] [PubMed] [Google Scholar]\n- Taylor HS, Vanden Heuvel GB, Igarashi P. A conserved Hox axis in the mouse and human female reproductive system: late establishment and persistent adult expression of the Hoxa cluster genes. Biology of reproduction. 1997;57(6):1338–1345. doi: 10.1095/biolreprod57.6.1338. [DOI] [PubMed] [Google Scholar]\n- Visser JA, Olaso R, Verhoef-Post M, Kramer P, Themmen AP, Ingraham HA. The serine/threonine transmembrane receptor ALK2 mediates Mullerian inhibiting substance signaling. Molecular endocrinology (Baltimore, Md. 2001;15(6):936–945. doi: 10.1210/mend.15.6.0645. [DOI] [PubMed] [Google Scholar]\n- Wienholds E, Koudijs MJ, van Eeden FJ, Cuppen E, Plasterk RH. The microRNA-producing enzyme Dicer1 is essential for zebrafish development. Nature genetics. 2003;35(3):217–218. doi: 10.1038/ng1251. [DOI] [PubMed] [Google Scholar]\n- Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993;75(5):855–862. doi: 10.1016/0092-8674(93)90530-4. [DOI] [PubMed] [Google Scholar]\n- Xu Q, Wilkinson DG. In situ Hybridization: A Practical Approach. 2nd. Oxford; Oxford University Press; 1999. In situ hybridization of mRNA with hapten labeled probes. [Google Scholar]\n- Yi R, Qin Y, Macara IG, Cullen BR. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development. 2003;17(24):3011–3016. doi: 10.1101/gad.1158803. [DOI] [PMC free article] [PubMed] [Google Scholar]\nAssociated Data\nThis section collects any data citations, data availability statements, or supplementary materials included in this article.","source_license":"CC0","license_restricted":false}