{"paper_id":"7824606d-2106-40ce-a5ab-543df5d48540","body_text":"Clinical and Experimental Obstetrics & Gynecology (CEOG) is published by IMR Press from Volume 47 Issue 1 (2020). Previous articles were published by another publisher on a subscription basis, and they are hosted by IMR Press on imrpress.com as a courtesy and upon agreement with S.O.G.\n1 Department of Obstetrics and Gynecology, College of Medicine, Soonchunhyang University Bucheon Hospital, Bucheon, Republic of Korea\n2 Institute of Tissue Regeneration Engineering (ITREN), Dankook University, Cheonan, Republic of Korea\n3 Department of Chemistry, School of Natural Science, Dankook University, Cheonan, Republic of Korea\n4 Department of Interdisciplinary Program in Biomedical Science, Soonchunhyang University Graduate School, Asan, Republic of Korea\n5 Department of Biomedical Engineering, College of Medicine, Korea University, Seoul, Republic of Korea\n†Contributed equally.\nAbstract\nObjectives: Vitamin D and vitamin D receptor (VDR) are closely associated with both various immune system functions and estrogen-related pathways. The authors hypothesized that VDR genetic polymorphisms are associated with endometriosis risk. In this casecontrol study, the authors investigated the associations between polymorphisms in the VDR gene (FokI, BsmI, ApaI, and TaqI) and endometriosis risk. Materials and Methods: This case-control study included 30 women with endometriosis and 30 women without endometriosis. Genotyping of VDR polymorphisms was conducted using polymerase chain reaction and DNA sequencing. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated to assess the association between the four VDR polymorphisms and endometriosis risk using Fisher’s exact test. Results: The four VDR genetic polymorphisms showed no significant associations with endometriosis risk. Similarly, a combination analysis indicated that no combinations of polymorphisms were associated with endometriosis risk. However, the present analysis combining three polymorphisms revealed very low ORs (CGGT: 0.536, TGTT: 0.250, and CGTT: 0.321). Conclusion: The present results suggest that VDR polymorphisms do not affect endometriosis risk in Korean women. However, the genotype frequencies of ApaI and TaqI differed between endometriosis patients and controls. Therefore, it is necessary to further validate the relationship between VDR polymorphisms and endometriosis risk in large-scale samples.\nKeywords\n- Vitamin D receptor\n- Polymorphism\n- Endometriosis\nEndometriosis is defined as the existence of endometriallike (gland and stroma) tissue outside the uterus, and is predominantly detected in women of reproductive age [1]. The symptoms include dysmenorrhea, chronic pelvic pain, deep dyspareunia, and infertility [2, 3]. The suppression of estrogen levels inhibits lesions, whereas the recovery of estrogen levels results in a relapse [4]. Several familial studies have reported that a family history of endometriosis is closely associated with endometriosis risk [5, 6]. Furthermore, chromatid breakage in lymphocytes is associated with the development of endometriosis [7]. This evidence suggests that endometriosis is associated not only with estrogen levels but also with genetic factors. On the other hand, the results of various studies have indicated that natural killer cells, macrophages, and cytokines may be involved in the pathogenesis of endometriosis. This suggests that endometriosis can be considered an autoimmune disorder [8]. Vitamin D plays a role in the regulation of calcium and phosphate transport and in bone mineralization [9]. Furthermore, it is associated with the regulation of cell proliferation, differentiation, and apoptosis [10-12].\nVitamin D regulates the transcription of target genes by binding to vitamin D receptor (VDR), which is involved in diverse systems, including the endocrine system, insulinlike growth factor (IGF) signaling, estrogen-related pathways, and the regulation of vitamin D [13]. Vitamin D and VDR are found in various cells of the immune system. The presence of vitamin D and VDR in peripheral T cells affects the development and function of T cells. Experimental evidence suggests that autoimmune diseases such as inflammatory bowel disease and multiple sclerosis are linked by vitamin D status and VDR signaling [14, 15]. In addition, Liel et al. [16] reported that estradiol 17-β (E2) regulates vitamin D activity in osteoblast-like cells. Estrogen increases calcium absorption in women with postmenopausal osteoporosis by increasing serum vitamin D levels [17]. This suggests that vitamin D and VDR are closely associated with various immune system functions and estrogen-related pathways. The VDR gene, located on chromosome 12 (12q14), consists of two promoter regions, six untranslated exon regions (exons 1a-1f), and eight coding exons (exons 2-9) [18, 19]. Molecular-based epidemiological studies have identified single nucleotide polymorphisms (SNPs) in the VDR gene, including Cdx-2 between exons 1f and 1e, FokI in exon 2, BsmI and ApaI (rs7975232) in intron 8, and TaqI (rs731236) in exon 9 [20, 21]. These polymorphisms may affect VDR function and expression in target cells [22-24]. Based on this evidence, the authors hypothesized that the polymorphisms of the VDR gene are associated with endometriosis risk. In this case-control study, the authors investigated the association between VDR genetic polymorphisms (FokI, BsmI, ApaI, and TaqI) and endometriosis risk.\nIn this case-control study, the authors enrolled patients undergoing oophorectomy, ovarian cystectomy, or salpingo-oophorectomy at Soonchunhyang University Bucheon Hospital. All women who participated in this case-control study were Korean nationals of Asian descent and were recruited between 2011 and 2013. The Soonchunhyang University Bucheon Hospital Institutional Review Board approved the study. Full informed consent was obtained from the patients prior to the study. Background information on each patient such as age, body weight, height, coexisting diseases, and drug prescriptions was obtained from the hospital information system. The authors collected 60 samples (15 paraffin-embedded tissues and 45 solid tissues) from 30 women with endometriosis and 30 women without endometriosis. For the endometriosis cases, the clinical stages of endometriosis were assessed according to the revised American Fertility Society classification system, and were graded as minimal (Stage I), mild (Stage II), moderate (Stage III), and severe (Stage IV).\nGenomic DNA was isolated from paraffin-embedded tissues and solid tissues.\nFor paraffin-embedded tissues, a small section (about 20 mg) was placed in a 1.5-mL tube and 1,000 µL of xylene was added, then the tube was vortexed for 30 seconds. All mixtures were centrifuged at 12,000 × g for five minutes at room temperature. The supernatant was removed by pipetting, and 1,000 µL of ethanol was added to the pellet to remove residual xylene. The mixtures were then centrifuged at 13,000 × g for five minute at room temperature.\nThe ethanol was carefully removed by pipetting, and then the tubes were dried at 37℃ for 15 minute. Solid tissues were homogenized to powder in liquid nitrogen using a clean pestle, and then the powdered tissues were transferred to fresh 1.5-mL tubes using a clean spatula.\nLysis buffer (400 μL, 50 mM Tris-HCl, pH 8.0, 50 mM EDTA, pH 8.0, and 100 mM NaCl) and 40 µL of proteinase K were added to the tissues. The tubes were incubated at 60℃ until all tissue fragments were completely dissolved. Phenol-chloroform isoamyl alcohol (440 μL) was added, and the mixtures were centrifuged at 12,000 × g for five minute at room temperature. The supernatants were then transferred to fresh 1.5-mL tubes by pipetting, and 30 µL of 2 M sodium acetate and 900 µL of cold 100% ethanol were added and the tubes were incubated at -20℃ for 30 minutes. The supernatant was discarded, and the pellet was washed with 75% ethanol. The tubes were dried at 50℃ for three hour. DNA was eluted with 50 µL of 10 mM Tris-HCl (pH 8.0) and stored at -20℃ until it was used for genotyping.\nPolymerase chain reaction (PCR) amplification of the four polymorphic sites (FokI, BsmI, ApaI, and TaqI) was performed in 25-μL reactions consisting of 1 μmol/L of each primer, 1 U of Taq polymerase, 10 mmol dNTPs, and 10× PCR buffer (Table 1). The PCR conditions were 94℃ for five minutes followed by 35 cycles of 94℃ for 30 seconds, 60℃ for 30 seconds, and 72℃ for 45 seconds, with a final incubation at 72℃ for five minutes. After amplification, we performed DNA sequencing (Table 2).\n| SNP | Sequence (5’-3’) | Tm (℃) | GC (%) | Restriction enzymes | Allele | Fragments (bp) | |\n|---|---|---|---|---|---|---|---|\n| FokI | F | GGTGGGTGGCACCAAGGATG | 61.2 | 65 | FokI | T | 31/62/92 |\n| R | GTGAAAGCCAGTGGCTCGGTC | 60.8 | 61.9 | C | 31/154 | ||\n| BsmI | F | CTGCCCTTAGCTCTGCCTTG | 58.2 | 60 | BsmI | G | 99/246 |\n| R | CATCACCGACATCATGTCCCC | 57.9 | 57.1 | A | 345 | ||\n| ApaI (rs7975232) | F | GGAAGGACCTAGGTCTGGATCC | 58.3 | 59.1 | ApaI | G | 161/533 |\n| R | CAGCAACTCCTCATGGCTGAG | 58 | 57.1 | T | 694 | ||\n| TaqI (rs731236) | F | GTGTTGCCAGGAATGGCCTT | 58.5 | 55 | TaqI | T | 655 |\n| R | CACAAGGGGCGTTAGCTTCATG | 58.6 | 54.5 | C | 198/457 |\nM: 100 bp DNA ladder, lane 1: GG allele of ApaI, lane 2: GT allele of ApaI, lane 3: TT allele of ApaI, lane 4: TT allele of TaqI, lane 5: TC allele of TaqI. The GG allele of ApaI is identified by the presence of a 161 bp and 533 bp bands and the TT allele of ApaI by the presence of a 694 bp band. The TT allele of TaqI is identified by the presence of a 655 bp band and the CC allele of TaqI by the presence of a 198 bp and 457 bp bands.\nAll statistical analyses were performed using GraphPad InStat. The Chi-squared test was used to determine if the identified study conformed to Hardy-Weinberg equilibrium (HWE) for the genotype distribution in the control group. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated to assess the association between the four VDR genetic polymorphisms and endometriosis risk using Fisher’s exact test. All p-values were considered significant at < 0.05.\nThe associations between the polymorphisms (FokI, BsmI, ApaI, and TaqI) of the VDR gene and endometriosis risk are summarized in Table 3. The genotype frequencies of the controls did not deviate from HWE. The present results show that the four polymorphisms were not significantly associated with endometriosis risk. For the FokI polymorphism, the ORs for the TC and CC alleles were 0.831 and 0.933, respectively (95% CI: 0.193, 3.578; 0.199, 4.373; p = 1.000; 1.000). For the BsmI polymorphism, the authors did not find the AA (homozygous) allele in cases or controls. The GA allele of the BsmI polymorphism had a high OR. However, the GA allele was not significantly associated with endometriosis risk (OR: 2.842, 95% CI: 0.240, 33.66; p = 0.569). Similarly, the authors did not find the CC (homozygous) allele of TaqI in cases or controls. Additionally, the TC allele of the TaqI polymorphism not associated with endometriosis risk (OR: 3.222, 95% CI: 0.316, 32.91; p = 0.612). However, they found that the genotype frequencies of the TaqI polymorphism differed between women with endometriosis and controls. The TT/TC/CC ratios in women with endometriosis and without endometriosis were 90/10/0% and 96.7/3.3/0%, respectively. For the ApaI polymorphism, the GT and TT alleles showed no relationship with endometriosis risk. However, the TT (homozygous) allele of the ApaI polymorphism had a very low OR (OR: 0.452, 95% CI: 0.074, 2.758; p = 0.665). The proportions of the ApaI polymorphism genotypes (GG/GT/TT) in women with endometriosis and without endometriosis were 70.0/23.3/ 6.7% and 63.3/ 23.3/13.3%, respectively. The authors then assessed the associations between combinations of the four polymorphisms (FokI-BsmI-ApaI-TaqI) and endometriosis risk (Table 4). The results showed that three combinations had low ORs (CGGT: 0.536; TGTG: 0.250; CGTT: 0.321). However, three combinations were not significantly associated with endometriosis risk.\n| FokI (T>C) | Case (n=21) | Control (n=28) | OR (95% CI) | p-value | HWE in control |\n|---|---|---|---|---|---|\n| TT | 5 | 6 | 1 | ||\n| TC | 9 | 13 | 0.831 (0.193-3.578) | 1.000 | |\n| CC | 7 | 9 | 0.933 (0.199-4.373) | 1.000 | |\n| T allele | 19 | 25 | 1 | ||\n| C allele | 23 | 31 | 0.976 (0.437-2.182) | 1.000 | p-value: 0.748 |\n| BsmI (G>A) | Case (n=21) | Control (n=28) | OR (95% CI) | p-value | HWE in control |\n| GG | 19 | 27 | 1 | ||\n| GA | 2 | 1 | 2.842 (0.240-33.66) | 0.569 | |\n| AA | 0 | 0 | |||\n| G allele | 40 | 55 | 1 | ||\n| A allele | 2 | 1 | 2.750 (0.241-31.41) | 0.575 | p-value: 0.923 |\n| ApaI (G>T) | Case (n=30) | Control (n=30) | OR (95% CI) | p-value | HWE in control |\n| GG | 21 | 19 | 1 | ||\n| GT | I7 | 7 | 0.905 (0.268-3.058) | 1.000 | |\n| TT | 2 | 4 | 0.452 (0.074-2.758) | 0.665 | |\n| G allele | 49 | 45 | 1 | ||\n| T allele | 11 | 15 | 0.674 (0.280-1.619) | 0.507 | p-value: 0.038 |\n| TaqI (T>C) | Case (n=30) | Control (n=30) | OR (95% CI) | p-value | HWE in control |\n| TT | 27 | 29 | 1 | ||\n| TC | 3 | 1 | 3.222 (0.316-32.91) | 0.612 | |\n| CC | 0 | 0 | |||\n| T allele | 57 | 59 | 1 | ||\n| C allele | 3 | 1 | 3.105 (0.314-30.75) | 0.619 | p-value: 0.926 |\nStatistically significant for p < 0.05.\n| Combinations | Case (n=21) | Control (n=28) | OR (95% CI) | p-value |\n|---|---|---|---|---|\n| T-G-G-T | 4 | 3 | 1.000 | |\n| C-G-G-T | 10 | 14 | 0.536 (0.098-2.942) | 0.671 |\n| T-G-T-T | 1 | 3 | 0.250 (0.017-3.773) | 0.546 |\n| C-G-T-T | 3 | 7 | 0.321 (0.043-2.418) | 0.350 |\n| C-G-T-C | 1 | 0 | - | - |\n| C-A-T-C | 2 | 1 | 1.500 (0.089-25.41) | 1.000 |\nStatistically significant for p < 0.05.\nSNPs are genetic variants that can occur in both coding sequences (exons) and non-coding sequences (introns). If they occur in regulatory regions, including 5′ untranslated regions (UTRs) or 3′ UTRs, they may affect mRNA expression and mRNA stability. If they occur in coding sequences, SNPs affect amino acid sequences, which may affect protein function [3]. Identifying SNPs associated with disease susceptibility may provide biomarkers for early diagnosis and disease prevention.\nEndometriosis is an estrogen-related disease, as the survival and growth of endometriosis tissues is dependent on estrogen levels. In addition, endometriotic implants generate cytokines. Cytokines have been implicated in altering immune system functions, including the activities of T cells, natural killer cells, and B cells [25]. Many epidemiological studies have investigated the associations between polymorphisms of numerous genes related to the pathophysiology of endometriosis and endometriosis risk. In particular, many researchers have investigated the relationship between polymorphisms in estrogen receptor genes and endometriosis risk. Among these studies, several reports have suggested that polymorphisms in estrogen receptor genes were highly associated with endometriosis risk [17, 26-29]. However, this finding is not consistent with those from other studies [30-33]. Similarly, the associations between polymorphisms in interleukin genes and endometriosis risk have been investigated. Interleukins are a group of cytokines. The activity of the immune system depends in a large part on interleukins, and they are also associated with autoimmune diseases. Furthermore, several studies have reported that serum interleukin-10 levels were significantly elevated in endometriosis patients [34, 35], and epidemiological studies indicated that interleukin-10 genetic polymorphisms were associated with endometriosis risk [36, 37]. However, not all previous studies produced corroborative results. Vitamin D is associated with estradiol responses and various immune system functions. Furthermore, vitamin D is associated with autoimmune disease [38]. Based on these observations, Vilarino et al. [39] examined the relationship between four polymorphisms of the VDR gene and endometriosis risk in Brazilian women. Their results suggested that the four VDR polymorphisms were not associated with endometriosis risk in Brazilian women. Ultimately, the associations between the polymorphisms of many different genes and endometriosis risk have been investigated, but the relationships between polymorphisms and endometriosis risk remain unclear. In this case-control study, the authors investigated four genetic polymorphisms of VDR and endometriosis risk in Korean women. The present authors’ conclusion is that there were no significant associations between the four VDR polymorphisms and endometriosis risk in Korean women. However, they found that the genotype frequencies differed between women with endometriosis and those without endometriosis (TT allele of ApaI and TC allele of TaqI). There are two limitations in this case-control study. The first limitation is the relatively small sample size of cases and controls. This limitation decreased the statistical power to determine the association between two VDR polymorphisms and endometriosis risk. Second, this case-control study did not consider gene-environment interaction factors such as vitamin D levels, menstrual status, age, smoking status, alcohol status, and disease stage, which may alter the associations between VDR polymorphisms and endometriosis risk. Further analysis with a larger sample size may confirm the relationships between the four polymorphisms (FokI, BsmI, ApaI, and TaqI) of the VDR gene and endometriosis risk. Additionally, the authors evaluated the associations between other VDR polymorphisms and endometriosis risk in Korean women.\nThis research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2015R1D1A3A01018104).","source_license":"CC0","license_restricted":false}