{"paper_id":"6e5c6386-ed8d-4198-af4c-4ba94ea39ec6","body_text":"1\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\nwww.nature.com/scientificreports\nOocyte quality is decreased in \nwomen with minimal or mild \nendometriosis\nBo Xu1, Nan Guo1, Xiao-min Zhang1, Wei Shi1, Xian-hong Tong1, Furhan Iqbal2 & Yu-\nsheng Liu1\nEndometriosis, a pathological condition in which the endometrium grows outside the uterus, is \none of the most common causes of female infertility; it is diagnosed in 25–40% of infertile women. \nThe mechanism by which endometriosis affects the fertility of females remains largely unknown. \nWe examined the ultrastructure of oocytes from patients with minimal or mild endometriosis and \ncontrol females undergoing in vitro fertilization (IVF) treatment by transmission electron microscopy \n(TEM) to investigate the physiological significance of oocyte quality for patients with minimal \nor mild endometriosis. The TEM results revealed that the oocytes from women with minimal or \nmild endometriosis exhibited abnormal mitochondrial structure and decreased mitochondria \nmass. Quantitative real time PCR analysis revealed that the mitochondrial DNA copy number was \nsignificantly reduced in the oocytes from women with minimal or mild endometriosis compared \nwith those of the control subjects. Our results suggest that decreased oocyte quality because of \nimpaired mitochondrial structure and functions probably an important factor affecting the fertility of \nendometriosis patients.\nEndometriosis is a disorder of the female reproductive system in which the endometrium (uterine lining) \ngrows outside the uterus; it is most commonly occurs on the ovaries and peritoneum, and it causes pre-\nmenstrual pain and dysmenorrhea 1–3. The main symptoms of the disease are pelvic pain, dysmenorrhea \nand dyspareunia1. Endometriosis is one of the most common causes of infertility and is diagnosed in \n25–40% of infertile women, although the mechanisms by which endometriosis impairs fertility remain \nlargely unknown\n2. The evidence-based therapies for endometriosis include medical and surgical treat-\nments1,2. Therapeutic laparoscopy and assisted reproductive techniques are the preferred approach for \ntreating infertile patients with advanced endometriosis2. In recent years, a substantial number of patients \nwith endometriosis have undergone in vitro  fertilization (IVF) because the technology of IVF offers a \npromising alternative to conventional medical or surgical therapies for refractory infertility associated \nwith endometriosis3.\nThe diagnosis of endometriosis in infertile women required the presence of one or more typical bluish \nor black lesions, and the development stage of endometriosis was determined according to the revised \nclassification of the American Fertility Society (R-AFS), including the implant (ranked according to the \ndiameter and depth of the endometriotic implants) and adhesion scores (ranked according to the density \nand degree of enclosure). According to the R-AFS scores, the endometriosis divides into four stages: \nminimal (stage I), mild (stage II), moderate (stage III), and severe (stage IV)\n1–3. The main features of \nminimal or mild endometriosis are peritoneal or ovarian endometriotic implants and filmy adhesions \non the fallopian tubes or ovaries, and minimal or mild endometriosisis more frequently diagnosed than \nmoderate or severe endometriosis 4. Minimal or mild endometriosis have drawn much more attention \n1Center for Reproductive Medicine, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei \n230001, China. 2Institute of Pure and Applied Biology. Bahauddin Zakariya University Multan, 60800, Pakistan. \nCorrespondence and requests for materials should be addre ssed to B.X. (email: bio_xubo@163.com) or Y.-s.L. \n(email: shengzhizhongxin@126.com)\nreceived: 27 January 2015\na ccepted: 05 May 2015\nPublished: 29 May 2015\nOPEN\n\nwww.nature.com/scientificreports/\n2\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\nfrom research groups, and the association with IVF outcomes has been extensively investigated1,2. Several \nstudies have suggested that the presence of minimal or mild endometriosis (stage I/II) is associated with \npoor fertilization1,2, whereas the implantation and outcome of pregnancy were implied to be similar in \nthe patients with minimal or mild endometriosis and those having tubal infertility after undergoing IVF \ntreatment\n4–6. Endometriosis, even in a mild stage, because of its poor receptivity, might have a direct \nnegative effect on the oocyte quality, the potential for embryonic development and implantation 7,8.\nDysfunction of a Fallopian tube 9, subtle impairments of the oocytes and the embryo development \npotential10,11, immunological defects 12 and anatomical dysfunctions of an ovary 13 have been postulated \nto explain infertility associated with endometriosis. It is widely accepted that oocyte quality might be a \nmajor factor in infertility in these patients\n10,14,15.\nMinimal or mild endometriosis has more frequently been diagnosed than moderate or severe endo-\nmetriosis in infertile women during in vitro  fertilization and embryo transfer (IVF-ET) cycles 4,7,8. \nWomen with moderate or severe endometriosis typically accept medical and surgical treatments before \nundergoing IVF-ET treatment, which e causes a concise result to be difficult\n7,8. To directly investigate \nthe association between endometriosis and oocyte quality, we enrolled women with minimal or mild \nendometriosis undergoing IVF-ET treatment in this study. Here, we report the quality of oocytes from \npatients with minimal or mild endometriosis by using Transmission Electron Microscopy (TEM) and \nquantitative real time PCR to correlate the oocyte quality of these patients with endometriosis.\nMaterials and methods\nEthical approval.  All of the experimental protocols and patient management procedures followed \nthe declaration of Helsinki and were approved by the Ethics Committees on Human Research of Anhui \nProvincial Hospital, an affiliation of Anhui Medical University, Hefei, China (Notification Number: 2011 \nEthics75). The couples consenting to participation in this study signed an informed consent form before \nbeing enrolled.\nSubject Information. The enrolled subjects (between 20 and 38 years of age; with tubal disorders \nand/or a male factor) were IVF patients in the Reproductive Medicine Centre of Anhui Provincial \nHospital from February 2011 to October 2012. A total of 41 women who had biopsy-demonstrated \nendometriosis and had undergone laparoscopic excision of minimal or mild endometriosis [stage I and \nstage II endometriosis according to the revised classification of the American Fertility Society (R-AFS)] \nwere enrolled in this study (25 patients were enrolled in the TEM analysis, and 16 patients were enrolled \nin the real time PCR analysis). In this study, the laparoscopy-based diagnosis of endometriosis required \nthe presence of one or more typical bluish or black lesions. The stages of endometriosis were determined \naccording to the R-AFS classification, including the implant and adhesion scores. The implant scores \nwere ranked according to the diameter and depth of the endometriotic implants on the peritoneum \nor ovaries, whereas the adhesion scores were ranked according to the density and degree of enclosure. \nTotal R-AFS scores (implants and adhesions) from 1 to 5 and 6 to 15 correspond to minimal (stage I) \nand mild (stage II) endometriosis, respectively. The patients underwent removal of the visible endome-\ntriotic implants by excision during laparoscopy. The exclusion criteria were recurrent cysts, polycys-\ntic ovary syndrome, endometrioma, uterine adenomyosis and fibroids. Forty homochromous patients \nwithout endometriosis detected by diagnostic laparoscopies having tube/male factor based infertility \nwere included as the control group (25 patients were enrolled in the TEM analysis and 15 patients were \nenrolled in the real time PCR analysis).\nPituitary down regulation. For all of the patients, a standard long-term pituitary down-regulation \nprotocol was followed. Briefly, all of the patients received GnRH-a (Diphereline; Ipsen Pharma Biotech, \nSignes, France) down-regulation from the mid-luteal phase of the preceding cycle of gonadotropin \n(Gn: rFSH, Gonal-F , Merk Serono SA, Geneva, Switzerland) stimulation. The treatment strategy was \nadapted, according to the ovarian response, followed by detection of the serum follicle stimulating hor -\nmone (FSH), the luteinizing hormone (LH), and estradiol (E2) as well as transvaginal ultrasonography, \nto evaluate whether the pituitary down-regulation was complete. After the pituitary down-regulation \nwas complete, r-FSH injections were initiated. Finally, follicle maturation was induced with 10,000 IU \nof hCG (LiZhu Pharma, ZhuHai, China) 34–36 hours before oocyte retrieval (when at least 2 follicles \nof18-mm or more than 3 follicles of 17-mm mean diameter were present). The decision on whether IVF \nor intra-cytoplasmic sperm injection (ICSI) should be adopted for the patient was determined upon the \nsemen condition on the day of the oocyte retrieval.\nEvaluation of oocytes by Transmission Electron Microscopy (TEM). A total of fifty mature \noocytes (MII) were included in this study. Twenty-five oocytes were collected from 25 patients with \nminimal or mild endometriosis, and twenty-five oocytes were collected from 25 control women. The \noocytes were fixated for four hours following their collection and then processed for the TEM analysis, \nas previously described\n16. Ultrathin sections (60-80 nm) were cut with a diamond knife, mounted on a \ncopper grid and contrasted with saturated uranyl acetate followed by lead citrate before they were ana-\nlysed and photographed (JEOL-1230 Transmission Electron Microscope).\n\nwww.nature.com/scientificreports/\n3\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\nMitochondrial DNA copy, number determination by quantitative real-time PCR. Nineteen \nmature (MII) oocytes from sixteen women with minimal to mild endometriosis and eighteen mature (MII) \noocytes from fifteen control women were prepared for analysis by quantitative real-time PCR. The cumu-\nlus cells of the corona radiata were gradually removed using hand-pulled glass denudation pipettes. The \noocytes were washed in NaH\n2PO4 (PH2.0) until the zona pellucidae dissolution. The oocytes were frozen \nin liquid nitrogen for further analysis. The oocyte samples were tested with a SYBR premix ExTaqTM II kit, \na quantitative real time PCR reaction mixture composed of 5 μ l of SYBR, 0.2 μ l of forward-primers, 0.2 μ l \nof reverse –primers, 3 μ l of mtDNA template and 1.6 μ l of water. The cycling was performed as follows: \nthe initial DNA denaturing step at 95 °C for 10 s followed by 40 cycles, each consisting of denaturation \nat 95 °C for 5 s and primer annealing at 60 °C for 31 s. The following primer designs were used. The gene \nsegments of ND1 (mtDNA housekeeping genes) was the highly conservative sequence and revealed the \ntotal mtDNA in the DNA patterns. The primers, ND1-F 5′ - GGCTACATACAATTACGCAAAG -3′ and \nND1-R 5′ - TAGAATGGAGTAGACCGAAAGG -3′ , were designed for the assay. After the purification \nand separation of the PCR product, the internal standard curve was generated from 10-fold dilutions of \nthe standard substance according to the 1 ng PCR products.\nStatistical analysis. In this study, power calculations were performed for the TEM and real time \nPCR experiments to detect an adequate sample size using the PASS statistical package, version 11. For \nthe TEM experiments, the sample size of approximately 20 patients achieve 100% power to detect the \ndifferences between the endometriosis and control groups with a significance level (alpha) of 0.05. For \nthe real time PCR experiments, the sample size of approximately 16 patients achieves 100% power to \ndetect the differences between the endometriosis and control groups with a significance level (alpha) of \n0.05. Because our variable was an ordinal level, a statistical analysis of the TEM and real time PCR results \nwas performed with the SPSS, version 13 statistical package. The data were presented as the mean ±  sd \nand compared between the experimental groups with a t-test. The rates between the groups were com-\npared using the Chi square test and Fisher’s exact test when appropriate, and P <  0.05 was considered \nsignificant.\nResults\nBasic clinical information.  In the comparison of the endometriosis and control groups, no signif-\nicant differences were observed regarding the age, duration of infertility, days of ovarian stimulation, \ndoses of gonadotropins applied and concentration of E2, LH, and progestational (P) on the day of HCG \n(Table 1).\nUltrastructure of the oocytes. The TEM showed that the cumulus cells had abundant organelles \nand that the cytoplasm of these cells in the endometriosis and control groups had identical bacilli form \nmitochondria with tubular and/or villiform cristae. The nuclei predominantly contained decentralized \nchromatin and a voluminous nucleolus (Fig. 1A,B). No difference regarding the density of the filamen-\ntous texture of the inner aspect of the zona pellucida (ZP) was observed in the groups (Fig. 2A,B). The \noocytes were surrounded by an integrated and regularly structured plasma membrane provided with \nnumerous microvilli stretching into a perivitelline space (PVS) that appeared to be normal in terms of \nParameter Group\nControl Group\nAge (year, mean ±  std) 30.31 ± 4.13\nDuration of infertility (year, \nmean ±  std) 4.92 ± 2.15\nbFSH (IU/L, mean ±  std) 7.23 ± 2.89\nbLH (IU/L, mean ±  std) 4.34 ± 1.81\nbE2 (pg/ml, mean ±  std) 45.46 ± 19.42\nbPRL (ng/ml, mean ±  std) 14.91± 6.27\nDays of ovarian stimulation \n(mean ±  std) 11.93 ± 2.19\nTotal of Gn doses (IU/L, \nmean ±  std) 2252.47 ± 828.42\nE2 on HCG day (pg/ml, \nmean ±  std) 2412.24 ± 1379.56\nLH on HCG day (IU/L, mean ±  std) 1.14 ± 0.88\nP on HCG day (ng/ml, mean ±  std) 1.38 ± 0.12\nTable 1. Basic information. P <  0.05 was considered statistically significant.\n\nwww.nature.com/scientificreports/\n4\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\nthe shape, width and content (Fig.  2C,D). There were no differences in the morphology and electron \ndensity of the cortical granule, Golgiapparatus and spindles between the groups (data not shown here).\nIn the oocytes of the control group, spherical or elliptical shaped mitochondria were well distributed \nin the cytoplasm, and arc-like or transverse cristae were irregularly placed on the periphery and parallel \nFigure 1. Cumulus cell of the oocytes in the endometriosis and control groups. The cumulus cells from \nthe control group show the same ultrastructural cytoplasmic characteristics of the cumulus cells surrounding \nthe oocytesas in the endometriosis group ( A,B). The tubular cristae of the mitochondria (arrows) are well \ndeveloped and evenly distributed. N  =   nuclei; M =   mitochondria; Scale bar ( A,B) =   500 nm.\nFigure 2. The electron density of the zona pellucida (A,B) and perivitelline space (C,D) in the \nendometriosis and control groups, respectively. No difference was observed between the endometriosis \nand control groups in the dense appearance of the inner aspect of the ZP , and some fibres are visible in the \nzona texture (A,B). The microvilli (arrows) are numerous and long on the oolemma of both groups ( C,D). \nMV =   microvilli; PVS =   perivitelline space; O  =   oocyte. Scale bar  =   500 nm.\n\nwww.nature.com/scientificreports/\n5\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\nto the outer mitochondrial membrane (Fig. 3A). In the cytoplasm of the oocytes from the women with \nminimal or mild endometriosis, numerous abnormal mitochondria (Fig. 3B–D), which contained small \nor swollen and blurred vacuoles, were detected. In addition, the percentage of abnormal mitochondria \nsignificantly increased in the oocytes of the endometriosis group compared with that of the control group \n(Fig. 3E). The mass of the mitochondria in the cytoplasm of the oocytes was altered in the endometriosis \ngroup (Fig. 4A,B). The relative number of mitochondria within the cytoplasm was significantly decreased \nin the oocytes from women with minimal or mild endometriosis (Fig. 4C).\nFigure 3. Ultrastructural differences in the mitochondria of normal oocytes and oocytes with \nendometriosis. Mitochondria with typical tubular cristae are visible in the control cytoplasm ( A). A large \ndegree of vacuolization (arrows) could be seen in the mitochondria of the endometriosis group ( B-D). \nThe rate of abnormal mitochondria was significantly lower in the control group ( E). M =   Mitochondria; \nAM =   abnormal mitochondria; Scale bar ( A,B,C,D) =   500 nm.The bars indicate the standard deviation (SD) \nof the mean. *: compared with those of the control group, the abnormal mitochondria are significantly \n(P <   0.05) increased in the oocytes from the endometriosis group. Note: Abnormal mitochondria rate  =   the \nnumber of abnormal mitochondria/total number of mitochondria.\nFigure 4. Comparison of the mitochondrial mass in the cytoplasm of the normal oocytes and the \noocytes from the endometriosis group. The electron micrograph of the oocytes in the control group \nrevealed abundant mitochondria in the cytoplasm ( A). However, the number of mitochondria was \nsignificantly reduced in the endometriosis group ( B). There were significant differences between the two \ngroups regarding the mass of the mitochondria in cytoplasm ( C). The bars indicate the standard deviation \n(SD) of the mean. *: compared with that of the control group, the number of mitochondria is significantly \n(P <   0.05) low in the oocytes from the endometriosis group. Note: Mitochondria mass  =   number of \nmitochondria/section. For each oocyte, the numbers of mitochondria were counted in at least 3 randomly \nselected TEM-oocyte sections. To eliminate errors in the mitochondria identification and counting, all of the \nanalyses were performed in a double-blind manner by two or three individuals, and the data were pooled.\n\nwww.nature.com/scientificreports/\n6\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\nThe detection of mitochondria DNA (mtDNA) copies. To ensure the decrease of the mitochon-\ndria mass in the oocytes of the endometriosis group, the number of mitochondria was determined by \nanalysing the mtDNA copies. Thus, quantitative real time PCR was performed to analyse the number of \nmtDNA copies per oocyte from the endometriosis and control group. The control group consisted of 18 \nmature oocytes (MII) collected from 15 patients with a mean mtDNA copy number of 84,657 ±  39,872 \n(Table 2). For the 19 mature oocytes of 16 patients from the endometriosis group, the mean mtDNA copy \nnumber was 50,781 ±  28,569, which indicated a significantly different mtDNA copy number between the \ntwo groups (P <  0.05)(Table 2).\nDiscussion\nEndometriosis affects a large number of women of reproductive age 17, and many infertile women \nwith endometriosis select IVF to improve their chances of achieving a pregnancy. Several studies have \nreported that the rate of fertilization was reduced during IVF/ICSI cycles in patients with minimal or \nmild endometriosis compared with that of the patients with tubal-factor infertility\n7,11,18. The mechanism \nby which endometriosis affects the fertilization rate remains unclear. Infertility in women with endome-\ntriosis has been reported to be associated with alterations in normal pelvic anatomy, disturbed hormonal \nsupport, ovulation dysfunction and disruption of the development of follicles, oocytes and embryos\n19,20. \nAmong the factors associated with infertility in women with endometriosis, the oocyte quality is the \nmost important because it directly reflects the intrinsic developmental potential and is responsible for \nnormal fertilization/embryonic development during IVF . Poor oocyte quality could be the key reason \nfor adverse pregnancy outcomes during IVF/ICSI cycles in women with minimal or mild endometriosis.\nUntil now, the association between endometriosis and oocyte quality has been detected primarily by \nclinical data analysis. The IVF-ET cycles in women with endometriosis have been reported to have, in \ngeneral, a low number of oocytes and decreased fertilization rate\n21–24. The good embryo rate has been \nreported to be reduced in the women with endometriosis after stimulated and/or unstimulated cycles \nof IVF25,26. Navarro et al. reported that the implantation rates of oocytes from donors with endometrio-\nsis were reduced in recipients without endometriosis 27. However, the effect of endometriosis on oocyte \nmorphology has received limited attention. By spindle imaging, Rajani et al. suggested that women with \nendometriosis have oocytes with normal meiotic spindles\n28. Mansour et al. documented the morpholog-\nical characteristics of oocytes by confocal imaging in women with endometriosis and reported abnor -\nmal meiotic spindles and chromosomal misalignment 11. In our study, based on the ultrastructural and \nquantitative real time PCR analysis of oocytes from patients with or without minimal or mild endome-\ntriosis, we have reported that the quality of these oocytes was decreased significantly, possibly because \nof the alteration of the follicular microenvironment affecting oocyte development and maturation\n29–31. \nMitochondria are double-membrane organelles that play a crucial role in the cell 32; they are considered \nto be the powerhouses of the cells and to be involved in diverse signalling pathways and intracellular \nprocesses, including regulation of intracellular redox potential, Ca 2+  handling and signalling, media-\ntion of cellular and organismal aging and control of apoptosis 33,34. Mitochondria are hypothesized to \nbe derived exclusively from oocytes, and their activities appear to be essential for oocyte maturation, \nchromosome segregation and the capacity of a high level of development\n35. Several studies have indi-\ncated that mitochondrial abnormalities and/or dysfunction could have an adverse influence on human \nembryonic developmental and might affect competence for the fertilization of human oocytes\n36–38. In \naddition, endometriosis lesions, or its secretary products, could result in mitochondria of poorer quality \nin oocytes, which would affect fertilization and implantation\n7. Therefore, we suggest that minimal or mild \nendometriosis is specifically linked to the occurrence of impaired mitochondrial structure and reduced \nmtDNA copy numbers because of disorders of cytoplasmic maturation.\nIn our study, the mtDNA copy number was decreased significantly in the oocytes of women with \nminimal or mild endometriosis in comparison to that of the control group (Table 2). Mitochondrial DNA \nis present in the mitochondrion and in the codes for proteins that are indispensable for cellular energy \nproduction\n39.Typically, a normal MII oocyte contains approximately 10 5 mitochondria in human 40, and \nthe mtDNA copy numbers could directly represent the mitochondria mass and function 39,40. The low \nmtDNA content might imply that perturbed oogenesis might be the primaryabnormality responsible for \npoor oocyte quality. Poor energy production could be linked to insufficient mitochondrial biogenesis and \noocyte maturation39. Mitochondria with mtDNA that possesses a common deletion are more pervasive in \narrested or degenerated oocytes 41. Additionally, these reports have suggested that mitochondria-related \nGroup No. of oocytes Mean minimum Maximum\nControl 19 84,657 ± 39,872 31,100 255,300\nEndometriosis 18 50,781 ± 28,569* 26,900 132,500\nTable 2. Mitochondrial DNA copy number for the oocytes from the two groups. Note: The values are the \nmeans ±  SD. * P <  0.05 vs. the control group.\n\nwww.nature.com/scientificreports/\n7\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\npoor oocyte quality is associated with adverse outcomes in IVF/ICSI cycles with minimal or mild endo-\nmetriosis.\nIn this study, we examined, by TEM, the oocyte quality in IVF patients with minimal or mild endo-\nmetriosis; to the best of our knowledge, TEM has not previously been used for investigating the asso-\nciation between oocyte quality and minimal or mild endometriosis. The oocytes from the patients with \nminimal or mild endometriosis showed increased abnormal mitochondria and reduced mitochondria \nmass, which suggested that the oocyte quality was decreased in oocytes from women with minimal or \nmild endometriosis. Some methodological limitations should be noted. In this study, the estimate of the \noocyte quality was predominantly based on the ultrastructure analysis. Beyond that, evidence from other \naspects was not sufficient. Moreover, only patients with minimal or mild endometriosis were enrolled in \nthis study. For these reasons, these findings could not be generalized to the broader community based \non this study alone, and studies using more oocyte quality assessment methods and having patients with \ndifferent stages of endometriosis are necessary.\nReferences\n1. Rock, J. A. & Markham, S. M. Pathogenesis of endometriosis. Lancet  340, 1264–1267 (1992).\n2. Ozkan, S., Murk, W . & Arici, A. Endometriosis and infertility: epidemiology and evidence-based treatments. Ann. N. Y. Acad. \nSci. 1127, 92–100 (2008).\n3. Damewood, M. D. The role of the new reproductive technologies including IVF and GIFT in endometriosis. Obstet. Gynecol. \nClin. North. Am. 16, 179–191 (1989).\n4. Harb, H. M., Gallos, I. D., Chu, J. & Harb, M., Coomarasamy, A. The effect of endometriosis on in vitro  fertilisation outcome: a \nsystematic review and meta-analysis. BJOG  120, 1308–1320 (2013).\n5. Hickman, T. N. Impact of endometriosis on implantation. Data from the Wilford Hall Medical Center IVF-ET Program. J. \nReprod. Med. 47, 801–808 (2002).\n6. Suzuki, T. et al. Impact of ovarian endometrioma on oocytes and pregnancy outcome in in vitro  fertilization. Fertil. Steril. 83, \n908–913 (2005).\n7. Barnhart, K., Dunsmoor-Su, R. & Coutifaris, C. Effect of endometriosis on in vitro  fertilization. Fertil. Steril. 77, 1148–1155 \n(2002).\n8. Bergendal, A. et al. Outcome of IVF in patients with endometriosis in comparison with tubal-factor infertility. J. Assist. Reprod. \nGenet. 15, 530–534 (1998).\n9. Lyons R. A. et al. Peritoneal fluid, endometriosis, and ciliary beat frequency in the human fallopian tube. Lancet 360, 1221–1222 \n(2002).\n10. Garrido N. et al. Follicular hormonal environment and embryo quality in women with endometriosis. Hum. Reprod. Update  6, \n67–74 (2000).\n11. Mansour, G., Sharma, R. K., Agarwal, A. & Falcone, T. Endometriosis-induced alterations in mouse metaphase II oocyte \nmicrotubules and chromosomal alignment: a possible cause of infertility. Fertil. Steril. 94, 1894–1899 (2010).\n12. Gleicher, N., el-Roeiy, A., Confino, E. & Friberg, J. Is endometriosis an autoimmune disease? Obstet. Gynecol. 70, 115–122 (1987).\n13. Matalliotakis, I. M. et al. Women with advanced-stage endometriosis and previous surgery respond less well to gonadotropin \nstimulation, but have similar IVF implantation and delivery rates compared with women with tubal factor infertility. Fertil. Steril. \n88, 1568–1572 (2007).\n14. Arici, A. et al. Monocyte chemotactic protein-1 concentration in peritoneal fluid of women with endometriosis and its modulation \nof expression in mesothelial cells. Fertil. Steril. 67, 1065–1072 (1997).\n15. Garrido, N., Pellicer, A., Remohi, J. & Simon, C. Uterine and ovarian function in endometriosis. Semin. Reprod. Med. 21, 183–192 \n(2003).\n16. Nottola, S. A. et al. Ultrastructural markers of quality in human mature oocytes vitrified using cryoleaf and cryoloop. Reprod. \nBiomed. Online 19 Suppl 3, 17–27 (2009).\n17. Marcoux, S., Maheux, R. & Berube, S. Laparoscopic surgery in infertile women with minimal or mild endometriosis. Canadian \nCollaborative Group on Endometriosis. N. Engl. J. Med. 337, 217–222 (1997).\n18. Opøien, H. K. et al. In vitro fertilization is a successful treatment in endometriosis-associated infertility. Fertil. Steril. 97, 912–8 \n(2012).\n19. Harlow, C. R. et al. Reduced preovulatory granulosa cell steroidogenesis in women with endometriosis. J. Clin. Endocrinol. Metab. \n81, 426–429 (1996).\n20. Toya, M. et al. Hiroi M. Moderate and severe endometriosis is associated with alterations in the cell cycle of granulosa cells in \npatients undergoing in vitro fertilization and embryo transfer. Fertil. Steril. 73, 344–350 (2000).\n21. Al-Fadhli, R., Kelly, S. M., Tulandi, T. & Tanr, S. L. Effects of differentstages of endometriosis on the outcome of in vitro  \nfertilization. JObstet. Gynaecol. Can. 28, 888–891 (2006).\n22. Bergqvist, A. & D’Hooghe, T. Mini symposium on pathogenesis ofendometriosis and treatment of endometriosis-associated \nsubfertility. Introduction: the endometriosis enigma. Hum. Reprod. Update  8, 79–83 (2002).\n23. Kumbak, B. et al. Invitro fertilization in normoresponder patients with endometriomas: comparison with basal simple ovarian \ncysts. Gynecol ObstetInvest. 65, 212–216 (2008).\n24. Mahutte, N. G. & Arici, A. Endometriosis and assisted reproductivetechnologies: are outcomes affected? Curr. Opin. Obstet. \nGynecol. 13, 275–279 (2001).\n25. Cahill, D. J. & Hull, M. G. Pituitary-ovarian dysfunction and endometriosis. Hum. Reprod. Update  6, 56–66 (2000).\n26. Hull, M. G. et al. The contribution of subtle oocyte or sperm dysfunctionaffecting fertilization in endometriosis-associated or \nunexplainedinfertility: a controlled comparison with tubal infertility and use ofdonor spermatozoa. Hum. Reprod. 13, 1825–1830 \n(1998).\n27. Navarro, J., Garrido, N., Remohi, J. & Pellicer, A. How does endometriosis affect infertility? Obstet. Gynecol. Clin. North. Am. 30, \n181–192 (2003).\n28. Rajani, S. et al. Assessment of oocyte quality in polycystic ovarian syndrome and endometriosis by spindle imaging and reactive \noxygen species levels in follicular fluid and its relationship with IVF-ET outcome. J. Hum. Reprod. Sci. 5, 187–93 (2012).\n29. Lessey, B. A. et al. Aberrant integrin expression in the endometrium of women with endometriosis. J. Clin. Endocrinol. Metab. \n79, 643–649 (1994).\n30. Lessey, B. A. Medical management of endometriosis and infertility. Fertil. Steril. 73, 1089–1096 (2000)\n31. Lucena, E. & Cubillos, J. Immune abnormalities in endometriosis compromising fertility in IVF-ET patients. J. Reprod. Med. 44, \n458–464 (1999).\n32. Wallace, D. C. Mitochondrial diseases in man and mouse. Science  283, 1482–1488 (1999).\n\nwww.nature.com/scientificreports/\n8\nScientific  RepoRts  | 5:10779 | DOi: 10.1038/srep10779\n33. Balaban, R. S., Nemoto, S. & Finkel T. Mitochondria, oxidants, and aging. Cell  120, 483–495 (2005).\n34. Dumollard, R., Duchen, M. & Carroll J. The role of mitochondrial function in the oocyte and embryo. Curr. Top. Dev. Biol. 77, \n21–49 (2007).\n35. Eichenlaub-Ritter, U., Wieczorek, M., Luke, S. & Seidel, T. Age related changes in mitochondrial function and new approaches \nto study redox regulation in mammalian oocytes in response to age or maturation conditions. Mitochondrion 11, 783–796 (2011).\n36. Au, H. K. et al. Abnormal mitochondrial structure in human unfertilized oocytes and arrested embryos. Ann. N. Y. Acad. Sci. \n1042, 177–185 (2005).\n37. Motta, P . M., Nottola, S. A., Makabe, S. & Heyn, R. Mitochondrial morphology in human fetal and adult female germ cells. Hum. \nReprod. 15 Suppl 2, 129–147 (2000).\n38. Van, Blerkom J. Mitochondria in human oogenesis and preimplantation embryogenesis, engines of metabolism, ionic regulation \nand developmental competence. Reproduction 128, 269–280 (2004).\n39. May-Panloup, P ., Chretien, M. F ., Malthiery, Y . & Reynier, P . Mitochondrial DNA in the oocyte and the developing embryo. Curr. \nTop. Dev. Biol. 77, 51–83 (2007).\n40. Chen X. et al. Rearranged mitochondrial genomes are present in human oocytes. Am. J. Hum. Genet. 57, 239–247 (1995).\n41. Steuerwald, N., Cohen, J., Herrera, R. J. & Brenner, C. A. Quantification of mRNA in single oocytes and embryos by real-time \nrapid cycle fluorescence monitored RT-PCR. Mol. Hum. Reprod. 6, 448–453 (2000).\nAcknowledgments\nThe authors thank Dr. Wen Hu for Electron Microscopy Techniques. This research was supported by \nthe Natural Science Foundation of Anhui Provincial of China (1308085QH131, 1408085MH150), the \nNational Natural Science Foundation of China (81370757), and Natural Science Research Project of \nAnhui Provincial Education Department (KJ2013Z134).\nAuthor Contributions\nB.X. and Y .L. conceived the idea and coordinated the project. B.X., N.G., X.Z. and W .S. collected data \nand performed the experiments. B.X., N.G., W .S. and X.T. analyzed the results. B.X. and F .I. wrote the \nmanuscript.\nAdditional Information\nCompeting financial interests: The authors declare no competing financial interests.\nHow to cite this article: Xu, B. et al. Oocyte quality is decreased in women with minimal or mild \nendometriosis. Sci. Rep. 5, 10779; doi: 10.1038/srep10779 (2015).\nThis work is licensed under a Creative Commons Attribution 4.0 International License. The \nimages or other third party material in this article are included in the article’s Creative Com-\nmons license, unless indicated otherwise in the credit line; if the material is not included under the \nCreative Commons license, users will need to obtain permission from the license holder to reproduce \nthe material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/","source_license":"CC0","license_restricted":false}