{"paper_id":"59cb5f96-404f-41d1-bf07-73d1063707bb","body_text":"Leiomyomas are benign uterine tumors with fibrotic characteristic affecting up to 70% of reproductive age women. There is higher prevalence and symptom severity in African Americans (AA) ( 1 – 3 ). In addition to age and race other risk factors for development of these tumors include premenopausal status, hypertension, positive family history and time since last birth ( 3 ). Intense efforts have focused on identifying the pathogenesis of these tumors. Estrogen is known to promote the growth of these tumors ( 1 ), and more recent studies have pointed to epigenetic mechanisms such as DNA methylation ( 4 ) and non-coding RNAs to play a significant role in tumorigenesis ( 5 ). The genetic heterogeneity associated with chromosomal re-arrangements and mutation in a number of genes such as Mediator Complex Subunit 12 gene ( MED12 ), fumarate hydratase ( FH ), High Mobility Group AT-Hook 2 ( HMGA2 ) have also been associated with development and growth of fibroids ( 1 ).\nAs part of our effort to elucidate the pathogenesis of fibroids we discovered and reported for the first time a marked dysregulation of tryptophan catabolic pathway in these tumors ( 6 ). Tryptophan (Trp) which is an essential amino acid is used for not only protein synthesis, but its degradation products serve as precursor for a number of important products such as serotonin and melatonin (see  figure 1 ). The degradation of tryptophan can occur through four pathways ( 7 ). Three of the pathways are less significant but the fourth pathway, the kynurenine pathway accounts for 95% of Trp degradation and exists mainly in the liver ( 7 ). The minor Trp degradation pathways are hydroxylation, with the end product of serotonin (only 3% of dietary Trp is used for brain serotonin synthesis), decarboxylation which produces tryptamine , and transamination which produces indole pyruvic acid ( 7 ). The kynurenine pathway produces many important biologically active metabolites including the important oxidized nicotinamide adenine dinucleotide (phosphate) [NAD(P)] and their reduced forms NAD(P)H, the N-methyl-D-aspartate (NMDA) receptor agonist quinolinic acid and the NMDA receptor antagonist kynurenic acid (KYNA), niacin, and picolinic acid ( 7 ). The first step in the degradation of Trp is catalyzed by action of either tryptophan 2,3-dioxygenase (TDO2) in the liver or Indoleamine-pyrrole 2,3-dioxygenase (IDO1) extra-hepatically to N-formylkynurenine which is then hydrolyzed to kynurenine by NFK formamidase ( 8 ). TDO2 is primarily localized in the liver while IDO1 is ubiquitously distributed ( 7 ).\nIn our initial study we reported leiomyoma as compared with matched myometrium expressed significantly higher levels of IDO1 and TDO2 mRNA and protein, and kynurenine (KYN) a marker of enzyme activity ( 6 ). The expression of TDO2 but not IDO1 mRNA was significantly higher in fibroids from AA patients as compared with Caucasian and Hispanic patients. TDO2 but not IDO1 protein and mRNA levels were more abundant in fibroids bearing the MED12 mutation as compared with mutation-negative leiomyomas ( 6 ). Treatment of LSMC (leiomyoma smooth muscle cells) and MSMC (myometrial smooth muscle cells) spheroids with the TDO2 inhibitor, 680C91 but not the IDO1 inhibitor, Epacodostat significantly repressed cell proliferation and the expression of collagen type I (COL1A1) and type III (COL3A1) in a dose-dependent manner ( 6 ). The objective of this study was several-fold, firstly to examine the expression of other enzymes in the Trp metabolism highlighted in  Fig. 1  in fibroids and their matched normal myometrium and determine if race and MED12 mutation were determinants of their expression. Secondly, we sought to determine the end products of Trp catabolism including serotonin, KYNA and NAD. We hypothesized that in addition to TDO2 and IDO1 other enzymes in Trp catabolism are dysregulated in fibroids leading to differences in the levels of end metabolites of Trp catabolism namely serotonin, KYNA and NAD in fibroids, and that by virtue of excess activity of TDO2/IDO1 in fibroids more kynurenine which is a ligand of aryl hydrocarbon receptor (AhR) ( 9 ) is produced leading to activation of AhR receptor and its target gene CYP1B1 (Cytochrome P450 1B1).\n\nPortions of uterine leiomyomas (intramural, 3–5 cm) and paired myometrium were obtained from patients (n=81) who were not taking any hormonal medications for at least 3 months prior to surgery at Harbor-UCLA Medical Center. Prior approval from the Institutional Review Board (#036247) at the Lundquist Institute at Harbor-UCLA Medical Center was obtained. Informed consent was obtained from all the patients participating in the study prior to surgery. The paired tissues were obtained from Caucasians (n=12), African Americans (n=25), Hispanics (n=37) and Asians (n=7). The mean age of patients was 45 ± 5.3 years with a range of 30–54 years. The tissues were snap frozen and stored in liquid nitrogen for further analysis as previously described ( 10 ,  11 ).\nTotal RNA was extracted from leiomyoma and matched myometrium using TRIzol (Thermo Fisher Scientific Inc., Waltham, MA). RNA concentration and integrity was determined using a Nanodrop 2000c spectrophotometer (Thermo Scientific, Wilmington, DE) and Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) according to manufacturer’s protocols ( 12 ,  13 ). 1μg of RNA was reverse transcribed using random primers for selected genes according to the manufacturer’s guidelines (Applied Biosystems, Carlsbad, CA). Quantitative RT-PCR was carried out using SYBR gene expression master mix (Applied Biosystems). Reactions were incubated for 10 min at 95°C followed by 40 cycles for 15 seconds at 95°C and 1 min at 60°C. The expression levels of selected genes were quantified using Invitrogen StepOne System with FBXW2 (F-box and WD repeat domain containing 2) used for normalization ( 14 ). All reactions were run in triplicate and relative mRNA expression was determined using the comparative cycle threshold method (2-ΔΔCq), as recommended by the supplier (Applied Biosystems). The primer sequences in the 5’–3’ direction used are listed in  supplementary Table 1 .\nGenomic DNA from leiomyomas and paired myometrial specimens was extracted from 100 mg of freshly frozen tissue using MagaZorb DNA Mini-Prep Kit (Promega, Madison, WI) according to the manufacturer’s protocol. PCR amplification and Sanger sequencing (Laragen Inc. Culver City, CA) was performed to investigate the MED12 exon 2 mutations using the primer sequences in the 5’–3’ direction: sense, GCCCTTTCACCTTGTTCCTT and antisense, TGTCCCTATAAGTCTTCCCAACC. PCR products were sequenced using Big Dye Terminator v.3.1 sequencing chemistry and the sequences were analyzed with the Software ChromasPro 2.1.8 and compared with the MED12 reference sequence ( NG_012808  and  NM_005120 ). The mutation analysis of the specimens indicated that 52 of the 81 specimens expressed the MED12 mutation. Missense mutations in MED12 exon 2 were the most frequent alteration (42/52 pairs), followed by in-frame insertion-deletion type mutations (10/52 pairs). The missense mutations in exon 2 included c.130G>C (p.Gly44Arg) (5/42 pairs), c.130G>A (p.Gly44Ser) (8/42 pairs), c.130G>T (p.Gly44Cys) (3/42 pairs), c.131G>C (p.Gly44Ala) (2/42 pairs), c.131G>A (p.Gly44Asp) (17/42 pairs), c.131G>T (p.Gly44Val) (6/42 pairs) and c.128A>C (p.Gln43Pro) (1/42 pairs).\nThe concentration of serotonin, KYNA and NAD in paired leiomyoma and myometrium homogenates (N=50) was measured according to the manufacturer’s instructions in duplicate using the Serotonin Research ELISA Kit (Rocky Mountain Diagnostics, Colorado Springs, CO), kynurenic acid (KYNA) ELISA Kit (FIVEphoton Biochemicals, San Diego, CA), and NAD/NADH Cell-Based Assay Kit (Cayman Chemical, Ann Arbor, MI), respectively. Absorbance of each plate was measured spectrophotometrically at a wavelength of 450 nm and the concentration was determined by comparing the optical density value of samples to the standard curve.\nThroughout the text, all data are presented as mean ± SEM and analyzed by PRISM software (Graph-Pad, San Diego, CA). Dataset normality was determined by the Kolmogorov–Smirnoff test, Shapiro-Wilk test, D’Agostino & Pearson test, and Anderson-Darling test. The data presented in this study was not normally distributed and therefore non-parametric tests were used for data analysis. Comparisons involving two groups was analyzed using the Wilcoxon matched pairs signed rank test ( Figs. 2 ,  5A – C ) or Mann Whitney test ( Figs. 3 ,  4  and  5D ) as appropriate. Statistical significance was established at P<0.05.\n\nIn the initial profiling study, we determined the expression of the key enzymes in Trp catabolism highlighted in  Fig.1  by qRT-PCR. We also determined the expression of Tryptophan tRNA ligase 1 and 2 ( WARS1/2 ) which catalyzes aminoacylation of tRNA(Trp) with tryptophan, and Large neutral amino acid transporter small subunit 2 ( SLC7A8 ) and Large neutral amino acids transporter small subunit 1 ( SLC7A5 ) which are sodium-independent high affinity transporters of neutral amino acids such as Trp ( 15 ,  16 ), and Kynurenine amino transferase 1 to 4 ( KAT1–4 ) which converts kynurenine into kynurenic acid ( 17 ,  18 ). As demonstrated in  Fig. 2A – B  the expression of Tryptophan hydroxylase 1 ( TPH1 ),  KAT2  and  SLC7A8 ,  SLC7A5  mRNA was significantly upregulated in fibroids, whereas the expression of Kynureninase ( KYNU ),  WARS1  was significantly lower in fibroids with no differences in the expression of  WARS2 , Kynurenine formamidase ( AFMID ), Kynurenine 3-monooxygenase ( KMO ) and  KAT1,3,4  in fibroids as compared with myometrium. Because of our finding that kynurenine the initial breakdown of Trp is upregulated in fibroids ( 6 ) and KYN is an endogenous ligand of AhR ( 9 ,  19 ) we also measured the expression of  CYP1B1  mRNA which is a marker of AhR activation. As shown in  Fig. 2A  the expression  CYP1B1  mRNA was significantly upregulated in fibroids consistent with AhR activation.\nWe then determined the effect of MED12 mutation and race/ethnicity on the expression of Trp catabolic pathway enzymes and CYP1B1 ( Figs. 3 – 4 ). As shown in  Fig. 3A  the presence of MED12 mutation had a significant impact on the expression of  CYP1B1 ,  WARS1 , and  KAT1 ,  KAT3  and  KAT4 , with tumors bearing the mutation expressing significantly more  CYP1B1  mRNA, lower  WARS1 , and  KAT1 ,  KAT3  and  KAT4  mRNA as compared with mutation-negative tumors. Race/ethnicity affected the expression of  KYNU  with tumors from AA and Hispanic patients expressing significantly lower levels of  KYNU  mRNA as compared with tumors from Caucasian patients ( Fig. 4A ). Although there was a trend for higher levels of  CYP1B1  in AA as compared with Caucasian patients this difference did not reach statistical significance ( Fig. 4B ). Additionally, tumors from Hispanic patients expressed significantly lower mRNA levels of  TPH1, KMO, KAT2  and  CYP1B1  as compared to AA patients, and lower  WARS1  levels as compared to Caucasian patients ( Figs. 4A – B ).\nBecause fibroids express more  TPH1 , the enzyme that converts Trp into 5-hydroxytryptophan in the first step in the conversion of Trp to serotonin, we quantified the levels of this neurotransmitter in fibroid and myometrial extracts by ELISA. There were no significant differences in serotonin levels between fibroids and paired myometrium ( Fig. 5A ). We also determined the levels of KYNA, the metabolite of KAT1–4. As shown in  Fig. 5B , KYNA levels in fibroids were not significantly different as compared to matched myometrium. Additional anlaysis in terms of race/ethnicity also did not reveal any significant changes in KYNA levels (data not shown). KYNU is the enzyme catalyzing the conversion of 3-hydroxykynurenine to 3-hydroxyanthranilic acid which through a number of additional enzymatic steps leads to generation of NAD ( 7 ). Because  KYNU  expression was lower in fibroids in a race/ethnicity dependent manner, we quantified the levels of NAD, the downstream end product of Trp metabolism. As shown in  Fig. 5C  the levels of NAD were significantly lower in fibroid extracts as compared with myometrium. However, when the NAD levels were analyzed based on race/ethnicity no significant differences in NAD levels were discernible ( Fig. 5D ).\n\nIn this report we build on our previous findings on dysregulation of Trp catabolism in fibroids ( 6 ) and show fibroids overexpressed  TPH1 ,  KAT2 ,  SCLC7A8  and  SLC7A5  mRNA and reduced expression of  KYNU ,  WARS1  mRNA with no changes in the expression of  WARS2 ,  AFMID ,  KMO  and  KAT1 ,  KAT3  and  KAT4  as compared with matched myometrium. The mRNA expression of  CYP1B1  a marker of AhR activation was higher in fibroids. Tumors bearing the MED12 mutation expressed more  CYP1B1 , and lower  WARS1  mRNA levels compared to mutation-negative fibroids. Race/ethnicity affected the expression of  KYNU  with tumors from AA and Hispanic patients expressing lower levels of  KYNU  mRNA as compared with Caucasians. We also quantified the levels of serotonin, KYNA and NAD which are the end metabolites of Trp catabolism. Although the expression of  TPH1  was higher in fibroids, serotonin levels were not significantly different in fibroids compared with myometrium. There was a race-dependent decrease in the expression of  KYNU  mRNA which catalyzes the conversion of 3-hydroxykynerenine into 3-hydroxyanthanilic acid in fibroids resulting in significantly reduced NAD levels in fibroids which was independent of race/ethnicity.\nThe data presented here indicate that fibroids handle the breakdown of Trp differently than myometrium in a number of ways. Firstly, the overexpression of  SLC7A8  and  SLC7A5  which are the transport proteins for Trp, suggests that there is greater uptake of Trp into the tumor cells. SLC7A5 also transports kynurenine into T cells and the ability of kynurenine to activate AhR was shown to be restricted to cells that expressed SLC7A5 ( 20 ). Secondly, the reduced expression of  WARS1  which is involved in the aminoacylation of rRNA(Trp) suggests that there is reduced use of Trp for protein synthesis in fibroids. Thirdly, the overexpression of TDO2/IDO1 and higher KYN levels in fibroids ( 6 ) indicates greater availability of the endogenous ligand (kynurenine) for AhR activation leading to increased transcription of AhR targets such as  CYP1B1  as shown by our current findings. Fourthly, the reduced expression of  KYNU  in fibroids would be expected to result in decreased generation of NAD in fibroids as indicated by our data. The increased expression of  KAT2  would suggest increased generation of kynurenic acid which is biologically active with immunosuppressive and anti-inflammatory effects ( 21 ). However, the levels of KYNA were not altered in fibroids indicating that although there is increased transcription of  KAT2  in fibroids, the enzyme activity was not affected in fibroids. The lack of a change in  AFMID  expression in the setting of increased levels of KYN in fibroids ( 6 ) was unexpected as AFMID is the immediate enzyme catalyzing the conversion of N-formyl-L-kynurenine into kynurenine, the second step in the kynurenine pathway of tryptophan degradation. A potential explanation for this observation might be that the reduced expression of several KAT isoforms (KAT1,3,4) in the MED12 mutated tumors coupled with a more marked overexpression of TDO2 in MED12 mutated tumors ( 6 ) could account for the increased KYN levels in fibroids.\nRace/ethnicity is well known to be a determinant of not only the prevalence but also the severity of symptoms associated with fibroids with AA women being more severely affected ( 1 ). In our previous study ( 6 ) we demonstrated that  TDO2  mRNA but not protein levels were higher in tumors from AA patients as compared with Caucasians. Here we expand on our previous findings and show that expression levels of  KYNU  which converts 3 hydroxykyneurenine into 3-hydroxyanthranilic acid is decreased in fibroids as compared with myometrium and this decrease is more pronounced in fibroids from AA and Hispanic patients as compared with Caucasian patients. Based on the race-dependent profile of KYNU we expected the NAD profiles to resemble the pattern of KYNU expression. However, no race/ethnicity dependent differences in NAD levels in fibroids were detected. This could be due to compensatory mechanisms in NAD synthesis through other pathways, as NAD synthesis occurs not only by the de novo pathway involving Trp but also through a salvage pathway ( 22 ). NAD is a key coenzyme in cellular metabolism which functions to carry electrons from one reaction to another ( 22 ). Reduced cellular NAD is a hallmark of cellular senescence ( 22 ). NAD is also required for the function of sirtuins which are NAD-dependent deacetylase and ADP ribosyl transferase ( 22 ); loss of sirtuins can lead to mitochondrial dysfunction causing redox imbalance and lead to damaged cell proteins, lipids and DNA damage ( 23 ). DNA damage can cause chromosomal alteration and gene mutations which are commonly found in fibroids ( 24 ). Prior studies demonstrated an increase in oxidative stress in fibroids secondary to overexpression of nicotinamide adenine dinucleotide phosphate oxidase ( 25 ). The increase in oxidative stress promotes inflammation which is well known to occur in fibroids ( 26 – 29 ), and this leads to cellular injury ( 30 ).\nOne of the main driver mutations for fibroids are gain-of-function mutations in exon 2 of the MED12 mutation which in various populations throughout the world has been shown to affect up to 86% of fibroids ( 31 ). Our data indicated that the expression of a number of transcripts in the Trp metabolism and its downstream AhR pathway are dependent on the MED12 gene mutation status similar to our earlier reported findings showing a more pronounced overexpression of TDO2 in MED12 bearing mutations ( 6 ). The expression of WARS1 which catalyzes the aminoacylation of Trp and the three isoforms of KAT (KAT1/3/4) but not KAT2 which converts kynurenine into kynurenic acid were all significantly lower in tumors bearing the MED12 mutation. In contrast, the expression of  CYP1B1  which is a key target of AhR pathway activation was greater in MED12 mutated fibroids as compared with mutation-negative tumors. The differences in the Trp metabolic profile of MED12 mutated fibroids as compared with mutation-negative tumors suggest there is lower utilization of Trp for protein synthesis, and a greater activation of AhR pathway in the mutated tumors.\nSerotonin is a minor byproduct of Trp metabolism which exerts its effect through 14 different types of receptors ( 32 ,  33 ). Our data indicated an increase in the expression of  TPH1  without a significant change in serotonin levels in fibroids. It is possible that although fibroids express more  TPH1  mRNA, the protein levels or enzyme activity of TPH1 is not affected. Additional research is required to delineate the role of serotonin in fibroids as this neurotransmitter has been shown to be a growth factor for multiple tumors ( 34 ), and to alter the expression of collagen and fibronectin ( 35 ). Furthermore, a selective blocker of the 5-HT1B receptor inhibited the leiomyoma cell proliferation and induced apoptosis and reduced cyclin D1 and α-SMA expression ( 36 ).\nIn summary, the data presented here builds on our earlier findings which showed a marked upregulation of TDO2/IDO1 in fibroids ( 6 ) and indicates that a number of other key enzymes in Trp metabolism are also dysregulated some of which are dependent on the MED12 mutation status of the tumor and some of which are race/ethnicity dependent. Trp metabolism in fibroid is selectively shunted in the KYN pathway with downstream activation of AhR. The reduced expression of  KYNU  in fibroids results in reduced generation of NAD which could alter mitochondrial function. These findings indicate that dysregulation of Trp metabolism could be a significant pathogenic mechanism underlying fibroid tumors and a promising target for future therapies.\n\nSupplementary Table 1: Primers sequences used for qRT-PCR.\nSupplementary Table 2: Glossary of Gene Abbreviations.","source_license":"CC0","license_restricted":false}