{"paper_id":"535cd02f-8447-4801-bda1-6d37e880a344","body_text":"RESEARCH Open Access\n© The Author(s) 2025. Open Access  This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 \nInternational License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you \ngive appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the \nlicensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or \nother third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the \nmaterial. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or \nexceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit  h t t p  : / /  c r e a  t i  \nv e c  o m m  o n s .  o r  g / l  i c e  n s e s  / b  y - n c - n d / 4 . 0 /.\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nhttps://doi.org/10.1186/s12967-025-06677-y\nJournal of Translational \nMedicine\n*Correspondence:\nYing Feng\nndefy05043@ncu.edu.cn\n1Department of Obstetrics and Gynecology, The Second Affiliated \nHospital of Nanchang University, No.1, Minde Road, Nanchang, Jiangxi, \nPeople’s Republic of China\nAbstract\nBackground EMS (Endometriosis) is characterized by the presence of functional endometrial tissue outside the \nuterus and is one of the most common gynecological disorders. SOX18 (SYR-related high-mobility group box 18) is \na transcription factor whose expression is higher in ectopic endometrial tissues than in eutopic endometrial tissues. \nHowever, its role in EMS has not been confirmed.\nMethods Here, immunohistochemistry (IHC) staining was used to analyze the expression pattern of SOX18 in EMS. \nNext, the effects of SOX18 on cell viability, migration and invasion were investigated. Dual-luciferase reporter assay, \nchromatin-immunoprecipitation (ch-IP) and DNA pull-down were employed to verify SOX18 binding to the OTUB1 \n(OTU domain-containing ubiquitin aldehyde binding protein 1) promoter. In addition, co-immunoprecipitation (co-IP) \nwas used to analyze the binding of OTUB1 to YAP1 (Yes-associated protein 1). Allograft mouse model of EMS was \nestablished to explore the role of SOX18 in vivo.\nResults In vitro results demonstrated that upregulation of SOX18 promoted the proliferation, migration and invasion \nof Ishikawa cells and induced the EMT process, while knockdown of SOX18 showed the opposite effect. In vivo results \nalso confirmed that SOX18 overexpression led to the deterioration of EMS, as reflected by significant pathological \nchanges in mice. Mechanistically, our data proved that SOX18 directly bound to the OTUB1 promoter region and \nactivated its transcription. Further investigation demonstrated that OTUB1 deubiquitinated YAP1 and enhanced \nits protein stability. Rescue experiments suggested that SOX18 modulated YAP1 expression through upregulating \nOTUB1, indicating the role of SOX18-OTUB1-YAP1 axis in EMS.\nConclusions These discoveries underscore that SOX18 contributes to the pathogenesis of EMS through promoting \nOTUB1 transcription and activating Hippo/YAP1 signaling pathway, which may provide a new therapeutic target for \nEMS.\nKeywords Endometriosis, SOX18, Hippo/YAP1, OTUB1\nThe SOX18-OTUB1-YAP1 axis: a new \nendometriosis target\nYing Feng1* , Jiamei Yue1, Si Fan1 and Jiayan Wu1\n\nPage 2 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nIntroduction\nEMS (Endometriosis) is a common, chronic, inflam -\nmatory, and hormone-dependent gynecological disor -\nder that is usually characterized by ectopia outside the \nuterine cavity, the presence and growth of endometrioid \ntissue. It predominantly affects about 10% of women of \nreproductive age [ 1, 2]. EMS is associated with multiple \nsymptoms, such as pelvic pain, dysmenorrhea, dyspareu -\nnia, urinary dysfunction, and related fertility problems \n[3]. Although it is benign, this chronic and multifacto -\nrial disease exhibits tumor-like biological behavior and \naffects the physical and mental health of the affected \nwomen [ 4]. Current treatments include surgical resec -\ntion of the lesion and drug therapy, but conventional \ntreatment is limited by the high rate of postoperative \nrecurrence and the side effects of drugs [ 5]. Therefore, \nunderstanding the molecular mechanisms driving EMS \nprogression is crucial for identifying diagnostic biomark -\ners and developing effective therapies.\nSOX18 (SYR-related high-mobility group box 18) is a \nmember of the SOX transcription factor family and is \ninvolved in a variety of biological processes, including \ncardiovascular development, cell-fate determination, \nand tissue homeostasis [ 6]. An increasing number of \nstudies demonstrated that SOX18 was highly expressed \nin tumor tissues and exacerbated their development, \nsuch as hepatocellular carcinoma [ 7], bladder cancer \n[8], gastric cancer [ 9], clear cell renal cell carcinoma [ 10] \nand prostate cancer [ 11]. In addition, SOX18 promoted \nTNF-α-induced airway smooth muscle cell proliferation \nand migration via regulating Notch1 signaling pathway, \nthus aggravating the progression of childhood asthma \n[12]. By analyzing the GSE11691 chip of GEO database, \nit was found that SOX18 expression was significantly \nupregulated in ectopic endometrial tissues compared \nwith eutopic endometrial tissues, but its role in EMS was \nunknown.\nHippo signaling pathway plays an important role in a \nvariety of biological processes such as organ size control, \ntissue homeostasis, cancer genesis, and immune response \n[13]. As the main downstream target of Hippo pathway, \nYAP1 (Yes-associated protein 1) is involved in the occur -\nrence and development of multiple cancers. For example, \nYAP1 initiated gastric tumorigenesis through upregula -\ntion of MYC [ 14]. YAP1 also facilitated invasion, metas -\ntasis, and epithelial-mesenchymal transformation (EMT) \nof non-small cell lung cancer cells [15]. In addition, a pre-\nvious study certified that activation of the Hippo/YAP1 \npathway promoted ectopic endometrial stromal cell pro -\nliferation and anti-apoptosis [16].\nOTUB1 (OTU domain-containing ubiquitin aldehyde \nbinding protein 1) is a deubiquitinating enzyme that \nblocks ubiquitination, resulting in protein stabilization \n[17]. OTUB1 has been identified to drive the progression \nof a variety of tumors. For instance, OTUB1 instigated \ncancer cell immunosuppression by stabilizing PD-L1 [18]. \nOTUB1 fostered breast cancer progression via blocking \nMYC protein degradation [ 19]. Noteworthily, OTUB1 \npromoted the pathogenesis of EMS through upregulating \nHSF119 [20]. Through the analysis of Jaspar database, we \nnoticed there were potential binding sites for SOX18 on \nthe promoter of OTUB1. Accordingly, it was speculated \nthat SOX18 may play a key role in EMS by regulating \nOTUB1 transcription. In addition, hitpredict database \nindicated a possible combination of OTUB1 and YAP1. \nRemarkably, Yan et al. demonstrated that OTUB1 aggra -\nvated gastric cancer progression by stabilizing YAP1 [21]. \nHowever, whether OTUB1-YAP1 axis affects the role of \nSOX18 in EMS remains to be explored.\nIn this study, we aimed to investigate the role of SOX18 \nin EMS and the molecular mechanism of the SOX18-\nOTUB1-YAP1 axis. Our results may contribute to the \ndevelopment of appropriate therapeutic strategies.\nMaterials and methods\nClinical samples\nThe clinical study was approved by the Medical Ethics \nCommittee of the Second Affiliated Hospital of Nan -\nchang University and conducted in accordance with the \nDeclaration of Helsinki. All subjects provided written \ninformed consent prior to participation. Nine ectopic \nendometrium samples (28–46 years old, n = 4 prolifera-\ntive and n = 5 secretory) with laparoscopically and his -\ntopathologically confirmed endometriosis (EMS) and 18 \neutopic endometrium samples (28–54 years old, n = 11 \nproliferative and n = 7 secretory) without evidence of \nEMS by laparoscopy were included in this study. All \npatients had regular menstrual cycles and none of them \nhad received hormonal treatment for at least 3 months \nprior to the surgery. Eutopic endometrial biopsy speci -\nmens were collected using endometrial aspiration cathe -\nters. Endometriotic cyst walls were collected and ectopic \nendometrial tissues were carefully stripped from the lin -\ning inner cyst wall. Paraffin-embedded eutopic endome -\ntrium and ectopic endometrium samples were used for \nimmunohistochemistry (IHC) staining to detect SOX18 \nexpression.\nDifferential gene analysis\nGSE11691 (containing ectopic endometrium ( n = 9) \nsamples and eutopic endometrium ( n = 9) samples) gene \nexpression profile was downloaded from the GEO data -\nbase (  h t t p  s : /  / w w w  . n  c b i  . n l  m . n i  h .  g o v / g e o /). The  fi   l t e r i n \ng conditions for differentially expressed genes (DEGs) \nbetween ectopic and eutopic endometrial tissue samples \nwere:|log2FC|>1, p < 0.01. At last, GO and KEGG enrich -\nment analyses were performed to explore important \npathways.\n\nPage 3 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nAllograft mouse model of EMS\nThe animal experiments were in lined with Guide for the \nCare and Use of Laboratory Animals, and approved by \nEthics Committee of the Nanchang University. EMS was \ninduced by a previously described method [ 22]. Eight-\nweek-old female C57BL/6J mice were used for model -\ning. One week before EMS induction surgery, mice were \nsubcutaneously injected with estradiol valerate (0.2  mg/ \nmouse). The donor mice were then killed, the uterine \nhorns removed and placed in a dish containing ster -\nile saline. After stripping the serosa and myometrium, \nthe endometrium-rich fragments were shredded. Pro -\ncessed fragments are always smaller than 1 mm 3. Frag -\nments suspended in sterile saline were intraperitoneally \ninjected into recipient mice. Fragments of endometrial \ntissue obtained from one mouse were injected into two \nmice. Mice in sham group were injected with the same \nvolume of normal saline intraperitoneally. One week after \ntransplantation of donor endometrial fragments, recipi -\nent mice were intraperitoneally injected with SOX18 \noverexpression or control adenovirus (1 × 109 pfu, volume \nno more than 1 ml). Three weeks later, a second injection \nof adenovirus was administered. The recipient mice were \nsacrificed 42 days after transplantation of donor endome-\ntrial fragments, and the recipient mice were dissected to \nobtain ectopic endometrial tissues, and endometrial tis -\nsues of the sham group were also collected.\nHistology and IHC staining\nH&E staining was used to detect the pathological \nchanges of ectopic endometrium in recipient mice. Tis -\nsues were embedded in paraffin and cut into 5 μm-thick \nsections. Sections were deparaffinized in xylene and \ndehydrated with graded ethanol. Afterwards, sections \nstained with hematoxylin (Solarbio, Beijing, China) for \n5  min and eosin (Sangon Biotech, Shanghai, China) for \n3  min. Finally, the staining was observed under a DP73 \nmicroscope (Olympus, Japan).\nFor IHC staining, paraffin-embedded sections were \ndeparaffinized and rehydrated, and the endogenous per -\noxidase was blocked with 3% H 2O2. Primary antibod -\nies (anti-SOX18, bs-17135R, 1: 100, BIOSS, Changzhou, \nChina; anti-OTUB1, GTX101973, 1: 100, GeneTex, \nUSA; anti-Vimentin, A19607, 1: 100, ABclonal, Shang -\nhai, China) were added and incubated overnight at 4 °C, \nfollowed by incubation with HRP-conjugated secondary \nantibody (31460, 1: 500, ThermoFisher, USA) at 37  °C \nfor 30  min. Subsequently, sections were incubated with \nDAB (MXB® Biotechnology, Fuzhou, China), stained \nwith hematoxylin and finally pictured under a DP73 \nmicroscope.\nCell culture and transfection\nIshikawa cells were purchased from iCell Bioscience Inc \n(Shanghai, China) and cultured in MEM medium (Solar -\nbio, Beijing, China) containing 15% fetal bovine serum at \n37℃ and 5% CO2.\nTo overexpress SOX18 and OTUB1, we amplified the \ncDNA of SOX18 or OTUB1 and subcloned them into \npcDNA3.1. For the knockdown of SOX18, OTUB1 and \nYAP1, we synthesized shRNA targeting these genes \nand subcloned them into pRNAH1.1 with the following \nsequences:\nshSOX18#1:  G A G T T C G A C C A G T A C C T C A A T T C A A \nG A G A T T G A G G T A C T G G T C\n G A A C T T T T T T.\nshSOX18#2:  G G G G C A A A G G A C G A G C G C A A T T C A \nA G A G A T T G C G C T C G T C C T\n T T G C C C T T T T T.\nshOTUB1: \n G C C G A C T A C C T T G T G G T C T A T T C A A G A G A T A G A \nC C A C A A G G T A G\n T C G G T T T T T.\nshYAP1: \n G G G T C A G A G A T A C T T C T T A A T T C A A G A G A T T A A \nG A A G T A T C T C T G A\n C C T T T T T.\nIshikawa cells were transfected with the overexpres -\nsion plasmids or shRNA plasmids using Lipofectamine \n3000 (Invitrogen, USA) according to the manufacturer’s \nprotocols.\nCell viability\nCCK-8 kit (Solarbio) was employed to detect cell viability \nat 0, 24, 48 and 72  h after transfection. Optical density \n(OD) values were measured at 450  nm with microplate \nreader 800TS (BioTek, USA).\nCell invasion and migration\nTranswell assays were used to evaluate cell migration and \ninvasion. Briefly, 200 µl cell suspension was added to the \nupper chamber and precoated with/without Matrigel gel \n(Corning, USA). Medium supplemented with 10% FBS \nwas added to the lower chamber. Afterwards, cells were \nallowed to migrate or invade into the lower chamber. \nAfter washing with PBS, cells were fixed with 4% poly -\nformaldehyde for 20  min and stained with 0.5% crystal \nviolet (Amresco, USA) for 5 min. Finally, cells were coun-\nterstained and photographed with a DP73 microscope.\nImmunofluorescence double staining\nCells were fixed with 4% paraformaldehyde and incu -\nbated with 0.1% tritonX-100 (Beyotime, Shanghai, China) \nat room temperature for 30 min. After blocking with 1% \nBSA, cells were incubated with primary antibodies (anti-\nOTUB1, 1: 100, ab270959, Abcam, UK and anti-YAP1, 1: \n\nPage 4 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \n50, sc-271134, Santa Cruz Biotechnology, USA) at 4  °C \novernight, followed by incubation with secondary anti -\nbodies (FITC-labeled goat anti-rabbit IgG, ab6717, 1: 200, \nAbcam) or (Cy3-labeled goat anti-mouse IgG, ab97035, 1: \n200, Abcam) at room temperature for 1 h. After that, sec-\ntions were treated with DAPI (Aladdin, Shanghai, China), \nand the staining was observed under DP73 microscope.\nReal-time PCR\nTotal RNA was extracted by TRIpure (BioTeke, Beijing, \nChina). cDNA was obtained by All-in-One First-Strand \nSuperMix (Magen, Guangzhou, China). Real-time PCR \nwas performed using 2×Fast Taq plus PCR Master Mix \n(Biosharp, Hefei, China) and SYBR Green (Solarbio) in \nPangaea 3 fluorescence quantifier (Aperbio, Suzhou, \nChina). The expression of targeted genes was analyzed \nwith a 2 −ΔΔCt  method. GAPDH was used as an internal \ncontrol. Primers used are shown in Table 1.\nWestern blot\nTissue and cell lysates were prepared with RIPA buf -\nfer (Solarbio) containing 10% PMSF (Solarbio). Next, \nprotein concentrations were quantified using a BCA kit \n(Solarbio). Samples were separated by sodium dodecyl \nsulfate-polyacrylamide gel electrophoresis on a 10% gel \n(Solarbio) and transferred to a polyvinylidene fluoride \nmembrane (Millipore, USA). Membranes were incubated \nwith primary antibodies at 4 °C overnight and goat anti-\nrabbit HRP-conjugated IgG (SE134, 1: 3000, Solarbio) or \ngoat anti-mouse HRP-conjugated IgG (SE131, 1: 3000, \nSolarbio) at 37 °C for 1 h. Next, membranes were devel -\noped with electrochemiluminescence regent (Beyotime) \nfor 5  min and visualized by Tanon Image (Shanghai, \nChina).\nPrimary antibodies used are as follows: anti-SOX18 \n(R381018, 1: 500, Zen-bioscience, Chengdu, China), \nanti-YAP1 (sc-271134, 1:300; Santa Cruz), anti-OTUB1 \n(ab270959, 1: 1000, Abcam), anti-PCNA (200947-2E1, 1: \n1000, Zen-bioscience), anti-E-cadherin (340341, 1:500, \nZen-bioscience), anti-N-cadherin (240010, 1: 1000, \nZen-bioscience), and anti-Vimentin (R22775, 1: 500, \nZen-bioscience).\nDual-luciferase reporter assay\nTo determine the transcription activity of OTUB1, pGL3 \nluciferase reporter vector containing the OTUB1 pro -\nmoter sequence was constructed and transfected into \nIshikawa cells with SOX18 overexpression plasmid. pRL-\nTK was used as control plasmid. After 48 h of transfec -\ntion, cells were harvested, and luciferase activity was \nmeasured by the kit (Keygen Biotech, Nanjing, China).\nChromatin-immunoprecipitation (Ch-IP)\nCh-IP was performed using the kit (Beyotime) accord -\ning to the manufacturers’ instructions. In brief, cells \nwere cross-linked with 1% formaldehyde for 10  min at \n37  °C and then broken down by ultrasonic treatment. \nAfter centrifugation, 70 µl Protein A/G beads were added \nand left for 30 min at 4 °C, and 20 µl sample was used as \ninput. Afterwards, the mixture of DNA and protein was \nthen incubated with 1  µg antibodies at 4  °C overnight. \nSamples were de-crosslinked with 20  µl 5  M NaCl at \n65 °C for 4 h, and purified DNA fragments were extracted \nwith phenol and chloroform for PCR.\nCo-immunoprecipitation (Co-IP)\nCells were lysed in RIPA lysis buffer containing 10% \nPMSF (Solarbio), and protein was isolated. Antibodies \nwere immobilized, and immunoprecipitation was then \ncarried out using the co-IP kit (Pierce, USA) following \nthe manufacturer’s protocol. Briefly, 200 µl IP cross-link-\ning buffer was used to wash AminoLink conjugated resin. \nNext, lysates were added to the corresponding resin in \nwhich the corresponding antibodies had been cured. \nAfter elution, samples were applied for western blot.\nTo evaluate ubiquitination of YAP1, Ishikawa treated \nwith a 20 µM proteasome inhibitor MG132 for 8 h. West-\nern blot was used to detect the ubiquitination levels of \nYAP1. Antibodies used are as follows: anti-YAP1 (sc-\n271134, 1: 300, Santa Cruz Biotechnology), anti-OTUB1 \n(ab270959, 1: 1000, Abcam, UK), flag (R24091, 1: 5000, \nZen-bioscience), myc (250112, 1: 5000, Zen-bioscience), \nand ubiquitin (381080, 1: 1000, Zen-bioscience).\nProtein stability\nIshikawa cells were treated with 100 µg/ml CHX (Alad -\ndin) for 0, 2, 4, 6 and 8 h. The residual rate of YAP1 pro -\ntein was calculated.\nTable 1 Primers used for real-time PCR assay\nGene Primer sequences (5’-3’) Product size (bp)\nhomo SOX18 F GGCAAAGCGTGGAAGGAG 101\nhomo SOX18 R TTGTAGTTGGGGTGGTCGC\nhomo CTGF F AAATCTCCAAGCCTATCAAGTT 124\nhomo CTGF R GGCAGGGTGGTGGTTCT\nhomo YAP1 F TGACCCTCGTTTTGCCATGA 125\nhomo YAP1 R GTTGCTGCTGGTTGGAGTTG\nhomo OTUB1 F CTGTTTCTATCGGGCTTTC 235\nhomo OTUB1 R GGAGGTGCTCTGGTCATT\nhomo ChIP-OTUB1 F GTGAAGCATACACCAGGAT 187\nhomo ChIP-OTUB1 R AGCCACCACTAAAGCAG\nmus SOX18 F CGTTTCCCAATCCTCTGTC 150\nmus SOX18 R TAGTGGCATCCGGTCGA\nmus OTUB1 F TAGCGACTCCGAAGGTG 231\nmus OTUB1 R AAGCAGTTGCCATCAGG\n\nPage 5 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nDNA pull-down\nDNA pull-down was conducted with Sufficient reagents \nfor 40 DNA pull down assay kit (BersinBio, Guangzhou, \nChina) according to the manufacturer’s protocol. Briefly, \nnuclear protein was extracted, and 40  µl Agarose beads \nwere added to the protein samples at 4  °C for 30  min. \nAfter centrifugation, protein samples were added with \n500  µl binding buffer, 5  µl poly (dI·dC), 5  µl protease \ninhibitor, 5  µl DTT, 9  µl EDTA, 4.5  µl EGTA, and then \nadded to the probe-magnetic bead complex. After incu -\nbation at 4  °C for 1  h, magnetic beads were collected. \nFinally, 15 µl protein samples were employed for western \nblot analysis.\nStatistical analysis\nGraphPad Prism 8 was utilized for data analysis. Differ -\nences between the two groups were evaluated using Stu -\ndent’s t test. Comparisons among three or more groups \nwere made using one-way ANOVA and Tukey’s post hoc \ntests. Pearson correlation analysis was used to evaluate \nthe correlation between SOX18 and OTUB1. p < 0.05 was \nconsidered statistically significant.\nResults\nThe expression of SOX18 was significantly upregulated in \nGEO database and clinical samples of EMS\nIn order to explore the potential factors of EMS, we first \nanalyzed the GEO public database and obtained the \nexpression data of GSE11691 chip. As revealed in volcano \nplot, 575 genes were significantly upregulated and 292 \ngenes were significantly downregulated in ectopic endo -\nmetrium compared with eutopic endometrium (Fig.  1A). \nTo shed light on the biological function of DEGs, GO and \nKEGG pathway analysis was performed. The results dis -\nplayed that DEGs associated with GO annotation were \nenriched in regulation of cell-cell adhesion, cell chemo -\ntaxis, cell growth, positive regulation of Hippo signaling, \nand DNA-binding transcription factor binding (Fig.  1B). \nDEGs enriched KEGG pathways were cell adhesion mol -\necules, ECM-receptor interaction and cytokine-cytokine \nreceptor interaction (Fig.  1B). The above enriched path -\nways indicated the pathogenic mechanism of EMS and \nprovide possible directions for further study.\nSOX transcription factor family is involved in many \nbiological processes, including cell proliferation, migra -\ntion and invasion. The role of members of the family of \nthe SOX in EMS aroused our great interest. Therefore, \nwe presented the expression of SOX family members \nin the GSE11691 chip by heat map (Fig.  1C). Among \nthem, three SOX family members were identified as \nDEGs, including SOX18, SOX10 and SOX11. SOX18 and \nSOX10 were upregulated genes, and SOX11 was down -\nregulated genes. By querying the function of these DEGs, \nSOX18 was selected as a potential molecular target for \nfollow-up study. As presented in Fig.  1D-E, SOX18 was \nhighly expressed in ectopic endometrial tissues based \non the data of GSE11691 microarray and IHC staining. \nThese findings indicated that SOX18 may play a key role \nin the development of EMS.\nSOX18 overexpression promoted the proliferation of \nIshikawa cells\nTo further determine the potential function of SOX18 \nin EMS, we conducted a series of validation tests by \noverexpressing or silencing SOX18 in Ishikawa cells, \nrespectively. SOX18 expression was downregulated by \ntransfection with shRNA plasmid targeting SOX18, \nand its expression was upregulated by transfection with \noverexpression plasmid (Supplementary Fig.  1A). Sub -\nsequently, the impact of SOX18 on cell proliferation was \ndetected. Findings from CCK-8 assay indicated that over-\nexpression of SOX18 resulted in a noteworthy increase \nin OD450 values, while knockdown of SOX18 reduced \ncell viability (Fig.  2A). In addition, our data presented \nthat SOX18 overexpression elevated PCNA and SOX18 \nexpression, while SOX18 knockdown showed the oppo -\nsite effect (Fig.  2B). These observations illustrated that \nSOX18 potentiated the proliferation of Ishikawa cells.\nSOX18 overexpression facilitated the migration, invasion \nand EMT of Ishikawa cells\nThe influence of SOX18 on the migration and invasion of \nIshikawa cells was investigated through Transwell assays \nwith or without Matrigel-precoat. Overexpression of \nSOX18 significantly enhanced the migratory and inva -\nsive capabilities of cells, while silencing SOX18 had a sig -\nnificant effect on reversing migration characteristics and \nreducing invasiveness of cells (Fig.  3A). To further exam-\nine whether SOX18 facilitates migration and invasion of \ncells by promoting EMT process, western blot analysis \nwas employed to detect the expression of EMT mark -\ners. As shown in Fig.  3B, the levels of epithelial markers \n(E-cadherin) were decreased, whereas, the levels of mes -\nenchymal markers (N-cadherin and vimentin) were obvi -\nously elevated in SOX18-overexpressed cells. Conversely, \nthe levels of EMT marker showed the opposite change \nin response to SOX18 knockdown (Fig.  3B). To sum up, \nour results demonstrated that SOX18 was involved in cell \nmigration, invasion and EMT, thus leading to the process \nof EMS.\nSOX18 overexpression enhanced the Hippo/YAP1 signaling \npathway in Ishikawa cells\nPrevious GO enrichment analysis revealed that DEGs \nwas enriched in regulation of Hippo signaling. Therefore, \nwe characterized the mechanism by which SOX18 influ -\nences the Hippo/YAP1 pathway. For western blot assay, \nSOX18 overexpression upregulated YAP1 expression, \n\nPage 6 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nFig. 1 The expression of SOX18 was significantly upregulated in GEO database and clinical samples of EMS. The data of GSE11691 gene expression profile \nwere collected, and the DEGs screening criteria was │log2FC│>1, p < 0.01 for bioinformatics analysis. (A) Volcano plot of GSE11691 microarray data was \nused to display gene expression. ( B) GO and KEGG analysis were performed on the selected DEGs. ( C) The heat map showed the expression of all SOX \nfamily members in GSE11691 chip. (D) The expression of SOX18 in human endometrial tissues based on the data of GSE11691 microarray. (E) IHC staining \nwas used to detect the expression of SOX18 in eutopic and ectopic endometrium of patients with EMS, and the staining results were analyzed by H-score. \nScale bar: 50 μm. *, p < 0.05. ***, p < 0.001. Data are presented as mean ± SD\n \n\nPage 7 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nwhile SOX18 knockdown inhibited its expression \n(Fig.  4A). Furthermore, the influence of SOX18 on the \ndownstream factor of Hippo/YAP1 signaling path -\nway was examined. Of note, SOX18 overexpression \nenhanced the expression of CTGF, while SOX18 knock -\ndown showed the opposite function (Fig.  4B). To gain a \ndeeper understanding of the functional changes induced \nby SOX18, Ishikawa cells were transfected with shRNA \nplasmid targeting YAP1. After 48  h, the transfection \nefficiency of YAP1 was verified by real-time PCR and \nwestern blot (Fig.  4C). Next, cells were co-transfected \nwith shRNA plasmid targeting YAP1 and SOX18 over -\nexpression plasmid. As observed, YAP1 knockdown \ninhibited cell viability enhanced by SOX18 (Fig.  4D). \nTranswell assay also confirmed that SOX18 overexpres -\nsion promoted cell invasion, but this effect was nullified \nby YAP1 knockdown (Fig.  4E). In addition, YAP1 knock -\ndown weakened the effect of SOX18 overexpression on \nEMT process, accompanied by increased E-cadherin and \ndecreased N-cadherin and vimentin (Fig.  4F). Together, \nFig. 3 SOX18 overexpression facilitated the migration, invasion and EMT of Ishikawa cells. (A) Transwell assay was used to determine cell migration and \ninvasion. Scale bar: 100 μm. (B) The expression of E-cadherin, N-cadherin and Vimentin was examined by western blot. ***, p < 0.001. ****, p < 0.0001. Data \nare presented as mean ± SD\n \nFig. 2 SOX18 overexpression promoted the proliferation of Ishikawa cells. (A) Cell viability was measured by CCK8 assay. (B) The expression of PCNA and \nSOX18 in the cells was detected by western blot. *, p < 0.05. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD\n \n\nPage 8 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nthese findings suggested that SOX18 promoted the devel-\nopment of EMS by enhancing the Hippo/YAP1 signaling \npathway.\nSOX18 transcriptionally upregulated the expression of \nOTUB1\nA previous study verified that OTUB1 promoted the \noccurrence and development of EMS [ 20]. Jaspar data \nrevealed potential SOX18 binding sites on the OTUB1 \npromoter, suggesting that SOX18 may be involved in the \nprogression of EMS through transcriptional regulation of \nOTUB1. Therefore, we further elucidated the regulatory \nmechanism of SOX18 and OTUB1. Firstly, IHC stain -\ning results indicated that the expression of OTUB1 was \nincreased in ectopic endometrial tissues compared with \neutopic endometrial tissues (Fig.  5A). Next, the correla -\ntion between SOX18 and OTUB1 in clinical samples was \nanalyzed according to H-score. The results showed a pos-\nitive correlation between SOX18 and OTUB1 (Fig.  5B). \nFurthermore, we discovered that SOX18 overexpression \nupregulated the levels of OTUB1, while SOX18 knock -\ndown downregulated its levels (Fig.  5C). The effect of \nSOX18 on the transcription of OTUB1 was evaluated by \ndual luciferase reporter assay. The results presented a sig-\nnificant increase in OTUB1 promoter activity as a result \nof SOX18 overexpression compared with vector, implying \nthat SOX18 was required to facilitate the transcription of \nOTUB1 (Fig.  5D). The binding of SOX18 to the OTUB1 \npromoter was also verified by Ch-IP assay (Fig.  5E). In \naddition, as demonstrated by DNA pull-down, SOX18 \nwild-type bound to the promoter of OTUB1, but the \nSOX18 mutant did not bind to OTUB1 (Fig.  5F). Totally, \nour data confirmed that SOX18 bound to the OTUB1 \npromoter and transcriptionally upregulated OTUB1.\nFig. 4 SOX18 overexpression enhanced the Hippo/YAP1 signaling pathway in Ishikawa cells. (A) The expression of YAP1 in the cells was tested by western \nblot. (B) The expression of CTGF in the cells was detected by real-time PCR. (C) Ishikawa cells were transfected with shRNA plasmid targeting YAP1. After \n48 h, the transfection efficiency of YAP1 was analyzed by real-time PCR and western blot. (D) Cell viability was examined by CCK8 assay. (E) Transwell assay \nwas used to test cell invasion. Scale bar: 100 μm. (F) The expression of E-cadherin, N-cadherin and Vimentin was detected by western blot. **, p < 0.01. ***, \np < 0.001. ****, p < 0.0001. Data are presented as mean ± SD\n \n\nPage 9 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nOTUB1 interacted with YAP1 and enhanced its protein \nstability\nOur previous results demonstrated that SOX18 tran -\nscriptionally activated OTUB1 and promoted the Hippo/\nYAP1 signaling pathway. Notably, hitpredict analysis \nrevealed the binding of OTUB1 to YAP1. Accordingly, we \nfurther clarified the molecular mechanism of OTUB1 and \nYAP1. Co-localization of OTUB1 and YAP1 in Ishikawa \ncells was detected by immunofluorescence double stain -\ning. The results showed that OTUB1 and YAP1 were \nmainly colocalized in cytoplasm (Fig.  6A). Co-IP also \nused to verify the interaction of OTUB1 to YAP1 in cells \n(Fig. 6B). To further explore the binding region of the two \nproteins, HEK-293T was co-transfected with an overex -\npression plasmid of different protein domains of OTUB1 \n(with a flag tag) and an overexpression plasmid of YAP1 \n(with a myc tag). The data certified that the OTU domain \nof OTUB1 combined with YAP1 (Fig.  6C). Furthermore, \nOTUB1 overexpression increased YAP1 levels, while \nOTUB1 knockdown showed the opposite effect (Fig. 6D). \nWe further asked whether OTUB1 upregulates YAP1 \nexpression through the proteasome pathway. To this end, \nIshikawa cells were treated with 20 µM protease inhibitor \nMG132 for 8 h, and YAP1 expression was tested by west -\nern blot. The results indicated that the levels of YAP1 \nwere upregulated after the addition of MG132 to OTUB1 \nknockdown cells (Fig.  6E). Subsequently, the effect of \nOTUB1 on the half-life of YAP1 protein was investigated, \nand the results displayed that overexpression of OTUB1 \ninhibited its protein degradation (Fig.  6F). Notably, fur -\nther assay suggested that OTUB1 overexpression medi -\nated deubiquitination of YAP1 (Fig.  6G). Based on the \nabove findings, we proved that OTUB1 deubiquitinated \nYAP1 and enhanced its protein stability.\nFig. 5 SOX18 transcriptionally upregulated the expression of OTUB1. ( A) IHC staining was employed to test the expression of OTUB1 in eutopic and \nectopic endometrium of patients with EMS, and the staining results were analyzed by H-score. Scale bar: 50 μm. ( B) Correlation between SOX18 and \nOTUB1 in clinical samples of EMS. ( C) The expression of OTUB1 in the cells was verified by real-time PCR and western blot. ( D) The luciferase reporter \nvector containing OTUB1 promoter sequence was co-transferred into Ishikawa cells with SOX18 overexpression plasmid. After 48 h, luciferase activity \nwas detected by the kit. (E) The binding of the exogenous SOX18 and OTUB1 promoter was examined by Ch-IP , and the PCR products were detected by \nagarose gel electrophoresis. ( F) DNA pull-down analysis of SOX18 and OTUB1 promoter binding in Ishikawa cells. **, p < 0.01. ****, p < 0.0001. Data are \npresented as mean ± SD\n \n\nPage 10 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nOTUB1 knockdown abolished the effect of SOX18 \noverexpression on EMS procession\nWe further verified whether OTUB1 mediates the role of \nSOX18 in the regulation of EMS progression and Hippo/\nYAP1 signaling pathway. Ishikawa cells were transfected \nwith shRNA plasmid targeting OTUB1 and SOX18 over -\nexpression plasmid. CCK8 experiment suggested that \nSOX18 overexpression promoted cell viability, while \nthis effect was abolished OTUB1 knockdown (Fig.  7A). \nFurthermore, overexpression of SOX18 promoted cell \ninvasion and EMT, whereas, knockdown of OTUB1 \nshowed the opposite effect (Fig.  7B-C). SOX18 enhanced \nthe Hippo/YAP1 signaling pathway, which was also coun-\nteracted by OTUB1 knockdown (Fig.  7D). Collectively, \nthese findings indicated that OTUB1 knockdown abro -\ngated the impact of SOX18 overexpression on Ishikawa \ncells, implying that SOX18-OTUB1-YAP1 axis played a \nvital role during EMS.\nFig. 6 OTUB1 interacted with YAP1 and enhanced its protein stability. (A) The co-localization of OTUB1 and YAP1 in Ishikawa cells was detected by immu-\nnofluorescence double staining. Scale bar: 50 μm. (B) Co-IP was used to verify the binding of OTUB1 to YAP1 in Ishikawa cells. (C) Overexpression plasmids \nof different protein domains of OTUB1 (with a flag tag) were co-transfected with YAP1 overexpression plasmid (with a myc tag) to HEK-293T. After 48 h, \nthe binding of OTUB1 to YAP1 in the cells was determined by Co-IP . (D) Ishikawa cells were transfected with shRNA plasmid targeting OTUB1 or OTUB1 \noverexpressed plasmid. After 48 h, the expression of OTUB1 and YAP1 were detected by western blot. ( E) The expression of YAP1 in Ishikawa cells was \nexamined by western blot after 20 µM MG132 treatment for 8 h. (F) Ishikawa cells were treated with 100 µg/ml CHX for 0, 2, 4, 6 and 8 h. The expression \nof YAP1 was detected by western blot, and the residual rate of YAP1 protein was calculated. (G) After Ishikawa cells were treated with 20 µM MG132 for \n8 h, the levels of ubiquitination in the cells were measured by co-IP . ****, p < 0.0001. Data are presented as mean ± SD\n \n\nPage 11 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nSOX18 overexpression worsened the progression of EMS in \nan animal model\nOur in vitro experiments demonstrated that SOX18 fos -\ntered the proliferation, migration, invasion and EMT. \nWe next asked whether SOX18 affects the develop -\nment of EMS in vivo. To test this hypothesis, we estab -\nlished allograft mouse model of EMS. In the therapeutic \nmodel, endometriotic-like lesions were observed. The \nresults suggested that the EMS mice had obvious endo -\nmetriotic-like lesions, and the lesions were more severe \nafter SOX18 overexpression (Fig.  8A). Meanwhile, H&E \nstaining revealed successful formation of cystic endome -\ntriotic lesions with epithelial and stromal cells in EMS \nmice overexpressing SOX18 (Fig.  8B). Overexpression \nof SOX18 increased the levels of Vimentin in the ectopic \nendometrial tissues of recipient mice (Fig.  8C). Further-\nmore, the expression of SOX18, and YAP1 and OTUB1 \nin the ectopic endometrial tissues of recipient mice was \nalso upregulated in response to SOX18 overexpression \n(Fig.  8D-E). Following on these results, we emphasized \nthat SOX18 overexpression worsened the progression of \nEMS in vivo.\nDiscussion\nEMS is one of the most common causes of chronic pelvic \npain and infertility [ 23]. EMT is a special biological pro -\ncess in which immotile epithelial cells are transformed \ninto highly motile mesenchymal cells with migratory \nand invasive properties during EMS [ 24, 25]. This study \ninvestigated the effect of SOX18 on the EMS develop -\nment and the possible underlying molecular mechanism \nin Ishikawa cells and a surgically induced mouse EMS \nmodel.\nSOX18, a member of the SOX transcription factor \nfamily, is involved in a variety of biological processes. \nIncreasing evidence suggested that SOX18 promoted \nthe progression of many cancers. For example, SOX18 \nexacerbated gastric cancer metastasis via transactivat -\ning MCAM and CCL7 [ 9]. Overexpression of SOX18 \nalso promoted cell metastasis in hepatocellular carci -\nnoma [ 26]. Downregulation of SOX18 suppressed the \nproliferation, migration and invasion of laryngeal can -\ncer cells via regulation of JAK2/STAT3 signaling path -\nway [ 27]. Upregulation of SOX18 in colorectal cancer \ncells also significantly elicited proliferation and inhib -\nited apoptosis [ 28]. In this work, bioinformatics analysis \nshowed a significant increase in SOX18 expression in \nectopic endometrial tissues compared to ectopic endo -\nmetrial tissues. The above results were also confirmed \nby IHC staining of clinical samples. Ishikawa, a human \nendometrial adenocarcinoma cell line, is usually selected \nas a cell model to study the transformation of endome -\ntrial glandular epithelial cells from non-receptive state \nto receptive state [ 29]. In the present study, cell func -\ntion experiments suggested that SOX18 overexpression \nplayed an important role in maintaining proliferation, \nmigration and invasion of Ishikawa cells, whereas down -\nregulation of SOX18 inhibited these cellular bioactivi -\nties. Concomitantly, upregulation of SOX18 increased \nthe expression of N-cadherin and vimentin, as well as \ndecreased the expression of E-cadherin, indicating that \nSOX18 enhanced EMT procession. Therefore, SOX18 \nFig. 7 OTUB1 knockdown abolished the effect of SOX18 overexpression on Ishikawa cells. ( A) Cell viability was tested by CCK8 assay. ( B) Cell invasion \nwas detected by Transwell assay. Scale bar: 100 μm. (C) The expression of E-cadherin, N-cadherin and Vimentin was determined by western blot. (D) The \nexpression of YAP1 in the cells was measured by western blot. **, p < 0.01. ****, p < 0.0001. Data are presented as mean ± SD\n \n\nPage 12 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nmay exhibit oncogene-like properties in EMS by trigger -\ning the EMT process. In allograft mouse model of EMS, \nour results ascertained that SOX18 overexpression led to \nthe worsening of EMS, manifested by increased lesions \nand histological changes in mice. These data substan -\ntiated that SOX18 participated in the development of \nEMS. Nevertheless, further investigation is warranted to \nelucidate the underlying molecular mechanism.\nYAP1 is a downstream effector of Hippo pathway. \nWhen activated, YAP1 localizes to the nucleus and binds \nto transcription factors such as TEA domain DNA bind -\ning family of transcription factors (TEAD) [ 30]. Next, \nYAP1 instigates tumor growth, metastasis of cancer cells \nand induces EMT in a variety of tumors. For example, \nYAP1 regulated the transcription of Slug by interacting \nwith TEAD to induce EMT in non-small cell lung can -\ncer [ 31]. In addition, elevated YAP1 expression facili -\ntated proliferation and blocked apoptosis in endometrial \nstromal cells [ 16]. Herein, we further explored whether \nSOX18 plays a role in EMS by regulating Hippo/YAP1 \nsignaling pathway. As demonstrated, SOX18 upregulated \nthe levels of YAP1 and its downstream factor CTGF, sug-\ngesting that SOX18 enhanced the Hippo/YAP1 signaling \npathway. Functional rescue experiments corroborated \nthat YAP1 knockdown eliminated the influence of SOX18 \non EMS progression, indicating that SOX18 promoted \nEMS progression through regulating the Hippo/YAP1 \nsignaling pathway.\nFig. 8 SOX18 overexpression worsened the progression of EMS in an animal model. (A) Photographs of endometriotic lesions in recipient mice. (B) H&E \nstaining was used to detect the histopathological changes of ectopic endometrium in recipient mice. Scale bar: 100 μm. ( C) The expression of Vimentin \nin ectopic endometrial tissues of recipient mice was measured by IHC staining. (D) Real-time PCR or western blot were used to examine the expression of \nSOX18 and YAP1 in ectopic endometrial tissues of recipient mice. Scale bar: 50 μm. (E) The expression of OTUB1 in ectopic endometrial tissues of recipient \nmice was tested by real-time PCR and IHC staining. Scale bar: 50 μm. *, p < 0.05. ****, p < 0.0001. Data are presented as mean ± SD\n \n\nPage 13 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nIn order to further explore the potential mechanism of \nSOX18 and Hippo/YAP1 signaling pathway, we analyzed \nthe potential downstream factors of SOX18. Analysis of \nJaspar database revealed that the binding sites of SOX18 \nexisted in the promoter region of OTUB1, suggesting \nthat OTUB1 may be regulated by SOX18. OTUB1 is a \ndeubiquitinating enzyme that blocks ubiquitination. A \nprevious study unraveled that OTUB1 contributed to the \npathogenesis of EMS by stabilizing HSF1 [ 20]. Our series \nof experiments verified that SOX18 bound to the OTUB1 \npromoter region and promoted its transcription. Based \non these results, we postulated that SOX18 instigated the \ndevelopment of EMS through transcriptional activation \nof OTUB1.\nOf note, OTUB1 led to gastric cancer progression by \nstabilizing YAP1 and regulating Hippo/YAP1 signaling \n[21]. Accordingly, we also identified the regulatory rela -\ntionship between OTUB1 and YAP1. Co-IP verified the \ncombination of OTUB1 and YAP1. Additionally, our data \nconfirmed that OTUB1 deubiquitinated YAP1 and pro -\nmoted its protein stabilization. We further emphasized \nwhether OTUB1 mediates the impact of SOX18 on EMS \nprogression and the Hippo/YAP1 signaling pathway. \nRescue experiment results demonstrated that knocking \ndown OTUB1 abrogated the effect of SOX18 overex -\npression, suggesting that the SOX18-OTUB1-YAP1 axis \nplayed a vital role during EMS.\nHowever, there are some limitations to this study. First, \nthe results of this study are expected to provide a new \ntheoretical basis and a new target for the early detec -\ntion, diagnosis, and clinical treatment of EMS. However, \nfurther validation of additional EMS patient samples \nis needed to confirm the clinical value of SOX18. In \naddition, we performed functional experiments using \nIshikawa cells instead of primary endometrial epithelial \ncells, which may lead to unreliable conclusions. Finally, \nEMS may involve other pathogenic mechanisms. For \nexample, SOX18 may also affect the progression of EMS \nby regulating NF-kappa B signaling pathway and PI3K-\nAkt signaling pathway. Thus, the deeper mechanism of \nSOX18 also need to be further studied.\nConclusions\nAccording to these findings, our study provides in vitro \nand in vivo evidence to shed light on the role of SOX18 \nin EMS and reveal its potential molecular mechanism \n(Fig. 9). Targeting the SOX18-OTUB1-YAP1 axis may be \na promising treatment strategy for EMS.\nFig. 9 Schematic illustration showing the mechanism of SOX18-OTUB1-YAP1 axis in promoting EMS progression\n \n\nPage 14 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \nSupplementary Information\nThe online version contains supplementary material available at  h t t p s :   /  / d o  i .  o r  \ng  /  1 0  . 1 1   8 6  / s 1 2  9 6 7 -  0 2 5 - 0  6 6 7 7 - y.\nSupplementary Material 1\nAcknowledgements\nWe thank the staff of Second Affiliated Hospital of Nanchang University for \ntheir efforts in clinical sample collection.\nAuthor contributions\nYing Feng did experiments, wrote and revised the manuscript. Jiamei Yue, Si \nFan and Jiayan Wu collected data, performed data analysis and summarized \nthe results. All authors reviewed and approved the final version of the \nmanuscript.\nFunding\nThis work was supported by the Natural Science Foundation of Jiangxi \nProvince (Grant No. 20232BAB206027).\nData availability\nAll data generated or analyzed during this study are available from the \ncorresponding author upon reasonable request.\nDeclarations\nEthics approval\nThe clinical study was approved by the Medical Ethics Committee of the \nSecond Affiliated Hospital of Nanchang University and conducted in \naccordance with the Declaration of Helsinki. The animal experiments were in \nlined with Guide for the Care and Use of Laboratory Animals, and approved by \nEthics Committee of the Nanchang University.\nConsent for publication\nAll authors approved the final manuscript and the submission to this journal.\nCompeting interests\nThe authors state that there are no conflicts of interest.\nReceived: 11 April 2025 / Accepted: 30 May 2025\nReferences\n1. Zondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN. Vigano P: endome-\ntriosis. Nat Rev Dis Primers. 2018;4:9.\n2. Malvezzi H, Marengo EB, Podgaec S, Piccinato CA. Endometriosis: current \nchallenges in modeling a multifactorial disease of unknown etiology. J Transl \nMed. 2020;18:311.\n3. Gruber TM, Mechsner S. Pathogenesis of endometriosis: the origin of pain \nand subfertility. Cells. 2021;10.\n4. Matias-Guiu X, Stewart CJR. Endometriosis-associated ovarian neoplasia. \nPathology. 2018;50:190–204.\n5. Falcone T, Flyckt R. Clinical management of endometriosis. Obstet Gynecol. \n2018;131:557–71.\n6. Grimm D, Bauer J, Wise P , Kruger M, Simonsen U, Wehland M, Infanger M, \nCorydon TJ. The role of SOX family members in solid tumours and metastasis. \nSemin Cancer Biol. 2020;67:122–53.\n7. Chen J, Feng W, Sun M, Huang W, Wang G, Chen X, Yin Y, Chen X, Zhang B, \nNie Y, et al. TGF-beta1-Induced SOX18 elevation promotes hepatocellular \ncarcinoma progression and metastasis through transcriptionally upregulating \nPD-L1 and CXCL12. Gastroenterology. 2024;167:264–80.\n8. Huaqi Y, Caipeng Q, Qiang W, Yiqing D, Tao X. The role of SOX18 in bladder \ncancer and its underlying mechanism in mediating cellular functions. Life Sci. \n2019;232:116614.\n9. Chen J, Dang Y, Feng W, Qiao C, Liu D, Zhang T, Wang Y, Tian D, Fan D, Nie Y, et \nal. SOX18 promotes gastric cancer metastasis through transactivating MCAM \nand CCL7. Oncogene. 2020;39:5536–52.\n10. Huaqi Y, Caipeng Q, Qiang W, Yiqing D, Xiang D, Xu T, Xiaowei Z, Qing L, \nShijun L, Tao X. Transcription factor SOX18 promotes clear cell renal cell car-\ncinoma progression and alleviates Cabozantinib-Mediated inhibitory effects. \nMol Cancer Ther. 2019;18:2433–45.\n11. Yin H, Sheng Z, Zhang X, Du Y, Qin C, Liu H, Dun Y, Wang Q, Jin C, Zhao Y, Xu T. \nOverexpression of SOX18 promotes prostate cancer progression via the regu-\nlation of TCF1, c-Myc, Cyclin D1 and MMP-7. Oncol Rep. 2017;37:1045–51.\n12. Jiang T, Li Z, Zhao D, Hui B, Zheng Z. SOX18 enhances the proliferation \nand migration of airway smooth muscle cells induced by tumor necrosis \nfactor-alpha via the regulation of Notch1 signaling. Int Immunopharmacol. \n2021;96:107746.\n13. Zhao B, Tumaneng K, Guan KL. The Hippo pathway in organ size control, \ntissue regeneration and stem cell self-renewal. Nat Cell Biol. 2011;13:877–83.\n14. Zhao W, Wang M, Cai M, Zhang C, Qiu Y, Wang X, Zhang T, Zhou H, Wang J, \nZhao W, Shao R. Transcriptional co-activators YAP/TAZ: potential therapeutic \ntargets for metastatic breast cancer. Biomed Pharmacother. 2021;133:110956.\n15. Mui CW, Chan WN, Chen B, Cheung AH, Yu J, Lo KW, Ke H, Kang W, To KF. \nTargeting YAP1/TAZ in nonsmall-cell lung carcinoma: from molecular mecha-\nnisms to precision medicine. Int J Cancer. 2023;152:558–71.\n16. Song Y, Fu J, Zhou M, Xiao L, Feng X, Chen H, Huang W. Activated Hippo/Yes-\nAssociated protein pathway promotes cell proliferation and Anti-apoptosis \nin endometrial stromal cells of endometriosis. J Clin Endocrinol Metab. \n2016;101:1552–61.\n17. Herhaus L, Al-Salihi M, Macartney T, Weidlich S, Sapkota GP . OTUB1 enhances \nTGFbeta signalling by inhibiting the ubiquitylation and degradation of active \nSMAD2/3. Nat Commun. 2013;4:2519.\n18. Zhu D, Xu R, Huang X, Tang Z, Tian Y, Zhang J, Zheng X. Deubiquitinating \nenzyme OTUB1 promotes cancer cell immunosuppression via preventing \nER-associated degradation of immune checkpoint protein PD-L1. Cell Death \nDiffer. 2021;28:1773–89.\n19. Han X, Ren C, Lu C, Qiao P , Yang T, Yu Z. Deubiquitination of MYC by OTUB1 \ncontributes to HK2 mediated Glycolysis and breast tumorigenesis. Cell Death \nDiffer. 2022;29:1864–73.\n20. Ling X, Lu J, Wang X, Liu L, Liu L, Wang Y, Sun Y, Ren C, Lu C, Yu Z. Ovar-\nian tumorB1-mediated heat shock transcription factor 1 deubiquitina-\ntion is critical for Glycolysis and development of endometriosis. iScience. \n2022;25:105363.\n21. Yan C, Yang H, Su P , Li X, Li Z, Wang D, Zang Y, Wang T, Liu Z, Bao Z, et al. \nOTUB1 suppresses Hippo signaling via modulating YAP protein in gastric \ncancer. Oncogene. 2022;41:5186–98.\n22. Zhang Z, Wang J, Chen Y, Suo L, Chen H, Zhu L, Wan G, Han X. Activin a pro-\nmotes myofibroblast differentiation of endometrial mesenchymal stem cells \nvia STAT3-dependent smad/ctgf pathway. Cell Commun Signal. 2019;17:45.\n23. Giudice LC. Clinical practice. Endometriosis. N Engl J Med. 2010;362:2389–98.\n24. Xiong W, Zhang L, Liu H, Li N, Du Y, He H, Zhang Z, Liu Y. E(2) -mediated EMT \nby activation of beta-catenin/Snail signalling during the development of \novarian endometriosis. J Cell Mol Med. 2019;23:8035–45.\n25. Ruan J, Tian Q, Li S, Zhou X, Sun Q, Wang Y, Xiao Y, Li M, Chang K, Yi X. The \nIL-33-ST2 axis plays a vital role in endometriosis via promoting epithelial-mes-\nenchymal transition by phosphorylating beta-catenin. Cell Commun Signal. \n2024;22:318.\n26. Chen J, Du F, Dang Y, Li X, Qian M, Feng W, Qiao C, Fan D, Nie Y, Wu K, Xia L. \nFibroblast growth factor 19-Mediated Up-regulation of SYR-Related High-\nMobility group box 18 promotes hepatocellular carcinoma metastasis by \ntransactivating fibroblast growth factor receptor 4 and Fms-Related tyrosine \nkinase 4. Hepatology. 2020;71:1712–31.\n27. Xu Y, Zhang Q, Zhou J, Li Z, Guo J, Wang W, Wang W. Down-regulation of \nSOX18 inhibits laryngeal carcinoma cell proliferation, migration, and invasion \nthrough JAK2/STAT3 signaling. Biosci Rep. 2019;39.\n28. Miao Z, Deng X, Shuai P , Zeng J. Upregulation of SOX18 in colorectal cancer \ncells promotes proliferation and correlates with colorectal cancer risk. Onco \nTargets Ther. 2018;11:8481–90.\n29. Huang Y, Wang Z, Li B, Ke L, Xiong Y, Zhang Y. Loss of KLF15 impairs endome-\ntrial receptivity by inhibiting EMT in endometriosis. J Endocrinol. 2024;261.\n30. Akrida I, Makrygianni M, Nikou S, Mulita F, Bravou V, Papadaki H. Hippo path-\nway effectors YAP , TAZ and TEAD are associated with EMT master regulators \nZEB, snail and with aggressive phenotype in phyllodes breast tumors. Pathol \nRes Pract. 2024;262:155551.\n\nPage 15 of 15\nFeng et al. Journal of Translational Medicine          (2025) 23:647 \n31. Yu M, Chen Y, Li X, Yang R, Zhang L, Huangfu L, Zheng N, Zhao X, Lv L, Hong \nY, et al. YAP1 contributes to NSCLC invasion and migration by promoting slug \ntranscription via the transcription co-factor TEAD. Cell Death Dis. 2018;9:464.\nPublisher’s note\nSpringer Nature remains neutral with regard to jurisdictional claims in \npublished maps and institutional affiliations.","source_license":"CC0","license_restricted":false}