{"paper_id":"4e6d833e-dbc4-4aa2-a7af-001b60f58d2e","body_text":"Gp8 mediates adsorption of bacteriophage vB_VpP_21JZSM01 to the host Vibrio parahaemolyticus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Gp8 mediates adsorption of bacteriophage vB_VpP_21JZSM01 to the host Vibrio parahaemolyticus Shuxuan Li, Xiaoni Wang, Jing Li, Ming Zhang, Ke Liu, Xuepeng Li, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8267643/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Apr, 2026 Read the published version in Antonie van Leeuwenhoek → Version 1 posted 9 You are reading this latest preprint version Abstract In this study, we aimed to identify the principal tail protein responsible for mediating adsorption of bacteriophage vB_VpP_21JZSM01 to its host bacterium Vibrio parahaemolyticus, a significant pathogen in aquaculture. The structure and function of three candidate proteins—the tail tubular protein Gp8, tail completion protein Gp20, and tail fibre protein Gp41 — were predicted through bioinformatic analysis. Recombinant plasmids were constructed and the three tail proteins were successfully expressed and purified. Competitive adsorption assays demonstrated an 81.3% reduction in bacteriophage adsorption efficiency following pre-treatment with rGp8, whereas rGp20 and rGp41 showed no statistically significant effects (p > 0.05). Labelling experiments using enhanced green fluorescent protein (EGFP) fusions revealed that only the group treated with rGp8-EGFP exhibited specific fluorescence signals. Furthermore, tight binding of rGp8 to the surface of host bacteria was directly visualised by transmission electron microscopy. Analysis of environmental factors indicated that the adsorption efficiency of rGp8 was optimal at 4 °C (approximately 80%), decreasing to 30% at 75 °C. Neutral pH supported the highest adsorption efficiency (70 – 80%), while strongly acidic (pH ≤ 5) or alkaline (pH ≥ 9) conditions markedly inhibited adsorption, reducing it to below 20%. Our findings identify the tail tubular protein rGp8 as the core functional determinant for host cell adsorption of bacteriophage vB_VpP_21JZSM01, with its adsorption efficiency modulated by temperature and pH. adsorption bacteriophage vB_VpP_21JZSM01 phage-host interaction tail tubular protein Vibrio parahaemolyticus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Vibrio parahaemolyticus is one of the principal pathogens responsible for seafood-associated diarrhoeal diseases worldwide (Li et al. 2019). Its pathogenicity arises from multifactorial virulence mechanisms, including adhesion, invasion, and immune-evasion strategies (Ghenem et al. 2017). This marine bacterium predominantly resides in coastal waters, seabed sediments, and consumable marine organisms, with seasonal prevalence peaking during summer months (Lopatek et al. 2018). Infections typically manifest as acute gastroenteritis characterised by abdominal cramps, nausea, vomiting, and fever, with immunocompromised individuals (e.g., those with diabetes or liver disease) facing elevated risks of septicaemia (Pazhani et al. 2021). In recent years, the overuse and/or misuse of antibiotics have resulted in the global emergence of an increasing number of multidrug-resistant strains of V. parahaemolyticus . These strains carry genes that mediate multidrug resistance mechanisms, presenting significant challenges to antibiotic treatment (Y. Li et al. 2025). Globally, drug resistance profiles of V. parahaemolyticus show significant geographical variation, with relatively high resistance rates in Asian countries, such as China, Malaysia, and South Korea. Coastal areas of China, with their industrial-scale aquaculture operations, face a serious V. parahaemolyticus multidrug resistance problem attributable to the extensive use of antibiotics (Zhao et al. 2018). Therefore, finding an environmentally friendly, highly efficient alternative to antibiotics has become a significant research focus. Bacteriophages (phages), which are viruses that specifically infect bacteria, may offer a solution to the growing issue of multidrug-resistant bacteria resulting from excessive antibiotic use (Jia et al. 2023). Phages primarily consist of two major blocks: a head and a tail. The head is composed of a protein capsid that safeguards the internal nucleic acid from damage, while the tail comprises essential structures including a tail tube, tail sheath, tail fibres, and tail spikes, which facilitate attachment and penetration of the host bacteria (Bhella et al. 2023). Following the recognition and adsorption of the bacteriophage tail proteins to the receptors on the host surface, the viral genetic material is injected into the periplasm of the host bacterium. Subsequently, the phage hijacks the host's biosynthetic machinery to drive viral replication and assemble progeny virus particles. These virus particles are then released into the extracellular environment, resulting in host cell lysis (Stone et al. 2019). The tail protein structures and functions of different bacteriophages vary significantly. Therefore, the specificity of a bacteriophage depends on the binding specificity between its tail proteins and host receptors (Gaborieau et al. 2024). The tail fibre assembly (Tfa) proteins derived from the Escherichia coli phages Mu and P2 mediate fibre folding and remain at the distal end of the fibre, becoming a component of the mature phage particle and binding to lipopolysaccharides (LPS) on the bacterial surface (North et al. 2021). In phage T4, the tail fibres exhibit dual receptor specificity, initiating host adsorption via binding to the outer membrane protein OmpC in E. coli K12 strains and to LPS receptors in E. coli B strains (Taslem Mourosi et al. 2022). Hu et al. (2020) demonstrated that tail tubular proteins A (TTPA) and tail tubular proteins B (TTPB) of the Vibrio phage OWB mediate bacteriophage adsorption, enabling the adsorption to the transmembrane protein Vp0980 on the V. parahaemolyticus strain ATCC17802. Andres et al. (2010) showed that the initial adhesion of P22 to Salmonella is mediated by the interaction between LPS and the spike protein of the bacteriophage. In summary, among the molecular determinants of phage – host specificity, the tail proteins play pivotal roles in receptor recognition and adsorption. We isolated vB_VpP_21JZSM01, a virulent long-tailed bacteriophage infecting V. parahaemolyticus , from seafood samples. Morphological analysis revealed an icosahedral head approximately 55 nm in diameter and a non-contractile tail about 90 nm in length. The phage exhibited a broad lytic spectrum, with an optimal multiplicity of infection (MOI) of 0.01, a latent period of 25 minutes, and a burst size of 180 PFU cell⁻¹. It demonstrated remarkable stability under various temperatures, pH conditions, and chloroform exposure. Additionally, vB_VpP_21JZSM01 significantly inhibited biofilm formation by its host bacterium. Further studies confirmed that vB_VpP_21JZSM01 primarily adsorbs to host cells by recognising surface polysaccharides. Here, we systematically investigated the structural and functional roles of the three predicted tail proteins (Gp8, Gp20, and Gp41) of the Vibrio phage vB_VpP_21JZSM01. Bioinformatics tools were used to elucidate the molecular signatures of these proteins through evolutionary conservation analysis and functional site prediction. A primary goal of functional genomics is to assign precise biological roles to genes predicted from sequence data. In this study, we addressed this challenge in the context of the phage vB_VpP_21JZSM01 genome, focusing on the functional characterisation of its structural components to elucidate the initial step of infection: host adsorption. Recombinant versions of these tail proteins were then produced using prokaryotic expression vectors and affinity purification. Finally, the dominant roles of these key tail proteins in host adsorption were explored using the double-layer agar plate method, fluorescence protein labelling, and transmission electron microscopy (TEM), revealing their sensitivity to environmental conditions such as temperature and pH. The results of this study offer a theoretical framework for understanding the mechanism underlying phage – host interactions. Material and Methods Bacterial strains, phages, and plasmids V. parahaemolyticus Vp1 was cultured at 37 °C in Luria-Bertani (LB) medium supplemented with 3.5% (w/v) NaCl. Bacteriophage vB_VpP_21JZSM01 is preserved in our laboratory (GenBank accession number: OR734989.1). The pCold-GST plasmid (Takara Bio, Dalian, China), which tags proteins with glutathione S-transferase, was used for recombinant tail protein expression, while pET-28a-EGFP (Abiowell Biotechnology, Changsha, China), a plasmid encoding enhanced green fluorescent protein (EGFP), served as the fluorescent protein expression system. Bioinformatics analysis of phage tail protein The amino acid sequences of tail proteins were analysed using the BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for homology searches (Kuznetsov and Bollin 2021). Multiple sequence alignment was performed using the ClustalW algorithm implemented in MEGA 11, followed by phylogenetic reconstruction using the neighbor-joining (NJ) method with 1000 bootstrap replicates. Evolutionary conservation analysis was conducted using SnapGene, while sequence similarity assessment and heatmap visualization were achieved using TBtools-II. Structural characterisation was performed using CavityPlus (http://www.pkumdl.cn/cavityplus) to predict potential ligand-binding pockets and to identify key amino acid residues constituting the putative binding sites (Wang et al. 2023). Construction of prokaryotic expression plasmids Using vB_VpP_21JZSM01 genomic DNA as template, the tail genes g8 , g20 , and g41 were amplified using PCR. The amplified products were purified, double-digested with restriction enzymes, and ligated into the pCold-GST expression vector using T4 DNA ligase overnight at 16 °C. The resulting recombinant plasmids, designated pCold-GST- g8 , pCold-GST- g20 , and pCold-GST- g41 , were verified by sequencing. The PCR primers used in this experiment are listed in Table 1. Table 1 PCR primer sequences used to amplify tail genes. Primer name Base sequence (5’→3’) Tm (°C) Amplicon Size (bp) g8 -F GGAATTC CATATG ATGAGAAAGTACAACGAAGATTATGC ( Nde I) 59.2 1965 g8 -R CCG GAATTC TTAATTCTGGTCAAATGTCTTGTAAAC ( EcoR I) 58.6 g20 -F GGAATTC CATATG ATGCTTGATATTATTGAGCTAAACAAA ( Nde I) 57.4 567 g20 -R ACGC GTCGAC TTATATCACGATAGGGTCGGTAG ( Sal I) 65.1 g41 -F GGAATTC CATATG ATGTCTGATGTAATGCGCAAGATAG ( Nde I) 60.8 948 g41 -R CCG GAATTC TTAAACTCGCGCAACAACAATAACG (EcoR I) 62.8 Bold underlining indicates restriction sites for the enzymes in parentheses. Expression and purification of recombinant tail proteins Plasmids pCold-GST- g8 , pCold-GST- g20 , and pCold-GST- g41 were transformed into E. coli BL21 (DE3) cells, expressed, and verified by restriction enzyme analysis. For recombinant protein purification, the cells were cultured in liquid LB medium supplemented with 50 μg ml -1 ampicillin at 37 °C with shaking until the OD 600 nm reached 0.6, then induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mmol l -1 and incubating at 16 °C for 18 h. The bacterial cells were harvested by centrifugation (4 °C, 12,000 × g , 20 min) and the pellets were resuspended in 5–10 ml Binding Buffer (1% Triton X-100, 150 mmol l -1 NaCl, 50 mmol l -1 Tris-HCl pH 7.5, 1 mmol l -1 EDTA, 1 mmol l -1 DTT, and protease inhibitors) (Chatzileontiadou et al. 2021). The cell suspension was subjected to ultrasonication on ice at 300 W under pulse mode (2 s working and 3 s stopping) for 15 min (K. Zhang et al. 2021). The supernatant was collected and subjected to affinity purification using Ni-Agarose Resin (Beyotime, Shanghai, China). The bound proteins were eluted with Elution Buffer (10 mmol l -1 reduced glutathione, 50 mmol l -1 Tris-HCl pH 8.0). The eluted fractions containing the purified recombinant proteins (rGp8, rGp20, and rGp41) were collected, and their concentrations were determined using a BCA Protein Concentration Assay Kit (Solarbio, Beijing, China). Western Blot (WB) analysis of recombinant proteins WB analysis was performed following Tsuji’s method with minor modifications (2020). Briefly, purified recombinant proteins rGp8, rGp20, and rGp41 were separated by SDS-PAGE and subsequently transferred onto methanol-activated PVDF membranes at 180 mA for 1.5 h. After the transfer, PVDF membranes were blocked with 4% (w/v) skimmed milk at room temperature for 2 h. They were then incubated overnight at 4 °C with the primary antibody, ProteinFind® Anti-His Mouse Monoclonal Antibody (TransGen Biotech, Beijing, China). Following washing with TBST (Tris-buffered saline with 0.1% Tween 20), the membranes was incubated with an HRP-conjugated goat anti-mouse IgG (H+L) (Sangon Biotech, Shanghai, China) secondary antibody for 1–2 h at room temperature. After furthe washing with TBST, protein bands were visualised using an enhanced chemiluminescence substrate. To confirm the integrity and position of the recombinant proteins, a parallel SDS-PAGE gel was run with identical samples and stained with BeyoBlue™ Coomassie Blue Super Fast Staining Solution (Beyotime, Shanghai, China). Preparation of phage lysate Following the method of Asghar et al. (2022), with slight modifications, a 500 μl aliquot of bacteriophage vB_VpP_l stock (-80 °C) was inoculated into 2216E liquid medium containing 2 ml of V. parahaemolyticus at logarithmic growth phase (OD 600 nm = 0.6-0.8). The mixture was incubated at 37 °C with shaking (180 rpm) for 5 h. Subsequent centrifugation (8,000 × g , 10 min, 4 °C) was performed to obtain the supernatant, followed by filtration through a 0.22 μm pore-size membrane filter. The resulting filtrate was collected as the amplified phage lysate. Competitive adsorption testing of tail proteins For competitive adsorption inhibition assays, 200 μl of bacterial suspension (10 9 cfu ml -1 ) was mixed with an equal volume of rGp8, rGp20, or rGp41 (diluted in PBS to a concentration of 1 mg ml -1 ), or 200 μl sterile LB broth for the control group, and incubated at 37 °C for 30 min. The mixtures were centrifuged (8,000 × g , 4 °C, 5 min), and the resulting pellets were washed three times with PBS to remove unbound proteins before being resuspended in 200 μl PBS. An equal volume of phage proliferation solution was added, incubated at 37 ℃ for 10 min, and centrifuged. The phage titre in the supernatant was quantified using the double-layer agar plaque assay, and the phage adsorption rate was calculated (Gou et al. 2025). Fluorescent labeling of tail proteins To obtain recombinant tail proteins fused with EGFP, we ligated the PCR products g8 , g20 , and g41 in 2.3 with the vector pET-28a-EGFP to produce rGp8-EGFP, rGp20-EGFP, and rGp41-EGFP, respectively. A 100 μl aliquot of bacterial suspension was incubated with an equal volume of rGp8-EGFP, rGp20-EGFP and Gp41-EGFP at 37 ℃ for 30 min, using an untreated bacterial suspension as the control. The mixture was centrifuged (4 °C, 8,000 × g, 10 min), and the pellet was collected, washed three times with PBS, and fluorescence was measured using a spectrofluorometer (JEM1200EX, JEOL, Tokyo, Japan). TEM of tail proteins Protein adsorption assays were performed following a modified protocol reported by Li et al (2025). Briefly, the host bacteria were mixed with rGp8, rGp20, or rGp41 and incubated for 30 min. After centrifugation, the pellets were resuspended in 100 μl of PBS buffer. A pure bacterial suspension was used as the control. Copper grids were immersed in resuspension solution for 10 min, and filter paper was used to absorb excess liquid. The grids were then fixed overnight with 2.5% glutaraldehyde. Following removal of the excess liquid, the grids were negatively stained with 2% phosphotungstic acid for 2 min. The staining solution was aspirated, and the grids were air-dried at room temperature before observation using TEM (JEM-F200, JEOL, Tokyo, Japan) with an accelerating voltage of 80 kV. Effect of temperature on adsorption of tail tubular protein to host bacteria The temperature-dependent adsorption assay was conducted following a modified protocol adapted from Zhang et al (2018). Briefly, 200 μl aliquots of rGp8 were treated at 4 ℃, 37 ℃, 45 ℃, 55 ℃, 65 ℃, or 75 ℃ for 10 min. Each sample was then combined with an equal volume of host bacterial suspension in the logarithmic growth phase and incubated for 30 min under static conditions to facilitate protein-mediated bacterial adsorption. An untreated bacterial suspension was used as the control. The suspensions were centrifuged (8,000 × g , 4 °C, 10 min), and the pellets were resuspended in 200 μl medium and mixed with an equivalent volume of phage suspension (7.96×10 8 PFU ml -1 ). After a further 10 min incubation at 37 °C, the mixtures were centrifuged, and the phage titre in the supernatant was quantified using the double-layer agar plaque assay. Effect of pH on adsorption of tail tubular protein to host bacteria To assess pH-dependent adsorption characteristics, aliquots of purified rGp8 were mixed with 100 μl of PBS buffer adjusted to pH values of 3, 4, 5, 6, 7, 8, 9, 10, and 11 using 1 mmol l -1 NaOH or 1 mmol l -1 HCl. The mixture were incubated for 10 min at room temperature. Each sample was then combined with an equal volume of bacterial suspension （10 9 cfu ml -1 ） and incubated for 30 min at 37 °C to facilitate adsorption. Unbound proteins were removed by centrifugation (8,000 × g , 4 °C, 10 min). The bacterial pellets were subsequently resuspended in 200 μl of medium and mixed with an equivalent volume of phage suspension. After a further10 min incubation at 37 °C, the samples were centrifuged, and the phage titre in the supernatant was quantified using a double-layer agar plaque assay. Statistical analysis All tests were carried out in triplicate (n = 3), with data presented as means ± standard deviation (SD). Statistical analysis was performed using SPSS version 29.0 with one-way analysis of variance. Mean values of individual groups were compared using Duncan's test to determine statistical significance, which was indicated by a p ‑ value < 0.05. Results and Discussion Bioinformatics analysis Phylogenetic analysis of tail proteins was performed using homologous sequences identified via BLAST. In the phylogenetic tree constructed from these sequences, the tail tubular protein Gp8 (WPH64010.1) exhibited the closest evolutionary relationship with the corresponding protein from Vibrio phage VPMS1 (YP008239681.1) (Fig. 1a). Comparative sequence analysis of proteins within the same phylogenetic clade demonstrated 77.22% amino acid identity between Gp8 and VPMS1 tail tubular protein (Fig. 1b). Multiple sequence alignment revealed high conservation in the C-terminal and central domains (Fig. S1), suggesting that these regions are critical for maintaining structural integrity and biological function. In contrast, the N-terminal region displayed significant sequence variability across species. We hypothesised that the conserved C-terminal domain represents the key recognition motif for host surface receptor binding, while the variable N-terminus contributes to host specificity. The tail completion protein Gp20 was found to share the closest phylogenetic relationship with the tail completion protein of Vibrio phage 1.029.O.10N.261.55.A7 (AUR82863.1) (Fig. 2a). Sequence similarity between the two proteins reached 91.49% (Fig. 2b), but alignment of homologous sequences (Fig. S2) revealed low amino acid sequence conservation. This suggests that most amino acid residues have undergone evolutionary changes, with only potentially functionally important residues being retained. The Gp41 tail fibre protein was found to exhibit the closest phylogenetic relationship with the putative tail fibre protein of Vibrio phage 1.056.O._10N.261.48.C11 (AUR84456.1) and that of phage 393E50-1 (CAH9015475.1) (Fig. 3a), with sequence similarities of 64.13% and 62.22%, respectively (Fig. 3b). Alignment of homologous sequences revealed low amino acid conservation (Fig. S3), suggesting that Gp41 may not play a key role in the adsorption of the phage to its host. The active site of a protein refers to a specific region on its interior or exterior surface that typically adopts a defined tertiary structure, binds to a ligand, and constitutes a key component of its biological functions (Coleman and Sharp 2010). Identifying ligand-binding pockets on the protein surface is of considerable importance for the functional prediction, drug target selection, and drug design. Gp8 exhibited a strong druggability score of 1070, with pocket dimensions of 25 (X), 18 (Y), and 15.5 (Z) centred at coordinates 11 (X), 14.5 (Y), and 8.75 (Z) (Fig. 4a). In contrast, Gp20 showed a higher druggability score of 2747, with pocket dimensions of 13 (X), 16 (Y), and 13.5 (Z) centred at 184.5 (X), 157.5 (Y), and 140.75 (Z) (Fig. 4b). The corresponding amino acid sites are detailed in Table (Table. S1). No active site was predicted for Gp41. Expression and purification of recombinant proteins The genes g8 , g20 , and g41 of vB_VpP_l were PCR-amplified using the phage genome as a template and cloned into the pCold-GST expression vector (Fig. S4). Large-scale recombinant protein expression in E. coli was carried out, and the target proteins were purified from the culture supernatant. SDS-PAGE analysis confirmed the expected molecular weights of the recombinant proteins: Gp8, rGp8 (100 kDa), rGp20 (51 kDa), and rGp41 (62 kDa) (Fig. 5a). WB analysis further verified the presence of a single specific band corresponding to each recombinant protein (Fig. 5b). Identification of the key tail protein through c ompetitive adsorption testing To investigate the role of each recombinant tail protein in phage adsorption, host bacterial cells were pre‑incubated with purified rGp8, rGp20, or rGp41 (1 mg ml -1 ) for 10 min at 37 °C prior to exposure to phage vB_VpP_21JZSM01 at a titre of 7.96×10⁸ PFU ml -1 . Phage adsorption efficiency was quantified using the double-layer agar plate method. As shown in Fig. 6, compared with the untreated control, pretreatment with rGp8 significantly reduced phage adsorption by 81.3%, whereas phage adsorption to bacteria pretreated with rGp20 or rGp41 was largely unaffected. This finding indicates that rGp8 blocked phage vB_VpP_l adsorption and infection of host bacteria by occupying the phage‑binding sites, highlighting the critical role of the tail tubular protein rGp8 in this process. Verification of rGp8 as the key tail protein through f luorescent labeling The adsorption activity of the recombinant tail proteins was verified indirectly by fusing each with EGFP, which has an emission wavelength of 510 nm (Stepanenko et al. 2004). Following incubation of a suspension of host bacteria with rGp8-EGFP, rGp20-EGFP, or rGp41-EGFP fusion proteins, a distinct peak near the emission wavelength of EGFP would be expected for proteins involved in phage adsorption. As shown in Fig. 7, this fluorescence peak was only observed with rGp8-EGFP. Bacteria incubated with rGp20-EGFP or rGp41-EGFP exhibited fluorescence levels similar to those of the untreated control group, further confirming the tail tubular protein rGp8 as the receptor‑binding protein for host infection by phage vB_VpP_l. TEM of host adsorption by recombinant tail proteins TEM was used to observe the adsorption of rGp, rGp20, and rGp41 following incubation of each with host bacteria (Fig. 8). While clear morphological structures of the bacteria were visible in all TEM images, only rGp8 exhibited obvious adsorption to the surface of the host bacterial cells (Fig. 8a). The appearance of bacteria incubated with rGp20 (Fig. 8b) or rGp41 (Fig. 8c) was similar to that of the control bacteria (Fig. 8d), with no evidence of protein adsorption. These results further confirm that the tail tubular protein rGp8 is the key protein mediating phage vB_VpP_l adsorption to its host. Effect of temperature on adsorption of tail tubular protein to host bacteria To examine the effect of temperature on the ability of recombinant tail tubular protein rGp8 to influence the phage adsorption to host bacteria, aliquots of rGp8 were pre‑incubated at 4 ℃, 37 ℃, 45 ℃, 55 ℃, 65 ℃, and 75 ℃ prior to incubation with a host bacterial suspension and subsequent exposure to phage. Results from the double‑layer agar plaque assay (Fig. 9) indicated that pre‑incubation of rGp8 at 4 ℃ resulted in a phage adsorption rate of 20.13%, which was not significantly different from that observed in the competitive adsorption inhibition assay (17.1%; Fig. 6). This suggests that rGp8 retained approximately 80% of its adsorption activity at 4 ℃. However, as the pre‑incubation temperature increased, the binding of rGp8 decreased while the phage adsorption rate rose. This indicates that occupancy of the bacterial surface by rGp8 was most effective at 4 ℃, thereby blocking phage adsorption and lysis of host cells. When rGp8 was pre‑incubated at 75 ℃, the phage adsorption rate reached 78.39%, corresponding to a reduction in rGp8 adsorption to about 20%. In summary, the tail tubular protein of phage vB_VpP_l exhibited the highest adsorption efficiency for host bacteria at 4 ℃, consistent with the findings of Zhang et al (2018). Effect of pH on adsorption of tail tubular protein to host bacteria To examine the effect of pH on the ability of the recombinant tail tubular protein rGp8 to influence phage adsorption to host bacteria, aliquots of rGp8 were treated at different pH values (3–11) for 10 min prior to incubation with a host bacterial suspension and subsequent exposure to phage. After removing unbound protein by centrifugation, double-layer agar plaque assays were performed (Fig. 10). At pH 6-8, the adsorption rate of the tail tubular protein ranged from 51.3% to 79.6%, indicating relatively effective adsorption under neutral conditions. The results showed that phage adsorption rates at pH 3-5 and pH 9-11 were not significantly different from those of the control group, suggesting that rGp8 exhibited minimal adsorption to the host bacteria under these pH conditions. This may be attributable to alterations in the charge distribution of rGp8 under acidic and alkaline conditions, where disruption of hydrogen and ionic bonds leads to protein denaturation or conformational changes that impair host recognition (Sahin et al. 2010). Conclusion Our findings provide a clear functional annotation for the g8 gene within the vB_VpP_21JZSM01 genome, transforming it from a hypothetical open reading frame into a mechanistically characterised host-recognition protein. This integrated approach—from genomic sequence to in vitro functional analysis—exemplifies how discrete genetic elements determine pivotal phenotypic outcomes in phage biology. Beyond its role as a structural component, Gp8 exhibits evolutionary conservation in its C-terminal domain, which is likely to harbour critical ligand-binding pockets essential for receptor recognition. Collectively, results from competitive adsorption assays, fluorescence labeling, and TEM with rGp8 demonstrated that rGp8 dominates the initial adsorption phase by occupying host surface receptors, effectively blocking phage attachment. Environmental sensitivity testing of rGp8 indicated that its adsorption is optimal at 4 °C and neutral pH, but is severely impaired under high temperatures or extreme pH conditions, providing important insights for practical applications. These findings suggest that phage-based biocontrol strategies targeting V. parahaemolyticus in seafood or aquaculture should prioritise storage conditions that preserve rGp8 functionality. From an evolutionary perspective, the high conservation of rGp8 across Vibrio -infecting phages (e.g., VPMS1) indicates a shared receptor-binding strategy within this phage group. This raises intriguing questions about the identity of the host receptor—likely a conserved surface protein or polysaccharide—which warrants further structural and genetic investigation. To identify the host receptor for rGp8, future studies could employ cryo-electron microscopy or gene knockout approaches, thereby advancing precision in phage engineering. Furthermore, the methodology established here—namely competitive phage adsorption assays combined with fluorescence protein tracking—provides a robust framework for the rapid identification of adsorption proteins in other phage systems, accelerating the development of phage-based therapeutics against multidrug-resistant pathogens. Our findings elucidate the phage adsorption machinery while establishing a crucial link between fundamental virology and applied microbiology. Declarations Acknowledgments We thank Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the language of a draft of this manuscript. Funding This work was supported by the Basic Scientific Research Project of Liaoning Provincial Department of Education, P.R.China (LJ212510167019) and the Open Fund of Institute of Ocean Research, Bohai University (BDHYYJY2025002). Competing Interests No conflict of interest declared. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. Author Contributions Conceptualization, SX.L and DF.Z.; methodology, SX.L., J.L. and DF.Z.; software, XN.W. and K.L.; validation, SX.L. and K.L.; formal analysis, SX.L.; investigation, J.L. and M.Z.; resources, DF.Z. and JR.L.; data curation, M.Z. and CY.L.; writing—original draft preparation, SX.L. and XN.W.; writing—review and editing, DF.Z. and M.Z; visualization, XN.W. and CY.L.; supervision, K.L.; project administration, DF.Z., XP.L. and JR.L.; funding acquisition, DF.Z. and XP.L. All authors have read and agreed to the published version of the manuscript. Data Availability Data will be made available on request. All data generated in this study are available within this article and its supplementary information files. Ethical Approval No studies involving human participants or animals were conducted by the authors for this article. Consent for publication All authors have read and agreed to the final version of the manuscript. Furthermore, they consent to its submission for publication. References Asghar S, Ahmed A, Khan S, Lail A, Shakeel M (2022) Genomic characterization of lytic bacteriophages A¥L and A¥M infecting ESBL K. pneumoniae and its therapeutic potential on biofilm dispersal and in-vivo bacterial clearance. Microbiol Res 262:127104. https://doi.org/10.1016/j.micres.2022.127104 Bhella D, Xiao H, Tan L, Tan Z, Zhang Y, Chen W, Li X, Song J, Cheng L, Liu H (2023) Structure of the siphophage neck–tail complex suggests that conserved tail tip proteins facilitate receptor binding and tail assembly. PLoS Biol 21(12):e3002441. https://doi.org/10.1371/journal.pbio.3002441 Chatzileontiadou DSM, Szeto C, Jayasinghe D, Gras S (2021) Protein purification and crystallization of HLA-A∗02:01 in complex with SARS-CoV-2 peptides. Star Protoc 2(3):100635. https://doi.org/10.1016/j.xpro.2021.100635 Coleman RG, Sharp KA (2010) Protein pockets: inventory, shape, and comparison. J Chem Inf Model 50(4):589-603. https://doi.org/https://doi.org/10.1021/ci900397t Dorothee A, Christin H, Ulrich B, Anaït S, Stefanie B, Robert S (2010) Tailspike interactions with lipopolysaccharide effect DNA ejection from phage P22 particles in vitro. J Biol Chem 285(47):36768-36775. https://doi.org/10.1074/jbc.M110.169003 Gaborieau B, Vaysset H, Tesson F, Charachon I, Dib N, Bernier J, Dequidt T, Georjon H, Clermont O, Hersen P, Debarbieux L, Ricard J-D, Denamur E, Bernheim A (2024) Prediction of strain level phage–host interactions across the Escherichia genus using only genomic information. Nat Microbiol 9(11):2847-2861. https://doi.org/10.1038/s41564-024-01832-5 Ghenem L, Elhadi N, Alzahrani F, Nishibuchi M (2017) Vibrio Parahaemolyticus : a review on distribution, pathogenesis, virulence determinants and epidemiology. Saudi J Med Med Sci 5(2):93-103. https://doi.org/10.4103/sjmms.sjmms_30_17 Gou Z, Yao P, Xiong L, Wang X, Yuan Q, Sun F, Cheng Y, Xia P (2025) Potential of a phage cocktail in the treatment of multidrug-resistant Klebsiella pneumoniae pulmonary infection in mice. BMC Microbiol 25(1):151. https://doi.org/10.1186/s12866-025-03851-6 Hu M, Zhang H, Gu D, Ma Y, Zhou X (2020) Identification of a novel bacterial receptor that binds tail tubular proteins and mediates phage infection of Vibrio parahaemolyticus . Emerging Microbes Infect 9(1):855-867. https://doi.org/10.1080/22221751.2020.1754134 Jia H-J, Jia P-P, Yin S, Bu L-K, Yang G, Pei D-S (2023) Engineering bacteriophages for enhanced host range and efficacy: insights from bacteriophage-bacteria interactions. Front Microbiol 14:1172635. https://doi.org/10.3389/fmicb.2023.1172635 Kuznetsov A, Bollin CJ (2021) NCBI genome workbench: desktop software for comparative genomics, visualization, and GenBank data submission. In: Katoh, K. (eds) Multiple Sequence Alignment. Methods in Molecular Biology, vol 2231. Humana, New York, pp 261-295. https://doi.org/10.1007/978-1-0716-1036-7_16 Li L, Meng H, Gu D, Li Y, Jia M (2019) Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol Res 222:43-51. https://doi.org/10.1016/j.micres.2019.03.003 Li P, Ma W, Cheng J, Zhan C, Lu H, Shen J, Zhou X (2025) Phages adapt to recognize an O-antigen polysaccharide site by mutating the “backup” tail protein ORF59, enabling reinfection of phage-resistant Klebsiella pneumoniae . Emerging Microbes Infect 14(1):2455592. https://doi.org/10.1080/22221751.2025.2455592 Li Y, Lin G, Pengsakul T, Yan Q, Huang L (2025) Antibiotic resistance in Vibrio parahaemolyticus : mechanisms, dissemination, and global public health challenges—a comprehensive review. Rev Aquacult 17(1):e13010. https://doi.org/10.1111/raq.13010 Lopatek M, Wieczorek K, Osek J, Björkroth J (2018) Antimicrobial resistance, virulence Factors, and genetic profiles of Vibrio parahaemolyticus from seafood. Appl Environ Microbiol 84(16):e00537-00518. https://doi.org/10.1128/aem.00537-18 Missirlis F, Tsuji Y (2020) Transmembrane protein western blotting: Impact of sample preparation on detection of SLC11A2 (DMT1) and SLC40A1 (ferroportin). PLoS One 15(7):e0235563. https://doi.org/10.1371/journal.pone.0235563 North OI, Davidson AR, O'Toole G (2021) Phage proteins required for tail fiber assembly also bind specifically to the surface of host bacterial strains. J Bacteriol 203(3):e00406-00420. https://doi.org/10.1128/jb.00406-20 Pazhani GP, Chowdhury G, Ramamurthy T (2021) Adaptations of Vibrio parahaemolyticus to stress during environmental survival, host colonization, and infection. Front Microbiol 12:737299. https://doi.org/10.3389/fmicb.2021.737299 Sahin E, Grillo AO, Perkins MD, Roberts CJ (2010) Comparative effects of pH and ionic strength on protein–protein interactions, unfolding, and aggregation for IgG1 antibodies. J Pharm Sci 99(12):4830-4848. https://doi.org/10.1002/jps.22198 Stepanenko OV, Verkhusha VV, Kazakov VI, Shavlovsky MM, Kuznetsova IM, Uversky VN, Turoverov KK (2004) Comparative studies on the structure and stability of fluorescent proteins EGFP, zFP506, mRFP1, \"dimer2\", and DsRed1. Biochemistry 43(47):14913-14923. https://doi.org/10.1021/bi048725t Stone E, Campbell K, Grant I, McAuliffe O (2019) Understanding and exploiting phage–host interactions. Viruses 11(6):567. https://doi.org/10.3390/v11060567 Taslem Mourosi J, Awe A, Guo W, Batra H, Ganesh H, Wu X, Zhu J (2022) Understanding bacteriophage tail fiber interaction with host surface receptor: the key “blueprint” for reprogramming phage host range. Int J Mol Sci 23(20):12146. https://doi.org/10.3390/ijms232012146 Wang S, Xie J, Pei J, Lai L (2023) CavityPlus 2022 update: an integrated platform for comprehensive protein cavity detection and property analyses with user-friendly tools and cavity databases. J Mol Biol 435(14):168141. https://doi.org/10.1016/j.jmb.2023.168141 Zhang K, Tan R, Yao D, Su L, Xia Y, Wu J (2021) Enhanced production of soluble Pyrococcus furiosus α-amylase in Bacillus subtilis through chaperone co-expression, heat treatment and fermentation optimization. J Microbiol Biotechnol 31(4):570-583. https://doi.org/10.4014/jmb.2101.01039 Zhang Z, Tian C, Zhao J, Xiao C, Wei X, Li H, Lin W, Feng R, Jiang A, Yang W, Yuan J, Zhao X (2018) Characterization of tail sheath protein of N4-like phage phiAxp-3. Front Microbiol 9:450. https://doi.org/10.3389/fmicb.2018.00450 Zhao S, Ma L, Wang Y, Fu G, Zhou J, Li X, Fang W (2018) Antimicrobial resistance and pulsed-field gel electrophoresis typing of Vibrio parahaemolyticus isolated from shrimp mariculture environment along the east coast of China. Mar Pollut Bull 136:164-170. https://doi.org/10.1016/j.marpolbul.2018.09.017 Additional Declarations No competing interests reported. Supplementary Files Supplementaryfiles.zip Cite Share Download PDF Status: Published Journal Publication published 04 Apr, 2026 Read the published version in Antonie van Leeuwenhoek → Version 1 posted Editorial decision: Revision requested 17 Jan, 2026 Reviews received at journal 15 Jan, 2026 Reviews received at journal 30 Dec, 2025 Reviewers agreed at journal 27 Dec, 2025 Reviewers agreed at journal 25 Dec, 2025 Reviewers invited by journal 25 Dec, 2025 Editor assigned by journal 05 Dec, 2025 Submission checks completed at journal 05 Dec, 2025 First submitted to journal 03 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8267643\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":565482997,\"identity\":\"9f91a7e5-7163-4686-b708-0df60d499876\",\"order_by\":0,\"name\":\"Shuxuan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shuxuan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":565482998,\"identity\":\"97748966-2c08-40ae-b7cb-b344bcd026f5\",\"order_by\":1,\"name\":\"Xiaoni Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Merieux NutriSciences Testing Technology (Qingdao) Co., Ltd\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaoni\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":565482999,\"identity\":\"970ac5e3-2e38-49ce-a3eb-ac0d3b4c8810\",\"order_by\":2,\"name\":\"Jing Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":565483000,\"identity\":\"eab70037-259f-4dce-9ef9-23339caaaa9e\",\"order_by\":3,\"name\":\"Ming Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ming\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":565483001,\"identity\":\"055daa72-8f1a-47a3-8573-2988f465d957\",\"order_by\":4,\"name\":\"Ke Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ke\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":565483002,\"identity\":\"80602bd5-e44c-4da4-93de-12a97c1efcd3\",\"order_by\":5,\"name\":\"Xuepeng Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuepeng\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":565483003,\"identity\":\"20840678-6f8c-484a-81c8-747e210a8726\",\"order_by\":6,\"name\":\"Jianrong Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianrong\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":565483004,\"identity\":\"73497985-ebe9-4664-8826-51ce2146bcc3\",\"order_by\":7,\"name\":\"Chunyan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Qingdao Baomaide Biotechnology Co., Ltd\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chunyan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":565483005,\"identity\":\"57887945-5179-4f39-9438-9448263deeb4\",\"order_by\":8,\"name\":\"Defu Zhang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHUlEQVRIiWNgGAWjYDACCRDBxsDPwN4A5sowSPCAGMwEtUg28BwAc3lI0CKRAOYT1iI/u/nZwy9lNhIGNx9vk7pRY8HDIN17TIKhwjqxgf3sAWxaGOccMzeWOZcmYXA7rUw65xjQChCP4Ux6YgNPXgI2LcwSCWbSkm2H6wxu55hJ57CB/JJjJsHYdjixQYLHAJsWNon0b0At/4EOOwPU8g+m5R9uLTxABZIf2w5IGNzgMZPObYNpacCtRUIip0ya4VyyhOSZtGLr3D4JHjaZM8YWCcfSjdt4crBqkZ+Rvk3yR5mdBN/xwxtv53yrk+OX7jG88aHGWraf/QxWLeAg4IHQJtA4AoIEGAMHYPwBoY0/4FE0CkbBKBgFIxgAAPFbU6By9CI5AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Bohai University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Defu\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-12-03 08:23:13\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8267643/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8267643/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s10482-026-02295-w\",\"type\":\"published\",\"date\":\"2026-04-04T15:58:42+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":99033103,\"identity\":\"10f1b6b0-e5e9-4e22-a8da-5cc05efee245\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":235945,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic tree of Gp8 and closely related proteins identified by BLAST. (a) Phylogenetic tree constructed using the neighbour-joining (NJ) method (n = 1000). (b) Amino acid sequence similarity of proteins on the same branch as Gp8 (WPH64010.1)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/c3e58d5b539048c7e636cd03.png\"},{\"id\":99033104,\"identity\":\"23db303f-0df2-47eb-9dd7-f59b65b69041\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":184506,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic tree of Gp20 and closely related proteins identified by BLAST. (a) Phylogenetic tree constructed using the NJ method (n = 1000). (b) Amino acid sequence similarity of proteins on the same branch as Gp20 (AUR82863.1)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/1f745d98a34b7165ec6a9c78.png\"},{\"id\":99314236,\"identity\":\"3aecb84f-c3ec-4f35-96c4-061856d688ef\",\"added_by\":\"auto\",\"created_at\":\"2025-12-31 16:21:01\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":160702,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic tree of 41 and closely related proteins identified by BLAST. (a) Phylogenetic tree constructed using the NJ method (n = 1000). (b) Amino acid sequence similarity of proteins on the same branch as Gp41 (AUR84456.1)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/8413f9e9230d56c4b5a60100.png\"},{\"id\":99313247,\"identity\":\"a3468d2e-c184-436e-9a01-64013021a76d\",\"added_by\":\"auto\",\"created_at\":\"2025-12-31 16:19:55\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":176411,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePredicted active site pockets of Gp8 (a) and Gp20 (b)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/0f212ede5f945233c34eba2c.png\"},{\"id\":99313836,\"identity\":\"60f76404-32f9-4588-93a5-fce7be25ecca\",\"added_by\":\"auto\",\"created_at\":\"2025-12-31 16:20:32\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":172090,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAnalysis of purified recombinant phage proteins rGp20, rGp41, and rGp8. SDS-PAGE (a) and WB (b) of rGp20, rGp41, and rGp8\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/6568dcfde35bbd4966e02dd7.png\"},{\"id\":99033107,\"identity\":\"8746b968-a008-4e60-a1e2-084e658bd195\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":40612,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCompetitive adsorption assay of phage tail proteins. Data represent the mean ± SD of three replicate experiments. a-c, significant difference (\\u003cem\\u003ep \\u003c/em\\u003e\\u0026lt; 0.05)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/b160156bb444a1356a064ee0.png\"},{\"id\":99033110,\"identity\":\"e616db10-6f80-4dce-9da3-cee6f45bb922\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":29708,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFluorescence-based adsorption assay of recombinant tail proteins rGp8, rGp20, and rGp41 fused to EGFP\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/473acbeeac5259947af44e62.png\"},{\"id\":99033113,\"identity\":\"2e3dcdda-04bc-445e-84b8-2a42f938882d\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"jpg\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":15121876,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTEM observation of recombinant tail proteins rGp8, rGp20, and rGp41 with host bacteria. Representative transmission electron microscopy (TEM) images of host bacterial cells following incubation with rGp8 (a), rGp20 (b), and rGp41 (c), compared with an untreated control (d). Scale bar = 1.0 μm\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"8.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/e96dd3dc02b0f1a158387ab4.jpg\"},{\"id\":99033109,\"identity\":\"831e0d08-7883-42db-bd96-1bedb62accd3\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":43324,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of temperature on host adsorption by tail tubular protein and subsequent phage exposure. Results of double-layer agar plaque assays showing the mean ± SD of three replicate experiments. a-f, significant differences (\\u003cem\\u003ep \\u003c/em\\u003e\\u0026lt; 0.05)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/45d462af47d303451dcdd770.png\"},{\"id\":99314167,\"identity\":\"55cc53d8-12f0-4693-a3c6-8acf6d57b53b\",\"added_by\":\"auto\",\"created_at\":\"2025-12-31 16:20:55\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":52358,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of pH on host adsorption by the tail tubular protein and subsequent phage exposure. Results of double-layer agar plaque assays showing the mean ± SD of three replicate experiments. a-g, significant differences (\\u003cem\\u003ep \\u003c/em\\u003e\\u0026lt; 0.05)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/3bfb0a93ea88ecb637762686.png\"},{\"id\":106343398,\"identity\":\"54328996-c58e-43fc-8adf-8ea200d10ced\",\"added_by\":\"auto\",\"created_at\":\"2026-04-07 16:05:10\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":16924012,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/fab77712-bc3e-4abf-8619-14f729a5302e.pdf\"},{\"id\":99033112,\"identity\":\"31c66d4d-e99f-4e43-928b-1064e71a55e0\",\"added_by\":\"auto\",\"created_at\":\"2025-12-26 09:11:38\",\"extension\":\"zip\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":3538638,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementaryfiles.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8267643/v1/ac0e9c053a0f9eec926c25dc.zip\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Gp8 mediates adsorption of bacteriophage vB_VpP_21JZSM01 to the host Vibrio parahaemolyticus\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e is one of the principal pathogens responsible for seafood-associated diarrhoeal diseases worldwide (Li et al. 2019). Its pathogenicity arises from multifactorial virulence mechanisms, including adhesion, invasion, and immune-evasion strategies (Ghenem et al. 2017). This marine bacterium predominantly resides in coastal waters, seabed sediments, and consumable marine organisms, with seasonal prevalence peaking during summer months (Lopatek et al. 2018). Infections typically manifest as acute gastroenteritis characterised by abdominal cramps, nausea, vomiting, and fever, with immunocompromised individuals (e.g., those with diabetes or liver disease) facing elevated risks of septicaemia (Pazhani et al. 2021). In recent years, the overuse and/or misuse of antibiotics have resulted in the global emergence of an increasing number of multidrug-resistant strains of \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e. These strains carry genes that mediate multidrug resistance mechanisms, presenting significant challenges to antibiotic treatment (Y. Li et al. 2025). Globally, drug resistance profiles of \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e show significant geographical variation, with relatively high resistance rates in Asian countries, such as China, Malaysia, and South Korea. Coastal areas of China, with their industrial-scale aquaculture operations, face a serious \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e multidrug resistance problem attributable to the extensive use of antibiotics (Zhao et al. 2018). Therefore, finding an environmentally friendly, highly efficient alternative to antibiotics has become a significant research focus. Bacteriophages (phages), which are viruses that specifically infect bacteria, may offer a solution to the growing issue of multidrug-resistant bacteria resulting from excessive antibiotic use (Jia et al. 2023).\\u003c/p\\u003e\\n\\u003cp\\u003ePhages primarily consist of two major blocks: a head and a tail. The head is composed of a protein capsid that safeguards the internal nucleic acid from damage, while the tail comprises essential structures including a tail tube, tail sheath, tail fibres, and tail spikes, which facilitate attachment and penetration of the host bacteria (Bhella et al. 2023). Following the recognition and adsorption of the bacteriophage tail proteins to the receptors on the host surface, the viral genetic material is injected into the periplasm of the host bacterium. Subsequently, the phage hijacks the host\\u0026apos;s biosynthetic machinery to drive viral replication and assemble progeny virus particles. These virus particles are then released into the extracellular environment, resulting in host cell lysis (Stone et al. 2019). The tail protein structures and functions of different bacteriophages vary significantly. Therefore, the specificity of a bacteriophage depends on the binding specificity between its tail proteins and host receptors (Gaborieau et al. 2024). The tail fibre assembly (Tfa) proteins derived from the \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e phages Mu and P2 mediate fibre folding and remain at the distal end of the fibre, becoming a component of the mature phage particle and binding to lipopolysaccharides (LPS) on the bacterial surface (North et al. 2021). In phage T4, the tail fibres exhibit dual receptor specificity, initiating host adsorption via binding to the outer membrane protein OmpC in \\u003cem\\u003eE. coli\\u003c/em\\u003e K12 strains and to LPS receptors in \\u003cem\\u003eE. coli\\u003c/em\\u003e B strains (Taslem Mourosi et al. 2022). Hu et al. (2020) demonstrated that tail tubular proteins A (TTPA) and tail tubular proteins B (TTPB) of the \\u003cem\\u003eVibrio\\u003c/em\\u003e phage OWB mediate bacteriophage adsorption, enabling the adsorption to the transmembrane protein Vp0980 on the \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e strain ATCC17802. Andres et al. (2010) showed that the initial adhesion of P22 to \\u003cem\\u003eSalmonella\\u003c/em\\u003e is mediated by the interaction between LPS and the spike protein of the bacteriophage. In summary, among the molecular determinants of phage \\u0026ndash; host specificity, the tail proteins play pivotal roles in receptor recognition and adsorption.\\u003c/p\\u003e\\n\\u003cp\\u003eWe isolated vB_VpP_21JZSM01, a virulent long-tailed bacteriophage infecting \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e, from seafood samples. Morphological analysis revealed an icosahedral head approximately 55 nm in diameter and a non-contractile tail about 90 nm in length. The phage exhibited a broad lytic spectrum, with an optimal multiplicity of infection (MOI) of 0.01, a latent period of 25 minutes, and a burst size of 180 PFU cell⁻\\u0026sup1;. It demonstrated remarkable stability under various temperatures, pH conditions, and chloroform exposure. Additionally, vB_VpP_21JZSM01 significantly inhibited biofilm formation by its host bacterium. Further studies confirmed that vB_VpP_21JZSM01 primarily adsorbs to host cells by recognising surface polysaccharides.\\u003c/p\\u003e\\n\\u003cp\\u003eHere, we systematically investigated the structural and functional roles of the three predicted tail proteins (Gp8, Gp20, and Gp41) of the \\u003cem\\u003eVibrio\\u003c/em\\u003e phage vB_VpP_21JZSM01. Bioinformatics tools were used to elucidate the molecular signatures of these proteins through evolutionary conservation analysis and functional site prediction. A primary goal of functional genomics is to assign precise biological roles to genes predicted from sequence data. In this study, we addressed this challenge in the context of the phage vB_VpP_21JZSM01 genome, focusing on the functional characterisation of its structural components to elucidate the initial step of infection: host adsorption. Recombinant versions of these tail proteins were then produced using prokaryotic expression vectors and affinity purification. Finally, the dominant roles of these key tail proteins in host adsorption were explored using the double-layer agar plate method, fluorescence protein labelling, and transmission electron microscopy (TEM), revealing their sensitivity to environmental conditions such as temperature and pH. The results of this study offer a theoretical framework for understanding the mechanism underlying phage \\u0026ndash; host interactions.\\u003c/p\\u003e\"},{\"header\":\"Material and Methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eBacterial strains, phages, and plasmids\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e Vp1 was cultured at 37 \\u0026deg;C in Luria-Bertani (LB) medium supplemented with 3.5% (w/v) NaCl.\\u0026nbsp;Bacteriophage vB_VpP_21JZSM01 is preserved in our laboratory (GenBank accession number: OR734989.1). The pCold-GST plasmid (Takara Bio, Dalian, China), which tags proteins with glutathione S-transferase, was used for recombinant tail protein expression, while pET-28a-EGFP (Abiowell Biotechnology, Changsha, China), a plasmid encoding enhanced green fluorescent protein (EGFP), served as the fluorescent protein expression system.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBioinformatics analysis of phage tail protein\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe amino acid sequences of tail proteins were analysed using the BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for homology searches (Kuznetsov and Bollin 2021). Multiple sequence alignment was performed using the ClustalW algorithm implemented in MEGA 11, followed by phylogenetic reconstruction using the neighbor-joining (NJ) method with 1000 bootstrap replicates. Evolutionary conservation analysis was conducted using SnapGene, while sequence similarity assessment and heatmap visualization were achieved using TBtools-II. Structural characterisation was performed using CavityPlus (http://www.pkumdl.cn/cavityplus) to predict potential ligand-binding pockets and to identify key amino acid residues constituting the putative binding sites (Wang et al. 2023).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConstruction of prokaryotic expression plasmids\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eUsing vB_VpP_21JZSM01 genomic DNA as template, the tail genes \\u003cem\\u003eg8\\u003c/em\\u003e, \\u003cem\\u003eg20\\u003c/em\\u003e, and \\u003cem\\u003eg41\\u003c/em\\u003e were amplified using PCR. The amplified products were purified, double-digested with restriction enzymes, and ligated into the pCold-GST expression vector using T4 DNA ligase overnight at 16 \\u0026deg;C. The resulting recombinant plasmids, designated pCold-GST-\\u003cem\\u003eg8\\u003c/em\\u003e, pCold-GST-\\u003cem\\u003eg20\\u003c/em\\u003e, and pCold-GST-\\u003cem\\u003eg41\\u003c/em\\u003e, were verified by sequencing. The PCR primers used in this experiment are listed in Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 1\\u0026nbsp;\\u003c/strong\\u003ePCR primer sequences used to amplify tail genes.\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"99%\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003ePrimer name\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eBase sequence (5\\u0026rsquo;\\u0026rarr;3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTm (\\u0026deg;C)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAmplicon Size (bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eg8\\u003c/em\\u003e-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGGAATTC\\u003cstrong\\u003e\\u003cu\\u003eCATATG\\u003c/u\\u003e\\u003c/strong\\u003eATGAGAAAGTACAACGAAGATTATGC (\\u003cem\\u003eNde\\u0026nbsp;\\u003c/em\\u003eI)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e59.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1965\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eg8\\u003c/em\\u003e-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eCCG\\u003cstrong\\u003e\\u003cu\\u003eGAATTC\\u003c/u\\u003e\\u003c/strong\\u003eTTAATTCTGGTCAAATGTCTTGTAAAC (\\u003cem\\u003eEcoR\\u003c/em\\u003e I)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eg20\\u003c/em\\u003e-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGGAATTC\\u003cstrong\\u003e\\u003cu\\u003eCATATG\\u003c/u\\u003e\\u003c/strong\\u003eATGCTTGATATTATTGAGCTAAACAAA (\\u003cem\\u003eNde\\u003c/em\\u003e I)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e57.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e567\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eg20\\u003c/em\\u003e-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eACGC\\u003cstrong\\u003e\\u003cu\\u003eGTCGAC\\u003c/u\\u003e\\u003c/strong\\u003eTTATATCACGATAGGGTCGGTAG (\\u003cem\\u003eSal\\u003c/em\\u003e I)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e65.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eg41\\u003c/em\\u003e-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGGAATTC\\u003cstrong\\u003e\\u003cu\\u003eCATATG\\u003c/u\\u003e\\u003c/strong\\u003eATGTCTGATGTAATGCGCAAGATAG (\\u003cem\\u003eNde\\u0026nbsp;\\u003c/em\\u003eI)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e60.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e948\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eg41\\u003c/em\\u003e-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eCCG\\u003cstrong\\u003e\\u003cu\\u003eGAATTC\\u003c/u\\u003e\\u003c/strong\\u003eTTAAACTCGCGCAACAACAATAACG (EcoR I)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e62.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eBold underlining indicates restriction sites for the enzymes in parentheses.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExpression and purification of recombinant tail proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePlasmids pCold-GST-\\u003cem\\u003eg8\\u003c/em\\u003e, pCold-GST-\\u003cem\\u003eg20\\u003c/em\\u003e, and pCold-GST-\\u003cem\\u003eg41\\u003c/em\\u003e were transformed into \\u003cem\\u003eE. coli\\u003c/em\\u003e BL21 (DE3) cells, expressed, and verified by restriction enzyme analysis. For recombinant protein purification, the cells were cultured in liquid LB medium supplemented with 50 \\u0026mu;g ml\\u003csup\\u003e-1\\u003c/sup\\u003e ampicillin at 37 \\u0026deg;C with shaking until the OD\\u003csub\\u003e600 nm\\u003c/sub\\u003e reached 0.6, then induced by adding isopropyl \\u0026beta;-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e and incubating at 16 \\u0026deg;C for 18 h. The bacterial cells were harvested by centrifugation (4 \\u0026deg;C, 12,000 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e, 20 min) and the pellets were resuspended in 5\\u0026ndash;10 ml Binding Buffer (1% Triton X-100, 150 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e NaCl, 50 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e Tris-HCl pH 7.5, 1 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e EDTA, 1 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e DTT, and protease inhibitors) (Chatzileontiadou et al. 2021). The cell suspension was subjected to ultrasonication on ice at 300 W under pulse mode (2 s working and 3 s stopping) for 15 min (K. Zhang et al. 2021). The supernatant was collected and subjected to affinity purification using Ni-Agarose Resin (Beyotime, Shanghai, China). The bound proteins were eluted with Elution Buffer (10 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e reduced glutathione, 50 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e Tris-HCl pH 8.0). The eluted fractions containing the purified recombinant proteins (rGp8, rGp20, and rGp41) were collected, and their concentrations were determined using a BCA Protein Concentration Assay Kit (Solarbio, Beijing, China).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eWestern Blot (WB) analysis of recombinant proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWB analysis was performed following Tsuji\\u0026rsquo;s method with minor modifications (2020). Briefly, purified recombinant proteins rGp8, rGp20, and rGp41 were separated by SDS-PAGE and subsequently transferred onto methanol-activated PVDF membranes at 180 mA for 1.5 h. After the transfer, PVDF membranes were blocked with 4% (w/v) skimmed milk at room temperature for 2 h. They were then incubated overnight at 4 \\u0026deg;C with the primary antibody, ProteinFind\\u0026reg; Anti-His Mouse Monoclonal Antibody (TransGen Biotech, Beijing, China). Following washing with TBST (Tris-buffered saline with 0.1% Tween 20), the membranes was incubated with an HRP-conjugated goat anti-mouse IgG (H+L) (Sangon Biotech, Shanghai, China) secondary antibody for 1\\u0026ndash;2 h at room temperature. After furthe washing with TBST, protein bands were visualised using an enhanced chemiluminescence substrate. To confirm the integrity and position of the recombinant proteins, a parallel SDS-PAGE gel was run with identical samples and stained with BeyoBlue\\u0026trade; Coomassie Blue Super Fast Staining Solution (Beyotime, Shanghai, China).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePreparation of phage lysate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFollowing the method of Asghar et al. (2022), with slight modifications, a 500 \\u0026mu;l aliquot of bacteriophage vB_VpP_l stock (-80 \\u0026deg;C) was inoculated into 2216E liquid medium containing 2 ml of \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e at logarithmic growth phase (OD\\u003csub\\u003e600\\u003c/sub\\u003e \\u003csub\\u003enm\\u003c/sub\\u003e = 0.6-0.8). The mixture was incubated at 37 \\u0026deg;C with shaking (180 rpm) for 5 h. Subsequent centrifugation (8,000 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e, 10 min, 4 \\u0026deg;C) was performed to obtain the supernatant, followed by filtration through a 0.22 \\u0026mu;m pore-size membrane filter. The resulting filtrate was collected as the amplified phage lysate.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompetitive adsorption testing of tail proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFor competitive adsorption inhibition assays, 200 \\u0026mu;l of bacterial suspension (10\\u003csup\\u003e9\\u003c/sup\\u003e cfu ml\\u003csup\\u003e-1\\u003c/sup\\u003e) was mixed with an equal volume of rGp8, rGp20, or rGp41 (diluted in PBS to a concentration of 1 mg ml\\u003csup\\u003e-1\\u003c/sup\\u003e), or 200 \\u0026mu;l sterile LB broth for the control group, and incubated at 37 \\u0026deg;C for 30 min. The mixtures were centrifuged (8,000 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e, 4 \\u0026deg;C, 5 min), and the resulting pellets were washed three times with PBS to remove unbound proteins before being resuspended in 200 \\u0026mu;l PBS. An equal volume of phage proliferation solution was added, incubated at 37 ℃ for 10 min, and centrifuged. The phage titre in the supernatant was quantified using the double-layer agar plaque assay, and the phage adsorption rate was calculated (Gou et al. 2025).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFluorescent labeling\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;of tail proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo obtain recombinant tail proteins fused with EGFP, we ligated the PCR products \\u003cem\\u003eg8\\u003c/em\\u003e, \\u003cem\\u003eg20\\u003c/em\\u003e, and \\u003cem\\u003eg41\\u003c/em\\u003e in 2.3 with the vector pET-28a-EGFP to produce rGp8-EGFP, rGp20-EGFP, and rGp41-EGFP, respectively. A 100 \\u0026mu;l aliquot of bacterial suspension was incubated with an equal volume of rGp8-EGFP, rGp20-EGFP and Gp41-EGFP at 37 ℃ for 30 min, using an untreated bacterial suspension as the control. The mixture was centrifuged (4 \\u0026deg;C, 8,000 \\u0026times; g, 10 min), and the pellet was collected, washed three times with PBS, and fluorescence was measured using a spectrofluorometer (JEM1200EX, JEOL, Tokyo, Japan).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTEM of tail proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eProtein adsorption assays were performed following a modified protocol reported by Li et al (2025). Briefly, the host bacteria were mixed with rGp8, rGp20, or rGp41 and incubated for 30 min. After centrifugation, the pellets were resuspended in 100 \\u0026mu;l of PBS buffer. A pure bacterial suspension was used as the control. Copper grids were immersed in resuspension solution for 10 min, and filter paper was used to absorb excess liquid. The grids were then fixed overnight with 2.5% glutaraldehyde. Following removal of the excess liquid, the grids were negatively stained with 2% phosphotungstic acid for 2 min. The staining solution was aspirated, and the grids were air-dried at room temperature before observation using TEM (JEM-F200, JEOL, Tokyo, Japan) with an accelerating voltage of 80 kV.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEffect of temperature on adsorption of tail tubular protein to host bacteria\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe temperature-dependent adsorption assay was conducted following a modified protocol adapted from Zhang et al (2018). Briefly, 200 \\u0026mu;l aliquots of rGp8 were treated at 4 ℃, 37 ℃, 45 ℃, 55 ℃, 65 ℃, or 75 ℃ for 10 min. Each sample was then combined with an equal volume of host bacterial suspension in the logarithmic growth phase and incubated for 30 min under static conditions to facilitate protein-mediated bacterial adsorption. An untreated bacterial suspension was used as the control. The suspensions were centrifuged (8,000 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e, 4 \\u0026deg;C, 10 min), and the pellets were resuspended in 200 \\u0026mu;l medium and mixed with an equivalent volume of phage suspension (7.96\\u0026times;10\\u003csup\\u003e8\\u003c/sup\\u003e PFU ml\\u003csup\\u003e-1\\u003c/sup\\u003e). After a further 10 min incubation at 37 \\u0026deg;C, the mixtures were centrifuged, and the phage titre in the supernatant was quantified using the double-layer agar plaque assay.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEffect of pH on adsorption of tail tubular protein to host bacteria\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo assess pH-dependent adsorption characteristics, aliquots of purified rGp8 were mixed with 100 \\u0026mu;l of PBS buffer adjusted to pH values of 3, 4, 5, 6, 7, 8, 9, 10, and 11 using 1 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e NaOH or 1 mmol l\\u003csup\\u003e-1\\u003c/sup\\u003e HCl. The mixture were incubated for 10 min at room temperature. Each sample was then combined with an equal volume of bacterial suspension （10\\u003csup\\u003e9\\u003c/sup\\u003e cfu ml\\u003csup\\u003e-1\\u003c/sup\\u003e） and incubated for 30 min at 37 \\u0026deg;C to facilitate adsorption. Unbound proteins were removed by centrifugation (8,000 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e, 4 \\u0026deg;C, 10 min). The bacterial pellets were subsequently resuspended in 200 \\u0026mu;l of medium and mixed with an equivalent volume of phage suspension. After a further10 min incubation at 37 \\u0026deg;C, the samples were centrifuged, and the phage titre in the supernatant was quantified using a double-layer agar plaque assay.\\u003c/p\\u003e\\n\\u003cp id=\\\"_Toc130042640\\\"\\u003e\\u003cstrong\\u003eStatistical analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll tests were carried out in triplicate (n = 3), with data presented as means \\u0026plusmn; standard deviation (SD). Statistical analysis was performed using SPSS version 29.0 with one-way analysis of variance. Mean values of individual groups were compared using Duncan\\u0026apos;s test to determine statistical significance, which was indicated by a \\u003cem\\u003ep\\u0026nbsp;\\u003c/em\\u003e‑ value \\u0026lt; 0.05.\\u003c/p\\u003e\"},{\"header\":\"Results and Discussion\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eBioinformatics analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePhylogenetic analysis of tail proteins was performed using homologous sequences identified via BLAST. In the phylogenetic tree constructed from these sequences, the tail tubular protein Gp8 (WPH64010.1) exhibited the closest evolutionary relationship with the corresponding protein from \\u003cem\\u003eVibrio\\u0026nbsp;\\u003c/em\\u003ephage VPMS1 (YP008239681.1) (Fig. 1a).\\u003c/p\\u003e\\n\\u003cp\\u003eComparative sequence analysis of proteins within the same phylogenetic clade demonstrated 77.22% amino acid identity between Gp8 and VPMS1 tail tubular protein (Fig. 1b). Multiple sequence alignment revealed high conservation in the C-terminal and central domains (Fig. S1), suggesting that these regions are critical for maintaining structural integrity and biological function. In contrast, the N-terminal region displayed significant sequence variability across species. We hypothesised that the conserved C-terminal domain represents the key recognition motif for host surface receptor binding, while the variable N-terminus contributes to host specificity.\\u003c/p\\u003e\\n\\u003cp\\u003eThe tail completion protein Gp20 was found to share the closest phylogenetic relationship with the tail completion protein of\\u0026nbsp;\\u003cem\\u003eVibrio\\u003c/em\\u003e phage 1.029.O.10N.261.55.A7 (AUR82863.1) (Fig. 2a). Sequence similarity between the two proteins reached 91.49% (Fig. 2b), but alignment of homologous sequences (Fig. S2) revealed low amino acid sequence conservation. This suggests that most amino acid residues have undergone evolutionary changes, with only potentially functionally important residues being retained.\\u003c/p\\u003e\\n\\u003cp\\u003eThe Gp41 tail fibre protein was found to exhibit the closest phylogenetic relationship with the putative tail fibre protein of \\u003cem\\u003eVibrio\\u003c/em\\u003e phage 1.056.O._10N.261.48.C11 (AUR84456.1) and that of phage 393E50-1 (CAH9015475.1) (Fig. 3a), with sequence similarities of 64.13% and 62.22%, respectively (Fig. 3b). Alignment of homologous sequences revealed low amino acid conservation (Fig. S3), suggesting that Gp41 may not play a key role in the adsorption of the phage to its host.\\u003c/p\\u003e\\n\\u003cp\\u003eThe active site of a protein refers to a specific region on its interior or exterior surface that typically adopts a defined tertiary structure, binds to a ligand, and constitutes a key component of its biological functions (Coleman and Sharp 2010). Identifying ligand-binding pockets on the protein surface is of considerable importance for the functional prediction, drug target selection, and drug design. Gp8 exhibited a strong druggability score of 1070, with pocket dimensions of 25 (X), 18 (Y), and 15.5 (Z) centred at coordinates 11 (X), 14.5 (Y), and 8.75 (Z) (Fig. 4a). In contrast, Gp20 showed a higher druggability score of 2747, with pocket dimensions of 13 (X), 16 (Y), and 13.5 (Z) centred at 184.5 (X), 157.5 (Y), and 140.75 (Z) (Fig. 4b). The corresponding amino acid sites are detailed in Table (Table. S1). No active site was predicted for Gp41.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExpression and purification of recombinant proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe genes \\u003cem\\u003eg8\\u003c/em\\u003e, \\u003cem\\u003eg20\\u003c/em\\u003e, and \\u003cem\\u003eg41\\u003c/em\\u003e of vB_VpP_l were PCR-amplified using the phage genome as a template and cloned into the pCold-GST expression vector (Fig. S4). Large-scale recombinant protein expression in \\u003cem\\u003eE. coli\\u0026nbsp;\\u003c/em\\u003ewas carried out, and the target proteins were purified from the culture supernatant. SDS-PAGE analysis confirmed the expected molecular weights of the recombinant proteins: Gp8, rGp8 (100 kDa), rGp20 (51 kDa), and rGp41 (62 kDa) (Fig. 5a). WB analysis further verified the presence of a single specific band corresponding to each recombinant protein (Fig. 5b).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIdentification of the key tail protein through c\\u003c/strong\\u003e\\u003cstrong\\u003eompetitive adsorption testing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo investigate the role of each recombinant tail protein in phage adsorption, host bacterial cells were pre‑incubated with purified rGp8, rGp20, or rGp41 (1 mg ml\\u003csup\\u003e-1\\u003c/sup\\u003e) for 10 min at 37 \\u0026deg;C prior to exposure to phage vB_VpP_21JZSM01 at a titre of 7.96\\u0026times;10⁸ PFU ml\\u003csup\\u003e-1\\u003c/sup\\u003e. Phage adsorption efficiency was quantified using the double-layer agar plate method. As shown in Fig. 6, compared with the untreated control, pretreatment with rGp8 significantly reduced phage adsorption by 81.3%, whereas phage adsorption to bacteria pretreated with rGp20 or rGp41 was largely unaffected. This finding indicates that rGp8 blocked phage vB_VpP_l adsorption and infection of host bacteria by occupying the phage‑binding sites, highlighting the critical role of the tail tubular protein rGp8 in this process.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eVerification of rGp8 as the key tail protein through f\\u003c/strong\\u003e\\u003cstrong\\u003eluorescent labeling\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe adsorption activity of the recombinant tail proteins was verified indirectly by fusing each with EGFP, which has an emission wavelength of 510 nm (Stepanenko et al. 2004). Following incubation of a suspension of host bacteria with rGp8-EGFP, rGp20-EGFP, or rGp41-EGFP fusion proteins, a distinct peak near the emission wavelength of EGFP would be expected for proteins involved in phage adsorption. As shown in Fig. 7, this fluorescence peak was only observed with rGp8-EGFP. Bacteria incubated with rGp20-EGFP or rGp41-EGFP exhibited fluorescence levels similar to those of the untreated control group, further confirming the tail tubular protein rGp8 as the receptor‑binding protein for host infection by phage vB_VpP_l.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTEM of host adsorption by recombinant tail proteins\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTEM was used to observe the adsorption of rGp, rGp20, and rGp41 following incubation of each with host bacteria (Fig. 8). While clear morphological structures of the bacteria were visible in all TEM images, only rGp8 exhibited obvious adsorption to the surface of the host bacterial cells (Fig. 8a). The appearance of bacteria incubated with rGp20 (Fig. 8b) or rGp41 (Fig. 8c) was similar to that of the control bacteria (Fig. 8d), with no evidence of protein adsorption. These results further confirm that the tail tubular protein rGp8 is the key protein mediating phage vB_VpP_l adsorption to its host.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEffect of temperature on adsorption of tail tubular protein to host bacteria\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo examine the effect of temperature on the ability of recombinant tail tubular protein rGp8 to influence the phage adsorption to host bacteria, aliquots of rGp8 were pre‑incubated at 4 ℃, 37 ℃, 45 ℃, 55 ℃, 65 ℃, and 75 ℃ prior to incubation with a host bacterial suspension and subsequent exposure to phage. Results from the double‑layer agar plaque assay (Fig. 9) indicated that pre‑incubation of rGp8 at 4 ℃ resulted in a phage adsorption rate of 20.13%, which was not significantly different from that observed in the competitive adsorption inhibition assay (17.1%; Fig. 6). This suggests that rGp8 retained approximately 80% of its adsorption activity at 4 ℃. However, as the pre‑incubation temperature increased, the binding of rGp8 decreased while the phage adsorption rate rose. This indicates that occupancy of the bacterial surface by rGp8 was most effective at 4 ℃, thereby blocking phage adsorption and lysis of host cells. When rGp8 was pre‑incubated at 75 ℃, the phage adsorption rate reached 78.39%, corresponding to a reduction in rGp8 adsorption to about 20%. In summary, the tail tubular protein of phage vB_VpP_l exhibited the highest adsorption efficiency for host bacteria at 4 ℃, consistent with the findings of Zhang et al (2018).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEffect of pH on adsorption of tail tubular protein to host bacteria\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo examine the effect of pH on the ability of the recombinant tail tubular protein rGp8 to influence phage adsorption to host bacteria, aliquots of rGp8 were treated at different pH values (3\\u0026ndash;11) for 10 min prior to incubation with a host bacterial suspension and subsequent exposure to phage. After removing unbound protein by centrifugation, double-layer agar plaque assays were performed (Fig. 10). At pH 6-8, the adsorption rate of the tail tubular protein ranged from 51.3% to 79.6%, indicating relatively effective adsorption under neutral conditions. The results showed that phage adsorption rates at pH 3-5 and pH 9-11 were not significantly different from those of the control group, suggesting that rGp8 exhibited minimal adsorption to the host bacteria under these pH conditions. This may be attributable to alterations in the charge distribution of rGp8 under acidic and alkaline conditions, where disruption of hydrogen and ionic bonds leads to protein denaturation or conformational changes that impair host recognition (Sahin et al. 2010).\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eOur findings provide a clear functional annotation for the \\u003cem\\u003eg8\\u003c/em\\u003e gene within the vB_VpP_21JZSM01 genome, transforming it from a hypothetical open reading frame into a mechanistically characterised host-recognition protein. This integrated approach\\u0026mdash;from genomic sequence to in vitro functional analysis\\u0026mdash;exemplifies how discrete genetic elements determine pivotal phenotypic outcomes in phage biology. Beyond its role as a structural component, Gp8 exhibits evolutionary conservation in its C-terminal domain, which is likely to harbour critical ligand-binding pockets essential for receptor recognition. Collectively, results from competitive adsorption assays, fluorescence labeling, and TEM with rGp8 demonstrated that rGp8 dominates the initial adsorption phase by occupying host surface receptors, effectively blocking phage attachment.\\u003c/p\\u003e\\n\\u003cp\\u003eEnvironmental sensitivity testing of rGp8 indicated that its adsorption is optimal at 4 \\u0026deg;C and neutral pH, but is severely impaired under high temperatures or extreme pH conditions, providing important insights for practical applications. These findings suggest that phage-based biocontrol strategies targeting \\u003cem\\u003eV. parahaemolyticus\\u003c/em\\u003e in seafood or aquaculture should prioritise storage conditions that preserve rGp8 functionality. From an evolutionary perspective, the high conservation of rGp8 across \\u003cem\\u003eVibrio\\u003c/em\\u003e-infecting phages (e.g., VPMS1) indicates a shared receptor-binding strategy within this phage group. This raises intriguing questions about the identity of the host receptor\\u0026mdash;likely a conserved surface protein or polysaccharide\\u0026mdash;which warrants further structural and genetic investigation. To identify the host receptor for rGp8, future studies could employ cryo-electron microscopy or gene knockout approaches, thereby advancing precision in phage engineering. Furthermore, the methodology established here\\u0026mdash;namely competitive phage adsorption assays combined with fluorescence protein tracking\\u0026mdash;provides a robust framework for the rapid identification of adsorption proteins in other phage systems, accelerating the development of phage-based therapeutics against multidrug-resistant pathogens. Our findings elucidate the phage adsorption machinery while establishing a crucial link between fundamental virology and applied microbiology.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the language of a draft of this manuscript.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Basic Scientific Research Project of Liaoning Provincial Department of Education, P.R.China (LJ212510167019) and the Open Fund of Institute of Ocean Research, Bohai University (BDHYYJY2025002).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting Interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNo conflict of interest declared. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization, SX.L and \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;DF.Z.; methodology, SX.L., J.L. and \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;DF.Z.; software, XN.W. and K.L.; validation, SX.L. and K.L.; formal analysis, SX.L.; investigation, J.L. and M.Z.; resources, DF.Z. and JR.L.; data curation, M.Z. and CY.L.; writing—original draft preparation, SX.L. and XN.W.; writing—review and editing, DF.Z. and M.Z; visualization, XN.W. and CY.L.; supervision, K.L.; project administration, DF.Z., XP.L. and JR.L.; funding acquisition, DF.Z. and XP.L. All authors have read and agreed to the published version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData will be made available on request. All data generated in this study are available within this article and its supplementary information files.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical Approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNo studies involving human participants or animals were conducted by the authors for this article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have read and agreed to the final version of the manuscript. Furthermore, they consent to its submission for publication.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003cp\\u003eAsghar S, Ahmed A, Khan S, Lail A, Shakeel M (2022) Genomic characterization of lytic bacteriophages A\\u0026yen;L and A\\u0026yen;M infecting ESBL \\u003cem\\u003eK. pneumoniae\\u003c/em\\u003e and its therapeutic potential on biofilm dispersal and \\u003cem\\u003ein-vivo\\u003c/em\\u003e bacterial clearance. Microbiol Res 262:127104. https://doi.org/10.1016/j.micres.2022.127104\\u003c/p\\u003e\\n\\u003cp\\u003eBhella D, Xiao H, Tan L, Tan Z, Zhang Y, Chen W, Li X, Song J, Cheng L, Liu H (2023) Structure of the siphophage neck\\u0026ndash;tail complex suggests that conserved tail tip proteins facilitate receptor binding and tail assembly. PLoS Biol 21(12):e3002441. https://doi.org/10.1371/journal.pbio.3002441\\u003c/p\\u003e\\n\\u003cp\\u003eChatzileontiadou DSM, Szeto C, Jayasinghe D, Gras S (2021) Protein purification and crystallization of HLA-A\\u0026lowast;02:01 in complex with SARS-CoV-2 peptides. Star Protoc 2(3):100635. https://doi.org/10.1016/j.xpro.2021.100635\\u003c/p\\u003e\\n\\u003cp\\u003eColeman RG, Sharp KA (2010) Protein pockets: inventory, shape, and comparison. J Chem Inf Model 50(4):589-603. https://doi.org/https://doi.org/10.1021/ci900397t\\u003c/p\\u003e\\n\\u003cp\\u003eDorothee A, Christin H, Ulrich B, Ana\\u0026iuml;t S, Stefanie B, Robert S (2010) Tailspike interactions with lipopolysaccharide effect DNA ejection from phage P22 particles in vitro. J Biol Chem 285(47):36768-36775. https://doi.org/10.1074/jbc.M110.169003\\u003c/p\\u003e\\n\\u003cp\\u003eGaborieau B, Vaysset H, Tesson F, Charachon I, Dib N, Bernier J, Dequidt T, Georjon H, Clermont O, Hersen P, Debarbieux L, Ricard J-D, Denamur E, Bernheim A (2024) Prediction of strain level phage\\u0026ndash;host interactions across the Escherichia genus using only genomic information. Nat Microbiol 9(11):2847-2861. https://doi.org/10.1038/s41564-024-01832-5\\u003c/p\\u003e\\n\\u003cp\\u003eGhenem L, Elhadi N, Alzahrani F, Nishibuchi M (2017) \\u003cem\\u003eVibrio Parahaemolyticus\\u003c/em\\u003e: a review on distribution, pathogenesis, virulence determinants and epidemiology. Saudi J Med Med Sci 5(2):93-103. https://doi.org/10.4103/sjmms.sjmms_30_17\\u003c/p\\u003e\\n\\u003cp\\u003eGou Z, Yao P, Xiong L, Wang X, Yuan Q, Sun F, Cheng Y, Xia P (2025) Potential of a phage cocktail in the treatment of multidrug-resistant \\u003cem\\u003eKlebsiella pneumoniae\\u003c/em\\u003e pulmonary infection in mice. BMC Microbiol 25(1):151. https://doi.org/10.1186/s12866-025-03851-6\\u003c/p\\u003e\\n\\u003cp\\u003eHu M, Zhang H, Gu D, Ma Y, Zhou X (2020) Identification of a novel bacterial receptor that binds tail tubular proteins and mediates phage infection of \\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e. Emerging Microbes Infect 9(1):855-867. https://doi.org/10.1080/22221751.2020.1754134\\u003c/p\\u003e\\n\\u003cp\\u003eJia H-J, Jia P-P, Yin S, Bu L-K, Yang G, Pei D-S (2023) Engineering bacteriophages for enhanced host range and efficacy: insights from bacteriophage-bacteria interactions. Front Microbiol 14:1172635. https://doi.org/10.3389/fmicb.2023.1172635\\u003c/p\\u003e\\n\\u003cp\\u003eKuznetsov A, Bollin CJ (2021) NCBI genome workbench: desktop software for comparative genomics, visualization, and GenBank data submission. In: Katoh, K. (eds) Multiple Sequence Alignment. Methods in Molecular Biology, vol 2231. Humana, New York, pp 261-295. https://doi.org/10.1007/978-1-0716-1036-7_16\\u003c/p\\u003e\\n\\u003cp\\u003eLi L, Meng H, Gu D, Li Y, Jia M (2019) Molecular mechanisms of \\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e pathogenesis. Microbiol Res 222:43-51. https://doi.org/10.1016/j.micres.2019.03.003\\u003c/p\\u003e\\n\\u003cp\\u003eLi P, Ma W, Cheng J, Zhan C, Lu H, Shen J, Zhou X (2025) Phages adapt to recognize an O-antigen polysaccharide site by mutating the \\u0026ldquo;backup\\u0026rdquo; tail protein ORF59, enabling reinfection of phage-resistant \\u003cem\\u003eKlebsiella pneumoniae\\u003c/em\\u003e. Emerging Microbes Infect 14(1):2455592. https://doi.org/10.1080/22221751.2025.2455592\\u003c/p\\u003e\\n\\u003cp\\u003eLi Y, Lin G, Pengsakul T, Yan Q, Huang L (2025) Antibiotic resistance in \\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e: mechanisms, dissemination, and global public health challenges\\u0026mdash;a comprehensive review. Rev Aquacult 17(1):e13010. https://doi.org/10.1111/raq.13010\\u003c/p\\u003e\\n\\u003cp\\u003eLopatek M, Wieczorek K, Osek J, Bj\\u0026ouml;rkroth J (2018) Antimicrobial resistance, virulence Factors, and genetic profiles of \\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e from seafood. Appl Environ Microbiol 84(16):e00537-00518. https://doi.org/10.1128/aem.00537-18\\u003c/p\\u003e\\n\\u003cp\\u003eMissirlis F, Tsuji Y (2020) Transmembrane protein western blotting: Impact of sample preparation on detection of SLC11A2 (DMT1) and SLC40A1 (ferroportin). PLoS One 15(7):e0235563. https://doi.org/10.1371/journal.pone.0235563\\u003c/p\\u003e\\n\\u003cp\\u003eNorth OI, Davidson AR, O\\u0026apos;Toole G (2021) Phage proteins required for tail fiber assembly also bind specifically to the surface of host bacterial strains. J Bacteriol 203(3):e00406-00420. https://doi.org/10.1128/jb.00406-20\\u003c/p\\u003e\\n\\u003cp\\u003ePazhani GP, Chowdhury G, Ramamurthy T (2021) Adaptations of \\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e to stress during environmental survival, host colonization, and infection. Front Microbiol 12:737299. https://doi.org/10.3389/fmicb.2021.737299\\u003c/p\\u003e\\n\\u003cp\\u003eSahin E, Grillo AO, Perkins MD, Roberts CJ (2010) Comparative effects of pH and ionic strength on protein\\u0026ndash;protein interactions, unfolding, and aggregation for IgG1 antibodies. J Pharm Sci 99(12):4830-4848. https://doi.org/10.1002/jps.22198\\u003c/p\\u003e\\n\\u003cp\\u003eStepanenko OV, Verkhusha VV, Kazakov VI, Shavlovsky MM, Kuznetsova IM, Uversky VN, Turoverov KK (2004) Comparative studies on the structure and stability of fluorescent proteins EGFP, zFP506, mRFP1, \\u0026quot;dimer2\\u0026quot;, and DsRed1. Biochemistry 43(47):14913-14923. https://doi.org/10.1021/bi048725t\\u003c/p\\u003e\\n\\u003cp\\u003eStone E, Campbell K, Grant I, McAuliffe O (2019) Understanding and exploiting phage\\u0026ndash;host interactions. Viruses 11(6):567. https://doi.org/10.3390/v11060567\\u003c/p\\u003e\\n\\u003cp\\u003eTaslem Mourosi J, Awe A, Guo W, Batra H, Ganesh H, Wu X, Zhu J (2022) Understanding bacteriophage tail fiber interaction with host surface receptor: the key \\u0026ldquo;blueprint\\u0026rdquo; for reprogramming phage host range. Int J Mol Sci 23(20):12146. https://doi.org/10.3390/ijms232012146\\u003c/p\\u003e\\n\\u003cp\\u003eWang S, Xie J, Pei J, Lai L (2023) CavityPlus 2022 update: an integrated platform for comprehensive protein cavity detection and property analyses with user-friendly tools and cavity databases. J Mol Biol 435(14):168141. https://doi.org/10.1016/j.jmb.2023.168141\\u003c/p\\u003e\\n\\u003cp\\u003eZhang K, Tan R, Yao D, Su L, Xia Y, Wu J (2021) Enhanced production of soluble \\u003cem\\u003ePyrococcus furiosus\\u003c/em\\u003e \\u0026alpha;-amylase in \\u003cem\\u003eBacillus subtilis\\u003c/em\\u003e through chaperone co-expression, heat treatment and fermentation optimization. J Microbiol Biotechnol 31(4):570-583. https://doi.org/10.4014/jmb.2101.01039\\u003c/p\\u003e\\n\\u003cp\\u003eZhang Z, Tian C, Zhao J, Xiao C, Wei X, Li H, Lin W, Feng R, Jiang A, Yang W, Yuan J, Zhao X (2018) Characterization of tail sheath protein of N4-like phage phiAxp-3. Front Microbiol 9:450. https://doi.org/10.3389/fmicb.2018.00450\\u003c/p\\u003e\\n\\u003cp\\u003eZhao S, Ma L, Wang Y, Fu G, Zhou J, Li X, Fang W (2018) Antimicrobial resistance and pulsed-field gel electrophoresis typing of \\u003cem\\u003eVibrio parahaemolyticus\\u003c/em\\u003e isolated from shrimp mariculture environment along the east coast of China. Mar Pollut Bull 136:164-170. https://doi.org/10.1016/j.marpolbul.2018.09.017\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"antonie-van-leeuwenhoek\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"anto\",\"sideBox\":\"Learn more about [Antonie van Leeuwenhoek](https://www.springer.com/journal/10482)\",\"snPcode\":\"10482\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10482/3\",\"title\":\"Antonie van Leeuwenhoek\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"adsorption, bacteriophage vB_VpP_21JZSM01, phage-host interaction, tail tubular protein, Vibrio parahaemolyticus\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8267643/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8267643/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"In this study, we aimed to identify the principal tail protein responsible for mediating adsorption of bacteriophage vB_VpP_21JZSM01 to its host bacterium Vibrio parahaemolyticus, a significant pathogen in aquaculture. The structure and function of three candidate proteins—the tail tubular protein Gp8, tail completion protein Gp20, and tail fibre protein Gp41 — were predicted through bioinformatic analysis. Recombinant plasmids were constructed and the three tail proteins were successfully expressed and purified. Competitive adsorption assays demonstrated an 81.3% reduction in bacteriophage adsorption efficiency following pre-treatment with rGp8, whereas rGp20 and rGp41 showed no statistically significant effects (p \\u003e 0.05). Labelling experiments using enhanced green fluorescent protein (EGFP) fusions revealed that only the group treated with rGp8-EGFP exhibited specific fluorescence signals. Furthermore, tight binding of rGp8 to the surface of host bacteria was directly visualised by transmission electron microscopy. Analysis of environmental factors indicated that the adsorption efficiency of rGp8 was optimal at 4 °C (approximately 80%), decreasing to 30% at 75 °C. Neutral pH supported the highest adsorption efficiency (70 – 80%), while strongly acidic (pH ≤ 5) or alkaline (pH ≥ 9) conditions markedly inhibited adsorption, reducing it to below 20%. Our findings identify the tail tubular protein rGp8 as the core functional determinant for host cell adsorption of bacteriophage vB_VpP_21JZSM01, with its adsorption efficiency modulated by temperature and pH.\",\"manuscriptTitle\":\"Gp8 mediates adsorption of bacteriophage vB_VpP_21JZSM01 to the host Vibrio parahaemolyticus\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-12-26 09:11:33\",\"doi\":\"10.21203/rs.3.rs-8267643/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-01-17T08:49:49+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-01-15T08:35:58+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-12-31T03:11:48+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"285254668425151404712069199604178641364\",\"date\":\"2025-12-27T07:39:57+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"275943231640808937183230907347315306612\",\"date\":\"2025-12-25T07:33:49+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-12-25T07:01:34+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-12-06T03:42:59+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-12-06T03:41:28+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Antonie van Leeuwenhoek\",\"date\":\"2025-12-03T07:59:27+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"antonie-van-leeuwenhoek\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"anto\",\"sideBox\":\"Learn more about [Antonie van Leeuwenhoek](https://www.springer.com/journal/10482)\",\"snPcode\":\"10482\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10482/3\",\"title\":\"Antonie van Leeuwenhoek\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"94168f67-1ad3-4902-bcbf-c03f23190fec\",\"owner\":[],\"postedDate\":\"December 26th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-04-07T16:02:04+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-8267643\",\"link\":\"https://doi.org/10.1007/s10482-026-02295-w\",\"journal\":{\"identity\":\"antonie-van-leeuwenhoek\",\"isVorOnly\":false,\"title\":\"Antonie van Leeuwenhoek\"},\"publishedOn\":\"2026-04-04 15:58:42\",\"publishedOnDateReadable\":\"April 4th, 2026\"},\"versionCreatedAt\":\"2025-12-26 09:11:33\",\"video\":\"\",\"vorDoi\":\"10.1007/s10482-026-02295-w\",\"vorDoiUrl\":\"https://doi.org/10.1007/s10482-026-02295-w\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8267643\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8267643\",\"identity\":\"rs-8267643\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}