{"paper_id":"4debc89f-d9b5-4af3-bb5f-d78d0a3f64e0","body_text":"PPP5C pathogenic variant identified: a potential key to gaining insight into developmental and epileptic encephalopathy? | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PPP5C pathogenic variant identified: a potential key to gaining insight into developmental and epileptic encephalopathy? Raffaele Falsaperla, Annamaria Sapuppo, Xena Giada Pappalardo, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5442441/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 Apr, 2025 Read the published version in Molecular and Cellular Pediatrics → Version 1 posted 9 You are reading this latest preprint version Abstract Background Emerging evidence suggesting a possible link between the PPP5C gene (Protein Phosphatase 5 Catalytic Subunit; OMIM#600658) and developmental and epileptic encephalopathy (DEE, OMIM#308350), although the clinical significance of pathogenic variants in this gene remains unclear. PPP5C is a member of the protein phosphatase catalytic subunit family, which is involved in various signaling pathways governing cell growth, differentiation, and responses to hormonal signals or cellular stress. To date, only one case with a PPP5C variant has been reported, associated with a severe neurological phenotype, including microcephaly, failure to thrive, and early-onset seizures. Results We report a 12-year-old girl affected by epilepsy and learning disorders. At the age of five, she presented convulsive status epilepticus with respiratory failure at onset and she started anticonvulsant therapy with Levetiracetam with a significant improvement. Genetic analysis revealed a de novo heterozygous missense variant of PPP5C gene (c.202C > T: p.Arg68Cys ), which had not been previously described in the literature. Conclusion This case expands the phenotypic spectrum associated with PPP5C variants, highlighting the potential role of this gene in neurological disorders. Our findings may provide some valuable insights into the spectrum of phenotypic manifestations linked to this gene less investigated in neuropediatrics. PPP5C developmental disorders status epilepticus developmental and epileptic encephalopathy Figures Figure 1 Figure 2 Figure 3 Figure 4 Background New findings indicate a potential association between the PPP5C (Protein Phosphatase 5 Catalytic Subunit) gene (OMIM# 600658) and developmental and epileptic encephalopathy (DEE, OMIM#308350) (1). As a phosphatase, PPP5C regulates the reversible phosphorylation of various proteins, influencing the activation or inhibition of numerous signaling pathways, including those involved in cell growth, differentiation, and responses to hormonal signals or cellular stress (2,3). The mRNA expression of PPP5C is widespread throughout the body based on Uniprot/SwissProt data ( https://www.uniprot.org ), and abundant in the mammalian brain according to Tissue Expression Database by Jersen Lab ( https://tissues.jensenlab.org ). This makes PPP5C a potential drug target in several diseases, including obesity, cancer, and Alzheimer's disease. (4). Transcriptomic levels are also found to be significant in embryonic tissues and stem cells in LifeMap Discovery database ( https://discovery.lifemapsc.com/ ). Despite evidence of tissue expression in both the developing and adult central nervous systems (CNS), the contribution of this gene in the neurological mechanisms underlying DEE has not yet been confirmed (1). In this report, we present a 12-year-old girl affected by epilepsy and learning disorders who carries a de novo variant in the PPP5C gene, not previously described. This is only the second case report, after Fielder et al. (2022) (1), analyzing the potential role of PPP5C in neurodevelopment. Results The proband is a 12 years old girl. Third child of non-consanguineous parents, born via spontaneous delivery at 40 weeks of gestation; birth weight 4200 grams (95th centile; +1,6 SD). At birth, perinatal asphyxia was reported. Neonatal period was uneventful. She showed normal acquisition of developmental milestones during infancy. At five years old she was admitted to our Hospital in Catania for convulsive status epilepticus and respiratory failure. Brain Magnetic Resonance Imaging (MRI) was performed, showing mild accentuation of peri-trigonal white matter signal suggestive of congenital chronic hypoxia sequelae (this MRI pattern was no longer detected on the follow-up at the age of 11). Electrical abnormalities in the left occipital leads were reported and she started Levetiracetam as anticonvulsant therapy (starting with 10 mg/kg/day, progressive dose increase up to 25 mg/kg/day divided in two doses) with a good control of seizures. At eight years old, learning disorder (dyslexia, dyscalculia and dysgraphia) was diagnosed after neuro-psychiatric evaluation; but Wechsler Intelligent Scale for Children (WISC-IV v.4; Wechsler, 2003) evaluation were within the normal range for age. Problem-solving was also inadequate. During the last follow up, at 12 years old, electroencephalography (EEG) showed “ instable, polymorphic, medium-voltage background activity dominated by bilateral theta rhythm. Slow wave and spike-and-wave complexes are recorded over the centro-parieto-temporal regions of both hemispheres and over the vertex regions” (Fig. 1). Figure 1 : EEG of the present patient at the age of 12 y.o. Standard 10–20 montage. Sens 100 uV. Duration 20 seconds. EEG electrodes: Z: Midline: FZ: Midline Frontal; CZ: Midline Central; PZ: Midline Parietal; OZ: Midline Occipital. Even numbers, right hemisphere locations; odd numbers, left hemisphere locations: Fp: Frontopolar; F: Frontal; C: Central; T: Temporal; P: Parietal; O: Occipital. ECG: Electrocardiogram. The general physical and neurological examination did not show any noteworthy signs; no nystagmus or strabismus, normal cerebellar tests, good muscle tone and strength. Ophthalmological and cardiological examination were normal, such as abdomen ultrasound. Genetic testing and data analysis After obtaining informed consent from the proband's parents, peripheral blood samples were collected from the affected child and her healthy parents to perform familial trio-Whole Exome Sequencing (trio-WES), Exome enrichment was performed using Kapa Hypercapture Roche and sequenced with NovaSeq 6000 (Illumina, San Diego, CA, USA). Paired-end sequence reads were aligned to the human genome reference (hg19) with the Burrows-Wheeler Aligner (BWA MEM) software and duplicate reads removed using Picard ( http://picard.sourceforge.net ). Variant Calling were performed using an inhouse pipeline based on GATK v.4.3 tools ( https://software.broadinstitute.org/gatk/ ). The data were filtered and annotated using GEMINI v0.19.1 and the Variant Effect Predictor (VEP). Variants with a minor allele frequency (MAF) less than 0.1% were retained by comparison with public databases, including the 1000 Genomes Project, the Genome Aggregation Database (gnomAD), and the NHLBI Exome Sequencing Project (ESP) 6500. These variants were prioritized under assumptions of dominant or recessive inheritance patterns and based on their predicted functional effects from CADD, PolyPhen-2, and SIFT. Variants were classified according to to the American College of Medical Genetics Genomics (ACMG) and the Association for Clinical Genomic Science (ACGS) recommendations (update 2023; uk-practice-guidelines-for-variant-classification-v1-2023) (5), with Varsome ( https://varsome.com/ ) and Franklin ( https://franklin.genoox.com/ ). Sequenced data were visualized using Integrative Genomics Viewer (IGV). The forward primer (5' CAGGGTTGGAGCACTGCCTCAT 3') and reverse primer (5' TCACCGTCTCGTAGTCTCGCAG 3') were utilized for both amplification and Sanger sequencing of a 290 bp amplicon containing the PPP5C variant. The result interpretation was also implemented by searching relevant data from scientific literature. Protein mutational prediction The 3D structure (PDB entry: 1A17) related to the human protein PPP5C (protein ID: P53041) was used to investigate in the Uniprot database ( http://www.uniprot.org/ ) and RCSB Protein DataBase (PDB) ( www.RCSB.org.it ) the effect of the genetic variation within the protein and possible patogenic implications into the stability and activity. WES analysis WES analysis revealed as a unique candidate a heterozygous, de novo missense variant in the PPP5C gene (NM_006247.4: c.202C > T: p.Arg68Cys) enconding for a serine/threonine phosphatase involved in various cellular processes, including cell growth, stress response, and DeoxyriboNucleic Acid (DNA) damage repair. The variant was visually inspected using IGV and its segregation was technically confirmed by Sanger sequencing on the trio (Fig. 2A-B). The missense variant was classified as likely pathogenic based on criteria PM2 (variant not observed in control populations), PS2 (de novo variant, paternity and maternity confirmed), and PP3 ( in silico computational predictions). Figure 2A-B. Identification and confirmation of the heterozygous c.202C > T variant in PPP5C within the familial trio. A) IGV screenshot displaying the heterozygous c.202C > T variant in the PPP5C gene in the proband, absent in both parents. B) Sanger sequencing electropherogram confirming the variant detected by WES. The black arrow indicates the position of the variant in the proband’s sequence.. Our in silico analysis revealed that he argine residue at position 68 of PPP5C is highly conserved across species (MutationTaster) and that multiple prediction tools indicated that the variant is likely deleterious and destabilizing at the protein level (Fig. 3 ). Moreover, AlphaFold protein structure database ( https://alphafold.ebi.ac.uk ) also suggested that the missense variant is likely to disrupt the alpha helix, as indicated by the per-residue model confidence score (pLDDT) between 0 and 100, with a measured score (pLDDT > 90). This alteration could affect the superhelical structures of the tetratricopeptide repeat (TPR) domain, which is involved in protein-protein interactions (8). Figure 3. In silico predictions fort he pathogenicity of the PPP5C p.Arg68Cys variant are summarized, utilizing both DNA and protein analysis approaches. Protein predictive modelling The protein structure analysis performed by Uniprot and PDB databases allowed us to reconstruct the potential effect of the variant detected in our proband on the stability and function of PPP5C. We integrated protein and genetic data related to the present variant (Arg68Cys), but also to the variant (Ala47Thr) studied by Fielder et al. (1). Our findings were illustrated in Fig. 4A-C in view to assess the clinical relevance of both variants, which alter the domain function of helix and TPR repeat. Figure 4A-C. Graphical representation of the primary and tertiary structure of PPP5C showing the Arg68Cys variant (present case) and the Ala47Thr variant (Fielder et al.). (A) Visualization of the native amino acid sequence of the PPP5C protein (PBD entry 1A17) from RCSB PDB Database (https://www.rcsb.org /), covering residues 16 to 181. The position and the amino acid of the two different variants are highlighted: Arg68Cys in the present case (green box) and Ala47Thr in the study of Fielder et al. (1) (pink box). (B) The location in the 3D protein structure of both variants are marked with a red rectangle. Each variant is coloured in pink and green, respectively. (C) A zoom-in of the helical structure of the TPR domain where the two variants occur. Discussion DEE are an heterogeneous group of disorders characterized by early-onset, severe epileptic seizures and EEG abnormalities on a background of developmental impairment that tends to worsen as a consequence of epilepsy (9). Usually, DEE manifests during early infantile or childhood age with a significant impact on the child's neurodevelopment and may result from both non-genetic and genetic aetiologies. Approximately 90 genes have been linked to DEE, with patients predominantly carrying pathogenic de novo variants (10). Recently, advancements in next-generation sequencing have led to the discovery of new genes in patients with DEE of previously unknown etiology. Our case report illustrated a pediatric patient with epilepsy, learning disorders, and a de novo heterozygous missense variant (c.202C > T: p.Arg68Cys ) in the PPP5C gene identified by WES. This variant was not previously described nor associated with learning disorders in the literature. The onset of seizures in this case was convulsive status epilepticus with respiratory failure, and anticonvulsant therapy initiated at the age of 5 led to a significant improvement in seizures. Additionally, the patient was diagnosed with learning disorders at the age of 6, a condition not previously linked to PPP5C gene mutations. PPP5C modulates various signaling pathways by dephosphorylating target proteins, impacting cellular stress responses and interacting with hormone receptors, particularly within the MAPK and glucocorticoid pathways. Dysregulation of PPP5C has been linked to cancer progression and other disorders due to its critical role in cell cycle control and stress response regulation. Interestingly, a recent discovery report of a de novo missense variant in PPP5C in an eight-year-old girl with microcephaly, epilepsy, and developmental delays suggests a potential role for this gene in DEE (1). However, this patient was later diagnosed with a Valyl-TRNA Synthetase 1 (VARS1) related condition, according to ClinVar variation (ClinVar ID: VCV001704329.2), making the contribution of this variant to the phenotype unclear. A comparison of clinical and genetic findings between our child and the case reported by Fielder et al. (1) was illustrated in the following Table 1 . Table 1 Clinical and genetic findings reported in the present case and compared with Fielder et al. (1). Present patient Fielder et al. 2022 (1) Sex Female Female Age at epilepsy onset 5 years old 12–16 months old Age at diagnosis 12 years old 6 years old EEG Instable, polymorphic, medium-voltage background activity dominated by bilateral theta rhythm at 12 years old. Slow wave and spike-and-wave complexes are recorded over the centro-parieto-temporal regions of both hemispheres and over the vertex regions. Recurrent spike and slow-wave activity independently and multifocal spikes. Type of seizure Status epilepticus, generalized tonic-clonic seizures. Generalized seizures, including tonic clonic and drop seizures that are medically refractory. Brain MRI Mild accentuation of peri-trigonal white matter signal suggestive of congenital chronic hypoxia sequelae (5 years old), improved during follow-up brain MRI at 11 years old. Reduced cerebral white matter volume + slightly incomplete myelination (11 months old), improved during follow-up brain MRI at 4 years old. PPP5C gene variant Heterozygous, de novo missense variant: NM_006247.4: c.202C > T: p.Arg68Cys . Heterozygous, de novo missense variant NM_006247.3: c.139G > A: p.Ala47Thr. Neurodevelopmental Normal achievement of developmental milestones. Rolled over at 8–9 months old with therapies, sat up after age one year, currently unable to walk independently and unable to talk. Physical exam Normal. Microcephaly (-5.5/6 D.S.) and synophrys. Ophthalmologic exam Normal. Pendular nystagmus and moderate myopia. Others Learning disorders. Failure to thrive and anaemia. According to clinical features shown in Table 1 , our case turned out to be phenotypically milder than Fielder's case. A brain MRI at four years of age showed reduced cerebral white matter volume, while seizures, which began at 12 to 16 months of age, were refractory to treatment. On the other hand, our patient presented with a later onset of seizures (five years), without microcephaly or other abnormalities on physical examination, with normal acquisition of neurodevelopmental milestones, unlike the other patient previously reported. Brain MRI initially showed mild accentuation of peri-trigonal white matter signal, suggestive of congenital chronic hypoxia sequelae, with a non-progressive course and signs of resolution in subsequent follow-ups. No reduction of cerebral white matter volume was reported, differently from the other girl. However, our patient presents with a later onset of symptoms, suggesting a potentially milder phenotype. These findings, despite the different phenotypic features observed, could suggests a potential link between genetic pathogenic variants in PPP5C and neurological developmental disorders. Interestingly, data of Test for Association with De Novo Alterations (TADA) collected in the Simons Foundation Autism Research Initiative (SFARI) ( https://www.sfari.org/resource/simons-simplex-collection/ ) and in the Autism Sequencing Consortium ( https://asc.broadinstitute.org/ ) identified PPP5C gene as a candidate gene of autism spectrum disorders (ASD) with a false discovery rate between 0.05 and 0.1 (11,12). This finding reinforces the involvement of PPP5C as a player in neurological pathways underlying PPP5C -related phenotypes. Given the current lack of a clearly defined clinical phenotype associated with PPP5C variants, our case may provide some valuable insights into the spectrum of phenotypic manifestations linked to this gene. While our findings provide valuable insights, this study has several limitations. The experimental animal model using C. elegans developed by Fielder et al. (1) suggests a possible link between PPP5C and a neurological phenotype; however, the dual diagnosis in their patient complicates direct clinical comparisons with our case. Additionally, we acknowledge that interpreting the functional roles of novel candidate variants—particularly missense or non-coding regulatory variants—requires careful consideration. Notably, the pathogenicity of the PPP5C variant identified in our patient is currently supported only by allele frequency data and in silico predictions, without functional validation. Therefore, it is crucial to investigate whether other cases have been described, but not yet recognized probably due to the under-reporting cases. This could ultimately aid in the identification and management of similar cases in the future, emphasizing the need for ongoing research and data collection in this emerging area of study. Conclusion The PPP5C gene, as a member of the serine/threonine protein phosphatases family, is widely expressed across human tissues, although its precise physiological functions remain not fully understood. To date, despite the identification of two cases with pathogenic variants in the PPP5C gene, including the girl reported in this study, a decisive association between a specific clinical phenotype to these genotypes cannot yet be established. However, the potential role of pathogenic variants in PPP5C in the development of DEE warrants significant attention. The re-analysis of cases not solved or unfairly overlooked as clinically-not informative reports would be crucial to confirm this potential association and to elucidate the contribution of PPP5C to neurological condition. Abbreviations ACGS Association for Clinical Genomic Science ACMG American College of Medical Genetics Genomics ASD Autism Spectrum Disorders BWA MEM Burrows-Wheeler Aligner CNS central nervous systems DEE developmental and epileptic encephalopathy DNA DeoxyriboNucleic Acid EEG Electroencephalography ESP Exome Sequencing Project gnomAD Genome Aggregation Database IGV Integrative Genomics Viewer MAF Minor Allele Frequency MRI Magnetic Resonance Imaging PDB Protein DataBase pLDDT per-residue model confidence score PPP5C Protein Phosphatase 5 Catalytic Subunit SFARI Simons Foundation Autism Research Initiative TADA Test for Association with De Novo Alterations TPR tetratricopeptide repeat VARS1 Valyl-TRNA Synthetase 1 VEP Variant Effect Predictor WES Whole Exome Sequencing WISC-IV Wechsler Intelligent Scale for Children v.4 Declarations Ethics approval and consent to participate The study was conducted ethically in accordance with the World Medical Association Declaration of Helsinki and approved by the Ethics Committee of the University of Catania, Italy (Ethical Committee Catania 1 Clinical Registration n. 210/2023/PO). Consent for publication Written informed consent was obtained from the parents of the patient for publication of the details of their medical case and any accompanying images. Competing interests The authors have no conflicts of interest to declare. Funding The Authors wish to thank the following grant entrusted by the Italian Ministry of Health [Ministero della Salute: MDS-DGPROGS-26] entitled:” PHARMA-HUB: a Hub for repurposing of drugs in rare diseases of the nervous system in the pediatric age ” [POS-T4 grant no. T4-AN-04]; Raffaele Falsaperla and Martino Ruggieri were recipient ,as Co-Principal Investigator and Principal Investigator, respectively, of this grant. Author Contribution Conceptualization, R.F., A.S. and X.G.P.; methodology, A.S., S.M. and R. Rocca; software, R.Rizzo and G. F.; validation, R.F., M.R. and X.G.P.; formal analysis, M.F., L.S., V.S. and S.M.; investigation, R.Rizzo and G. F.; resources, R.Rizzo; data curation, R.Rocca, R.Rizzo and G.F.; writing—original draft preparation, A.S., X. G. P., R.F.; R.Rocca and R.Rizzo; writing—review and editing, A.S., S.M. and X.G.P.; visualization, S.M., V.S., G.F.; supervision, M.R.All authors have read and agreed to the published version of the manuscript. Data Availability Data is provided within the manuscript References Fielder SM, Rosenfeld JA, Burrage LC, Emrick L, Lalani S, Attali R, et al. Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay. Mol Genet Metab. 2022 May;136(1):65–73. Hamilton CL, Abney KA, Vasauskas AA, Alexeyev M, Li N, Honkanen RE, et al. Serine/threonine phosphatase 5 (PP5C/PPP5C) regulates the ISOC channel through a PP5C-FKBP51 axis. Pulm Circ. 2018;8(1):2045893217753156. Hinds TD, Sánchez ER. Protein phosphatase 5. Int J Biochem Cell Biol. 2008;40(11):2358–62. Zhang H, Zhang Q, Tu J, You Q, Wang L. Dual function of protein phosphatase 5 (PPP5C): An emerging therapeutic target for drug discovery. Eur J Med Chem. 2023 Jun 5;254:115350. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med Off J Am Coll Med Genet. 2015 May;17(5):405–24. Steinhaus R, Proft S, Schuelke M, Cooper DN, Schwarz JM, Seelow D. MutationTaster2021. Nucleic Acids Res. 2021 Jul 2;49(W1):W446–51. Minton K. Predicting variant pathogenicity with AlphaMissense. Nat Rev Genet. 2023 Dec;24(12):804. Das AK, Cohen PW, Barford D. The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J. 1998 Mar 2;17(5):1192–9. Guerrini R, Conti V, Mantegazza M, Balestrini S, Galanopoulou AS, Benfenati F. Developmental and epileptic encephalopathies: from genetic heterogeneity to phenotypic continuum. Physiol Rev. 2023 Jan 1;103(1):433–513. Hamdan FF, Myers CT, Cossette P, Lemay P, Spiegelman D, Laporte AD, et al. High Rate of Recurrent De Novo Mutations in Developmental and Epileptic Encephalopathies. Am J Hum Genet. 2017 Nov 2;101(5):664–85. Iossifov I, O’Roak BJ, Sanders SJ, Ronemus M, Krumm N, Levy D, et al. The contribution of de novo coding mutations to autism spectrum disorder. Nature. 2014 Nov 13;515(7526):216–21. Satterstrom FK, Kosmicki JA, Wang J, Breen MS, De Rubeis S, An JY, et al. Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism. Cell. 2020 Feb 6;180(3):568–584.e23. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 02 Apr, 2025 Read the published version in Molecular and Cellular Pediatrics → Version 1 posted Editorial decision: Revision requested 08 Jan, 2025 Reviews received at journal 07 Jan, 2025 Reviews received at journal 01 Jan, 2025 Reviewers agreed at journal 27 Nov, 2024 Reviewers agreed at journal 26 Nov, 2024 Reviewers invited by journal 21 Nov, 2024 Editor assigned by journal 21 Nov, 2024 Submission checks completed at journal 14 Nov, 2024 First submitted to journal 12 Nov, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5442441\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":386591396,\"identity\":\"dfc2f878-f641-4644-bcff-f7e06c127d4c\",\"order_by\":0,\"name\":\"Raffaele Falsaperla\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Unit of Pediatrics and Pediatric Emergency Department, Azienda Ospedaliero-Universitaria Policlinico \\\"Rodolico-San Marco\\\", San Marco Hospital, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Raffaele\",\"middleName\":\"\",\"lastName\":\"Falsaperla\",\"suffix\":\"\"},{\"id\":386591397,\"identity\":\"e66043ad-06ee-489b-a2ee-d07cfb16f72b\",\"order_by\":1,\"name\":\"Annamaria Sapuppo\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA90lEQVRIiWNgGAWjYBADHghVAcTMzA2kaDkD0sJInBYIYGwDk/i18M/uPfjpRs09Gf4G3oOfC+fVRvO3A7X8qNiGU4vEnXPJ0jnHinkkDvAlS8/cdjx3xmHGBsaeM7dxW3Mjx0A6hy2Bh+EAj4E077ZjuQ1ALcyMbbi1yN/IMf6d8y+BR/4Aj/Fv3jnHcucT0mJwI8dMOrctgcfgAI+ZNG9DTe4GQloMgVqsc/sSeAwP86VZ8xw7kLsRqOUgPr/IAR12O+dbgr3c8d7Dt3lq6nLnnT988MGPCjzehwNmcGweBrMPEKEeBMBa6ohUPApGwSgYBSMJAACQ61aOVp1uEgAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Unit of Pediatrics and Pediatric Emergency Department, Azienda Ospedaliero-Universitaria Policlinico \\\"Rodolico-San Marco\\\", San Marco Hospital, 95123 Catania\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Annamaria\",\"middleName\":\"\",\"lastName\":\"Sapuppo\",\"suffix\":\"\"},{\"id\":386591398,\"identity\":\"6b0640dd-86c4-486d-a21f-c5eed2dd6253\",\"order_by\":2,\"name\":\"Xena Giada Pappalardo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Biomedical and Biotechnological Sciences (BIOMETEC), University of Catania, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xena\",\"middleName\":\"Giada\",\"lastName\":\"Pappalardo\",\"suffix\":\"\"},{\"id\":386591399,\"identity\":\"132373db-936e-4882-9dbf-afa521a7a6a8\",\"order_by\":3,\"name\":\"Roberta Rizzo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Biomedical and Biotechnological Sciences (BIOMETEC), University of Catania, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Roberta\",\"middleName\":\"\",\"lastName\":\"Rizzo\",\"suffix\":\"\"},{\"id\":386591400,\"identity\":\"32b6f4e0-11c3-4185-81df-a014584c4fab\",\"order_by\":4,\"name\":\"Roberta Rocca\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Postgraduate Training Program in Pediatrics, Department of Clinical and Experimental Medicine, University of Catania, 95123, Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Roberta\",\"middleName\":\"\",\"lastName\":\"Rocca\",\"suffix\":\"\"},{\"id\":386591401,\"identity\":\"8ab21e41-2c8c-4ea4-ae82-7aea79e9bba0\",\"order_by\":5,\"name\":\"Gaia Fusto\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Biomedical and Biotechnological Sciences (BIOMETEC), University of Catania, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gaia\",\"middleName\":\"\",\"lastName\":\"Fusto\",\"suffix\":\"\"},{\"id\":386591402,\"identity\":\"bdff671b-37fb-4522-a7b6-412540c9139c\",\"order_by\":6,\"name\":\"Silvia Marino\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Unit of Pediatrics and Pediatric Emergency Department, Azienda Ospedaliero-Universitaria Policlinico \\\"Rodolico-San Marco\\\", San Marco Hospital, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Silvia\",\"middleName\":\"\",\"lastName\":\"Marino\",\"suffix\":\"\"},{\"id\":386591403,\"identity\":\"ab01952a-0af1-4193-833b-08363b762e55\",\"order_by\":7,\"name\":\"Vincenzo Sortino\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Unit of Pediatrics and Pediatric Emergency Department, Azienda Ospedaliero-Universitaria Policlinico \\\"Rodolico-San Marco\\\", San Marco Hospital, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Vincenzo\",\"middleName\":\"\",\"lastName\":\"Sortino\",\"suffix\":\"\"},{\"id\":386591404,\"identity\":\"f55de5f8-2372-49b3-a696-eca386f41f9d\",\"order_by\":8,\"name\":\"Lucia Saccuzzo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Biomedical and Biotechnological Sciences, Section of Clinical biochemistry and medical genetics, University of Catania, via Santa Sofia, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lucia\",\"middleName\":\"\",\"lastName\":\"Saccuzzo\",\"suffix\":\"\"},{\"id\":386591405,\"identity\":\"5ec4ff46-05e4-47ea-a7e9-37cb920a568a\",\"order_by\":9,\"name\":\"Martino Ruggieri\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Unit of Pediatric Clinic, Department of Clinica and Experimental Medicine, University of Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Martino\",\"middleName\":\"\",\"lastName\":\"Ruggieri\",\"suffix\":\"\"},{\"id\":386591406,\"identity\":\"892d5905-d82c-43cc-96ea-4b5c83740bf4\",\"order_by\":10,\"name\":\"Marco Fichera\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Biomedical and Biotechnological Sciences, Section of Clinical biochemistry and medical genetics, University of Catania, via Santa Sofia, 95123 Catania\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Marco\",\"middleName\":\"\",\"lastName\":\"Fichera\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-11-12 22:53:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5442441/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5442441/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s40348-025-00191-3\",\"type\":\"published\",\"date\":\"2025-04-02T15:57:06+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":71743718,\"identity\":\"30b9780b-e0d8-43cc-a3da-632bd4f470b7\",\"added_by\":\"auto\",\"created_at\":\"2024-12-18 08:36:52\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":414038,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEEG of the present patient at the age of 12 y.o.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eStandard 10-20 montage. Sens 100 uV. Duration 20 seconds. EEG electrodes: Z: Midline: FZ: Midline Frontal; CZ: Midline Central; PZ: Midline Parietal; OZ: Midline Occipital. Even numbers, right hemisphere locations; odd numbers, left hemisphere locations: Fp: Frontopolar; F: Frontal; C: Central; T: Temporal; P: Parietal; O: Occipital. ECG: Electrocardiogram.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5442441/v1/92e34cfd18b0c0cc9e4d8343.jpg\"},{\"id\":71743367,\"identity\":\"c41ba330-8f5f-493a-904b-1343e8a599ad\",\"added_by\":\"auto\",\"created_at\":\"2024-12-18 08:28:52\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":177568,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA-B. Identification and confirmation of the heterozygous c.202C\\u0026gt;T variant in \\u003cem\\u003ePPP5C \\u003c/em\\u003ewithin the familial trio. A) IGV screenshot displaying the heterozygous c.202C\\u0026gt;T variant in the \\u003cem\\u003ePPP5C\\u003c/em\\u003egene in the proband, absent in both parents. B) Sanger sequencing electropherogram confirming the variant detected by WES. The black arrow indicates the position of the variant in the proband’s sequence.\\u003cem\\u003e.\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure2AB.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5442441/v1/9afa6d3c06686f71a15b2b98.jpg\"},{\"id\":71743369,\"identity\":\"881e3478-5dd2-4594-8420-54fbafb37d91\",\"added_by\":\"auto\",\"created_at\":\"2024-12-18 08:28:52\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":205309,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eIn \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003esilico\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e predictions fort he pathogenicity of the \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePPP5C\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e p.Arg68Cys variant are summarized, utilizing both DNA and protein analysis approaches.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5442441/v1/1d82320eb5650ca0a0287bad.png\"},{\"id\":71742000,\"identity\":\"b8780ee4-bc39-40c4-b8c8-d3cf4b831a8b\",\"added_by\":\"auto\",\"created_at\":\"2024-12-18 08:20:52\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":142918,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eA-C.\\u003c/strong\\u003e \\u003cstrong\\u003eGraphical representation of the primary and tertiary structure of PPP5C showing the Arg68Cys variant (present case) and the Ala47Thr variant (Fielder et al.). \\u003c/strong\\u003e(A) Visualization of the native amino acid sequence of the PPP5C protein (PBD entry 1A17) from RCSB PDB Database (https://www.rcsb.org/), covering residues 16 to 181. The position and the amino acid of the two different variants are highlighted: \\u003cem\\u003eArg68Cys\\u003c/em\\u003ein the present case (green box) and \\u003cem\\u003eAla47Thr\\u003c/em\\u003e in the study of Fielder et al. (1) (pink box). (B) The location in the 3D protein structure of both variants are marked with a red rectangle. Each variant is coloured in pink and green, respectively. (C) A zoom-in of the helical structure of the TPR domain where the two variants occur.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure4AC.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5442441/v1/3079100edc92439a39a02a4e.jpg\"},{\"id\":80081992,\"identity\":\"5f951b17-c947-46ef-85dd-b9da43b93a99\",\"added_by\":\"auto\",\"created_at\":\"2025-04-07 16:05:06\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1862674,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5442441/v1/b0fed5a4-c425-4ded-b720-bf8af23c51a0.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"PPP5C pathogenic variant identified: a potential key to gaining insight into developmental and epileptic encephalopathy?\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eNew findings indicate a potential association between the \\u003cem\\u003ePPP5C\\u003c/em\\u003e (Protein Phosphatase 5 Catalytic Subunit) gene (OMIM# 600658) and developmental and epileptic encephalopathy (DEE, OMIM#308350) (1). As a phosphatase, \\u003cem\\u003ePPP5C\\u003c/em\\u003e regulates the reversible phosphorylation of various proteins, influencing the activation or inhibition of numerous signaling pathways, including those involved in cell growth, differentiation, and responses to hormonal signals or cellular stress (2,3). The mRNA expression of \\u003cem\\u003ePPP5C\\u003c/em\\u003e is widespread throughout the body based on Uniprot/SwissProt data (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.uniprot.org\\u003c/span\\u003e\\u003cspan address=\\\"https://www.uniprot.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), and abundant in the mammalian brain according to Tissue Expression Database by Jersen Lab (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://tissues.jensenlab.org\\u003c/span\\u003e\\u003cspan address=\\\"https://tissues.jensenlab.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). This makes \\u003cem\\u003ePPP5C\\u003c/em\\u003e a potential drug target in several diseases, including obesity, cancer, and Alzheimer's disease. (4). Transcriptomic levels are also found to be significant in embryonic tissues and stem cells in LifeMap Discovery database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://discovery.lifemapsc.com/\\u003c/span\\u003e\\u003cspan address=\\\"https://discovery.lifemapsc.com/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). Despite evidence of tissue expression in both the developing and adult central nervous systems (CNS), the contribution of this gene in the neurological mechanisms underlying DEE has not yet been confirmed (1).\\u003c/p\\u003e \\u003cp\\u003eIn this report, we present a 12-year-old girl affected by epilepsy and learning disorders who carries a de novo variant in the \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene, not previously described. This is only the second case report, after Fielder et al. (2022) (1), analyzing the potential role of \\u003cem\\u003ePPP5C\\u003c/em\\u003e in neurodevelopment.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eThe proband is a 12 years old girl. Third child of non-consanguineous parents, born via spontaneous delivery at 40 weeks of gestation; birth weight 4200 grams (95th centile; +1,6 SD). At birth, perinatal asphyxia was reported. Neonatal period was uneventful. She showed normal acquisition of developmental milestones during infancy.\\u003c/p\\u003e \\u003cp\\u003eAt five years old she was admitted to our Hospital in Catania for convulsive status epilepticus and respiratory failure. Brain Magnetic Resonance Imaging (MRI) was performed, showing mild accentuation of peri-trigonal white matter signal suggestive of congenital chronic hypoxia sequelae (this MRI pattern was no longer detected on the follow-up at the age of 11). Electrical abnormalities in the left occipital leads were reported and she started Levetiracetam as anticonvulsant therapy (starting with 10 mg/kg/day, progressive dose increase up to 25 mg/kg/day divided in two doses) with a good control of seizures. At eight years old, learning disorder (dyslexia, dyscalculia and dysgraphia) was diagnosed after neuro-psychiatric evaluation; but Wechsler Intelligent Scale for Children (WISC-IV v.4; Wechsler, 2003) evaluation were within the normal range for age. Problem-solving was also inadequate.\\u003c/p\\u003e \\u003cp\\u003eDuring the last follow up, at 12 years old, electroencephalography (EEG) showed \\u0026ldquo;\\u003cem\\u003einstable, polymorphic, medium-voltage background activity dominated by bilateral theta rhythm. Slow wave and spike-and-wave complexes are recorded over the centro-parieto-temporal regions of both hemispheres and over the vertex regions\\u0026rdquo;\\u003c/em\\u003e (Fig.\\u0026nbsp;1).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure 1\\u003c/b\\u003e: \\u003cb\\u003eEEG of the present patient at the age of 12 y.o.\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eStandard 10\\u0026ndash;20 montage. Sens 100 uV. Duration 20 seconds. EEG electrodes: Z: Midline: FZ: Midline Frontal; CZ: Midline Central; PZ: Midline Parietal; OZ: Midline Occipital. Even numbers, right hemisphere locations; odd numbers, left hemisphere locations: Fp: Frontopolar; F: Frontal; C: Central; T: Temporal; P: Parietal; O: Occipital. ECG: Electrocardiogram.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe general physical and neurological examination did not show any noteworthy signs; no nystagmus or strabismus, normal cerebellar tests, good muscle tone and strength. Ophthalmological and cardiological examination were normal, such as abdomen ultrasound.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGenetic testing and data analysis\\u003c/h2\\u003e \\u003cp\\u003e After obtaining informed consent from the proband's parents, peripheral blood samples were collected from the affected child and her healthy parents to perform familial trio-Whole Exome Sequencing (trio-WES),\\u003c/p\\u003e \\u003cp\\u003eExome enrichment was performed using Kapa Hypercapture Roche and sequenced with NovaSeq 6000 (Illumina, San Diego, CA, USA). Paired-end sequence reads were aligned to the human genome reference (hg19) with the Burrows-Wheeler Aligner (BWA MEM) software and duplicate reads removed using Picard (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://picard.sourceforge.net\\u003c/span\\u003e\\u003cspan address=\\\"http://picard.sourceforge.net\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). Variant Calling were performed using an inhouse pipeline based on GATK v.4.3 tools (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://software.broadinstitute.org/gatk/\\u003c/span\\u003e\\u003cspan address=\\\"https://software.broadinstitute.org/gatk/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe data were filtered and annotated using GEMINI v0.19.1 and the Variant Effect Predictor (VEP). Variants with a minor allele frequency (MAF) less than 0.1% were retained by comparison with public databases, including the 1000 Genomes Project, the Genome Aggregation Database (gnomAD), and the NHLBI Exome Sequencing Project (ESP) 6500. These variants were prioritized under assumptions of dominant or recessive inheritance patterns and based on their predicted functional effects from CADD, PolyPhen-2, and SIFT.\\u003c/p\\u003e \\u003cp\\u003eVariants were classified according to to the American College of Medical Genetics Genomics (ACMG) and the Association for Clinical Genomic Science (ACGS) recommendations (update 2023; uk-practice-guidelines-for-variant-classification-v1-2023) (5), with Varsome (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://varsome.com/\\u003c/span\\u003e\\u003cspan address=\\\"https://varsome.com/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) and Franklin (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://franklin.genoox.com/\\u003c/span\\u003e\\u003cspan address=\\\"https://franklin.genoox.com/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eSequenced data were visualized using Integrative Genomics Viewer (IGV). The forward primer (5' CAGGGTTGGAGCACTGCCTCAT 3') and reverse primer (5' TCACCGTCTCGTAGTCTCGCAG 3') were utilized for both amplification and Sanger sequencing of a 290 bp amplicon containing the \\u003cem\\u003ePPP5C\\u003c/em\\u003e variant. The result interpretation was also implemented by searching relevant data from scientific literature.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eProtein mutational prediction\\u003c/h3\\u003e\\n\\u003cp\\u003eThe 3D structure (PDB entry: 1A17) related to the human protein PPP5C (protein ID: P53041) was used to investigate in the Uniprot database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.uniprot.org/\\u003c/span\\u003e\\u003cspan address=\\\"http://www.uniprot.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) and RCSB Protein DataBase (PDB) (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.RCSB.org.it\\u003c/a\\u003e\\u003c/span\\u003e\\u003cspan address=\\\"http://www.RCSB.org.it\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) the effect of the genetic variation within the protein and possible patogenic implications into the stability and activity.\\u003c/p\\u003e\\n\\u003ch3\\u003eWES analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eWES analysis revealed as a unique candidate a heterozygous, de novo missense variant in the \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene (NM_006247.4: c.202C\\u0026thinsp;\\u0026gt;\\u0026thinsp;T: p.Arg68Cys) enconding for a serine/threonine phosphatase involved in various cellular processes, including cell growth, stress response, and DeoxyriboNucleic Acid (DNA) damage repair. The variant was visually inspected using IGV and its segregation was technically confirmed by Sanger sequencing on the trio (Fig.\\u0026nbsp;2A-B). The missense variant was classified as likely pathogenic based on criteria PM2 (variant not observed in control populations), PS2 (de novo variant, paternity and maternity confirmed), and PP3 (\\u003cem\\u003ein silico\\u003c/em\\u003e computational predictions).\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003e \\u003cb\\u003eFigure 2A-B. Identification and confirmation of the heterozygous c.202C\\u0026thinsp;\\u0026gt;\\u0026thinsp;T variant in\\u003c/b\\u003e \\u003cb\\u003ePPP5C\\u003c/b\\u003e \\u003cb\\u003ewithin the familial trio.\\u003c/b\\u003e A) IGV screenshot displaying the heterozygous c.202C\\u0026thinsp;\\u0026gt;\\u0026thinsp;T variant in the \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene in the proband, absent in both parents. B) Sanger sequencing electropherogram confirming the variant detected by WES. The black arrow indicates the position of the variant in the proband\\u0026rsquo;s sequence..\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e \\u003cp\\u003eOur in silico analysis revealed that he argine residue at position 68 of \\u003cem\\u003ePPP5C\\u003c/em\\u003e is highly conserved across species (MutationTaster) and that multiple prediction tools indicated that the variant is likely deleterious and destabilizing at the protein level (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eMoreover, AlphaFold protein structure database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://alphafold.ebi.ac.uk\\u003c/span\\u003e\\u003cspan address=\\\"https://alphafold.ebi.ac.uk\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) also suggested that the missense variant is likely to disrupt the alpha helix, as indicated by the per-residue model confidence score (pLDDT) between 0 and 100, with a measured score (pLDDT\\u0026thinsp;\\u0026gt;\\u0026thinsp;90). This alteration could affect the superhelical structures of the tetratricopeptide repeat (TPR) domain, which is involved in protein-protein interactions (8).\\u003c/p\\u003e \\u003cp\\u003eFigure 3. In silico predictions fort he pathogenicity of the PPP5C p.Arg68Cys variant are summarized, utilizing both DNA and protein analysis approaches. \\u003c/p\\u003e\\n\\u003ch3\\u003eProtein predictive modelling\\u003c/h3\\u003e\\n\\u003cp\\u003eThe protein structure analysis performed by Uniprot and PDB databases allowed us to reconstruct the potential effect of the variant detected in our proband on the stability and function of PPP5C. We integrated protein and genetic data related to the present variant (Arg68Cys), but also to the variant (Ala47Thr) studied by Fielder et al. (1).\\u003c/p\\u003e \\u003cp\\u003eOur findings were illustrated in \\u003cb\\u003eFig.\\u0026nbsp;4A-C\\u003c/b\\u003e in view to assess the clinical relevance of both variants, which alter the domain function of helix and TPR repeat.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure 4A-C. Graphical representation of the primary and tertiary structure of PPP5C showing the Arg68Cys variant (present case) and the Ala47Thr variant (Fielder et al.).\\u003c/b\\u003e (A) Visualization of the native amino acid sequence of the PPP5C protein (PBD entry 1A17) from RCSB PDB Database \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e(https://www.rcsb.org\\u003c/span\\u003e\\u003cspan address=\\\"http://(https://www.rcsb.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e/), covering residues 16 to 181. The position and the amino acid of the two different variants are highlighted: \\u003cem\\u003eArg68Cys\\u003c/em\\u003e in the present case (green box) and \\u003cem\\u003eAla47Thr\\u003c/em\\u003e in the study of Fielder et al. (1) (pink box). (B) The location in the 3D protein structure of both variants are marked with a red rectangle. Each variant is coloured in pink and green, respectively. (C) A zoom-in of the helical structure of the TPR domain where the two variants occur.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eDEE are an heterogeneous group of disorders characterized by early-onset, severe epileptic seizures and EEG abnormalities on a background of developmental impairment that tends to worsen as a consequence of epilepsy (9). Usually, DEE manifests during early infantile or childhood age with a significant impact on the child's neurodevelopment and may result from both non-genetic and genetic aetiologies. Approximately 90 genes have been linked to DEE, with patients predominantly carrying pathogenic \\u003cem\\u003ede novo\\u003c/em\\u003e variants (10). Recently, advancements in next-generation sequencing have led to the discovery of new genes in patients with DEE of previously unknown etiology.\\u003c/p\\u003e \\u003cp\\u003eOur case report illustrated a pediatric patient with epilepsy, learning disorders, and a \\u003cem\\u003ede novo\\u003c/em\\u003e heterozygous missense variant (c.202C\\u0026thinsp;\\u0026gt;\\u0026thinsp;T: \\u003cem\\u003ep.Arg68Cys\\u003c/em\\u003e) in the \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene identified by WES. This variant was not previously described nor associated with learning disorders in the literature. The onset of seizures in this case was convulsive status epilepticus with respiratory failure, and anticonvulsant therapy initiated at the age of 5 led to a significant improvement in seizures. Additionally, the patient was diagnosed with learning disorders at the age of 6, a condition not previously linked to \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene mutations.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003ePPP5C\\u003c/em\\u003e modulates various signaling pathways by dephosphorylating target proteins, impacting cellular stress responses and interacting with hormone receptors, particularly within the MAPK and glucocorticoid pathways. Dysregulation of \\u003cem\\u003ePPP5C\\u003c/em\\u003e has been linked to cancer progression and other disorders due to its critical role in cell cycle control and stress response regulation. Interestingly, a recent discovery report of a de novo missense variant in \\u003cem\\u003ePPP5C\\u003c/em\\u003e in an eight-year-old girl with microcephaly, epilepsy, and developmental delays suggests a potential role for this gene in DEE (1). However, this patient was later diagnosed with a Valyl-TRNA Synthetase 1 (VARS1) related condition, according to ClinVar variation (ClinVar ID: VCV001704329.2), making the contribution of this variant to the phenotype unclear. A comparison of clinical and genetic findings between our child and the case reported by Fielder et al. (1) was illustrated in the following Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eClinical and genetic findings reported in the present case and compared with Fielder et al. (1).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ePresent patient\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eFielder et al. 2022 (1)\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eSex\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFemale\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eFemale\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAge at epilepsy onset\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5 years old\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e12\\u0026ndash;16 months old\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAge at diagnosis\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e12 years old\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6 years old\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eEEG\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eInstable, polymorphic, medium-voltage background activity dominated by bilateral theta rhythm at 12 years old. Slow wave and spike-and-wave complexes are recorded over the centro-parieto-temporal regions of both hemispheres and over the vertex regions.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eRecurrent spike and slow-wave activity independently and multifocal spikes.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eType of seizure\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eStatus epilepticus, generalized tonic-clonic seizures.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGeneralized seizures, including tonic clonic and drop seizures that are medically refractory.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eBrain MRI\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eMild accentuation of peri-trigonal white matter signal suggestive of congenital chronic hypoxia sequelae (5 years old), improved during follow-up brain MRI at 11 years old.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReduced cerebral white matter volume\\u0026thinsp;+\\u0026thinsp;slightly incomplete myelination (11 months old), improved during follow-up brain MRI at 4 years old.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003ePPP5C\\u003c/b\\u003e \\u003cb\\u003egene variant\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHeterozygous, de novo missense variant: NM_006247.4: c.202C\\u0026thinsp;\\u0026gt;\\u0026thinsp;T: \\u003cem\\u003ep.Arg68Cys\\u003c/em\\u003e.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eHeterozygous, de novo missense variant NM_006247.3: c.139G\\u0026thinsp;\\u0026gt;\\u0026thinsp;A: \\u003cem\\u003ep.Ala47Thr.\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eNeurodevelopmental\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNormal achievement of developmental milestones.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eRolled over at 8\\u0026ndash;9 months old with therapies, sat up after age one year, currently unable to walk independently and unable to talk.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003ePhysical exam\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNormal.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eMicrocephaly (-5.5/6 D.S.) and synophrys.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eOphthalmologic exam\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNormal.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003ePendular nystagmus and moderate myopia.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eOthers\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eLearning disorders.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eFailure to thrive and anaemia.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eAccording to clinical features shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, our case turned out to be phenotypically milder than Fielder's case. A brain MRI at four years of age showed reduced cerebral white matter volume, while seizures, which began at 12 to 16 months of age, were refractory to treatment. On the other hand, our patient presented with a later onset of seizures (five years), without microcephaly or other abnormalities on physical examination, with normal acquisition of neurodevelopmental milestones, unlike the other patient previously reported. Brain MRI initially showed mild accentuation of peri-trigonal white matter signal, suggestive of congenital chronic hypoxia sequelae, with a non-progressive course and signs of resolution in subsequent follow-ups. No reduction of cerebral white matter volume was reported, differently from the other girl. However, our patient presents with a later onset of symptoms, suggesting a potentially milder phenotype. These findings, despite the different phenotypic features observed, could suggests a potential link between genetic pathogenic variants in \\u003cem\\u003ePPP5C\\u003c/em\\u003e and neurological developmental disorders. Interestingly, data of Test for Association with De Novo Alterations (TADA) collected in the Simons Foundation Autism Research Initiative (SFARI) (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.sfari.org/resource/simons-simplex-collection/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.sfari.org/resource/simons-simplex-collection/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) and in the Autism Sequencing Consortium (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://asc.broadinstitute.org/\\u003c/span\\u003e\\u003cspan address=\\\"https://asc.broadinstitute.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) identified \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene as a candidate gene of autism spectrum disorders (ASD) with a false discovery rate between 0.05 and 0.1 (11,12). This finding reinforces the involvement of \\u003cem\\u003ePPP5C\\u003c/em\\u003e as a player in neurological pathways underlying \\u003cem\\u003ePPP5C\\u003c/em\\u003e-related phenotypes.\\u003c/p\\u003e \\u003cp\\u003eGiven the current lack of a clearly defined clinical phenotype associated with \\u003cem\\u003ePPP5C\\u003c/em\\u003e variants, our case may provide some valuable insights into the spectrum of phenotypic manifestations linked to this gene. While our findings provide valuable insights, this study has several limitations. The experimental animal model using \\u003cem\\u003eC. elegans\\u003c/em\\u003e developed by Fielder et al. (1) suggests a possible link between \\u003cem\\u003ePPP5C\\u003c/em\\u003e and a neurological phenotype; however, the dual diagnosis in their patient complicates direct clinical comparisons with our case. Additionally, we acknowledge that interpreting the functional roles of novel candidate variants\\u0026mdash;particularly missense or non-coding regulatory variants\\u0026mdash;requires careful consideration. Notably, the pathogenicity of the PPP5C variant identified in our patient is currently supported only by allele frequency data and in silico predictions, without functional validation.\\u003c/p\\u003e \\u003cp\\u003eTherefore, it is crucial to investigate whether other cases have been described, but not yet recognized probably due to the under-reporting cases. This could ultimately aid in the identification and management of similar cases in the future, emphasizing the need for ongoing research and data collection in this emerging area of study.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThe \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene, as a member of the serine/threonine protein phosphatases family, is widely expressed across human tissues, although its precise physiological functions remain not fully understood. To date, despite the identification of two cases with pathogenic variants in the \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene, including the girl reported in this study, a decisive association between a specific clinical phenotype to these genotypes cannot yet be established. However, the potential role of pathogenic variants in \\u003cem\\u003ePPP5C\\u003c/em\\u003e in the development of DEE warrants significant attention. The re-analysis of cases not solved or unfairly overlooked as clinically-not informative reports would be crucial to confirm this potential association and to elucidate the contribution of \\u003cem\\u003ePPP5C\\u003c/em\\u003e to neurological condition.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eACGS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAssociation for Clinical Genomic Science\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eACMG\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAmerican College of Medical Genetics Genomics\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eASD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAutism Spectrum Disorders\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eBWA MEM\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eBurrows-Wheeler Aligner\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eCNS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ecentral nervous systems\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eDEE\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003edevelopmental and epileptic encephalopathy\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eDNA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eDeoxyriboNucleic Acid\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eEEG\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eElectroencephalography\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eESP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eExome Sequencing Project\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003egnomAD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eGenome Aggregation Database\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eIGV\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eIntegrative Genomics Viewer\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eMAF\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMinor Allele Frequency\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eMRI\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMagnetic Resonance Imaging\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003ePDB\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eProtein DataBase\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003epLDDT\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eper-residue model confidence score\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cem\\u003ePPP5C\\u003c/em\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eProtein Phosphatase 5 Catalytic Subunit\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eSFARI\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eSimons Foundation Autism Research Initiative\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eTADA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eTest for Association with De Novo Alterations\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eTPR\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003etetratricopeptide repeat\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eVARS1\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eValyl-TRNA Synthetase 1\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eVEP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eVariant Effect Predictor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eWES\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWhole Exome Sequencing\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eWISC-IV\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWechsler Intelligent Scale for Children v.4\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was conducted ethically in accordance with the World Medical Association Declaration of Helsinki and approved by the Ethics Committee of the University of Catania, Italy (Ethical Committee Catania 1 Clinical Registration n. 210/2023/PO).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWritten informed consent was obtained from the parents of the patient for publication of the details of their medical case and any accompanying images.\\u003c/p\\u003e\\n\\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e\\n\\u003cp\\u003eThe authors have no conflicts of interest to declare.\\u003c/p\\u003e\\n\\u003ch2\\u003eFunding\\u003c/h2\\u003e\\n\\u003cp\\u003eThe Authors wish to thank the following grant entrusted by the Italian Ministry of Health [Ministero della Salute: MDS-DGPROGS-26] entitled:\\u0026rdquo;\\u003cem\\u003ePHARMA-HUB: a Hub for repurposing of drugs in rare diseases of the nervous system in the pediatric age\\u003c/em\\u003e\\u0026rdquo; [POS-T4 grant no. T4-AN-04]; Raffaele Falsaperla and Martino Ruggieri were recipient ,as Co-Principal Investigator and Principal Investigator, respectively, of this grant.\\u003c/p\\u003e\\n\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\n\\u003cp\\u003eConceptualization, R.F., A.S. and X.G.P.; methodology, A.S., S.M. and R. Rocca; software, R.Rizzo and G. F.; validation, R.F., M.R. and X.G.P.; formal analysis, M.F., L.S., V.S. and S.M.; investigation, R.Rizzo and G. F.; resources, R.Rizzo; data curation, R.Rocca, R.Rizzo and G.F.; writing\\u0026mdash;original draft preparation, A.S., X. G. P., R.F.; R.Rocca and R.Rizzo; writing\\u0026mdash;review and editing, A.S., S.M. and X.G.P.; visualization, S.M., V.S., G.F.; supervision, M.R.All authors have read and agreed to the published version of the manuscript.\\u003c/p\\u003e\\n\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\n\\u003cp\\u003eData is provided within the manuscript\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eFielder SM, Rosenfeld JA, Burrage LC, Emrick L, Lalani S, Attali R, et al. Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay. Mol Genet Metab. 2022 May;136(1):65\\u0026ndash;73.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHamilton CL, Abney KA, Vasauskas AA, Alexeyev M, Li N, Honkanen RE, et al. Serine/threonine phosphatase 5 (PP5C/PPP5C) regulates the ISOC channel through a PP5C-FKBP51 axis. Pulm Circ. 2018;8(1):2045893217753156.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHinds TD, S\\u0026aacute;nchez ER. Protein phosphatase 5. Int J Biochem Cell Biol. 2008;40(11):2358\\u0026ndash;62.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang H, Zhang Q, Tu J, You Q, Wang L. Dual function of protein phosphatase 5 (PPP5C): An emerging therapeutic target for drug discovery. Eur J Med Chem. 2023 Jun 5;254:115350.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRichards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med Off J Am Coll Med Genet. 2015 May;17(5):405\\u0026ndash;24.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSteinhaus R, Proft S, Schuelke M, Cooper DN, Schwarz JM, Seelow D. MutationTaster2021. Nucleic Acids Res. 2021 Jul 2;49(W1):W446\\u0026ndash;51.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMinton K. Predicting variant pathogenicity with AlphaMissense. Nat Rev Genet. 2023 Dec;24(12):804.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDas AK, Cohen PW, Barford D. The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J. 1998 Mar 2;17(5):1192\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuerrini R, Conti V, Mantegazza M, Balestrini S, Galanopoulou AS, Benfenati F. Developmental and epileptic encephalopathies: from genetic heterogeneity to phenotypic continuum. Physiol Rev. 2023 Jan 1;103(1):433\\u0026ndash;513.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHamdan FF, Myers CT, Cossette P, Lemay P, Spiegelman D, Laporte AD, et al. High Rate of Recurrent De Novo Mutations in Developmental and Epileptic Encephalopathies. Am J Hum Genet. 2017 Nov 2;101(5):664\\u0026ndash;85.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIossifov I, O\\u0026rsquo;Roak BJ, Sanders SJ, Ronemus M, Krumm N, Levy D, et al. The contribution of de novo coding mutations to autism spectrum disorder. Nature. 2014 Nov 13;515(7526):216\\u0026ndash;21.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSatterstrom FK, Kosmicki JA, Wang J, Breen MS, De Rubeis S, An JY, et al. Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism. Cell. 2020 Feb 6;180(3):568\\u0026ndash;584.e23.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-and-cellular-pediatrics\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"macp\",\"sideBox\":\"Learn more about [Molecular and Cellular Pediatrics](http://molcellped.springeropen.com)\",\"snPcode\":\"40348\",\"submissionUrl\":\"https://submission.nature.com/new-submission/40348/3\",\"title\":\"Molecular and Cellular Pediatrics\",\"twitterHandle\":\"@springeropen\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"PPP5C, developmental disorders, status epilepticus, developmental and epileptic encephalopathy\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5442441/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5442441/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cb\\u003eBackground\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eEmerging evidence suggesting a possible link between the \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene (Protein Phosphatase 5 Catalytic Subunit; OMIM#600658) and developmental and epileptic encephalopathy (DEE, OMIM#308350), although the clinical significance of pathogenic variants in this gene remains unclear. \\u003cem\\u003ePPP5C\\u003c/em\\u003e is a member of the protein phosphatase catalytic subunit family, which is involved in various signaling pathways governing cell growth, differentiation, and responses to hormonal signals or cellular stress. To date, only one case with a \\u003cem\\u003ePPP5C\\u003c/em\\u003e variant has been reported, associated with a severe neurological phenotype, including microcephaly, failure to thrive, and early-onset seizures.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eResults\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eWe report a 12-year-old girl affected by epilepsy and learning disorders. At the age of five, she presented convulsive status epilepticus with respiratory failure at onset and she started anticonvulsant therapy with Levetiracetam with a significant improvement. Genetic analysis revealed a de novo heterozygous missense variant of \\u003cem\\u003ePPP5C\\u003c/em\\u003e gene (c.202C\\u0026thinsp;\\u0026gt;\\u0026thinsp;T: \\u003cem\\u003ep.Arg68Cys\\u003c/em\\u003e), which had not been previously described in the literature.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eConclusion\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eThis case expands the phenotypic spectrum associated with \\u003cem\\u003ePPP5C\\u003c/em\\u003e variants, highlighting the potential role of this gene in neurological disorders. Our findings may provide some valuable insights into the spectrum of phenotypic manifestations linked to this gene less investigated in neuropediatrics.\\u003c/p\\u003e\",\"manuscriptTitle\":\"PPP5C pathogenic variant identified: a potential key to gaining insight into developmental and epileptic encephalopathy?\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-12-18 08:20:47\",\"doi\":\"10.21203/rs.3.rs-5442441/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-01-08T20:49:27+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-01-07T22:14:55+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-01-01T15:28:51+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"122016167669009880498763918531706648207\",\"date\":\"2024-11-27T11:37:13+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"88667548999508540169046915233211961490\",\"date\":\"2024-11-26T23:16:48+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-11-21T09:44:24+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-11-21T09:38:04+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-11-14T23:03:22+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Molecular and Cellular Pediatrics\",\"date\":\"2024-11-12T22:48:09+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-and-cellular-pediatrics\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"macp\",\"sideBox\":\"Learn more about [Molecular and Cellular Pediatrics](http://molcellped.springeropen.com)\",\"snPcode\":\"40348\",\"submissionUrl\":\"https://submission.nature.com/new-submission/40348/3\",\"title\":\"Molecular and Cellular Pediatrics\",\"twitterHandle\":\"@springeropen\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"2baa3fdc-d2da-4113-a4ac-bd1c7b81966f\",\"owner\":[],\"postedDate\":\"December 18th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-04-07T15:59:25+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-5442441\",\"link\":\"https://doi.org/10.1186/s40348-025-00191-3\",\"journal\":{\"identity\":\"molecular-and-cellular-pediatrics\",\"isVorOnly\":false,\"title\":\"Molecular and Cellular Pediatrics\"},\"publishedOn\":\"2025-04-02 15:57:06\",\"publishedOnDateReadable\":\"April 2nd, 2025\"},\"versionCreatedAt\":\"2024-12-18 08:20:47\",\"video\":\"\",\"vorDoi\":\"10.1186/s40348-025-00191-3\",\"vorDoiUrl\":\"https://doi.org/10.1186/s40348-025-00191-3\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5442441\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5442441\",\"identity\":\"rs-5442441\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}