{"paper_id":"5346811d-af66-4e8f-952b-0d9f88b5493b","body_text":"Eur . J. Gynaecol. Oncol. 2022; 43(1): 42–47\nhttp://doi.org/10.31083/j.ejgo4301012\nCopyright: © 2022 The Author(s). Published by IMR Press.\nThis is an open access article under the CC BY 4.0 license .\nPublisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\nOriginal Research\nA rare variant in the MARVELD2 gene is associated with Chinese\nsamples with ovarian endometriosis\nQiu-Y an Wan1,2,3, Rong-Fang Liu 1,3, Y ang Zou3, Y ong Luo3, Jiang-Y an Zhou3,\nYing-Hui Deng4, Xin Zeng 3, Guo-Dong Gao 3, Ou-Ping Huang 1,3,5,*\n1The College of Medicine, Nanchang University, 330006 Nanchang, Jiangxi, China\n2Department of Gynecological Oncology, Jiangxi Cancer Hospital, 330029 Nanchang, Jiangxi, China\n3Key Laboratory of Women’s Reproductive Health of Jiangxi Province, Jiangxi Provincial Maternal & Child Healthcare Hospital, 330006 Nanchang,\nJiangxi, China\n4Department of Pathology, Jiangxi Provincial Maternal & Child Healthcare Hospital, 330006 Nanchang, Jiangxi, China\n5Department of Gynecology, Jiangxi Provincial Maternal & Child Healthcare Hospital, 330006 Nanchang, Jiangxi, China\n*Correspondence: jxfbhop59@126.com (Ou-Ping Huang)\nAcademic Editor: Enrique Hernandez\nSubmitted: 10 September 2021 Revised: 8 November 2021 Accepted: 18 November 2021 Published: 15 February 2022\nAbstract\nObjectives: Endometriosis is a common gynecological disease affecting up to ~10% of women at reproductive age. Prior combined\nstudies implied that MARVELD2 might be involved in the pathogenesis of certain malignancies. Here, 211 Han Chinese samples with\novarian endometriosis were analyzed for the presence of MARVELD2 mutations. Methods: We analyze the potential presence of MAR-\nVELD2 mutations by direct DNA sequencing. Results: A total of 7 variants, 5 missense and 2 synonymous variants, were identified\nin our 211 ovarian endometriosis samples with different frequencies. Among the 5 missense variant, a missense rare variant p.V198M\n(c.592G>A), was identified in 10 out of our 211 samples (4.74%). This rare variant was identified with extremely low frequency in\n766 control samples from 766 Chinese women without endometriosis (0.13%, 1/766) and control samples in the public databases. The\nevolutionary conservation analysis results suggested that the MARVELD2 rare variant lead to highly conserved amino acid substitutions\namong 14 vertebrate species from Human to Snake. Furthermore, both the SIFT and Polyphen-2 programs predicted this rare variant to\nbe ‘disease causing’. However, we failed to observe any statistical significance between the MARVELD2 rare variant and the available\nclinical data. Conclusions: We identified a potential pathogenic rare variant in the MARVELD2 gene in Chinese samples with ovarian\nendometriosis, indicating the MARVELD2 rare variant might play an active role in the pathogenesis of endometriosis.\nKeywords: MARVELD2; Rare variant; Ovarian endometriosis; Han Chinese\n1. Introduction\nEndometriosis is a common gynecological disease, in\nspite of the subject of many scientific researches, the de-\ntailed molecular etiology remains still unclear [ 1]. Among\nwhich, the ‘Sampsons hypothesis’ is the most extensively\nadmissive interpretation, which implies that endometriosis\ntakes place owing to retrograde menstruation, where en-\ndometrial tissue passes through the fallopian tube into the\nperitoneal and pelvic cavity where it implants [ 2]. The im-\nplantation theory indicates the formation of endometriosis\nin the peritoneal cavity and ovary needs endometrial tissue\nor cells fulfilling a process of adhesion, invasion and pro-\nliferation [3].\nTricellulin, a major component of tight junctions, en-\ncoded by the MARVELD2 gene [ 4], was the first identi-\nfied protein to be uniquely localized at the tri-epithelial\njunctions [5]. Prior studies have revealed that MARVELD2\nmutations could cause nonsyndromic deafness, and these\nMARVELD2 mutations were shown to cause tricellulin de-\nfects and deletion, thereby affecting the adhesion and the\ntight junction function between epithelial cells [ 6–8]. Fur-\nthermore, dysregulated MARVELD2 expression was asso-\nciated with patients’ prognosis in certain cancer types [ 9–\n11] and could promote cell migration [12]. Endometriosis is\nsimilar to cancer and exhibits enhanced invasion and migra-\ntion [13–15]. This disorder is considered as a precancerous\nlesion and harbored a variety of mutations in certain onco-\ngene and tumor suppressor genes [ 16–19]. A large-scale\nsequencing effort has revealed that epithelial cells harbored\ncancer-associated mutations promoting the pathogenesis of\nendometriosis [20]. In addition, increased expression of tri-\ncellulin could promote the invasions and metastasis of cer-\ntain human tumor [ 21].\nPrior studies have revealed that certain germline mu-\ntations, including single nucleotide polymorphism (SNP),\nplayed important roles in the pathogenesis of endometrio-\nsis via candidate gene or large-scale sequencing strategies\n[22,23]. In addition, somatic mutations in certain genes,\nwere also shown to confer the risk of endometriosis [ 16–\n18,24]. Prior studies have found that dysregulated expres-\nsion of MARVELD2 was associated with patients’ prognosis\nin certain cancer types [9–11] and could promote cell migra-\n\nTable 1. The potential association of MARVELD2 rare variant with clinical data in 211 Chinese samples with ovarian\nendometriosis.\nFeatures Total sample Wild type (n = 201) Mutation (n = 10) p value\nAge (years) 211 29.56 ± 7.33 31.5 ± 4.72 0.42\nAge of menarche (years) 211 12.53 ± 1.49 13.2 ± 2.14 0.37\nHemoglobin (g/L) 211 122.35 ± 11.34 130.1 ± 4.23 0.16\nTSH (mIU/mL) 211 2.12 ± 1.23 1.8 ± 1.18 0.12\nFT3 (pg/mL) 211 3.15 ± 0.18 3.06 ± 0.26 0.09\nFT4 (ng/dL) 211 1.31 ± 0.13 1.26 ± 0.19 0.08\nAFP (ng/mL) 211 2.62 ± 1.36 3.11 ± 0.93 0.35\nCEA (ng/mL) 211 1.03 ± 0.42 0.96 ± 0.26 0.22\nCA125 (U/mL) 211 115.33 ± 166.23 103.25 ± 78.39 0.56\nSCCA (ng/mL) 211 1.47 ± 0.56 1.52 ± 0.86 0.37\nWhitebloodcellcount (×109) 211 6.26 ± 2.12 6.12 ± 0.58 0.39\nLymphocyte cell count (×10 9) 211 1.88 ± 0.63 1.46 ± 0.39 0.34\nEosinophil granulocyte (×10 9) 211 0.15 ± 0.07 0.08 ± 0.06 0.55\nMononuclear cell count (×10 9) 211 0.47 ± 0.07 0.42 ± 0.09 0.11\nNeutrophil cell count (×10 9) 211 3.88 ± 1.62 3.96 ± 1.22 0.77\nPlatelet (×109) 211 201.38 ± 52.63 213.66 ± 45.38 0.45\nNeutrophil cell proportion (%) 211 58.37 ± 7.66 65.38 ± 3.38 0.27\nTSH, thyroid stimulating hormone; FT3, free triiodothyronine; FT4, free thyroxine; AFP , α-fetoprotein;\nCEA, carcinoembryonic antigen; CA125, cancer antigen 125; SCCA, squamous cell carcinoma antigen.\nTable 2. The primer information for MARVELD2 gene (NM_001038603) amplification.\nGene Exon Annealing PCR amplicon Forward primers (5′-3′) Reverse primers (5′-3′)\nMARVELD2 2 56 ◦C 1260 bp atcagcatcattgagagga acatacacacacaaatgag\nMARVELD2 3 52 ◦C 335 bp atcaacctcttaaaattgag ggtcttgaaattctggtctc\nMARVELD2 4, 5 55 ◦C 706 bp ccacctgatcttcttcctc ctctagatttcagtgctcct\nMARVELD2 6 58 ◦C 339 bp tctcagtgtgctttgagata aatgctcatttctctaggtt\nMARVELD2 7 53 ◦C 286 bp tgtagagagcttaactgttac tggtttcaaataagcgtta\ntion [12]. Considering the important role of tight junction\nplayed in cell invasion and migration [24], and endometrio-\nsis was a premalignant disorder and harbored a number of\nmutations [25,26], we thus hypothesized that MARVELD2\nmutations might also existed in endometriosis samples.\nHere, we recruited and analyzed a total of 211 Chi-\nnese patients with ovarian endometriosis for the presence of\nMARVELD2 mutations. A rare variant in the MARVELD2\ngene was identified in 10 out of 211 samples (4.74%).\n2. Materials and methods\n2.1 Samples\nA total of 211 Chinese patients with ovarian en-\ndometriosis, as well as control samples from 766 Chi-\nnese women without endometriosis were also collected\nfrom Jiangxi Provincial Maternal and Child Health Hospi-\ntal (Nanchang, China). Written informed consent was ob-\ntained from each sample prior to this study, and the present\nstudy was performed according to the tenets of the Helsinki\nDeclaration and was approved by the Institutional Review\nBoard of Jiangxi Provincial Maternal and Child Health Hos-\npital.\n2.2 Clinical data\nThe clinical data for the participating women with\novarian endometriosis was collected at the time of sam-\npling, including age, age at menarche, the laboratorial\ndata included serum hemoglobin, free triiodothyronine\n(FT3), free thyroxine (FT4), thyroid stimulating hormone\n(TSH), carcinoembryonic antigen (CEA), cancer antigen\n125 (CA125), squamous cell carcinoma antigen (SCCA)\nand α-fetoprotein (AFP) were determined on day 3 of the\nmenstrual cycle by radioimmunoassay, as described previ-\nously [17,18]. In addition, the number of white blood cells,\nlymphocytes, eosinophil granulocytes, neutrophil granulo-\ncytes, mononuclear cells, platelet, and neutrophil granulo-\ncyte proportion was analyzed by an automated hematology\nanalyzer XN-3000 (Sysmex Corporation, Kobe, Japan) (Ta-\nble 1), as described previously [ 17,18].\n2.3 DNA extraction and mutation analysis\nThe genomic DNA was extracted from the peripheral\nblood of our samples. Omega Blood DNA kit (OMEGA\nBio-tek Inc., Doraville, GA) was used to isolate the ge-\nnomic DNA for our samples, as described previously\n[17]. The entire coding regions of the MARVELD2 gene\n43\n\nTable 3. The identified variants of the MARVELD2 gene (NM_001038603) in our patients.\nSNP Amino acid /Nucleotide change Frequency SIFT prediction Polyphen-2 prediction\nrs1185246 p.T33I/c.98C>T 43.60% (92/211) Tolerated Benign\nrs111458976 p.Y62Y/c.186C>T 55.45% (117/211) - -\nrs181575833 p.Pro102Pro/c.306G>A 0.48% (1/211) - -\nrs575942430 p.Y159C/c.476A>G 0.48% (1/211) Tolerated Benign\nrs201914751 p.V198M/c.592G>A 4.74% (10/211) Damaging Damaging\nrs771384203 p.G237A/c.710G>C 0.48% (1/211) Tolerated Benign\nrs1198930354 p.V489M/c.1465G>A 1.42% (3/211) Tolerated Benign\nTable 4. The allele frequency comparison of MARVELD2 rare variant among our patients and control samples in the present\nstudy and public databases.\nSNP ID Case (N = 211) Normal control (N = 766) p value a Allele frequency in EXAC p value a Allele frequency in 1000 genome p value a\nrs201914751 10/422 1/1532 2.36 × 10 −6 22/121412 2.2 × 10 −16 3/5008 2.31 × 10 −9\na p value, Fisher’s exact test.\n(NM_001038603) were amplified with certain PCR primer\npairs (Table 2), and subjected to direct DNA sequencing.\nThe PCR reactions were performed as follows, 30 ng DNA,\n1.5 µL 10 × PCR buffer, 250 µM dNTPs mix, 0.20 µM\neach primer, 2.5 mM MgCl 2, 0.5 U Taq DNA polymerase\n(Takara, Dalian, China). The PCR reaction was performed\nas follows: 95 ◦C premature for 5 min, 35 cycles in-\ncluding 94 ◦C for 30 sec, 52–58 ◦C for 45 sec and 72\n◦C for 30 sec, ended with a 10 min extension at 72 ◦C.\nThe obtained PCR products were sequenced on an ABI\n3730XL DNASequencer (Applied Biosystems, Waltham,\nMA, USA). The potential MARVELD2 mutations were an-\nalyzed and aligned with standard DNA sequences of the\nHuman MARVELD2 gene via DNAStar Lasergene software\n(Madison, WI, USA).\n2.4 Evolutionary conservation analysis of the rare variant\nof MARVELD2\nWe downloaded the MARVELD2 proteins\nfrom 14 vertebrate species from GenBank database\n(www.ncbi.nlm.nih.gov/gene), including Human\n(NP_001033692), Chimpanzee (XP_003310745),\nMonkey (XP_001094419), Mouse (NP_001033691),\nRat (NP_001102406), Cattle (XP_002696327),\nDog (XP_019690741), Horse (XP_023474013),\nPig (NP_001230877), Cat (XP_019690741), Tree\nshrew (XP_006169576), Chicken (XP_424965), Bat\n(XP_006762445) and Snake (XP_039176681). The con-\nservation of the mutated MARVELD2 residue was analyzed\nwith MEGA4 software (Tokyo, Japan) [ 27].\n2.5 In silico analysis of the MARVELD2 rare variant\nWe used SIFT [ 28] and Polyphen-2 [ 29] online pro-\ngrams to predict the potential pathogenicity of these mis-\nsense variants of MARVELD2. These programs could auto-\nmatically assess this rare variant to be damaging or benign.\n2.6 Statistical analysis\nWe used two-sided Student’s t-test and Mann-\nWhitney’s method to analyze the potential association of\nnumerical and continuous variables between ovarian en-\ndometriosis samples with and without MARVELD2 muta-\ntions, respectively; Fisher’s exact test was used to analyze\nthe allele frequency of MARVELD2 rare variant between\nthe cases and controls; p value less than 0.05 was consid-\nered statistically significant. All statistical analyses were\nperformed by the software SPSS 19.0 (SPSS, Inc., Chicago,\nIL, USA).\n3. Results\n3.1 Sample characteristics\nThe median age of the samples was 32 years (range,\n20–52) and the median age at menarche was 14 years\n(range, 10–19). The detailed clinical data, including\nhemoglobin, FT3, FT4, TSH, CEA, CA125, SCCA, AFP ,\nand blood cell counts, are summarized in Table 1.\n3.2 MARVELD2 rare variant in ovarian endometriosis\nA total of 7 variants, 5 missense and 2 synony-\nmous variants, were identified in our 211 samples with\novarian endometriosis with different frequencies (Table 3).\nAmong the 5 missense variant, a rare variant (rs201914751)\np.V198M (c.592G>A), was identified with high frequency\nin our samples with ovarian endometriosis (10/211, 4.74%)\n(Fig. 1) (Table 3). This rare variant was found in 766 con-\ntrol samples from 766 Chinese women without endometrio-\nsis with extremely low frequency (0.13%, 1/766) ( p <\n0.01); furthermore, this rare variant existed in extremely\nlow frequencies in control samples in the 1000 genome\n(www.ncbi.nlm.nih.gov/variation/tools/1000genomes) and\nEXAC (www.exac.broadinstitute.org) databases, which in-\ncluded 2504 and 60706 samples, respectively ( p < 0.01)\n(Table 4). The average age and age of menarche of the 10\nsample with MARVELD2 rare variant (p.V198M) was 31.5\n44\n\n\nand 13.2 years old, respectively.\nFig. 1. The representative sequencing electropherograms of\nMARVELD2 p.V198M (c.592G>A) mutation, the arrow refers\nto locations of the mutations. “OCB-176” was an endometriosis\nsamples with MARVELD2 mutation, while “Control” was a con-\ntrol sample without MARVELD2 mutation.\n3.3 In silico and Evolutionary conservation analyses of the\nMARVELD2 missensevariants\nBoth the SIFT and Polyphen-2 programs were used to\npredict the potential pathogenicities of these variants, the\npredicted results showed that the p.V198M variant was ‘dis-\nease causing’; while other four variants were benign. The\nevolutionary conservation analysis result suggested that the\nMARVELD2 rare variant lead to highly conserved amino\nacid substitution from valine to methionine at the 198th\ncodon (V198M), among the 14 vertebrate species from Hu-\nman to Snake (Fig. 2).\n3.4 Association between MARVELD2 rare variant and\nclinical data\nThe clinical data between the ovarian endometrio-\nsis samples with and without MARVELD2 rare variant\n(p.V198M) was analyzed, including patients’ age, age of\nmenarche, FT3, FT4, TSH, hemoglobin, CA125, SCCA,\nAFP , CEA, white blood cell count, eosinophil granulocyte,\nlymphocyte cell count, neutrophil cell count, mononuclear\ncell count, platelet and neutrophil cell proportion. How-\never, we failed to get any significant association between\nMARVELD2 rare variant and these clinical parameters (Ta-\nble 1).\nFig. 2. The evolutionary conservation analysis result of MAR-\nVELD2 p.V198Mmutation from Human to Snake.\n4. Discussion\nMARVELD2, formerly referred to as TRIC-a, encodes\ntricellulin, a tricellular tight junction protein [4]. Tricellulin\nis mainly localized in tricellular cell contacts, while in bi-\ncellular tight junctions to a lesser extent [ 30]. To date, it’s\ndeemed that tricellulin expression ubiquitously exists in ep-\nithelial junctions of tissues and organs throughout the body\n[6], as well as in ovarian epithelia [ 31].\nPrior large-scale sequencing studies have revealed that\ncommon variants in certain genes played important role\nin the pathogenesis of endometriosis, including vascular\nendothelial growth factor receptor 2 (VEGFR2), mitogen-\nactivated protein kinase kinase kinase 4 (MAP3K4), and\nWnt family member 4 (WNT4) [ 32–34]. Recently, in-\ncreasing evidences have suggested that rare variants also\nfacilitate the initiation and development of endometriosis\n[35,36]. In the present study, we have screened a total of\n211 Han Chinese samples with ovarian endometriosis for\nthe presence of MARVELD2 mutations, via sequencing the\nwhole coding region and the exon-intron boundaries of the\nMARVELD2 gene. Here, we identified a MARVELD2 mis-\nsense rare variant, p.V198M (c.592G >A), in 10 out of 211\nHan Chinese samples with ovarian endometriosis (4.74%),\nthe frequency of this rare variant is significant higher than\nthat either in the local control women without endometrio-\nsis or in the control samples in the 1000 genome and EXAC\ndatabases (p < 0.01). The evolutionary conservation anal-\n45\n\nysis result showed that the MARVELD2 rare variant caused\nhighly conserved amino acid substitution among 14 ver-\ntebrate species. Furthermore, the bioinformatic programs\nprediction result showed this rare variant might be damag-\ning.\nMARVELD2 mutations could cause nonsyndromic\ndeafness [ 6–8] and the molecular mechanism involved in\naffecting the paracellular permeability, leading to a toxic-\nity for cochlear hair cells [ 37]. Subsequent studies found\nthat dysregulated expression of MARVELD2 could change\nthe capacities of cell invasion and migration in diverse\ncancer types, including colorectal and gastric cancers, and\nthe potential underlying molecular mechanism involved in\nactin and cytoskeletal reorganization, as well as epithelial-\nmesenchymal transitions (EMT) process [ 21,38]. As a pre-\nmalignant condition, endometriosis usually exhibited with\ndysregulation of cell invasion and migration, we thus spec-\nulated that the MARVELD2 rare variant identified in the\npresent study might play active role in the pathogenesis of\nendometriosis.\nOn the other hand, we failed to observe any positive\nassociation between the MARVELD2 rare variant and the\navailable clinical data. Of note, our sample size of ovarian\nendometriosis was relatively small, we will continue to ob-\ntain additional samples in order to re-analyze the potential\nassociation.\n5. Conclusions\nWe identified a relatively high frequency of MAR-\nVELD2 rare variant in our samples with ovarian en-\ndometriosis, indicating this rare variant might play positive\nrole in the pathogenesis of this disease.\nAuthor contributions\nQW—investigation and manuscript preparation;\nRL—sample collection; YZ—investigation; YL—\ninvestigation; JZ—data analysis; YD—sample collection;\nXZ—data analysis; GG—sample collection; OH—\nmethodology, manuscript revision.\nEthics approval and consent to participate\nAll subjects gave their informed consent for inclu-\nsion before they participated in the study. The study was\nconducted in accordance with the Declaration of Helsinki,\nand the protocol was approved by the Ethics Committee of\nJiangxi Provincial Maternal and Child Health Hospital (ap-\nproval number: JXSFYBJYY2020KJK015).\nAcknowledgment\nWe thank the sample donors who participated in this\nstudy.\nFunding\nThis project was supported by the National Natural\nScience Foundation of China [Grant No. 81771559 and\n82160291].\nConflict of interest\nThe authors declare no conflict of interest.\nReferences\n[1] Gaetje R, Holtrich U, Engels K, Kissler S, Rody A, Karn T,et al.\nDifferential expression of claudins in human endometrium and\nendometriosis. Gynecological Endocrinology. 2008; 24: 442–\n449.\n[2] Sampson JA. Metastatic or Embolic Endometriosis, due to the\nMenstrual Dissemination of Endometrial Tissue into the V enous\nCirculation. American Journal of Pathology. 1927; 3: 93–110.\n[3] Y oung VJ, Brown JK, Saunders PTK, Horne AW. The role of the\nperitoneum in the pathogenesis of endometriosis. Human Repro-\nduction Update. 2013; 19: 558–569.\n[4] Nayak G, Lee SI, Y ousaf R, Edelmann SE, Trincot C, V an Itallie\nCM, et al. Tricellulin deficiency affects tight junction architec-\nture and cochlear hair cells. Journal of Clinical Investigation.\n2013; 123: 4036–4049.\n[5] Ikenouchi J, Furuse M, Furuse K, Sasaki H, Tsukita S, Tsukita\nS. Tricellulin constitutes a novel barrier at tricellular contacts of\nepithelial cells. Journal of Cell Biology. 2005; 171: 939–945.\n[6] Riazuddin S, Ahmed ZM, Fanning AS, Lagziel A, Kitajiri S,\nRamzan K, et al . Tricellulin is a Tight-Junction Protein Nec-\nessary for Hearing. The American Journal of Human Genetics.\n2006; 79: 1040–1051.\n[7] Chishti MS, Bhatti A, Tamim S, Lee K, McDonald M, Leal SM,\net al. Splice-site mutations in the TRIC gene underlie autosomal\nrecessive nonsyndromic hearing impairment in Pakistani fami-\nlies. Journal of Human Genetics. 2008; 53: 101–105.\n[8] Zheng J, Meng W, Zhang C, Liu H, Y ao J, Wang H, et al. New\nSNP variants of MARVELD2 (DFNB49) associated with non-\nsyndromic hearing loss in Chinese population. Journal of Zhe-\njiang University: Science B. 2019; 20: 164–169.\n[9] Somorácz A, Korompay A, Törzsök P , Patonai A, Erdélyi-Belle\nB, Lotz G, et al. Tricellulin Expression and its Prognostic Signif-\nicance in Primary Liver Carcinomas. Pathology Oncology Re-\nsearch. 2014; 20: 755–764.\n[10] Kojima T, Sawada N. Regulation of tight junctions in human\nnormal pancreatic duct epithelial cells and cancer cells. Annals\nof the New Y ork Academy of Sciences. 2012; 1257: 85–92.\n[11] Korompay A, Borka K, Lotz G, Somorácz A, Törzsök P , Erdélyi-\nBelle B, et al . Tricellulin expression in normal and neoplastic\nhuman pancreas. Histopathology. 2012; 60: E76–E86.\n[12] Kyuno T, Kyuno D, Kohno T, Konno T, Kikuchi S, Arimoto\nC, et al . Tricellular tight junction protein LSR/angulin-1 con-\ntributes to the epithelial barrier and malignancy in human pan-\ncreatic cancer cell line. Histochemistry and Cell Biology. 2020;\n153: 5–16.\n[13] Xu Z, Zhang L, Y u Q, Zhang Y , Y an L, Chen Z. The estrogen-\nregulated lncRNA H19/miR-216a-5p axis alters stromal cell in-\nvasion and migration via ACTA2 in endometriosis. Molecular\nHuman Reproduction. 2019; 25: 550–561.\n[14] Choi YS, Park JH, Y oon JK, Y oon JS, Kim JS, Lee JH,et al. Po-\ntential roles of aquaporin 9 in the pathogenesis of endometriosis.\nMolecular Human Reproduction. 2019; 25: 373–384.\n[15] Liu J, Wang Y , Chen P , Ma Y , Wang S, Tian Y ,et al. AC002454.1\nand CDK6 synergistically promote endometrial cell migration\nand invasion in endometriosis. Reproduction. 2019; 157: 535–\n46\n\n\n543.\n[16] Lac V , V erhoef L, Aguirre-Hernandez R, Nazeran TM, Tessier-\nCloutier B, Praetorius T, et al. Iatrogenic endometriosis harbors\nsomatic cancer-driver mutations. Human Reproduction. 2019;\n34: 69–78.\n[17] Zou Y , Zhou J, Guo J, Wang L, Luo Y , Zhang Z,et al. The pres-\nence of KRAS, PPP2R1a and ARID1a mutations in 101 Chinese\nsamples with ovarian endometriosis. Mutation Research. 2018;\n809: 1–5.\n[18] Zou Y , Zhou JY , Wang F, Zhang ZY , Liu FY , Luo Y , et al .\nAnalysis of CARD10 and CARD11 somatic mutations in pa-\ntients with ovarian endometriosis. Oncology Letters. 2018; 16:\n491–496.\n[19] Cao B, Zeng Y , Wu F, Liu J, Shuang Z, Xu X, et al. Novel TR-\nERF1 mutations in Chinese patients with ovarian endometriosis.\nMolecular Medicine Reports. 2018; 17: 5435–5439.\n[20] Suda K, Nakaoka H, Y oshihara K, Ishiguro T, Tamura R,\nMori Y ,et al. Clonal expansion and diversifification of cancer-\nassociated mutations in endometriosis and normal endometrium.\nCell Reports. 2018, 24: 1777–1789.\n[21] Zhang JX, Qin MB, Y e Z, Peng P , Li SM, Song Q,et al. Associ-\nation of tricellulin expression with poor colorectal cancer prog-\nnosis and metastasis. Oncology Reports. 2020; 44: 2174–2184.\n[22] Angioni S, D’Alterio MN, Coiana A, Anni F, Gessa S, Deiana\nD. Genetic Characterization of Endometriosis Patients: Review\nof the Literature and a Prospective Cohort Study on a Mediter-\nranean Population. International Journal of Molecular Sciences.\n2020; 21: 1765.\n[23] Deiana D, Gessa S, Anardu M, Daniilidis A, Nappi L, D’Alterio\nMN, et al. Genetics of endometriosis: a comprehensive review.\nGynecological Endocrinology. 2019; 35: 553–558.\n[24] Anglesio MS, Papadopoulos N, Ayhan A, Nazeran TM, Noë\nM, Horlings HM, et al . Cancer-Associated Mutations in En-\ndometriosis without Cancer. New England Journal of Medicine.\n2017; 376: 1835–1848.\n[25] Li X, Zhang Y , Zhao L, Wang L, Wu Z, Mei Q, et al .\nWhole-exome sequencing of endometriosis identifies frequent\nalterations in genes involved in cell adhesion and chromatin-\nremodeling complexes. Human Molecular Genetics. 2014; 23:\n6008–6021.\n[26] Wang K, Li T, Xu C, Ding Y , Li W, Ding L. Claudin-7 downreg-\nulation induces metastasis and invasion in colorectal cancer via\nthe promotion of epithelial-mesenchymal transition. Biochem-\nical and Biophysical Research Communications. 2019; 508:\n797–804.\n[27] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular\nEvolutionary Genetics Analysis (MEGA) software version 4.0.\nMolecular Biology and Evolution. 2007; 24: 1596–1599.\n[28] Choi Y , Chan AP . PROVEAN web server: a tool to predict the\nfunctional effect of amino acid substitutions and indels. Bioin-\nformatics. 2015; 31: 2745–2747.\n[29] Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova\nA, Bork P , et al. A method and server for predicting damaging\nmissense mutations. Nature Methods. 2010; 7: 248–249.\n[30] Krug SM, Amasheh S, Richter JF, Milatz S, Günzel D, West-\nphal JK, et al. Tricellulin Forms a Barrier to Macromolecules in\nTricellular Tight Junctions without Affecting Ion Permeability.\nMolecular Biology of the Cell. 2009; 20: 3713–3724.\n[31] Raleigh DR, Marchiando AM, Zhang Y , Shen L, Sasaki H, Wang\nY ,et al. Tight junction-associated MARVEL proteins marveld3,\ntricellulin, and occludin have distinct but overlapping functions.\nMolecular Biology of the Cell. 2010; 21: 1200–1213.\n[32] Steinthorsdottir V , Thorleifsson G, Aradottir K, Feenstra B, Sig-\nurdsson A, Stefansdottir L, et al . Common variants upstream\nof KDR encoding VEGFR2 and in TTC39B associate with en-\ndometriosis. Nature Communications. 2016; 7: 12350.\n[33] Uimari O, Rahmioglu N, Nyholt DR, Vincent K, Missmer\nSA, Becker C, et al . Genome-wide genetic analyses high-\nlight mitogen-activated protein kinase (MAPK) signaling in the\npathogenesis of endometriosis. Human Reproduction. 2017; 32:\n780–793.\n[34] Nyholt DR, Low S, Anderson CA, Painter JN, Uno S, Morris\nAP ,et al. Genome-wide association meta-analysis identifies new\nendometriosis risk loci. Nature Genetics. 2012; 44: 1355–1359.\n[35] Rahmioglu N, Montgomery GW, Zondervan KT. Genetics of\nEndometriosis. Women’s Health. 2015; 11: 577–586.\n[36] Sapkota Y , Vivo ID, Steinthorsdottir V , Fassbender A, Bowdler\nL, Buring JE, et al. Analysis of potential protein-modifying vari-\nants in 9000 endometriosis patients and 150000 controls of Eu-\nropean ancestry. Scientific Reports. 2017; 7: 11380.\n[37] Nayak G, Lee SI, Y ousaf R, Edelmann SE, Trincot C, V an Itallie\nCM, et al. Tricellulin deficiency affects tight junction architec-\nture and cochlear hair cells. Journal of Clinical Investigation.\n2013; 123: 4036–4049.\n[38] Masuda R, Semba S, Mizuuchi E, Y anagihara K, Y okozaki H.\nNegative regulation of the tight junction protein tricellulin by\nsnail-induced epithelial-mesenchymal transition in gastric car-\ncinoma cells. Pathobiology. 2010; 77: 106–113.\n47","source_license":"CC0","license_restricted":false}