{"paper_id":"7945c2d3-5993-43b9-a602-215517fdc03f","body_text":"Anti-inflammatory and regenerative effects of MKARE® Eggshell Membrane: an in vitro osteoarthritis model and placebo-controlled clinical study. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Anti-inflammatory and regenerative effects of MKARE ® Eggshell Membrane: an in vitro osteoarthritis model and placebo-controlled clinical study. Alejandro Casado-Santos, Manuel A. La Nuez-García, Patricia Álvarez-Rodríguez, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3875703/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Apr, 2024 Read the published version in Journal of Functional Foods → Version 1 posted You are reading this latest preprint version Abstract MKARE®, a 100% natural ingredient derived from fresh eggshell membrane (ESM), has a rich composition in bioactive compounds like collagen, hyaluronic acid, and elastin. These components are beneficial for managing osteoarthritis (OA) due to their anti-inflammatory and regenerative properties. Highlighting the significance of freshness, our research has shown that the effectiveness of MKARE® is higher than that of other commercial products based on ESM that have been stored for several days at room temperature, losing their bioactive compounds. This study explores the MKARE® anti-inflammatory capacity through an in vitro and clinical analyses, demonstrating its ability to alleviate OA symptoms and improve joint health. This underscores the crucial role of freshness in optimizing the therapeutic benefits. Food Science & Technology Eggshell Eggshell membrane osteoarthritis pain chondrocytes Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction In recent years, the pursuit of natural and sustainable therapeutic agents has prompted the investigation of diverse sources with potential medical applications (K J Ruff et al., 2009 ). One particularly promising candidate is the eggshell membrane (ESM), known for its rich composition of bioactive compounds that exhibit anti-inflammatory and regenerative properties. Within the realm of musculoskeletal disorders, especially osteoarthritis (OA), a prevalent inflammatory joint disease impacting millions globally, there has been an escalating demand for innovative interventions (K J Ruff et al., 2009 ). Articular cartilage, the specialized tissue covering the ends of bones within joints, plays a crucial role in preserving joint function and facilitating smooth movement. Chondrocytes, the primary cellular components of articular cartilage, are responsible for synthesizing and maintaining the extracellular matrix, vital for the integrity and mechanical properties of the cartilage. However, during the progression of OA, an imbalance between pro-inflammatory and anti-inflammatory factors disrupts chondrocyte homeostasis, leading to an increase in pro-inflammatory cytokines, catabolic enzymes, and matrix metalloproteinases. Ultimately, this cascade results in cartilage degradation and joint dysfunction (Fernandes et al., 2002a ). Due to the constrained regenerative ability of cartilage, the development of therapies capable of mitigating inflammation and promoting chondrocyte regeneration is of great importance in OA management. This has driven researchers to explore natural sources, such as the ESM, for its potential to alleviate inflammation and facilitate tissue repair (Cánovas et al., 2022 ). The ESM is a thin, yet complex, biocompatible layer that separates the eggshell (ES) from the egg white. It consists of diverse bioactive components, such as aggrecan (ACAN) collagen, glycosaminoglycans, elastin, and growth factors. The ESM has demonstrated significant therapeutic potential in wound healing and tissue repair. Due to its multifaceted composition (Han et al., 2023 ), ESM emerges as a compelling candidate for addressing inflammatory processes linked to osteoarthritis (OA) and promoting the restoration of chondrocyte function (Kiers & Bult, 2021 ). Collagen and ACAN, key constituents of the ESM, play a pivotal role in offering structural integrity and support to the extracellular matrix. These contribute to the stability of tissues and their ability to withstand mechanical stress. Additionally, the presence of glycosaminoglycans, such as chondroitin sulfate and hyaluronic acid, suggests a potential role in enhancing joint lubrication and reducing friction, thus alleviating pain and discomfort experienced by OA patients (Dudhia, 2005 ; Monfort et al., 2008 ). Moreover, the ESM contains elastin, a protein that imparts elasticity to tissues, allowing them to withstand repetitive stresses. In the context of OA, regenerative potential of elastin may contribute to the restoration of damaged cartilage and the prevention of further degradation (Li et al., 2021 ). Another crucial aspect of the ESM membrane is the presence of growth factors, such as transforming growth factor-beta (TGF-β) and fibroblast growth factor (FGF). These growth factors have been implicated in tissue repair and regeneration by stimulating cell proliferation, migration, and synthesis of extracellular matrix components. In an inflamed chondrocyte microenvironment, the application of ESM-derived growth factors may counteract the detrimental effects of pro-inflammatory mediators and foster a more conducive environment for tissue healing (Furukawa et al., 2021 ). Products based on ESM are currently available on the market, specifically designed for the treatment of OA. These products are commonly promoted as supplements aimed at alleviating joint pain and enhancing mobility ( Eggshell Membrane Market Size | Industry Report, 2021–2028 , n.d.). They are available in various forms, including capsules, tablets, and powders. The ESM market has grown significantly in the last years. This growth is attributed to the increasing demand for nutritional supplements and the adoption of this product in the pharmaceutical, cosmetic, and food and beverage industries ( Eggshell Membrane Market Size, Share, Growth 2024–2032 , n.d.). MKARE® is a 100% natural functional ingredient based on fresh ESM, which natively contains a unique source of bioactive compounds with multiple clinically proven health benefits. MKARE® is rich in collagen (I, V and X), hyaluronic acid, elastin, chondroitin sulfate, glucosamine and more than 400 proteins, a perfect matrix of key biomolecules in a single ingredient (Dar et al., 2017 ). Recent studies emphasize the significance of using fresh eggshell membrane, as it guarantees the maximal preservation of those bioactive compounds (Kiers & Bult, 2021 ). The aim of this work is to evaluate the anti-inflammatory potential and regenerative effects of the MKARE® product. For that purpose, we will employ a well-established in vitro model of chondrocyte inflammation. This model allows us to simulate the inflammatory processes observed in OA and assess the response of chondrocytes to ESM treatment. Through comprehensive experimental analyses, we aim to elucidate the underlying molecular mechanisms behind the beneficial effects of ESM on chondrocytes. Additionally, we have conducted a clinical study involving patients afflicted with OA, obtaining promising results. Furthermore, we assessed the significance of the freshness of the membrane compared to other products available on the market, particularly those derived from ES that have been stored for several days at room temperature (RT). 2. Materials and methods 2.1. Obtention and preparation of ES and ESM under different storage conditions Complete ES and ESM obtained from Arandovo® facilities were analyzed. For this purpose, soluble components of both ES and ESM were solubilized. 2.1.1. Preparation of Water-Soluble Fractions of ES 50 g of finely powdered sample was resuspended in 50 mL of milli-Q water. The mixture was homogenized and stirred at room temperature for 1 hour. Samples were centrifuged at 9,250 x g for 10 minutes, and the supernatant was collected for assays. This process was repeated in triplicate for each sample type. Three different conditions were analyzed: (i) Fresh ES labeled as ES-F; (ii) frozen ES labeled as ES-Fr; (iii) ES stored at RT for 13 days labeled as ES-RT. 2.1.2. Preparation of Water-Soluble Fractions of ESM 5 g of the powder from each sample was resuspended in 30 mL of milli-Q water. The mixture was homogenized and stirred at room temperature for 1 hour. Samples were centrifuged at 9,000 x g for 10 minutes, and the supernatant was collected for assays. This procedure was also performed in triplicate for each sample. Three different conditions were analyzed: (i) Fresh ESM labeled as MKARE®; (ii) ESM stored at RT for 13 days labeled as ESM-RT. 2.2. Evaluation of ES and ESM protein quality 2.2.1. Determination of free amino groups (reaction with OPA) Total protein content of the supernatants was quantified using Kjeldahl method (Varelis, 2016 ). Degree of hydrolysis of the water-soluble fractions was estimated by reacting the free amino acid groups with o-phthalaldehyde (OPA), following the method described by (Nielsen et al., 2001 ) analysis was conducted in triplicate for each soluble fraction obtained. 2.2.2. SDS-PAGE profile analysis Samples were diluted to a protein concentration of 0.8 mg/mL in treatment buffer containing Tris-HCl (0.05 M, pH 6.8), sodium dodecyl sulfate (SDS, 1.6% w/v), glycerol (8% v/v), bromophenol blue (0.002% w/v), and β-mercaptoethanol (2% v/v). After dilution, samples were heated to 95ºC for 5 minutes with stirring, then centrifuged. Electrophoresis was conducted using a Criterion XT 12% Bis-Tris polyacrylamide gel (Bio-Rad®), alongside a Criterion XT molecular weight marker. 2.2.3. Molecular weight analysis via Size Exclusion Chromatography (SEC) Chromatographic analysis was performed using an Acquity Ultra-high-Performance Liquid Chromatography (UPLC) system (Waters) with a bioZenTM 1.8 µm, 150 × 4.6 mm column and a bioZenTM SEC-2 precolumn, 4.6mm (Phenomenex®). A water/acetonitrile/TFA solution (55/45/0.1, v/v/v) served as the mobile phase at a flow rate of 100 µL/min. Samples from the water-soluble fraction were diluted in the mobile phase to a protein concentration of 1.5 mg/mL, then centrifuged at 12,800 × g for 5 minutes at room temperature. The injection volume was 3 µL, with absorbance monitored at 214 nm. SEC with HPLC was used to determine the molecular weight distribution of the MKARE® hydrolysate. Standards and a SEC 130Aº column from Agilent Technology® were employed in a Waters Company HPLC-UV system. 2.3. In vitro model of inflammation on human chondrocytes 2.3.1. Treatment of MKARE® In the process of extracting ESM-F (MKARE®), two distinct fractions are identified for analysis: the soluble fraction and the hydrolyzed matrix. To prepare soluble fraction (MKARE®-S), the membrane undergoes a gentle extraction process. The hydrolyzed matrix refers to the structural components of the membrane that are not readily soluble. This fraction is obtained by enzymatically hydrolyzing MKARE® to solubilize the membrane, converting it into low molecular weight peptides, and thereby enhancing its bioavailability. Preparation of soluble fraction (MKARE®-S/ESM—RT-S) 1 g of ESM was resuspended in 10 mL of milli-Q water and agitated magnetically overnight at 4ºC. The mixture was centrifuged at 4ºC, 5000 rpm, and the supernatant was filtered through a 0.22µm cellulose acetate filter using a syringe. The filtrate was stored at 4ºC for use in in vitro assays. Preparation of enzymatic digestion of ESM (MKARE®-H/ESM-RT-H) ESM was hydrolyzed at 50 mg/mL with papain at 50ºC overnight, with the addition of 30 mM sodium metabisulfite. The ESM liquid was filtered similarly and stored at 4ºC for use in following assays. The ESM filtrate solution was heated to 100ºC for 10 minutes to inactivate the enzyme before use in chondrocyte in vitro assays. 2.3.2. Chondrocyte culture assay Our in vitro model of inflammation was developed in chondrocytes (P2) inflamed with TNF (25 ng/mL). For this purpose, chondrocytes were seeded on 6-well plates, with 4.8x10 4 cells/well. When 80% cell confluence was reached, samples were treated as follows: Group 1 (control) (Chondrocytes inflamed with TNF): Chondrocytes cultured with serum-free αMEM (Hyclone®) and 1% penicillin/streptomycin (Hyclone®) plus 25 ng/mL TNF. Group 2 (TNF inflamed chondrocytes and ESM-RT-H treated): Chondrocytes cultured with serum-free αMEM (Hyclone®) and 1% penicillin/streptomycin (Hyclone®) plus 25 ng/mL TNF and 0.5 mg/mL ESM-RT-H. Group 3 (TNF inflamed chondrocytes and MKARE®-H treated): Chondrocytes cultured with serum-free αMEM (Hyclone®) and 1% penicillin/streptomycin (Hyclone®) plus 25 ng/mL TNF and 0.5 mg/mL of MKARE®-H. Group 4 (TNF inflamed chondrocytes and ESM-RT-S treated): Chondrocytes cultured with serum-free αMEM (Hyclone®) and 1% penicillin/streptomycin (Hyclone®) plus 25 ng/mL TNF and 1 mg/mL ESM-RT-S. Group 5 (TNF inflamed chondrocytes and MKARE®-S treated): Chondrocytes cultured with serum-free αMEM (Hyclone®) and 1% penicillin/streptomycin (Hyclone®) plus 25 ng/mL TNF and 1 mg/mL MKARE®-S. After 24 hours of incubation, cell samples were collected and using for the following experiments. 2.3.1. Citotoxicity MTT assay MTT [3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazol bromide] assay (Invitrogen®) was carried out on the inflamed and treated chondrocytes. Cell viability and proliferation can be determined through the MTT assay based on the mitochondrial functionality of the treated cells. Chondrocytes were seeded (1.2x104 cells/well) on 48 well plates with the experimental conditions. Analysis was carried out after 24 h of culture. After 24h, the medium was removed, and the plates rinsed with PBS. Then, plates were incubated for 3 h at 37°C with a medium containing DMEM without phenol red and 10% MTT, avoiding exposure to direct light. 100 µl of solubilizing solution of DMSO-Isopropanol (1:1) (Fisher Scientific®) was then added and the plates were incubated for 30 min on a PMS-1000i microplate orbital shaker (Grant Bio™). Optical density in each well was quantified at 570 nm with a multiplate spectrophotometer reader Multiskan GO (Thermo Fisher Scientific®). 2.3.2. Quantitative real-time PCR (qPCR) RNA was extracted from the cultured cells using the GeneMATRIX universal RNA purification kit by EURx®, following the protocol provided by the supplier. Total RNA was quantified using the QUBIT® RNA assay from Thermo Scientific®. For the synthesis of cDNA, 1000 ng of the extracted RNA was employed, using the high-capacity cDNA reverse transcription kit (Applied Biosystems®). Expression levels of aggrecan ACAN, IL-1α, IL-6, and TNF genes were assessed by qPCR. The primers used are listed in Table 1 . Beta-actin (ACT-β) was used as a normalization reference. qPCR assays were conducted with the Power SYBR™ Green PCR Master Mix (2× concentration) (Applied Biosystems®), in a reaction volume of 20 microliters, using the StepOne real-time PCR system (Applied Biosystems®), in accordance with the manufacturer’s protocol. Relative expression of the target genes was determined using the 2 –ΔΔCt comparative method, with normalization to the housekeeping gene, ACT-β. Table 1 Primer sequences and conditions used for qPCR. Gen NCBI RefSeq Forward/Reverse (5’-3’) Tª melting ºC Product size (bp) ACT-β NM_001101.3 CCCTCCATCGTCCACCGCAAATGCT CTGCTGTCACCTTCACCGTTCCAGT 59.7 58.0 131 ACAN NM_001369268.1 CTGCCCAACTACCCGGCCAT TGCGCCCTGTCAAAGTCGAG 72.1 71.0 200 IL-6 NM_000600.3 ATAACCACCCCTGACCCAA CCATGCTACATTTGCCGAA 74.4 72.5 169 IL-1a NM_000575.5 AGAGGAAGAAATCATCAAG TTATACTTTGATTGAGGGCG 57.5 59.2 139 TNF NM_000594.3 CCTGAAAACAACCCTCAGACGCCACA TCCTCGGCCAGCTCCACGTCCC 77.9 79.3 155 2.4. In vivo study of the effects of MKARE® 2.4.1. Study design This study was designed as a randomized, double-blind, placebo-controlled nutritional intervention trial using an excel functional randomization. The subject flow chart containing the intent-to-treat (ITT) population is summarized in Fig. 1 . 2.4.2. Patients Subjects were recruited through various channel information by e-mail notification or on a presential meeting day. The age range of patients selected was 40–66 years with osteoarticular problems. Due to this, the participants exhibited symptoms such as pain, stiffness, or functional limitations in their daily lives. Participants who reported known allergy to eggs or egg products, were pregnant or breastfeeding were excluded of the study All subjects gave written informed consent before data acquisition. Before enrolling in the study, participants received instructions on the proper consumption of the product and guidance on when and how to use the online questionnaires. 2.4.3. Procedure The protocol was approved by the Ethical Committee of the University of León for compliance with the provisions of Regulation (EU) 2016/679 of the European Parliament and of the Council of 27 April 2016 on Data Protection (GDPR). All study participants were provided with written instructions and received product capsules by postal mail. Starting on day 1 and continuing over 60 days, subjects ingested one capsule per day containing MKARE®, ESM-RT or placebo. The pre-defined primary efficacy endpoint of the study was the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) with Likert analogue scale from 0 a 10. The WOMAC questionnaire is designed for the assessment of lower extremity pain and function in OA of the knee or hip by assessing severity of pain (5 questions), stiffness (2 questions) and limitation of physical function (17 questions). Subjects reported (0–10, 0 = no pain at all, 10 = the most intense pain) through an online version of WOMAC questionnaire on days 0, 7, 30, and 60. 2.5. Statistical analyses In the in vitro assay, each experiment was independently conducted three times. The reported results represent the average ± standard deviation of the three values obtained from these independent studies. ANOVA was used to identify significant differences between groups, and Tukey's or Dunnett’s post-hoc analysis were then performed. p < 0.05 was used to classify results as statistically significant. In the in vivo study baseline comparison was performed to verify randomization amongst the three groups via ANOVA. The evolution from day 0 to 60 was evaluated trough a repeated measures univariate analysis of variance (RM-ANOVA) with the Geisser-Greenhouse correction. In both cases, statistical significance was accepted at a p < 0.05 after performing Tukey’s post hoc analysis. For the Number Needed to Treat (NNT) evaluation, an absolute improvement of 30% from baseline was considered as the clinically relevant criteria, with 95% Confidence Intervals (CI). GraphPad Software® was used for the statistical analysis. 3. Results and Discussions 3.1. Evaluation of ES and ESM quality under different storage conditions. Complete ES were obtained from Arandovo® facilities. Determination of the influence of eggshell storage conditions on the quality of its composition is a key factor (Y. Nys J. Gautron & Hincke, 2001). Samples of both ES and ESM from Arandovo® were analyzed to determine whether storage conditions had some impact on the quality of both the eggshell and the final product (MKARE®). MKARE® is an ESM powder produced in Arandovo® through an industrial hydromechanical separation process. Upon collection of ES, they are processed on the same day to obtain the ESM. This procedure is implemented at the locations where the ES are generated. This timely processing is crucial to preserve all the proteins from the eggshell membrane, ensuring its maximum biological efficacy (Y. Nys J. Gautron & Hincke, 2001). To confirm this, both qualitative and quantitative tests have been conducted to substantiate this hypothesis. Table 2 shows the values obtained for the free amino groups in the water-soluble fraction of the different samples of the three ES extractions carried out, as well as the total average. Results showed that the sample stored at room temperature (ES-RT) has a higher content of free amino groups, indicative of a higher degree of protein hydrolysis. On the other hand, as expected (Chi et al., 2022 ), the fresh sample (ES-F) has the lowest content of free amino groups (lower degree of hydrolysis). Upon comparing the hydrolysis levels of two samples from the same batch, ES-RT and frozen (ES-Fr), a significant increase in the free amino group content was observed in the sample stored at room temperature. Table 2 Free amino groups present in the water-soluble fraction of the samples, determined by the OPA method. Average from three replicates. Statistically significant differences between samples (P < 0.05). mmol eq. glutamic acid/kg sample Extraction 1 Extraction 2 Extraction 3 Average ES-F 2.649 2.760 2.776 2.728 ± 0.069 ES-Fr 3.543 3.990 4.359 3.964 ± 0.409 ES-RT 6.848 8.098 7.978 7.642 ± 0.690 The ES is composed of fibrous proteins such as elastin and collagen, which are crosslinked, making it insoluble. Additionally, there exists a group of soluble proteins, such as ovotransferrin, lysozyme, ovocalyxin-36, and more than 400 types that have been identified with proven functionality (Ahmed et al., 2017 , 2019 ; Mine et al., 2023 ). Figure 2 A shows an SDS-PAGE electrophoresis profile of the water-soluble protein fractions of the three types of ES samples. As observed, both in the fresh sample and the sample stored under freezing conditions, the water-soluble fraction shows intense bands corresponding to proteins with molecular weights around 75 and 37 kDa. The 75 kDa band is attributed to ovotransferrin (J. Gautron M. T. Hincke & Nys, 2001), while the 37 kDa band has been previously attributed to ovocalyxin 36 (Cordeiro et al., 2013 ). Other less intense bands are also observed, corresponding to molecular weights of approximately 150 kDa and in the range of 75 − 50 kDa. In the case of the sample stored at RT, only very weak bands corresponding to 75 and 37 kDa are detected, indicating that most of the proteins are degraded after storage under RT conditions. Water-soluble protein fractions were also analyzed using liquid chromatography by Size Exclusion Chromatography (SEC) to verify the degree of hydrolysis. Figure 2 B presents a chromatographic profile corresponding to the ES-F sample (the sample stored frozen; ES-Fr shows a similar profile). A set of high-intensity peaks corresponding to soluble proteins with a molecular weight greater than 5800 Da is observed. In contrast, the ES-RT image displays a chromatographic profile of the eggshell sample stored at room temperature. This profile exhibits significantly reduced peaks, indicating a higher degradation of soluble proteins due to RT storage. These results suggest extensive degradation of the eggshell proteins when stored at RT. These findings are consistent with those obtained from the OPA assay. The samples undergo significant hydrolysis when stored at RT, considerably reducing the proportion of proteins with molecular weight > 5800 Da and increasing the amount of free amino groups and smaller peptides in the water-soluble fraction. Storage under freezing conditions proves effective in limiting the hydrolysis process considerably. SDS-PAGE and SEC profiles of the soluble proteins extracted from MKARE® and ESM-RT membranes are presented in Fig. 2 . SDS-PAGE assay shows (Fig. 2 A) the existence of a band corresponding to approximately 10–15 kDa in MKARE® that does not appear in the ESM-RT. This band has been previously detected in the protein fraction of the ES and corresponds to lysozyme (Ahlborn et al., 2006 ; Kaweewong et al., 2013 ). A large portion of the proteins present in the products could not be identified due to the low solubility of both products in the treatment buffer used. The absence of a clearly detected lysozyme band in ESM-RT product suggest a potential lower concentration or loss of this protein in that product. The SEC results show that the peak intensity of MKARE® is three times higher than that of ESM-RT (Fig. 2 B). This finding aligns with expectations, as it was previously confirmed that the soluble proteins from the ES stored at RT were largely degraded, whereas the soluble proteins from a fresh shell, like those used for MKARE® extraction, retained all their soluble proteins intact. This has significant implications for the effectiveness of the ESM as a supplement for osteoarticular issues. More than 400 types of proteins, such as ovotransferrin, ovocalyxin-36, ovocleidins 17 and 116, lysozyme, etc., have been detected in the ESM. Most of these have demonstrated mineralization and anti-inflammatory effects (Carrillo et al., 2016 ; Cordeiro et al., 2013 ; Wu & Acero-Lopez, 2012 ). If a fresh membrane such as MKARE® retains these soluble proteins, it will offer a bioactivity that a membrane obtained from an eggshell stored at RT cannot provide. In the realm of ESM research, the freshness of the ES plays a pivotal role in harnessing its maximum potential. This is especially critical when considering the therapeutic proteins present in the eggshell membrane, which are known for their mineralization and anti-inflammatory properties (Matsuoka et al., 2019 ; Qosimah et al., 2016 ). To preserve these valuable proteins, it is imperative to take measures to prevent their degradation. When ES are produced and subsequently stored at RT, they undergo a process of protein degradation and microbial growth, which can lead to a significant loss of bio-functional proteins. This degradation not only diminishes the therapeutic efficacy of the ESM but also affects the overall quality of the extracted material (Rath et al., 2017 ). Therefore, it is essential to process these eggshells promptly after they are generated to obtain a high-quality, bio-functional product such as MKARE®. Our experiments reveal distinct differences between MKARE® extracted from fresh ES and those from ES stored at RT for extended periods. The latter showed a marked decrease in the integrity and concentration of bio-functional proteins, underlining the necessity of immediate processing post-generation for optimal results. 3.3. MKARE® have no cytotoxic effects on human chondrocytes in vitro. To carry out the in vitro assay, two distinct fractions of ESM were selected for analysis: the soluble fraction (MKARE®-S) and the hydrolyzed matrix (MKARE®- RT- H). The soluble fraction encompasses the readily dissolvable components of the membrane, which may include various proteins, GAGs, and other bioactive molecules. The characterization of this fraction provides insights into the naturally occurring compounds within the membrane that might contribute to its bioactivity. To obtain this soluble fraction (MKARE®-S and ESM-RT-S), the membrane undergoes a gentle extraction process, typically using a buffered solution, to ensure the preservation of its bioactive components (Ahmed et al., 2017 ). Conversely, the hydrolyzed matrix (MKARE®-H and ESM-RT-H) refers to all components of ESM, the soluble components and the structural components of the membrane that are not readily soluble (fibrous proteins: elastin, collagens…). This fraction is subjected to enzymatic hydrolysis, a process that breaks down the more complex, insoluble proteins and fibers into smaller peptides. This hydrolysis is crucial for revealing the full spectrum of bioactive substances within the membrane, some of which may only be liberated through this process. The methods of extraction and hydrolysis were meticulously optimized to maximize yield and maintain the integrity of the bioactive compounds, ensuring the reliability and relevance of our findings. The profile of molecular weight of the dissolutions of ESM employed in the in vitro assay was characterized by SEC and showed a maximum molecular weight of 2944 Da (results not shown). Both fractions, the soluble and the hydrolyzed matrix, offer distinct and complementary insights into the eggshell membrane's biochemical profile (Wedekind et al., 2017 ). Analyzing these two fractions separately allows for a more comprehensive understanding of the membrane's potential health benefits, including its application in areas such as osteoarthritis treatment, skin care, and nutrition. To ensure that the ESM had no adverse effects on cell viability, an MTT assay was conducted. In this assay MKARE®-H, MKARE®-S, ESM-RT-H and ESM-RT-S were tested to confirm the compatibility and safety of the ESM in a biological context. In Fig. 3 A the proliferation of chondrocytes cultured with the different ESM samples is shown. Cells were viable when they were cultured with all the products according to the results obtained from the MTT assay, though the highest proliferation rate was obtained with both soluble fractions. No significant differences in viability were shown respect to control sample. 3.3. MKARE® possesses protective and anti-inflammatory effects on human chondrocyte cell model of inflammation. Despite recent advancements in using ESM for various biomedical applications, including cultivation of human fibroblasts on ESM for tissue engineering applications (Vuong et al., 2018 ), there appears to be a notable absence of studies focusing specifically on the use of ESM in in vitro chondrocyte models for OA. Researching the effects of ESM on chondrocytes, particularly within the inflammatory environment, could provide invaluable insights into the development of novel therapeutic strategies for this pathology. Recent studies have revealed that the release of inflammatory molecules, such as pro-inflammatory cytokines, are essential mediators of altered metabolism and accelerated extracellular matrix degradation (Fernandes et al., 2002b ; Wojdasiewicz et al., 2014 ). In our in vitro model the effect of MKARE®-H, MKARE®-S, ESM-RT-H and ESM-RT-S added to chondrocyte-inflamed cultures was compared. The expression of specific chondrogenic genes such as ACAN was analyzed under the different experimental conditions stimulated with TNF. Figure 3 B shows significant increases in ACAN gene expression with the addition of all ESM samples. The higher rate was obtained with MKARE®-H sample. Regarding the inflammatory genes, MKARE®-H dramatically reduced the expression of these mediators (IL-1α and IL-6). The same effect was detected in TNF gene expression though the downregulation observed was not significant, even a significant increase was observed when ESM-RT-H was added. These results are in keeping with other works which have also shown increased expression of IL-1α and IL-6 after TNF inflammation (Porée et al., 2008 ; Yang et al., 2014 ). IL-1α and multifunctional cytokine IL-6 is hypothesized to play a role in the inflammatory processes associated with OA by inducing collagen degradation that leads to cartilage erosion and joint destruction, as well as by boosting the production of other pro-inflammatory cytokines such MMPs ( Scheller et al., 2011 ). Our results showed that MKARE® strongly reduced the expression of pro inflammatory genes activity and increased specific genes of cartilage such as ACAN. In both assays, the greatest effect was observed when MKARE®-H was added to the inflamed chondrocyte cultures. 3.4. Placebo-controlled clinical study of MKARE® effects on patients with knee osteoarthritis. To carry out the clinical study, subjects were recruited through various channel such as e-mail notification or in-person meetings. The age range of patients selected was 40–66 years, media of age: 51.4-year-old. 44% - male and 56% - female with osteoarthritic problems with symptoms of pain, stiffness or functionality problems in their daily life. Furthermore, applicants were excluded in case they reported known allergy to eggs or egg products, were pregnant or breastfeeding. All subjects gave written informed consent before data acquisition. Before enrolment subjects were instructed how and when to consume the product and how to use the online questionnaires. Throughout the study, support was available through both telephone and mail. Although there is growing popularity for these products, particularly in treating osteoarthritis, the scientific evidence regarding their effectiveness is mixed. Some studies in rats have shown positive results in reducing inflammatory cytokines and improving joint swelling when administering ESM (Kevin J. Ruff et al., 2018 ; Sim et al., 2015 ; Wedekind et al., 2017 ). However, it is important to note that these results in animals do not always directly translate to humans. In the context of human studies, the findings are diverse. Certain studies have reported statistically significant improvements in pain relief and stiffness in patients who consumed ESM (K J Ruff et al., 2009 ), but other studies have had high dropout rates or have not shown significant improvements in joint function or overall joint health (Kiers & Bult, 2021 ). Moreover, some studies have lacked a placebo control group, making it difficult to determine the true effectiveness of the supplement (Aguirre, 2016 ). In our study, of the 60 patients from the original ITT population (20 for MKARE®, 20 for ESM-RT and 20 for placebo), 7 patients dropped out from the study due to various reasons, most commonly associated with lack of adherence to the treatment. Thus, the final total population evaluated was 53 (19 for MKARE®, 16 for ESM-RT and 18 for placebo) with an overall drop-out rate of 11.7%. Firstly, the WOMAC baseline score was evaluated to verify randomization amongst the three groups via ANOVA, showing no significant differences between groups at p < 0.05. Post-baseline analyses, focused on the variation of the WOMAC scores throughout the study were carried out. The RM-ANOVA analysis of variance showed a significant overall improvement in patients treated with MKARE®, and ESM-RT compared to day 0 in both 30 (MKARE® mean improvement: 45.43%, p = 0.002**; ESM-RT mean improvement: 37.38%, p = 0.03*) and 60 days (MKARE® mean improvement: 51.15%, p = 0.003**; ESM-RT mean improvement: 32.61%, p = 0.032*) timespans. No significant improvement over time was observed in the placebo group. Figure 4 , shows the individualized analysis for each sub score and treatment group, consolidating a higher significant improvement in the MKARE® compared to ESM-RT group. The NNT is a common approach in pharmacology to convey the real efficiency of a new treatment. This figure represents the number of patients needed to be treated to prevent one additional bad outcome (e.g. worsening of an illness). NNTs of 5 or below are normally regarded equivalent to an effective treatment to a pain related condition (Wen et al., 2005 ). In this study, the NNT value was calculated considering an absolute ≥ 30% individual overall improvement from baseline as the clinically relevant outcome, and the placebo group as the control standard. Based on this criterion, the MKARE® group showed an Absolute Risk Reduction (ARR) of 40.6% with an NNT value of 3 (95% CI, 1.4 to 8.9) at 30 days and an ARR of 40.1% with an NNT value of 3 (95% CI, 1.4 to 9.1) at 60 days. On the other hand, the ESM-RT group showed an ARR of 28.47% with an NNT value of 4 (95% CI; NNH 29 to infinity to NNB 1.7) at 30 days and an ARR of 11.10% with an NNT value of 9 (95% CI; NNH 4.5 to infinity to NNB 2.3). Conclusion In conclusion, MKARE® emerges as a promising approach to address inflammation and stimulate chondrocyte regeneration in the context of OA. ESM freshness is a crucial factor; as the membrane ages, it undergoes biochemical changes that can compromise its therapeutic efficacy. The integrity and concentration of vital constituents are best maintained in fresh membranes, making them more effective in promoting joint health and alleviating osteoarticular symptoms. This emphasis on the freshness of the eggshell membrane opens a new perspective in natural osteoarticular therapies, highlighting the potential of utilizing fresh bio-sourced materials for clinical benefits. Declarations Declaration of Competing Interest MLNG and PAR are currently employed by the sponsor of the study. VVS, ACS, EGC, MLG and YGR declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Ethics Statement Authors follow a code of ethics. Data availability Data will be made available on request. Acknowledgements We thank Fundación Leonesa Pro-neurociencias for its financial support. References Aguirre, A. (2016). International Journal of Clinical Rheumatology The effect of daily administration of 300 mg of ovomet® for treatment of arthritis in elderly patients. International Journal of Clinical Rheumatology , 11 (5), 77–81. https://www.openaccessjournals.com/articles/the-effect-of-daily-administration-of-300-mg-of-ovomet174-for-treatment-of-arthritis-in-elderly-patients.pdf Ahlborn, G. J., Clare, D. A., Sheldon, B. W., & Kelly, R. W. (2006). Identification of eggshell membrane proteins and purification of ovotransferrin and β-NAGase from hen egg white. Protein Journal , 25 (1), 71–81. https://doi.org/10.1007/s10930-006-0010-8 Ahmed, T. A. E., Suso, H. P., & Hincke, M. T. (2017). In-depth comparative analysis of the chicken eggshell membrane proteome. Journal of Proteomics , 155 , 49–62. https://doi.org/10.1016/j.jprot.2017.01.002 Ahmed, T. A. E., Suso, H. P., & Hincke, M. T. (2019). Experimental datasets on processed eggshell membrane powder for wound healing. Data in Brief , 26 , 104457. https://doi.org/10.1016/j.dib.2019.104457 Cánovas, F., Abellán-Ruíz, M. S., García-Muñoz, A. M., Luque-Rubia, A. J., Victoria-Montesinos, D., Pérez-Piñero, S., Sánchez-Macarro, M., & López-Román, F. J. (2022). Randomised Clinical Trial to Analyse the Efficacy of Eggshell Membrane to Improve Joint Functionality in Knee Osteoarthritis. Nutrients , 14 (11). https://doi.org/10.3390/nu14112340 Carrillo, W., Spindola, H., Ramos, M., Recio, I., & Carvalho, J. E. (2016). Anti-Inflammatory and Anti-Nociceptive Activities of Native and Modified Hen Egg White Lysozyme. Journal of Medicinal Food , 19 (10), 978–982. https://doi.org/10.1089/jmf.2015.0141 Chi, Y., Liu, R., Lin, M., & Chi, Y. (2022). A novel process to separate the eggshell membranes and eggshells via flash evaporation. Food Science and Technology (Brazil) , 42 . https://doi.org/10.1590/fst.07522 Cordeiro, C. M. M., Esmaili, H., Ansah, G., & Hincke, M. T. (2013). Ovocalyxin-36 is a pattern recognition protein in chicken eggshell membranes. PLoS ONE , 8 (12), 1–13. https://doi.org/10.1371/journal.pone.0084112 Dar, Q. A., Schott, E. M., Catheline, S. E., Maynard, R. D., Liu, Z., Kamal, F., Farnsworth, C. W., Ketz, J. P., Mooney, R. A., Hilton, M. J., Jonason, J. H., Prawitt, J., & Zuscik, M. J. (2017). Daily oral consumption of hydrolyzed type 1 collagen is chondroprotective and antiinflammatory in murine posttraumatic osteoarthritis. PLoS ONE , 12 (4). https://doi.org/10.1371/JOURNAL.PONE.0174705 Dudhia, J. (2005). Aggrecan, aging and assembly in articular cartilage. Cellular and Molecular Life Sciences , 62 (19–20), 2241–2256. https://doi.org/10.1007/s00018-005-5217-x Eggshell Membrane Market Size, Share, Growth 2024-2032 . (n.d.). Retrieved December 17, 2023, from https://www.expertmarketresearch.com/reports/eggshell-membrane-market Eggshell Membrane Market Size | Industry Report, 2021-2028 . (n.d.). Retrieved December 17, 2023, from https://www.grandviewresearch.com/industry-analysis/eggshell-membranes-market Fernandes, J. C., Martel-Pelletier, J., & Pelletier, J.-P. (2002a). The role of cytokines in osteoarthritis pathophysiology. Biorheology , 39 (1–2), 237–246. Fernandes, J. C., Martel-Pelletier, J., & Pelletier, J.-P. (2002b). The role of cytokines in osteoarthritis pathophysiology. Biorheology , 39 (1–2), 237–246. http://www.ncbi.nlm.nih.gov/pubmed/12082286 Furukawa, K., Kono, M., Kataoka, T., Hasebe, Y., Jia, H., & Kato, H. (2021). Effects of eggshell membrane on keratinocyte differentiation and skin aging in vitro and in vivo. Nutrients , 13 (7). https://doi.org/10.3390/nu13072144 Han, C., Chen, Y., Shi, L., Chen, H., Li, L., Ning, Z., Zeng, D., & Wang, D. (2023). Advances in eggshell membrane separation and solubilization technologies. Frontiers in Veterinary Science , 10 (11). https://doi.org/10.3389/fvets.2023.1116126 J. Gautron M. T. Hincke, M. P. J. M. G.-R. T. B., & Nys, Y. (2001). Ovotransferrin is a Matrix Protein of the Hen Eggshell Membranes and Basal Calcified Layer. Connective Tissue Research , 42 (4), 255–267. https://doi.org/10.3109/03008200109016840 Kaweewong, K., Garnjanagoonchorn, W., Jirapakkul, W., & Roytrakul, S. (2013). Solubilization and identification of hen eggshell membrane proteins during different times of chicken embryo development using the proteomic approach. Protein Journal , 32 (4), 297–308. https://doi.org/10.1007/s10930-013-9487-0 Kiers, J. L., & Bult, J. H. F. (2021). Mildly Processed Natural Eggshell Membrane Alleviates Joint Pain Associated with Osteoarthritis of the Knee: A Randomized Double-Blind Placebo-Controlled Study. Journal of Medicinal Food , 24 (3), 292–298. https://doi.org/10.1089/jmf.2020.0034 Li, G., Cheng, T., & Yu, X. (2021). The Impact of Trace Elements on Osteoarthritis. Frontiers in Medicine , 8 (December), 1–13. https://doi.org/10.3389/fmed.2021.771297 Matsuoka, R., Kurihara, H., Yukawa, H., & Sasahara, R. (2019). Eggshell membrane protein can be absorbed and utilised in the bodies of rats. BMC Research Notes , 12 (1). https://doi.org/10.1186/s13104-019-4306-0 Mine, Y., Guyonnet, V., Hatta, H., Nau, F., & Qiu, N. (2023). Handbook of Egg Science and Technology . CRC Press. https://doi.org/10.1201/9781003254430 Monfort, J., Pelletier, J.-P., Garcia-Giralt, N., & Martel-Pelletier, J. (2008). Biochemical basis of the effect of chondroitin sulphate on osteoarthritis articular tissues. Annals of the Rheumatic Diseases , 67 (6), 735–740. https://doi.org/10.1136/ard.2006.068882 Nielsen, P. M., Petersen, D., & Dambmann, C. (2001). Improved method for determining food protein degree of hydrolysis. Journal of Food Science , 66 (5), 642–646. https://doi.org/10.1111/j.1365-2621.2001.tb04614.x Porée, B., Kypriotou, M., Chadjichristos, C., Beauchef, G., Renard, E., Legendre, F., Melin, M., Gueret, S., Hartmann, D. J., Malléin-Gerin, F., Pujol, J. P., Boumediene, K., & Galéra, P. (2008). Interleukin-6 (IL-6) and/or soluble IL-6 receptor down-regulation of human type II collagen gene expression in articular chondrocytes requires a decrease of Sp1.Sp3 ratio and of the binding activity of both factors to the COL2A1 promoter. The Journal of Biological Chemistry , 283 (8), 4850–4865. https://doi.org/10.1074/JBC.M706387200 Qosimah, D., Oktafian, N., Wisang, S., Hutasuhut, F. I., Melati, I., & Priani, F. O. (2016). Glucosamine in the egg shells and goat fats as therapy for osteoarthritis rat model. International Journal of PharmTech Research , 9 (7), 122–129. Rath, N. C., Liyanage, R., Makkar, S. K., & Lay, J. O. (2017). Protein profiles of hatchery egg shell membrane. Proteome Science , 15 (1), 1–9. https://doi.org/10.1186/s12953-017-0112-6 Ruff, K J, Winkler, A., Jackson, R. W., DeVore, D. P., & Ritz, B. W. (2009). Eggshell membrane in the treatment of pain and stiffness from osteoarthritis of the knee: a randomized, multicenter, double-blind, placebo-controlled clinical study. Clinical Rheumatology , 28 (8), 907–914. https://doi.org/10.1007/s10067-009-1173-4 [doi] Ruff, Kevin J., Morrison, D., Duncan, S. A., Back, M., Aydogan, C., & Theodosakis, J. (2018). Beneficial effects of natural eggshell membrane versus placebo in exercise-induced joint pain, stiffness, and cartilage turnover in healthy, postmenopausal women. Clinical Interventions in Aging , 13 , 285–295. https://doi.org/10.2147/CIA.S153782 Scheller, A. C., Schmidt-Arras, D. & Rose-John, S. (2011). The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta . May;1813(5):878-88. https://doi.org/10.1016/j.bbamcr.2011.01.034 Sim, B. Y., Bak, J. W., Lee, H. J., Jun, J. A., Choi, H. J., Kwon, C. J., Kim, H. Y., Ruff, K. J., Brandt, K., & Kim, D. H. (2015). Erratum: Effects of natural eggshell membrane (NEM) on monosodium iodoacetate-induced arthritisin rats (Journal of Nutrition and Health (2015) 48:4 (364-370)). Journal of Nutrition and Health , 48 (5), 457–458. https://doi.org/10.4163/jnh.2015.48.5.457 Varelis, P. (2016). Food Chemistry and Analysis. In Reference Module in Food Science . Elsevier. https://doi.org/https://doi.org/10.1016/B978-0-08-100596-5.03341-2 Vuong, T. T., Rønning, S. B., Ahmed, T. A. E., Brathagen, K., Høst, V., Hincke, M. T., Suso, H. P., & Pedersen, M. E. (2018). Processed eggshell membrane powder regulates cellular functions and increase MMP-activity important in early wound healing processes. PLoS ONE , 13 (8), 1–23. https://doi.org/10.1371/journal.pone.0201975 Wedekind, K. J., Ruff, K. J., Atwell, C. A., Evans, J. L., & Bendele, A. M. (2017). Beneficial effects of natural eggshell membrane (NEM) on multiple indices of arthritis in collagen-induced arthritic rats. Modern Rheumatology , 27 (5), 838–848. https://doi.org/10.1080/14397595.2016.1259729 Wen, L., Badgett, R., & Cornell, J. (2005). Number needed to treat: A descriptor for weighing therapeutic options. American Journal of Health-System Pharmacy : AJHP : Official Journal of the American Society of Health-System Pharmacists , 62 , 2031–2036. https://doi.org/10.2146/ajhp040558 Wojdasiewicz, P., Poniatowski, Ł. A., & Szukiewicz, D. (2014). The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. Mediators of Inflammation , 2014 , 1–19. https://doi.org/10.1155/2014/561459 Wu, J., & Acero-Lopez, A. (2012). Ovotransferrin: Structure, bioactivities, and preparation. Food Research International , 46 (2), 480–487. https://doi.org/10.1016/j.foodres.2011.07.012 Y. Nys J. Gautron, M. D. M. J. M. G.-R., & Hincke, M. T. (2001). Biochemical and functional characterisation of eggshell matrix proteins in hens. World’s Poultry Science Journal , 57 (4), 401–413. https://doi.org/10.1079/WPS20010029 Yang, Y., Gao, S.-G., Zhang, F.-J., Luo, W., Xue, J.-X., & Lei, G.-H. (2014). Effects of osteopontin on the expression of IL-6 and IL-8 inflammatory factors in human knee osteoarthritis chondrocytes. European Review for Medical and Pharmacological Sciences , 18 (23), 3580–3586. http://www.ncbi.nlm.nih.gov/pubmed/25535126 Additional Declarations The authors declare potential competing interests as follows: MLNG and PAR are currently employed by the sponsor of the study. VVS, ACS, EGC, MLG and YGR declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Supplementary Files Graphicalabstract.tif GRAPHICAL ABSTRACT Cite Share Download PDF Status: Published Journal Publication published 30 Apr, 2024 Read the published version in Journal of Functional Foods → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3875703\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":267830445,\"identity\":\"875f482f-33b7-4ad2-a4d9-f65c229c89cd\",\"order_by\":0,\"name\":\"Alejandro Casado-Santos\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABMElEQVRIie3QMWuDQBTA8ZPCubzU9YWk9SsoBdvB4lexFK6Ls3QoQRB06gcoFPoVhE7dAgfnIs4OHVICzeJgyJJBSk9bMkQS6Nbh/oty8PO9kxCV6v+GYPRPirsjOD1O3Ok4IlrUE/pL6HHCXGveE7Ij5BAxUr5sti2HizxdLSG8Mi/NmDda8j6leiwW5H42uETBnPFjwsEpCjuGEu23hDLUkk+gIO4sUvDBmIo4ZBRJUgVaPEpQywQ4RJMfoRg40s73hVnpm3XbLfay+uiIlwlj0/TErCX5GixmVWBNgDKwkNgduZFTCP5MAUmik31iF0E4OUtcwCKwn55LvM0Ec9AvJQHG0BeDu5zn+eu6btEz0nzR1OHsOuPyHzYh9wydC2weBosdyB+8qFQqleovfQOUcmnUsNZMwwAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"UNIVERSIDAD DE LEÓN\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Alejandro\",\"middleName\":\"\",\"lastName\":\"Casado-Santos\",\"suffix\":\"\"},{\"id\":267831225,\"identity\":\"1ede9ac8-0ce8-4994-964a-722d1a4304c6\",\"order_by\":1,\"name\":\"Manuel A. La Nuez-García\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"ARANDOVO\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Manuel\",\"middleName\":\"A. La\",\"lastName\":\"Nuez-García\",\"suffix\":\"\"},{\"id\":267831226,\"identity\":\"73159a96-20d2-43da-92d9-4609628aa31d\",\"order_by\":2,\"name\":\"Patricia Álvarez-Rodríguez\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"ARANDOVO\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Patricia\",\"middleName\":\"\",\"lastName\":\"Álvarez-Rodríguez\",\"suffix\":\"\"},{\"id\":267831227,\"identity\":\"4129d180-2678-4987-b2e8-be668808dc5d\",\"order_by\":3,\"name\":\"Elsa González-Cubero\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"UNIVERSIDAD DE LEÓN\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Elsa\",\"middleName\":\"\",\"lastName\":\"González-Cubero\",\"suffix\":\"\"},{\"id\":267831228,\"identity\":\"fb7a69fb-f4ef-4503-b75c-d2503a86753c\",\"order_by\":4,\"name\":\"Yaiza González-Rodríguez\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"UNIVERSIDAD DE LEÓN\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yaiza\",\"middleName\":\"\",\"lastName\":\"González-Rodríguez\",\"suffix\":\"\"},{\"id\":267831229,\"identity\":\"9b431533-3d50-428e-a6cf-727ccccf7a7b\",\"order_by\":5,\"name\":\"María Luisa González- Fernández\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"UNIVERSIDAD DE LEÓN\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"María\",\"middleName\":\"Luisa González-\",\"lastName\":\"Fernández\",\"suffix\":\"\"},{\"id\":267831270,\"identity\":\"76c308d4-6cfd-4f3c-b34c-3b844cf68c44\",\"order_by\":6,\"name\":\"Vega Villar-Suárez\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIie2RsarCMBSGTyicLKlZT+FynyEu0s1XKQh16eZyQbg41UV3HcTXcKyLLlFwE1wKQieFjg4OJh0Fo6NDvuknycf5DwHweL4X+mkBsNKGjxWBAIGy4eMxVkGy4e1TtR0fapbHAvmuGoarWEg+LaC+OxStB8RyU0z0O6dQk4gm+4TN89dKNMsSAm13SfEUGlcdMxWEI4eyvPRujSIrHFila5W7o5gkviH4MwqlGDRTyCiADkVkGCeNUgXRwiiktVpPHbsg356Ptfr/lTJl9TU3YTxplzdHMfMRCpLns8IlAPDSfe/xeDyeB6vIP52qDXRiAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"UNIVERSIDAD DE LEÓN-IBIOMED\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Vega\",\"middleName\":\"\",\"lastName\":\"Villar-Suárez\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-01-18 12:05:54\",\"currentVersionCode\":1,\"declarations\":{\"humanSubjects\":false,\"vertebrateSubjects\":false,\"conflictsOfInterestStatement\":true,\"humanSubjectEthicalGuidelines\":false,\"humanSubjectConsent\":false,\"humanSubjectClinicalTrial\":false,\"humanSubjectCaseReport\":false,\"vertebrateSubjectEthicalGuidelines\":false},\"doi\":\"10.21203/rs.3.rs-3875703/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3875703/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1016/j.jff.2024.106119\",\"type\":\"published\",\"date\":\"2024-05-01T02:25:45+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":49860683,\"identity\":\"9bdd1192-72e1-4f9f-8ff8-6a62541a4709\",\"added_by\":\"auto\",\"created_at\":\"2024-01-19 08:44:48\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":321748,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEnrollment, randomization, and completion flow diagram on the ITT population.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIGURE1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3875703/v1/cb193f7cc25aeb6f0f137346.png\"},{\"id\":49860686,\"identity\":\"70b1cb7d-5113-44dc-b12a-994dea78c614\",\"added_by\":\"auto\",\"created_at\":\"2024-01-19 08:44:49\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":923416,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003e(A) \\u003c/strong\\u003eSDS-PAGE electrophoresis gel under denaturing conditions of samples of ES (1: ES-F; 2: ES-Fr and 3: ES-RT) and ESM (1: MKARE\\u003csup\\u003e®\\u003c/sup\\u003e and 2: ESM-RT). \\u003cstrong\\u003e(B)\\u003c/strong\\u003e Chromatograms obtained by Size Exclusion Chromatography (SEC) of the water-soluble fraction obtained from the different samples of ES (ES-F and ES-RT) and ESM (MKARE\\u003csup\\u003e®\\u003c/sup\\u003e and ESM-RT).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIGURE2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3875703/v1/d8e006586caf03c14bf3250f.png\"},{\"id\":49860994,\"identity\":\"0c71c8c1-a78e-4c3b-9ff7-4d9c7d7f32bf\",\"added_by\":\"auto\",\"created_at\":\"2024-01-19 08:52:49\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":486904,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eA) \\u003c/strong\\u003eMTT assay of human chondrocyte cells supplemented with ESM. The number of viable cells is expressed as the increased absorbance of the MTT test on 24 h of culture. ns p value \\u0026gt; 0.05. \\u003cstrong\\u003eB) \\u003c/strong\\u003eRelative gene expression of ACAN as specific gene of chondrogenesis in human chondrocytes compared for TNF-inflamed chondrocytes, MKARE\\u003csup\\u003e®\\u003c/sup\\u003e-treated TNF-inflamed chondrocytes and ESM-RT-treated TNF-inflamed chondrocytes after 24h of incubation. \\u003cstrong\\u003eC)\\u003c/strong\\u003e Relative gene expression of specific genes of inflammation TNF, IL-1α and IL-6 in human chondrocytes. MKARE\\u003csup\\u003e®\\u003c/sup\\u003e-treated TNF-inflamed chondrocytes and ESM-RT-treated TNF-inflamed chondrocytes after 24h of incubation. p value: * p≤ 0.05; ** p≤ 0.01; ***p≤ 0.001. Each bar represents the mean ± SEM of at least three experiments performed in triplicates.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIGURE3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3875703/v1/aa9a736b2ed9397a9801bb7e.png\"},{\"id\":49860684,\"identity\":\"21235727-b11f-40db-86ad-dbe362faa160\",\"added_by\":\"auto\",\"created_at\":\"2024-01-19 08:44:49\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":646835,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eWOMAC pain score development for each treatment group (subscores: \\u003cstrong\\u003eA)\\u003c/strong\\u003e Pain; \\u003cstrong\\u003eB)\\u003c/strong\\u003e Stiffness; \\u003cstrong\\u003eC)\\u003c/strong\\u003ePhysical function). p value: ns \\u0026gt; 0.05; * p≤ 0.05; ** p≤ 0.01; ***p≤ 0.001. Each bar represents the mean ± SEM of at least three experiments performed in triplicates.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIGURE4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3875703/v1/d15f79e72c9d9e4bedde9be5.png\"},{\"id\":53129892,\"identity\":\"8727da72-9c60-4d7f-98ce-a09db63814a6\",\"added_by\":\"auto\",\"created_at\":\"2024-03-21 02:25:52\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1092185,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3875703/v1/26ef450f-5679-4042-aee0-8cb3c433d75e.pdf\"},{\"id\":49860687,\"identity\":\"ad8e63ee-104a-46e5-9da7-3fe6ccc12060\",\"added_by\":\"auto\",\"created_at\":\"2024-01-19 08:44:49\",\"extension\":\"tif\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1217956,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGRAPHICAL ABSTRACT\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Graphicalabstract.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3875703/v1/30c21ae668390c7f0b6fce6a.tif\"}],\"financialInterests\":\"The authors declare potential competing interests as follows: MLNG and PAR are currently employed by the sponsor of the study. VVS, ACS, EGC, MLG and YGR declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\",\"formattedTitle\":\"\\u003cp\\u003e\\u003cstrong\\u003eAnti-inflammatory and regenerative effects of MKARE\\u003c/strong\\u003e\\u003csup\\u003e\\u003cstrong\\u003e® \\u003c/strong\\u003e\\u003c/sup\\u003e\\u003cstrong\\u003eEggshell Membrane: an \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e osteoarthritis model and placebo-controlled clinical study.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eIn recent years, the pursuit of natural and sustainable therapeutic agents has prompted the investigation of diverse sources with potential medical applications (K J Ruff et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e). One particularly promising candidate is the eggshell membrane (ESM), known for its rich composition of bioactive compounds that exhibit anti-inflammatory and regenerative properties. Within the realm of musculoskeletal disorders, especially osteoarthritis (OA), a prevalent inflammatory joint disease impacting millions globally, there has been an escalating demand for innovative interventions (K J Ruff et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eArticular cartilage, the specialized tissue covering the ends of bones within joints, plays a crucial role in preserving joint function and facilitating smooth movement. Chondrocytes, the primary cellular components of articular cartilage, are responsible for synthesizing and maintaining the extracellular matrix, vital for the integrity and mechanical properties of the cartilage. However, during the progression of OA, an imbalance between pro-inflammatory and anti-inflammatory factors disrupts chondrocyte homeostasis, leading to an increase in pro-inflammatory cytokines, catabolic enzymes, and matrix metalloproteinases. Ultimately, this cascade results in cartilage degradation and joint dysfunction (Fernandes et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2002a\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eDue to the constrained regenerative ability of cartilage, the development of therapies capable of mitigating inflammation and promoting chondrocyte regeneration is of great importance in OA management. This has driven researchers to explore natural sources, such as the ESM, for its potential to alleviate inflammation and facilitate tissue repair (C\\u0026aacute;novas et al., \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe ESM is a thin, yet complex, biocompatible layer that separates the eggshell (ES) from the egg white. It consists of diverse bioactive components, such as aggrecan (ACAN) collagen, glycosaminoglycans, elastin, and growth factors. The ESM has demonstrated significant therapeutic potential in wound healing and tissue repair. Due to its multifaceted composition (Han et al., \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e), ESM emerges as a compelling candidate for addressing inflammatory processes linked to osteoarthritis (OA) and promoting the restoration of chondrocyte function (Kiers \\u0026amp; Bult, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eCollagen and ACAN, key constituents of the ESM, play a pivotal role in offering structural integrity and support to the extracellular matrix. These contribute to the stability of tissues and their ability to withstand mechanical stress. Additionally, the presence of glycosaminoglycans, such as chondroitin sulfate and hyaluronic acid, suggests a potential role in enhancing joint lubrication and reducing friction, thus alleviating pain and discomfort experienced by OA patients (Dudhia, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Monfort et al., \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eMoreover, the ESM contains elastin, a protein that imparts elasticity to tissues, allowing them to withstand repetitive stresses. In the context of OA, regenerative potential of elastin may contribute to the restoration of damaged cartilage and the prevention of further degradation (Li et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Another crucial aspect of the ESM membrane is the presence of growth factors, such as transforming growth factor-beta (TGF-β) and fibroblast growth factor (FGF). These growth factors have been implicated in tissue repair and regeneration by stimulating cell proliferation, migration, and synthesis of extracellular matrix components. In an inflamed chondrocyte microenvironment, the application of ESM-derived growth factors may counteract the detrimental effects of pro-inflammatory mediators and foster a more conducive environment for tissue healing (Furukawa et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eProducts based on ESM are currently available on the market, specifically designed for the treatment of OA. These products are commonly promoted as supplements aimed at alleviating joint pain and enhancing mobility (\\u003cem\\u003eEggshell Membrane Market Size | Industry Report, 2021\\u0026ndash;2028\\u003c/em\\u003e, n.d.). They are available in various forms, including capsules, tablets, and powders. The ESM market has grown significantly in the last years. This growth is attributed to the increasing demand for nutritional supplements and the adoption of this product in the pharmaceutical, cosmetic, and food and beverage industries (\\u003cem\\u003eEggshell Membrane Market Size, Share, Growth 2024\\u0026ndash;2032\\u003c/em\\u003e, n.d.).\\u003c/p\\u003e \\u003cp\\u003eMKARE\\u0026reg; is a 100% natural functional ingredient based on fresh ESM, which natively contains a unique source of bioactive compounds with multiple clinically proven health benefits. MKARE\\u0026reg; is rich in collagen (I, V and X), hyaluronic acid, elastin, chondroitin sulfate, glucosamine and more than 400 proteins, a perfect matrix of key biomolecules in a single ingredient (Dar et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Recent studies emphasize the significance of using fresh eggshell membrane, as it guarantees the maximal preservation of those bioactive compounds (Kiers \\u0026amp; Bult, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe aim of this work is to evaluate the anti-inflammatory potential and regenerative effects of the MKARE\\u0026reg; product. For that purpose, we will employ a well-established \\u003cem\\u003ein vitro\\u003c/em\\u003e model of chondrocyte inflammation. This model allows us to simulate the inflammatory processes observed in OA and assess the response of chondrocytes to ESM treatment. Through comprehensive experimental analyses, we aim to elucidate the underlying molecular mechanisms behind the beneficial effects of ESM on chondrocytes. Additionally, we have conducted a clinical study involving patients afflicted with OA, obtaining promising results. Furthermore, we assessed the significance of the freshness of the membrane compared to other products available on the market, particularly those derived from ES that have been stored for several days at room temperature (RT).\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.1. Obtention and preparation of ES and ESM under different storage conditions\\u003c/h2\\u003e\\n \\u003cp\\u003eComplete ES and ESM obtained from Arandovo\\u0026reg; facilities were analyzed. For this purpose, soluble components of both ES and ESM were solubilized.\\u003c/p\\u003e\\n \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.1.1. Preparation of Water-Soluble Fractions of ES\\u003c/h2\\u003e\\n \\u003cp\\u003e50 g of finely powdered sample was resuspended in 50 mL of milli-Q water. The mixture was homogenized and stirred at room temperature for 1 hour. Samples were centrifuged at 9,250 x g for 10 minutes, and the supernatant was collected for assays. This process was repeated in triplicate for each sample type. Three different conditions were analyzed: (i) Fresh ES labeled as ES-F; (ii) frozen ES labeled as ES-Fr; (iii) ES stored at RT for 13 days labeled as ES-RT.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.1.2. Preparation of Water-Soluble Fractions of ESM\\u003c/h2\\u003e\\n \\u003cp\\u003e5 g of the powder from each sample was resuspended in 30 mL of milli-Q water. The mixture was homogenized and stirred at room temperature for 1 hour. Samples were centrifuged at 9,000 x g for 10 minutes, and the supernatant was collected for assays. This procedure was also performed in triplicate for each sample. Three different conditions were analyzed: (i) Fresh ESM labeled as MKARE\\u0026reg;; (ii) ESM stored at RT for 13 days labeled as ESM-RT.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.2. Evaluation of ES and ESM protein quality\\u003c/h2\\u003e\\n \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.2.1. Determination of free amino groups (reaction with OPA)\\u003c/h2\\u003e\\n \\u003cp\\u003eTotal protein content of the supernatants was quantified using Kjeldahl method (Varelis, \\u003cspan class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). Degree of hydrolysis of the water-soluble fractions was estimated by reacting the free amino acid groups with o-phthalaldehyde (OPA), following the method described by (Nielsen et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e) analysis was conducted in triplicate for each soluble fraction obtained.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.2.2. SDS-PAGE profile analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eSamples were diluted to a protein concentration of 0.8 mg/mL in treatment buffer containing Tris-HCl (0.05 M, pH 6.8), sodium dodecyl sulfate (SDS, 1.6% w/v), glycerol (8% v/v), bromophenol blue (0.002% w/v), and \\u0026beta;-mercaptoethanol (2% v/v). After dilution, samples were heated to 95\\u0026ordm;C for 5 minutes with stirring, then centrifuged. Electrophoresis was conducted using a Criterion XT 12% Bis-Tris polyacrylamide gel (Bio-Rad\\u0026reg;), alongside a Criterion XT molecular weight marker.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.2.3. Molecular weight analysis via Size Exclusion Chromatography (SEC)\\u003c/h2\\u003e\\n \\u003cp\\u003eChromatographic analysis was performed using an Acquity Ultra-high-Performance Liquid Chromatography (UPLC) system (Waters) with a bioZenTM 1.8 \\u0026micro;m, 150 \\u0026times; 4.6 mm column and a bioZenTM SEC-2 precolumn, 4.6mm (Phenomenex\\u0026reg;). A water/acetonitrile/TFA solution (55/45/0.1, v/v/v) served as the mobile phase at a flow rate of 100 \\u0026micro;L/min. Samples from the water-soluble fraction were diluted in the mobile phase to a protein concentration of 1.5 mg/mL, then centrifuged at 12,800 \\u0026times; g for 5 minutes at room temperature. The injection volume was 3 \\u0026micro;L, with absorbance monitored at 214 nm.\\u003c/p\\u003e\\n \\u003cp\\u003eSEC with HPLC was used to determine the molecular weight distribution of the MKARE\\u0026reg; hydrolysate. Standards and a SEC 130A\\u0026ordm; column from Agilent Technology\\u0026reg; were employed in a Waters Company HPLC-UV system.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.3. In vitro model of inflammation on human chondrocytes\\u003c/h2\\u003e\\n \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.3.1. Treatment of MKARE\\u0026reg;\\u003c/h2\\u003e\\n \\u003cp\\u003eIn the process of extracting ESM-F (MKARE\\u0026reg;), two distinct fractions are identified for analysis: the soluble fraction and the hydrolyzed matrix. To prepare soluble fraction (MKARE\\u0026reg;-S), the membrane undergoes a gentle extraction process. The hydrolyzed matrix refers to the structural components of the membrane that are not readily soluble. This fraction is obtained by enzymatically hydrolyzing MKARE\\u0026reg; to solubilize the membrane, converting it into low molecular weight peptides, and thereby enhancing its bioavailability.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePreparation of soluble fraction (MKARE\\u0026reg;-S/ESM\\u0026mdash;RT-S)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e1 g of ESM was resuspended in 10 mL of milli-Q water and agitated magnetically overnight at 4\\u0026ordm;C. The mixture was centrifuged at 4\\u0026ordm;C, 5000 rpm, and the supernatant was filtered through a 0.22\\u0026micro;m cellulose acetate filter using a syringe. The filtrate was stored at 4\\u0026ordm;C for use in \\u003cem\\u003ein vitro\\u003c/em\\u003e assays.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePreparation of enzymatic digestion of ESM (MKARE\\u0026reg;-H/ESM-RT-H)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003eESM was hydrolyzed at 50 mg/mL with papain at 50\\u0026ordm;C overnight, with the addition of 30 mM sodium metabisulfite. The ESM liquid was filtered similarly and stored at 4\\u0026ordm;C for use in following assays. The ESM filtrate solution was heated to 100\\u0026ordm;C for 10 minutes to inactivate the enzyme before use in chondrocyte \\u003cem\\u003ein vitro\\u003c/em\\u003e assays.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.3.2. Chondrocyte culture assay\\u003c/h2\\u003e\\n \\u003cp\\u003eOur \\u003cem\\u003ein vitro\\u003c/em\\u003e model of inflammation was developed in chondrocytes (P2) inflamed with TNF (25 ng/mL). For this purpose, chondrocytes were seeded on 6-well plates, with 4.8x10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well. When 80% cell confluence was reached, samples were treated as follows:\\u003c/p\\u003e\\n \\u003cul\\u003e\\n \\u003cli\\u003e\\n \\u003cp\\u003eGroup 1 (control) (Chondrocytes inflamed with TNF): Chondrocytes cultured with serum-free \\u0026alpha;MEM (Hyclone\\u0026reg;) and 1% penicillin/streptomycin (Hyclone\\u0026reg;) plus 25 ng/mL TNF.\\u003c/p\\u003e\\n \\u003c/li\\u003e\\n \\u003cli\\u003e\\n \\u003cp\\u003eGroup 2 (TNF inflamed chondrocytes and ESM-RT-H treated): Chondrocytes cultured with serum-free \\u0026alpha;MEM (Hyclone\\u0026reg;) and 1% penicillin/streptomycin (Hyclone\\u0026reg;) plus 25 ng/mL TNF and 0.5 mg/mL ESM-RT-H.\\u003c/p\\u003e\\n \\u003c/li\\u003e\\n \\u003cli\\u003e\\n \\u003cp\\u003eGroup 3 (TNF inflamed chondrocytes and MKARE\\u0026reg;-H treated): Chondrocytes cultured with serum-free \\u0026alpha;MEM (Hyclone\\u0026reg;) and 1% penicillin/streptomycin (Hyclone\\u0026reg;) plus 25 ng/mL TNF and 0.5 mg/mL of MKARE\\u0026reg;-H.\\u003c/p\\u003e\\n \\u003c/li\\u003e\\n \\u003cli\\u003e\\n \\u003cp\\u003eGroup 4 (TNF inflamed chondrocytes and ESM-RT-S treated): Chondrocytes cultured with serum-free \\u0026alpha;MEM (Hyclone\\u0026reg;) and 1% penicillin/streptomycin (Hyclone\\u0026reg;) plus 25 ng/mL TNF and 1 mg/mL ESM-RT-S.\\u003c/p\\u003e\\n \\u003c/li\\u003e\\n \\u003cli\\u003e\\n \\u003cp\\u003eGroup 5 (TNF inflamed chondrocytes and MKARE\\u0026reg;-S treated): Chondrocytes cultured with serum-free \\u0026alpha;MEM (Hyclone\\u0026reg;) and 1% penicillin/streptomycin (Hyclone\\u0026reg;) plus 25 ng/mL TNF and 1 mg/mL MKARE\\u0026reg;-S.\\u003c/p\\u003e\\n \\u003c/li\\u003e\\n \\u003c/ul\\u003e\\n \\u003cp\\u003eAfter 24 hours of incubation, cell samples were collected and using for the following experiments.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.3.1. Citotoxicity MTT assay\\u003c/h2\\u003e\\n \\u003cp\\u003eMTT [3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazol bromide] assay (Invitrogen\\u0026reg;) was carried out on the inflamed and treated chondrocytes. Cell viability and proliferation can be determined through the MTT assay based on the mitochondrial functionality of the treated cells. Chondrocytes were seeded (1.2x104 cells/well) on 48 well plates with the experimental conditions. Analysis was carried out after 24 h of culture. After 24h, the medium was removed, and the plates rinsed with PBS. Then, plates were incubated for 3 h at 37\\u0026deg;C with a medium containing DMEM without phenol red and 10% MTT, avoiding exposure to direct light. 100 \\u0026micro;l of solubilizing solution of DMSO-Isopropanol (1:1) (Fisher Scientific\\u0026reg;) was then added and the plates were incubated for 30 min on a PMS-1000i microplate orbital shaker (Grant Bio\\u0026trade;). Optical density in each well was quantified at 570 nm with a multiplate spectrophotometer reader Multiskan GO (Thermo Fisher Scientific\\u0026reg;).\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.3.2. Quantitative real-time PCR (qPCR)\\u003c/h2\\u003e\\n \\u003cp\\u003eRNA was extracted from the cultured cells using the GeneMATRIX universal RNA purification kit by EURx\\u0026reg;, following the protocol provided by the supplier. Total RNA was quantified using the QUBIT\\u0026reg; RNA assay from Thermo Scientific\\u0026reg;. For the synthesis of cDNA, 1000 ng of the extracted RNA was employed, using the high-capacity cDNA reverse transcription kit (Applied Biosystems\\u0026reg;). Expression levels of aggrecan ACAN, IL-1\\u0026alpha;, IL-6, and TNF genes were assessed by qPCR. The primers used are listed in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. Beta-actin (ACT-\\u0026beta;) was used as a normalization reference. qPCR assays were conducted with the Power SYBR\\u0026trade; Green PCR Master Mix (2\\u0026times; concentration) (Applied Biosystems\\u0026reg;), in a reaction volume of 20 microliters, using the StepOne real-time PCR system (Applied Biosystems\\u0026reg;), in accordance with the manufacturer\\u0026rsquo;s protocol. Relative expression of the target genes was determined using the 2\\u003csup\\u003e\\u0026ndash;\\u0026Delta;\\u0026Delta;Ct\\u003c/sup\\u003e comparative method, with normalization to the housekeeping gene, ACT-\\u0026beta;.\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u0026nbsp;\\u003ctable id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003ePrimer sequences and conditions used for qPCR.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"5\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGen\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNCBI\\u003c/p\\u003e\\n \\u003cp\\u003eRefSeq\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eForward/Reverse (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eT\\u0026ordf; melting \\u0026ordm;C\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eProduct size (bp)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eACT-\\u0026beta;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNM_001101.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCCCTCCATCGTCCACCGCAAATGCT\\u003c/p\\u003e\\n \\u003cp\\u003eCTGCTGTCACCTTCACCGTTCCAGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e59.7\\u003c/p\\u003e\\n \\u003cp\\u003e58.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e131\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eACAN\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNM_001369268.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCTGCCCAACTACCCGGCCAT\\u003c/p\\u003e\\n \\u003cp\\u003eTGCGCCCTGTCAAAGTCGAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e72.1\\u003c/p\\u003e\\n \\u003cp\\u003e71.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e200\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eIL-6\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNM_000600.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eATAACCACCCCTGACCCAA\\u003c/p\\u003e\\n \\u003cp\\u003eCCATGCTACATTTGCCGAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e74.4\\u003c/p\\u003e\\n \\u003cp\\u003e72.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e169\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eIL-1a\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNM_000575.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAGAGGAAGAAATCATCAAG\\u003c/p\\u003e\\n \\u003cp\\u003eTTATACTTTGATTGAGGGCG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e57.5\\u003c/p\\u003e\\n \\u003cp\\u003e59.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e139\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTNF\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNM_000594.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCCTGAAAACAACCCTCAGACGCCACA\\u003c/p\\u003e\\n \\u003cp\\u003eTCCTCGGCCAGCTCCACGTCCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e77.9\\u003c/p\\u003e\\n \\u003cp\\u003e79.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e155\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.4. In vivo study of the effects of MKARE\\u0026reg;\\u003c/h2\\u003e\\n \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.4.1. Study design\\u003c/h2\\u003e\\n \\u003cp\\u003eThis study was designed as a randomized, double-blind, placebo-controlled nutritional intervention trial using an excel functional randomization. The subject flow chart containing the intent-to-treat (ITT) population is summarized in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.4.2. Patients\\u003c/h2\\u003e\\n \\u003cp\\u003eSubjects were recruited through various channel information by e-mail notification or on a presential meeting day. The age range of patients selected was 40\\u0026ndash;66 years with osteoarticular problems. Due to this, the participants exhibited symptoms such as pain, stiffness, or functional limitations in their daily lives. Participants who reported known allergy to eggs or egg products, were pregnant or breastfeeding were excluded of the study All subjects gave written informed consent before data acquisition. Before enrolling in the study, participants received instructions on the proper consumption of the product and guidance on when and how to use the online questionnaires.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e2.4.3. Procedure\\u003c/h2\\u003e\\n \\u003cp\\u003eThe protocol was approved by the Ethical Committee of the University of Le\\u0026oacute;n for compliance with the provisions of Regulation (EU) 2016/679 of the European Parliament and of the Council of 27 April 2016 on Data Protection (GDPR).\\u003c/p\\u003e\\n \\u003cp\\u003eAll study participants were provided with written instructions and received product capsules by postal mail. Starting on day 1 and continuing over 60 days, subjects ingested one capsule per day containing MKARE\\u0026reg;, ESM-RT or placebo. The pre-defined primary efficacy endpoint of the study was the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) with Likert analogue scale from 0 a 10. The WOMAC questionnaire is designed for the assessment of lower extremity pain and function in OA of the knee or hip by assessing severity of pain (5 questions), stiffness (2 questions) and limitation of physical function (17 questions). Subjects reported (0\\u0026ndash;10, 0\\u0026thinsp;=\\u0026thinsp;no pain at all, 10\\u0026thinsp;=\\u0026thinsp;the most intense pain) through an online version of WOMAC questionnaire on days 0, 7, 30, and 60.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.5. Statistical analyses\\u003c/h2\\u003e\\n \\u003cp\\u003eIn the \\u003cem\\u003ein vitro\\u003c/em\\u003e assay, each experiment was independently conducted three times. The reported results represent the average\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation of the three values obtained from these independent studies. ANOVA was used to identify significant differences between groups, and Tukey\\u0026apos;s or Dunnett\\u0026rsquo;s post-hoc analysis were then performed. p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was used to classify results as statistically significant.\\u003c/p\\u003e\\n \\u003cp\\u003eIn the \\u003cem\\u003ein vivo\\u003c/em\\u003e study baseline comparison was performed to verify randomization amongst the three groups via ANOVA. The evolution from day 0 to 60 was evaluated trough a repeated measures univariate analysis of variance (RM-ANOVA) with the Geisser-Greenhouse correction. In both cases, statistical significance was accepted at a p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 after performing Tukey\\u0026rsquo;s post hoc analysis. For the Number Needed to Treat (NNT) evaluation, an absolute improvement of 30% from baseline was considered as the clinically relevant criteria, with 95% Confidence Intervals (CI).\\u003c/p\\u003e\\n \\u003cp\\u003eGraphPad Software\\u0026reg; was used for the statistical analysis.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"3. Results and Discussions \",\"content\":\"\\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.1. Evaluation of ES and ESM quality under different storage conditions.\\u003c/h2\\u003e\\n \\u003cp\\u003eComplete ES were obtained from Arandovo\\u0026reg; facilities. Determination of the influence of eggshell storage conditions on the quality of its composition is a key factor (Y. Nys J. Gautron \\u0026amp; Hincke, 2001). Samples of both ES and ESM from Arandovo\\u0026reg; were analyzed to determine whether storage conditions had some impact on the quality of both the eggshell and the final product (MKARE\\u0026reg;).\\u003c/p\\u003e\\n \\u003cp\\u003eMKARE\\u0026reg; is an ESM powder produced in Arandovo\\u0026reg; through an industrial hydromechanical separation process. Upon collection of ES, they are processed on the same day to obtain the ESM. This procedure is implemented at the locations where the ES are generated. This timely processing is crucial to preserve all the proteins from the eggshell membrane, ensuring its maximum biological efficacy (Y. Nys J. Gautron \\u0026amp; Hincke, 2001). To confirm this, both qualitative and quantitative tests have been conducted to substantiate this hypothesis.\\u003c/p\\u003e\\n \\u003cp\\u003eTable \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e shows the values obtained for the free amino groups in the water-soluble fraction of the different samples of the three ES extractions carried out, as well as the total average. Results showed that the sample stored at room temperature (ES-RT) has a higher content of free amino groups, indicative of a higher degree of protein hydrolysis. On the other hand, as expected (Chi et al.,\\u0026nbsp;\\u003cspan class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e), the fresh sample (ES-F) has the lowest content of free amino groups (lower degree of hydrolysis). Upon comparing the hydrolysis levels of two samples from the same batch, ES-RT and frozen (ES-Fr), a significant increase in the free amino group content was observed in the sample stored at room temperature.\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u0026nbsp;\\u003ctable id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eFree amino groups present in the water-soluble fraction of the samples, determined by the OPA method. Average from three replicates. Statistically significant differences between samples (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05).\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"5\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003emmol eq.\\u0026nbsp;glutamic acid/kg sample\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eExtraction 1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eExtraction 2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eExtraction 3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eAverage\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eES-F\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2.649\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2.760\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2.776\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e2.728\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.069\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eES-Fr\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e3.543\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e3.990\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4.359\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e3.964\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.409\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eES-RT\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e6.848\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e8.098\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e7.978\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e7.642\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.690\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n \\u003cp\\u003eThe ES is composed of fibrous proteins such as elastin and collagen, which are crosslinked, making it insoluble. Additionally, there exists a group of soluble proteins, such as ovotransferrin, lysozyme, ovocalyxin-36, and more than 400 types that have been identified with proven functionality (Ahmed et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e, \\u003cspan class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e; Mine et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Figure \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA shows an SDS-PAGE electrophoresis profile of the water-soluble protein fractions of the three types of ES samples. As observed, both in the fresh sample and the sample stored under freezing conditions, the water-soluble fraction shows intense bands corresponding to proteins with molecular weights around 75 and 37 kDa. The 75 kDa band is attributed to ovotransferrin (J. Gautron M. T. Hincke \\u0026amp; Nys, 2001), while the 37 kDa band has been previously attributed to ovocalyxin 36 (Cordeiro et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Other less intense bands are also observed, corresponding to molecular weights of approximately 150 kDa and in the range of 75\\u0026thinsp;\\u0026minus;\\u0026thinsp;50 kDa. In the case of the sample stored at RT, only very weak bands corresponding to 75 and 37 kDa are detected, indicating that most of the proteins are degraded after storage under RT conditions.\\u003c/p\\u003e\\n \\u003cp\\u003eWater-soluble protein fractions were also analyzed using liquid chromatography by Size Exclusion Chromatography (SEC) to verify the degree of hydrolysis. Figure \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB presents a chromatographic profile corresponding to the ES-F sample (the sample stored frozen; ES-Fr shows a similar profile). A set of high-intensity peaks corresponding to soluble proteins with a molecular weight greater than 5800 Da is observed. In contrast, the ES-RT image displays a chromatographic profile of the eggshell sample stored at room temperature. This profile exhibits significantly reduced peaks, indicating a higher degradation of soluble proteins due to RT storage. These results suggest extensive degradation of the eggshell proteins when stored at RT. These findings are consistent with those obtained from the OPA assay. The samples undergo significant hydrolysis when stored at RT, considerably reducing the proportion of proteins with molecular weight\\u0026thinsp;\\u0026gt;\\u0026thinsp;5800 Da and increasing the amount of free amino groups and smaller peptides in the water-soluble fraction. Storage under freezing conditions proves effective in limiting the hydrolysis process considerably.\\u003c/p\\u003e\\n \\u003cp\\u003eSDS-PAGE and SEC profiles of the soluble proteins extracted from MKARE\\u0026reg; and ESM-RT membranes are presented in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. SDS-PAGE assay shows (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA) the existence of a band corresponding to approximately 10\\u0026ndash;15 kDa in MKARE\\u0026reg; that does not appear in the ESM-RT. This band has been previously detected in the protein fraction of the ES and corresponds to lysozyme (Ahlborn et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e; Kaweewong et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). A large portion of the proteins present in the products could not be identified due to the low solubility of both products in the treatment buffer used. The absence of a clearly detected lysozyme band in ESM-RT product suggest a potential lower concentration or loss of this protein in that product. The SEC results show that the peak intensity of MKARE\\u0026reg; is three times higher than that of ESM-RT (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). This finding aligns with expectations, as it was previously confirmed that the soluble proteins from the ES stored at RT were largely degraded, whereas the soluble proteins from a fresh shell, like those used for MKARE\\u0026reg; extraction, retained all their soluble proteins intact. This has significant implications for the effectiveness of the ESM as a supplement for osteoarticular issues. More than 400 types of proteins, such as ovotransferrin, ovocalyxin-36, ovocleidins 17 and 116, lysozyme, etc., have been detected in the ESM. Most of these have demonstrated mineralization and anti-inflammatory effects (Carrillo et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Cordeiro et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Wu \\u0026amp; Acero-Lopez, \\u003cspan class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e). If a fresh membrane such as MKARE\\u0026reg; retains these soluble proteins, it will offer a bioactivity that a membrane obtained from an eggshell stored at RT cannot provide.\\u003c/p\\u003e\\n \\u003cp\\u003eIn the realm of ESM research, the freshness of the ES plays a pivotal role in harnessing its maximum potential. This is especially critical when considering the therapeutic proteins present in the eggshell membrane, which are known for their mineralization and anti-inflammatory properties (Matsuoka et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e; Qosimah et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). To preserve these valuable proteins, it is imperative to take measures to prevent their degradation. When ES are produced and subsequently stored at RT, they undergo a process of protein degradation and microbial growth, which can lead to a significant loss of bio-functional proteins. This degradation not only diminishes the therapeutic efficacy of the ESM but also affects the overall quality of the extracted material (Rath et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Therefore, it is essential to process these eggshells promptly after they are generated to obtain a high-quality, bio-functional product such as MKARE\\u0026reg;.\\u003c/p\\u003e\\n \\u003cp\\u003eOur experiments reveal distinct differences between MKARE\\u0026reg; extracted from fresh ES and those from ES stored at RT for extended periods. The latter showed a marked decrease in the integrity and concentration of bio-functional proteins, underlining the necessity of immediate processing post-generation for optimal results.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.3. MKARE\\u0026reg; have no cytotoxic effects on human chondrocytes in vitro.\\u003c/h2\\u003e\\n \\u003cp\\u003eTo carry out the \\u003cem\\u003ein vitro\\u003c/em\\u003e assay, two distinct fractions of ESM were selected for analysis: the soluble fraction (MKARE\\u0026reg;-S) and the hydrolyzed matrix (MKARE\\u0026reg;- RT- H). The soluble fraction encompasses the readily dissolvable components of the membrane, which may include various proteins, GAGs, and other bioactive molecules. The characterization of this fraction provides insights into the naturally occurring compounds within the membrane that might contribute to its bioactivity. To obtain this soluble fraction (MKARE\\u0026reg;-S and ESM-RT-S), the membrane undergoes a gentle extraction process, typically using a buffered solution, to ensure the preservation of its bioactive components (Ahmed et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Conversely, the hydrolyzed matrix (MKARE\\u0026reg;-H and ESM-RT-H) refers to all components of ESM, the soluble components and the structural components of the membrane that are not readily soluble (fibrous proteins: elastin, collagens\\u0026hellip;). This fraction is subjected to enzymatic hydrolysis, a process that breaks down the more complex, insoluble proteins and fibers into smaller peptides. This hydrolysis is crucial for revealing the full spectrum of bioactive substances within the membrane, some of which may only be liberated through this process. The methods of extraction and hydrolysis were meticulously optimized to maximize yield and maintain the integrity of the bioactive compounds, ensuring the reliability and relevance of our findings. The profile of molecular weight of the dissolutions of ESM employed in the \\u003cem\\u003ein vitro\\u003c/em\\u003e assay was characterized by SEC and showed a maximum molecular weight of 2944 Da (results not shown). Both fractions, the soluble and the hydrolyzed matrix, offer distinct and complementary insights into the eggshell membrane\\u0026apos;s biochemical profile (Wedekind et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Analyzing these two fractions separately allows for a more comprehensive understanding of the membrane\\u0026apos;s potential health benefits, including its application in areas such as osteoarthritis treatment, skin care, and nutrition.\\u003c/p\\u003e\\n \\u003cp\\u003eTo ensure that the ESM had no adverse effects on cell viability, an MTT assay was conducted. In this assay MKARE\\u0026reg;-H, MKARE\\u0026reg;-S, ESM-RT-H and ESM-RT-S were tested to confirm the compatibility and safety of the ESM in a biological context. In Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA the proliferation of chondrocytes cultured with the different ESM samples is shown. Cells were viable when they were cultured with all the products according to the results obtained from the MTT assay, though the highest proliferation rate was obtained with both soluble fractions. No significant differences in viability were shown respect to control sample.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.3. MKARE\\u0026reg; possesses protective and anti-inflammatory effects on human chondrocyte cell model of inflammation.\\u003c/h2\\u003e\\n \\u003cp\\u003eDespite recent advancements in using ESM for various biomedical applications, including cultivation of human fibroblasts on ESM for tissue engineering applications (Vuong et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e), there appears to be a notable absence of studies focusing specifically on the use of ESM in \\u003cem\\u003ein vitro\\u003c/em\\u003e chondrocyte models for OA. Researching the effects of ESM on chondrocytes, particularly within the inflammatory environment, could provide invaluable insights into the development of novel therapeutic strategies for this pathology.\\u003c/p\\u003e\\n \\u003cp\\u003eRecent studies have revealed that the release of inflammatory molecules, such as pro-inflammatory cytokines, are essential mediators of altered metabolism and accelerated extracellular matrix degradation (Fernandes et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2002b\\u003c/span\\u003e; Wojdasiewicz et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). In our \\u003cem\\u003ein vitro\\u003c/em\\u003e model the effect of MKARE\\u0026reg;-H, MKARE\\u0026reg;-S, ESM-RT-H and ESM-RT-S added to chondrocyte-inflamed cultures was compared. The expression of specific chondrogenic genes such as ACAN was analyzed under the different experimental conditions stimulated with TNF. Figure \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB shows significant increases in ACAN gene expression with the addition of all ESM samples. The higher rate was obtained with MKARE\\u0026reg;-H sample.\\u003c/p\\u003e\\n \\u003cp\\u003eRegarding the inflammatory genes, MKARE\\u0026reg;-H dramatically reduced the expression of these mediators (IL-1\\u0026alpha; and IL-6). The same effect was detected in TNF gene expression though the downregulation observed was not significant, even a significant increase was observed when ESM-RT-H was added. These results are in keeping with other works which have also shown increased expression of IL-1\\u0026alpha; and IL-6 after TNF inflammation (Por\\u0026eacute;e et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Yang et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). IL-1\\u0026alpha; and multifunctional cytokine IL-6 is hypothesized to play a role in the inflammatory processes associated with OA by inducing collagen degradation that leads to cartilage erosion and joint destruction, as well as by boosting the production of other pro-inflammatory cytokines such MMPs ( Scheller et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e\\n \\u003cp\\u003eOur results showed that MKARE\\u0026reg; strongly reduced the expression of pro inflammatory genes activity and increased specific genes of cartilage such as ACAN. In both assays, the greatest effect was observed when MKARE\\u0026reg;-H was added to the inflamed chondrocyte cultures.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec24\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.4. Placebo-controlled clinical study of MKARE\\u0026reg; effects on patients with knee osteoarthritis.\\u003c/h2\\u003e\\n \\u003cp\\u003eTo carry out the clinical study, subjects were recruited through various channel such as e-mail notification or in-person meetings. The age range of patients selected was 40\\u0026ndash;66 years, media of age: 51.4-year-old. 44% - male and 56% - female with osteoarthritic problems with symptoms of pain, stiffness or functionality problems in their daily life. Furthermore, applicants were excluded in case they reported known allergy to eggs or egg products, were pregnant or breastfeeding. All subjects gave written informed consent before data acquisition. Before enrolment subjects were instructed how and when to consume the product and how to use the online questionnaires. Throughout the study, support was available through both telephone and mail.\\u003c/p\\u003e\\n \\u003cp\\u003eAlthough there is growing popularity for these products, particularly in treating osteoarthritis, the scientific evidence regarding their effectiveness is mixed. Some studies in rats have shown positive results in reducing inflammatory cytokines and improving joint swelling when administering ESM (Kevin J. Ruff et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e; Sim et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Wedekind et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). However, it is important to note that these results in animals do not always directly translate to humans.\\u003c/p\\u003e\\n \\u003cp\\u003eIn the context of human studies, the findings are diverse. Certain studies have reported statistically significant improvements in pain relief and stiffness in patients who consumed ESM (K J Ruff et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e), but other studies have had high dropout rates or have not shown significant improvements in joint function or overall joint health (Kiers \\u0026amp; Bult, \\u003cspan class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Moreover, some studies have lacked a placebo control group, making it difficult to determine the true effectiveness of the supplement (Aguirre, \\u003cspan class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e).\\u003c/p\\u003e\\n \\u003cp\\u003eIn our study, of the 60 patients from the original ITT population (20 for MKARE\\u0026reg;, 20 for ESM-RT and 20 for placebo), 7 patients dropped out from the study due to various reasons, most commonly associated with lack of adherence to the treatment. Thus, the final total population evaluated was 53 (19 for MKARE\\u0026reg;, 16 for ESM-RT and 18 for placebo) with an overall drop-out rate of 11.7%.\\u003c/p\\u003e\\n \\u003cp\\u003eFirstly, the WOMAC baseline score was evaluated to verify randomization amongst the three groups via ANOVA, showing no significant differences between groups at p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e\\n \\u003cp\\u003ePost-baseline analyses, focused on the variation of the WOMAC scores throughout the study were carried out. The RM-ANOVA analysis of variance showed a significant overall improvement in patients treated with MKARE\\u0026reg;, and ESM-RT compared to day 0 in both 30 (MKARE\\u0026reg; mean improvement: 45.43%, p\\u0026thinsp;=\\u0026thinsp;0.002**; ESM-RT mean improvement: 37.38%, p\\u0026thinsp;=\\u0026thinsp;0.03*) and 60 days (MKARE\\u0026reg; mean improvement: 51.15%, p\\u0026thinsp;=\\u0026thinsp;0.003**; ESM-RT mean improvement: 32.61%, p\\u0026thinsp;=\\u0026thinsp;0.032*) timespans. No significant improvement over time was observed in the placebo group. Figure \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e, shows the individualized analysis for each sub score and treatment group, consolidating a higher significant improvement in the MKARE\\u0026reg; compared to ESM-RT group.\\u003c/p\\u003e\\n \\u003cp\\u003eThe NNT is a common approach in pharmacology to convey the real efficiency of a new treatment. This figure represents the number of patients needed to be treated to prevent one additional bad outcome (e.g. worsening of an illness). NNTs of 5 or below are normally regarded equivalent to an effective treatment to a pain related condition (Wen et al., \\u003cspan class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). In this study, the NNT value was calculated considering an absolute\\u0026thinsp;\\u0026ge;\\u0026thinsp;30% individual overall improvement from baseline as the clinically relevant outcome, and the placebo group as the control standard. Based on this criterion, the MKARE\\u0026reg; group showed an Absolute Risk Reduction (ARR) of 40.6% with an NNT value of 3 (95% CI, 1.4 to 8.9) at 30 days and an ARR of 40.1% with an NNT value of 3 (95% CI, 1.4 to 9.1) at 60 days. On the other hand, the ESM-RT group showed an ARR of 28.47% with an NNT value of 4 (95% CI; NNH 29 to infinity to NNB 1.7) at 30 days and an ARR of 11.10% with an NNT value of 9 (95% CI; NNH 4.5 to infinity to NNB 2.3).\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, MKARE\\u0026reg; emerges as a promising approach to address inflammation and stimulate chondrocyte regeneration in the context of OA. ESM freshness is a crucial factor; as the membrane ages, it undergoes biochemical changes that can compromise its therapeutic efficacy. The integrity and concentration of vital constituents are best maintained in fresh membranes, making them more effective in promoting joint health and alleviating osteoarticular symptoms. This emphasis on the freshness of the eggshell membrane opens a new perspective in natural osteoarticular therapies, highlighting the potential of utilizing fresh bio-sourced materials for clinical benefits.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of Competing Interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMLNG and PAR are currently employed by the sponsor of the study. VVS, ACS, EGC, MLG and YGR declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics Statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAuthors follow a code of ethics.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData will be made available on request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Fundación Leonesa Pro-neurociencias for its financial support.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eAguirre, A. (2016). International Journal of Clinical Rheumatology The effect of daily administration of 300 mg of ovomet\\u0026reg; for treatment of arthritis in elderly patients. \\u003cem\\u003eInternational Journal of Clinical Rheumatology\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(5), 77\\u0026ndash;81. https://www.openaccessjournals.com/articles/the-effect-of-daily-administration-of-300-mg-of-ovomet174-for-treatment-of-arthritis-in-elderly-patients.pdf\\u003c/li\\u003e\\n \\u003cli\\u003eAhlborn, G. J., Clare, D. A., Sheldon, B. W., \\u0026amp; Kelly, R. W. (2006). Identification of eggshell membrane proteins and purification of ovotransferrin and \\u0026beta;-NAGase from hen egg white. \\u003cem\\u003eProtein Journal\\u003c/em\\u003e, \\u003cem\\u003e25\\u003c/em\\u003e(1), 71\\u0026ndash;81. https://doi.org/10.1007/s10930-006-0010-8\\u003c/li\\u003e\\n \\u003cli\\u003eAhmed, T. A. E., Suso, H. P., \\u0026amp; Hincke, M. T. (2017). In-depth comparative analysis of the chicken eggshell membrane proteome. \\u003cem\\u003eJournal of Proteomics\\u003c/em\\u003e, \\u003cem\\u003e155\\u003c/em\\u003e, 49\\u0026ndash;62. https://doi.org/10.1016/j.jprot.2017.01.002\\u003c/li\\u003e\\n \\u003cli\\u003eAhmed, T. A. E., Suso, H. P., \\u0026amp; Hincke, M. T. (2019). Experimental datasets on processed eggshell membrane powder for wound healing.\\u0026nbsp;\\u003cem\\u003eData in Brief\\u003c/em\\u003e, \\u003cem\\u003e26\\u003c/em\\u003e, 104457. https://doi.org/10.1016/j.dib.2019.104457\\u003c/li\\u003e\\n \\u003cli\\u003eC\\u0026aacute;novas, F., Abell\\u0026aacute;n-Ru\\u0026iacute;z, M. S., Garc\\u0026iacute;a-Mu\\u0026ntilde;oz, A. M., Luque-Rubia, A. J., Victoria-Montesinos, D., P\\u0026eacute;rez-Pi\\u0026ntilde;ero, S., S\\u0026aacute;nchez-Macarro, M., \\u0026amp; L\\u0026oacute;pez-Rom\\u0026aacute;n, F. J. (2022).\\u0026nbsp;Randomised Clinical Trial to Analyse the Efficacy of Eggshell Membrane to Improve Joint Functionality in Knee Osteoarthritis.\\u0026nbsp;\\u003cem\\u003eNutrients\\u003c/em\\u003e, \\u003cem\\u003e14\\u003c/em\\u003e(11). https://doi.org/10.3390/nu14112340\\u003c/li\\u003e\\n \\u003cli\\u003eCarrillo, W., Spindola, H., Ramos, M., Recio, I., \\u0026amp; Carvalho, J. E. (2016).\\u0026nbsp;Anti-Inflammatory and Anti-Nociceptive Activities of Native and Modified Hen Egg \\u0026nbsp;White Lysozyme. \\u003cem\\u003eJournal of Medicinal Food\\u003c/em\\u003e, \\u003cem\\u003e19\\u003c/em\\u003e(10), 978\\u0026ndash;982. https://doi.org/10.1089/jmf.2015.0141\\u003c/li\\u003e\\n \\u003cli\\u003eChi, Y., Liu, R., Lin, M., \\u0026amp; Chi, Y. (2022). A novel process to separate the eggshell membranes and eggshells via flash evaporation. \\u003cem\\u003eFood Science and Technology (Brazil)\\u003c/em\\u003e, \\u003cem\\u003e42\\u003c/em\\u003e. https://doi.org/10.1590/fst.07522\\u003c/li\\u003e\\n \\u003cli\\u003eCordeiro, C. M. M., Esmaili, H., Ansah, G., \\u0026amp; Hincke, M. T. (2013). Ovocalyxin-36 is a pattern recognition protein in chicken eggshell membranes. \\u003cem\\u003ePLoS ONE\\u003c/em\\u003e, \\u003cem\\u003e8\\u003c/em\\u003e(12), 1\\u0026ndash;13. https://doi.org/10.1371/journal.pone.0084112\\u003c/li\\u003e\\n \\u003cli\\u003eDar, Q. A., Schott, E. M., Catheline, S. E., Maynard, R. D., Liu, Z., Kamal, F., Farnsworth, C. W., Ketz, J. P., Mooney, R. A., Hilton, M. J., Jonason, J. H., Prawitt, J., \\u0026amp; Zuscik, M. J. (2017). Daily oral consumption of hydrolyzed type 1 collagen is chondroprotective and antiinflammatory in murine posttraumatic osteoarthritis. \\u003cem\\u003ePLoS ONE\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(4). https://doi.org/10.1371/JOURNAL.PONE.0174705\\u003c/li\\u003e\\n \\u003cli\\u003eDudhia, J. (2005). Aggrecan, aging and assembly in articular cartilage. \\u003cem\\u003eCellular and Molecular Life Sciences\\u003c/em\\u003e, \\u003cem\\u003e62\\u003c/em\\u003e(19\\u0026ndash;20), 2241\\u0026ndash;2256. https://doi.org/10.1007/s00018-005-5217-x\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eEggshell Membrane Market Size, Share, Growth 2024-2032\\u003c/em\\u003e. (n.d.). Retrieved December 17, 2023, from https://www.expertmarketresearch.com/reports/eggshell-membrane-market\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eEggshell Membrane Market Size | Industry Report, 2021-2028\\u003c/em\\u003e. (n.d.). Retrieved December 17, 2023, from https://www.grandviewresearch.com/industry-analysis/eggshell-membranes-market\\u003c/li\\u003e\\n \\u003cli\\u003eFernandes, J. C., Martel-Pelletier, J., \\u0026amp; Pelletier, J.-P. (2002a).\\u0026nbsp;The role of cytokines in osteoarthritis pathophysiology. \\u003cem\\u003eBiorheology\\u003c/em\\u003e, \\u003cem\\u003e39\\u003c/em\\u003e(1\\u0026ndash;2), 237\\u0026ndash;246.\\u003c/li\\u003e\\n \\u003cli\\u003eFernandes, J. C., Martel-Pelletier, J., \\u0026amp; Pelletier, J.-P. (2002b). The role of cytokines in osteoarthritis pathophysiology. \\u003cem\\u003eBiorheology\\u003c/em\\u003e, \\u003cem\\u003e39\\u003c/em\\u003e(1\\u0026ndash;2), 237\\u0026ndash;246. http://www.ncbi.nlm.nih.gov/pubmed/12082286\\u003c/li\\u003e\\n \\u003cli\\u003eFurukawa, K., Kono, M., Kataoka, T., Hasebe, Y., Jia, H., \\u0026amp; Kato, H. (2021). Effects of eggshell membrane on keratinocyte differentiation and skin aging in vitro and in vivo.\\u0026nbsp;\\u003cem\\u003eNutrients\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(7). https://doi.org/10.3390/nu13072144\\u003c/li\\u003e\\n \\u003cli\\u003eHan, C., Chen, Y., Shi, L., Chen, H., Li, L., Ning, Z., Zeng, D., \\u0026amp; Wang, D. (2023).\\u0026nbsp;Advances in eggshell membrane separation and solubilization technologies. \\u003cem\\u003eFrontiers in Veterinary Science\\u003c/em\\u003e, \\u003cem\\u003e10\\u003c/em\\u003e(11). https://doi.org/10.3389/fvets.2023.1116126\\u003c/li\\u003e\\n \\u003cli\\u003eJ. Gautron M. T. Hincke, M. P. J. M. G.-R. T. B., \\u0026amp; Nys, Y. (2001). Ovotransferrin is a Matrix Protein of the Hen Eggshell Membranes and Basal Calcified Layer. \\u003cem\\u003eConnective Tissue Research\\u003c/em\\u003e, \\u003cem\\u003e42\\u003c/em\\u003e(4), 255\\u0026ndash;267. https://doi.org/10.3109/03008200109016840\\u003c/li\\u003e\\n \\u003cli\\u003eKaweewong, K., Garnjanagoonchorn, W., Jirapakkul, W., \\u0026amp; Roytrakul, S. (2013). Solubilization and identification of hen eggshell membrane proteins during different times of chicken embryo development using the proteomic approach. \\u003cem\\u003eProtein Journal\\u003c/em\\u003e, \\u003cem\\u003e32\\u003c/em\\u003e(4), 297\\u0026ndash;308. https://doi.org/10.1007/s10930-013-9487-0\\u003c/li\\u003e\\n \\u003cli\\u003eKiers, J. L., \\u0026amp; Bult, J. H. F. (2021). Mildly Processed Natural Eggshell Membrane Alleviates Joint Pain Associated with Osteoarthritis of the Knee: A Randomized Double-Blind Placebo-Controlled Study. \\u003cem\\u003eJournal of Medicinal Food\\u003c/em\\u003e, \\u003cem\\u003e24\\u003c/em\\u003e(3), 292\\u0026ndash;298. https://doi.org/10.1089/jmf.2020.0034\\u003c/li\\u003e\\n \\u003cli\\u003eLi, G., Cheng, T., \\u0026amp; Yu, X. (2021). The Impact of Trace Elements on Osteoarthritis. \\u003cem\\u003eFrontiers in Medicine\\u003c/em\\u003e, \\u003cem\\u003e8\\u003c/em\\u003e(December), 1\\u0026ndash;13. https://doi.org/10.3389/fmed.2021.771297\\u003c/li\\u003e\\n \\u003cli\\u003eMatsuoka, R., Kurihara, H., Yukawa, H., \\u0026amp; Sasahara, R. (2019). Eggshell membrane protein can be absorbed and utilised in the bodies of rats. \\u003cem\\u003eBMC Research Notes\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(1). https://doi.org/10.1186/s13104-019-4306-0\\u003c/li\\u003e\\n \\u003cli\\u003eMine, Y., Guyonnet, V., Hatta, H., Nau, F., \\u0026amp; Qiu, N. (2023). \\u003cem\\u003eHandbook of Egg Science and Technology\\u003c/em\\u003e. CRC Press. https://doi.org/10.1201/9781003254430\\u003c/li\\u003e\\n \\u003cli\\u003eMonfort, J., Pelletier, J.-P., Garcia-Giralt, N., \\u0026amp; Martel-Pelletier, J. (2008). Biochemical basis of the effect of chondroitin sulphate on osteoarthritis articular tissues. \\u003cem\\u003eAnnals of the Rheumatic Diseases\\u003c/em\\u003e, \\u003cem\\u003e67\\u003c/em\\u003e(6), 735\\u0026ndash;740. https://doi.org/10.1136/ard.2006.068882\\u003c/li\\u003e\\n \\u003cli\\u003eNielsen, P. M., Petersen, D., \\u0026amp; Dambmann, C. (2001). Improved method for determining food protein degree of hydrolysis. \\u003cem\\u003eJournal of Food Science\\u003c/em\\u003e, \\u003cem\\u003e66\\u003c/em\\u003e(5), 642\\u0026ndash;646. https://doi.org/10.1111/j.1365-2621.2001.tb04614.x\\u003c/li\\u003e\\n \\u003cli\\u003ePor\\u0026eacute;e, B., Kypriotou, M., Chadjichristos, C., Beauchef, G., Renard, E., Legendre, F., Melin, M., Gueret, S., Hartmann, D. J., Mall\\u0026eacute;in-Gerin, F., Pujol, J. P., Boumediene, K., \\u0026amp; Gal\\u0026eacute;ra, P. (2008). Interleukin-6 (IL-6) and/or soluble IL-6 receptor down-regulation of human type II collagen gene expression in articular chondrocytes requires a decrease of Sp1.Sp3 ratio and of the binding activity of both factors to the COL2A1 promoter. \\u003cem\\u003eThe Journal of Biological Chemistry\\u003c/em\\u003e, \\u003cem\\u003e283\\u003c/em\\u003e(8), 4850\\u0026ndash;4865. https://doi.org/10.1074/JBC.M706387200\\u003c/li\\u003e\\n \\u003cli\\u003eQosimah, D., Oktafian, N., Wisang, S., Hutasuhut, F. I., Melati, I., \\u0026amp; Priani, F. O. (2016). Glucosamine in the egg shells and goat fats as therapy for osteoarthritis rat model. \\u003cem\\u003eInternational Journal of PharmTech Research\\u003c/em\\u003e, \\u003cem\\u003e9\\u003c/em\\u003e(7), 122\\u0026ndash;129.\\u003c/li\\u003e\\n \\u003cli\\u003eRath, N. C., Liyanage, R., Makkar, S. K., \\u0026amp; Lay, J. O. (2017). Protein profiles of hatchery egg shell membrane. \\u003cem\\u003eProteome Science\\u003c/em\\u003e, \\u003cem\\u003e15\\u003c/em\\u003e(1), 1\\u0026ndash;9. https://doi.org/10.1186/s12953-017-0112-6\\u003c/li\\u003e\\n \\u003cli\\u003eRuff, K J, Winkler, A., Jackson, R. W., DeVore, D. P., \\u0026amp; Ritz, B. W. (2009). Eggshell membrane in the treatment of pain and stiffness from osteoarthritis of the knee: a randomized, multicenter, double-blind, placebo-controlled clinical study. \\u003cem\\u003eClinical Rheumatology\\u003c/em\\u003e, \\u003cem\\u003e28\\u003c/em\\u003e(8), 907\\u0026ndash;914. https://doi.org/10.1007/s10067-009-1173-4 [doi]\\u003c/li\\u003e\\n \\u003cli\\u003eRuff, Kevin J., Morrison, D., Duncan, S. A., Back, M., Aydogan, C., \\u0026amp; Theodosakis, J. (2018). Beneficial effects of natural eggshell membrane versus placebo in exercise-induced joint pain, stiffness, and cartilage turnover in healthy, postmenopausal women. \\u003cem\\u003eClinical Interventions in Aging\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e, 285\\u0026ndash;295. https://doi.org/10.2147/CIA.S153782\\u003c/li\\u003e\\n \\u003cli\\u003eScheller, A. C., Schmidt-Arras, D. \\u0026amp; Rose-John, S. (2011).\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eThe pro- and anti-inflammatory properties of the cytokine interleukin-6. \\u003cem\\u003eBiochim Biophys Acta\\u003c/em\\u003e. \\u0026nbsp;May;1813(5):878-88. https://doi.org/10.1016/j.bbamcr.2011.01.034\\u003c/li\\u003e\\n \\u003cli\\u003eSim, B. Y., Bak, J. W., Lee, H. J., Jun, J. A., Choi, H. J., Kwon, C. J., Kim, H. Y., Ruff, K. J., Brandt, K., \\u0026amp; Kim, D. H. (2015). Erratum: Effects of natural eggshell membrane (NEM) on monosodium iodoacetate-induced arthritisin rats (Journal of Nutrition and Health (2015) 48:4 (364-370)). \\u003cem\\u003eJournal of Nutrition and Health\\u003c/em\\u003e, \\u003cem\\u003e48\\u003c/em\\u003e(5), 457\\u0026ndash;458. https://doi.org/10.4163/jnh.2015.48.5.457\\u003c/li\\u003e\\n \\u003cli\\u003eVarelis, P. (2016). Food Chemistry and Analysis. In \\u003cem\\u003eReference Module in Food Science\\u003c/em\\u003e. Elsevier. https://doi.org/https://doi.org/10.1016/B978-0-08-100596-5.03341-2\\u003c/li\\u003e\\n \\u003cli\\u003eVuong, T. T., R\\u0026oslash;nning, S. B., Ahmed, T. A. E., Brathagen, K., H\\u0026oslash;st, V., Hincke, M. T., Suso, H. P., \\u0026amp; Pedersen, M. E. (2018). Processed eggshell membrane powder regulates cellular functions and increase MMP-activity important in early wound healing processes. \\u003cem\\u003ePLoS ONE\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(8), 1\\u0026ndash;23. https://doi.org/10.1371/journal.pone.0201975\\u003c/li\\u003e\\n \\u003cli\\u003eWedekind, K. J., Ruff, K. J., Atwell, C. A., Evans, J. L., \\u0026amp; Bendele, A. M. (2017). Beneficial effects of natural eggshell membrane (NEM) on multiple indices of arthritis in collagen-induced arthritic rats. \\u003cem\\u003eModern Rheumatology\\u003c/em\\u003e, \\u003cem\\u003e27\\u003c/em\\u003e(5), 838\\u0026ndash;848. https://doi.org/10.1080/14397595.2016.1259729\\u003c/li\\u003e\\n \\u003cli\\u003eWen, L., Badgett, R., \\u0026amp; Cornell, J. (2005). Number needed to treat: A descriptor for weighing therapeutic options. \\u003cem\\u003eAmerican Journal of Health-System Pharmacy : AJHP : Official Journal of the American Society of Health-System Pharmacists\\u003c/em\\u003e, \\u003cem\\u003e62\\u003c/em\\u003e, 2031\\u0026ndash;2036. https://doi.org/10.2146/ajhp040558\\u003c/li\\u003e\\n \\u003cli\\u003eWojdasiewicz, P., Poniatowski, Ł. A., \\u0026amp; Szukiewicz, D. (2014). The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. \\u003cem\\u003eMediators of Inflammation\\u003c/em\\u003e, \\u003cem\\u003e2014\\u003c/em\\u003e, 1\\u0026ndash;19. https://doi.org/10.1155/2014/561459\\u003c/li\\u003e\\n \\u003cli\\u003eWu, J., \\u0026amp; Acero-Lopez, A. (2012). Ovotransferrin: Structure, bioactivities, and preparation. \\u003cem\\u003eFood Research International\\u003c/em\\u003e, \\u003cem\\u003e46\\u003c/em\\u003e(2), 480\\u0026ndash;487. https://doi.org/10.1016/j.foodres.2011.07.012\\u003c/li\\u003e\\n \\u003cli\\u003eY. Nys J. Gautron, M. D. M. J. M. G.-R., \\u0026amp; Hincke, M. T. (2001). Biochemical and functional characterisation of eggshell matrix proteins in hens. \\u003cem\\u003eWorld\\u0026rsquo;s Poultry Science Journal\\u003c/em\\u003e, \\u003cem\\u003e57\\u003c/em\\u003e(4), 401\\u0026ndash;413. https://doi.org/10.1079/WPS20010029\\u003c/li\\u003e\\n \\u003cli\\u003eYang, Y., Gao, S.-G., Zhang, F.-J., Luo, W., Xue, J.-X., \\u0026amp; Lei, G.-H. (2014). Effects of osteopontin on the expression of IL-6 and IL-8 inflammatory factors in human knee osteoarthritis chondrocytes. \\u003cem\\u003eEuropean Review for Medical and Pharmacological Sciences\\u003c/em\\u003e, \\u003cem\\u003e18\\u003c/em\\u003e(23), 3580\\u0026ndash;3586. http://www.ncbi.nlm.nih.gov/pubmed/25535126\\u003cstrong\\u003e\\u003c/strong\\u003e\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Eggshell, Eggshell membrane, osteoarthritis, pain, chondrocytes\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3875703/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3875703/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMKARE\\u0026reg;, a 100% natural ingredient derived from fresh eggshell membrane (ESM), has a rich composition in bioactive compounds like collagen, hyaluronic acid, and elastin. These components are beneficial for managing osteoarthritis (OA) due to their anti-inflammatory and regenerative properties. Highlighting the significance of freshness, our research has shown that the effectiveness of MKARE\\u0026reg; is higher than that of other commercial products based on ESM that have been stored for several days at room temperature, losing their bioactive compounds. This study explores the MKARE\\u0026reg; anti-inflammatory capacity through an in vitro and clinical analyses, demonstrating its ability to alleviate OA symptoms and improve joint health. This underscores the crucial role of freshness in optimizing the therapeutic benefits.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Anti-inflammatory and regenerative effects of MKARE® Eggshell Membrane: an in vitro osteoarthritis model and placebo-controlled clinical study.\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-01-19 08:44:44\",\"doi\":\"10.21203/rs.3.rs-3875703/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"da5eed38-054c-4cb5-900d-deb2d395ee98\",\"owner\":[],\"postedDate\":\"January 19th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":28221794,\"name\":\"Food Science \\u0026 Technology\"}],\"tags\":[],\"updatedAt\":\"2024-03-21T02:25:45+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-3875703\",\"link\":\"https://doi.org/10.1016/j.jff.2024.106119\",\"journal\":{\"identity\":\"journal-of-functional-foods\",\"isVorOnly\":true,\"title\":\"Journal of Functional Foods\"},\"publishedOn\":\"2024-05-01 02:25:45\",\"publishedOnDateReadable\":\"May 1st, 2024\"},\"versionCreatedAt\":\"2024-01-19 08:44:44\",\"video\":\"\",\"vorDoi\":\"10.1016/j.jff.2024.106119\",\"vorDoiUrl\":\"https://doi.org/10.1016/j.jff.2024.106119\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3875703\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3875703\",\"identity\":\"rs-3875703\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}