{"paper_id":"4dd04dec-7580-4acb-9ac2-1cb772b3051e","body_text":"Investigating the Role of ATP6AP1 in Modulating Breast Cancer Proliferation, Migration, and Drug Sensitivity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Investigating the Role of ATP6AP1 in Modulating Breast Cancer Proliferation, Migration, and Drug Sensitivity He Li, Ke Tao, Xuefeng Gu, Tianwei Qian, Kailv Sun This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8734268/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Breast cancer (BRCA) remains one of the most prevalent malignancies affecting women globally. Despite significant advancements in diagnostic tools and therapeutic strategies, the marked heterogeneity of BRCA leads to considerable variability in patient prognosis. ATP6AP1, functioning as a subunit of the V-ATPase (vacuolar-type H+-ATPase), is a transmembrane protein crucial for the assembly and regulation of this proton pump. To elucidate the role of ATP6AP1 in BRCA, we conducted an in-depth analysis of multiple public databases. This investigation aimed to establish correlations between ATP6AP1 expression and clinicopathological features, alongside performing survival prognostic analyses. The expression levels of ATP6AP1 in breast cancer tissues and cell lines were subsequently validated using quantitative reverse transcription polymerase chain reaction (qrt-PCR), Western blotting, and immunohistochemistry (IHC). Further experiments, including clone formation, scratch, Transwell migration/invasion assays, and EdU proliferation assays, were employed to assess the impact of ATP6AP1 on cancer cell proliferation, migration, and invasion. Additionally, the relationship between ATP6AP1 and drug sensitivity was predicted using the CellMiner database. Our overarching goal was to delineate the potential functions of ATP6AP1 in BRCA and to understand its implications for drug responsiveness. We observed significantly elevated ATP6AP1 expression in BRCA tissues and cell lines, which strongly correlated with poor patient prognosis. Crucially, the knockdown of ATP6AP1 markedly suppressed the viability and proliferative capacity of BRCA cells. In conclusion, ATP6AP1 emerges as a prognostic biomarker for BRCA and represents a promising therapeutic target. ATP6AP1 BRCA Migration Drug sensitivity Figures Figure 1 Figure 2 Figure 3 Introduction BC as one of the most frequently diagnosed malignancies in women, is also a leading cause of cancer-related mortality, accounting for approximately 11.7% of all cancer deaths [ 1 ] . With ongoing modernization and evolving lifestyles, the incidence of BC continues to rise [ 2 ] . Although advancements in diagnostic tools and their widespread adoption have led to improved rates of early BC detection, allowing for curative surgical resection in patients with early-stage, localized tumors and a relatively favorable prognosis, patients for whom early diagnosis is challenging or who have rapidly progressing tumors and miss the surgical window still face a comparatively poorer outcome [ 3 – 5 ] . This underscores the critical importance of identifying key therapeutic targets and prognostic biomarkers, which will further facilitate the development of precise and individualized treatment strategies for BC patients. The ATP6AP1 gene encodes for the ATP hydrolysis-driven proton transporter subunit of V-ATPases. As an accessory subunit of V-ATPases, ATP6AP1 not only participates in the regulation of numerous normal physiological processes but is also significantly implicated in the pathogenesis of various diseases [ 6 – 8 ] . For instance, a study identified that missense mutations in ATP6AP1 are highly associated with a spectrum of neurocognitive disorders, including hypogammaglobulinemia and liver disease [ 9 ] . Another investigation demonstrated that progressive supranuclear palsy (PSP), a rare neurodegenerative disorder primarily affecting the central nervous system, is strongly correlated with reduced levels of ATP6AP1 and ATP6AP2 [ 10 ] . In the context of cancer, however, ATP6AP1, as a subunit of the V-ATPase complex, facilitates tumor cell growth and metastasis in hypoxic and acidic microenvironments by increasing proton (H+) secretion [ 11 ] . For example, Li's research revealed that elevated SSR4 expression in gastric cancer may enhance the function of mitochondrial respiratory chain complex I (CI) and complex V (CV) by regulating the expression of NDUFB11 and ATP6AP1, thereby promoting mitochondrial oxidative phosphorylation and consequently contributing to GC metastasis and dissemination [ 12 ] . Similarly, a study employing whole-exome sequencing and targeted sequencing analysis found that mutations or depletion of ATP6AP1 or ATP6AP2 in granulosa cell tumors can confer oncogenic properties, providing a critical link between the regulation of intracellular pH and tumorigenesis [ 13 ] . To elucidate the potential relationship between ATP6AP1 expression and its impact on BRCA cells, as well as its association with patient prognosis, we first characterized ATP6AP1 expression in public databases such as TCGA and GEPIA2. Subsequently, we conducted analyses of clinical relevance, survival outcomes, and drug sensitivity based on relevant expression profiles and clinicopathological data retrieved from these public databases. Finally, we validated the effects of ATP6AP1 on BRCA cells through in vitro experiments, thereby providing data support for understanding the mechanisms underlying the development, progression, and invasion-metastasis of BRCA. Materials and Methods ATP6AP1 differential expression and survival analysis We utilized the online database GEPIA2 ( http://gepia2.cancer-pku.cn/#general ) to analyze the expression of ATP6AP1 in BRCAand to perform survival analyses. We utilized the online database ENCORI ( https://rnasysu.com/encori/panGeneDiffExp.php ) to analyze the differential expression and perform survival analysis of ATP6AP1 in BRCA. We used the online database The Human Protein Atlas ( https://www.proteinatlas.org/ ) to investigate the protein expression and distribution of ATP6AP1 in BRCA. Analysis of BRCA expression and clinicopathologic correlation Using the GDC Data Transfer Tool [ 13 ] , raw RNA-sequencing and clinical information data for breast cancer were downloaded from The Cancer Genome Atlas (TCGA) database ( https://portal.gdc.cancer.gov/ ). From an initial cohort of1236 samples, normal and duplicate samples were excluded, as were those withincomplete data, resulting in a final dataset of 832 tumor samples. The merge function in R was used to integrate the expression and clinical data for thesesamples. ATP6AP1 expression was dichotomized into high and low groups based on its median expression value. Subsequently, chi-squared tests were performed to investigate the association between ATP6AP1 expression and various clinicopathological features. Cell culture Breast cancer cell lines and normal breast cell were purchased from Wuhan Pronasisi Life Science Co., Ltd. The cell lines MCF10A, MDA-MB-231, MDA-MB-468, and MCF7 were cultured in DMEM medium supplemented with10% fetal bovine serum (Gibco, USA) and 1% penicillin-streptomycin at 37°C in a humidified incubator with 5% CO2. QRT-PCR For RNA extraction, cells were lysed with 1 mL of TRIzol reagent to obtain a homogenized sample. Subsequently, 0.2 mL of pre-chilled chloroform was added, followed by centrifugation at 12,000 rpm for 15 minutes at 4°C. The upper aqueous phase (approximately 0.5 mL) was carefully aspirated and mixedwith an equal volume (0.5 mL) of isopropanol. The mixture was incubated at room temperature for 10 minutes. Following this, centrifugation was performed at 12,000 rpm for 10 minutes at 4°C. The resulting RNA pellet was dissolved in 40 µL of RNase-free water, and reverse transcription was performed. Real-time quantitative polymerase chain reaction (RT-qPCR) was conductedusing ATP6AP1-specific primers (Forward: CAGCGACTTGCAGCTCTCTAC, Reverse: TGAAATCCTCAATGCTCAGCTTG). The housekeeping gene GAPDH (Forward: GGAGCGAGATCCCTCCAAAAT, Reverse: GGCTGTTGTCATACTTCTCATGG) was used as an internal control for normalization. Western blot Breast cancer cells were lysed using a lysis buffer containing 1% protease inhibitor cocktail on ice for 30 minutes. The lysates were then centrifuged at 12,000 rpm for 15 minutes at 4°C, and the supernatant was collected. Protein concentration was determined using the bicinchoninic acid assay. Proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 6% non-fat dry milk for 2 hours at room temperature. Primary antibodies, rabbit anti-human ATP6AP1 (1:1000 dilution) and rabbit anti-human GAPDH (1:5000 dilution), were added and incubated overnight at 4°C. The membranes were washed three times with TBST for 10 minutes each. Subsequently, secondary antibodies were added and incubated for 1 hour at room temperature. After three washes with TBST for 10 minutes each, signals were visualized using a chemiluminescence imaging system. Data were analyzed, and the expression levels of the target protein ATP6AP1 were normalized to GAPDH as an internal control. Wound healing assay To investigate whether ATP6AP1 influences the lateral migration ability of breast cancer MDA-MB-231 and MCF7 cell lines, cells with successful ATP6AP1 knockout were digested and resuspended in DMEM cell culture medium. They were then seeded into 6-well plates. Once the cells reached 70–80% confluency, a straight scratch was introduced using a 10µL pipette tip. The cells were washed with PBS to remove floating debris and dead cells, and then cultured in serum-free DMEM. All images were captured using an inverted phase-contrast microscope (Carl Zeiss, Germany) at 100x magnification 24 hours post-scratch. Colony Formation Assay Breast cancer cells were digested with trypsin, resuspended, and prepared into corresponding cell suspensions. After counting with a cell counting chamber, the cells were seeded into 6-well culture plates and gently swirled to ensure uniform distribution. Approximately 800–1000 cells per well were plated for each experimental group, with three replicate wells per group. Following inoculation, the plates were placed in a 37°C cell culture incubator. The medium was changed every 3–4 days during this period, and the cell status was observed. After 14 days, the formation of cell colonies was observed under an inverted microscope. The cells were then washed three times with PBS. An appropriate amount of 4% paraformaldehyde was added to each well to fix the cells for 30minutes. The cells were washed again three times with PBS. 500 µL of crystalviolet staining solution was added to each fixed well, staining the cells for 30 minutes. The cells were washed several times with ddH2O, air-dried, and then photographed for colony counting. Transwell assay for cell migration capacity Successfully knocked-out MDA-MB-231 and MCF7 cells were harvested, resuspended in serum-free medium, and counted. 600µL of DMEM complete medium containing 10% fetal bovine serum was added to the lower chamber. 200µL of cell suspension containing the same number of cells was seeded into the upper chamber. The plates were then placed in the incubator for continuousculture for 24 hours. Non-migrated cells in the upper chamber were removed with a sterile cotton swab. Cells on the membrane surface were fixed with 4%paraformaldehyde and stained with crystal violet for 10 minutes. Images were captured and cell numbers were counted under a microscope. Drug Sensitivity Analysis Drug sensitivity profiles will be acquired from Cellminer ( https://discover.nci.nih.gov/cellminer/ ). Pearson correlation will be applied to assess associations between ATP6AP1 sensitivity and various drug responses. Drugs demonstrating a correlation strength exceeding 0.3 and a statistical significance of p < 0.05 will be deemed relevant. Visualization of these significant drug associations will be performed utilizing the R ggplot2 package. Results ATP6AP1 is upregulated in breast cancer tissue samples and cell lines and is associated with poor prognosis. To investigate the expression of ATP6AP1 in breast cancer cells and tissues, we first analyzed its expression in breast cancer and normal tissues using public databases. The results revealed significantly higher ATP6AP1 expression in BRCA compared to normal mammary tissue (Fig. 1 A-B). Immunohistochemical staining further corroborated this finding, demonstrating markedly lower ATP6AP1 expression in normal MCF10A breast tissue than in BRCA tissues. Notably, ATP6AP1 primarily localized to the cytoplasm within BRCA samples (Fig. 1 C). Subsequently, we employed qRT-PCR to assess ATP6AP1 expression in normal cells and three breast cancer cell lines (MDA-MB-231, MDA-MB-468, MCF7), observing significantly elevated ATP6AP1 levels in breast cancer cells relative to their normal counterparts (Fig. 1 D). Western blot analysis also indicated substantially lower ATP6AP1 expression in normal breast tissue compared to cancerous tissue. Collectively, these findings suggest a potential involvement of ATP6AP1 in the pathogenesis and progression of breast cancer. Furthermore, we analyzed the impact of ATP6AP1 expression on overall survival OS in breast cancer patients using database analysis. The results indicated that patients in the high ATP6AP1 expression group exhibited significantly poorer OS compared to those in the low ATP6AP1 expression group (Fig. 1 F-G). ATP6AP1 is upregulated in breast cancer tissue samples and cell lines and is associated with poor prognosis. In this study, 832 BRCA patients were stratified into high and low ATP6AP1 expression groups to analyze correlations with clinical characteristics. The results showed a strong association between high ATP6AP1 expression and lymph node metastasis. Table 1 1 Association of ATPAP1 expression with clinicopathologic features of BRCA patients Low group(n=) High group(n=) P Gender Male (n = 10) Female (n = 822) 8 485 2 337 = 0.179 Race Black(n = 166) Asian(n = 53) American(n = 1) White(n = 612) 108 33 1 315 58 20 0 261 = 0.249 Age, years < 60 (n = 476) ≥ 60(n = 357) 280 213 195 144 = 0.835 Tumor Stage T1-2 (n = 697) T3-4 (n = 135) 415 78 282 57 = 0.703 Lymph Node Stage N0 (n = 402) N1 (n = 281) N2 (n = 84) N3(n = 53) N4(n = 12) 245 149 51 42 6 157 132 33 11 6 = 0.006* Metastasis Stage M0(n = 681) 404 277 = 0.289 M1(n = 15) 6 9 M2(n = 136) 83 53 ATP6AP1 promotes BRCA cell proliferation, migration, and invasion. To investigate the role of ATP6AP1 in the development and progression of BRCA, we initially assessed the expression of ATP6AP1 in BRCA cells. Subsequently, we used Western blot to validate the efficacy of transfecting sh1-ATP6AP1, sh2-ATP6AP1, and sh3-ATP6AP1. The results indicated that sh3-ATP6AP1 demonstrated a statistically significant difference compared to the control group and exhibited the highest knockdown efficiency (Fig. 2 A). Based on these findings, we selected MDA-MB-231 and MCF7 cells with stable sh3-ATP6AP1 knockdown for subsequent functional experiments. Cell proliferation was assessed by colony formation assay. The results showed that, compared to the control group, cells in the sh3-ATP6AP1 group exhibited significantly reduced viability (Fig. 2 B), indicating that the knockdown of ATP6AP1 significantly inhibited the proliferative capacity of BRCA cells. To investigate the effect of ATP6AP1 on BRCA metastasis, we performed wound healing assays in MDA-MB-231 and MCF7 cells to assess cell migration capacity. The results showed that, compared to the control group, the wound healing ability in the sh-ATP6AP1 group was significantly inhibited (Fig. 2 C). Invasive capacity of MDA-MB-231 and MCF7 cells was assessed using Transwell assays. The results showed that the sh1-ATP6AP1 group significantly inhibited cellular invasion (Fig. 2 D). Subsequent EdU assays further validated BRCA cell proliferation, revealinga significant decrease in the proliferation capacity of the sh3-ATP6AP1 group compared to the control group (Fig. 2 E). This indicates that ATP6AP1 knockdown significantly inhibited BRCA cell proliferation. KEGG/GO functional enrichment and drug sensitivity analysis. KEGG pathway enrichment analysis of ATP6AP1-associated genes revealed that pathways such as autophagy were the most enriched (Fig. 3 A). Furthermore, Gene Ontology (GO) analysis of ATP6AP1-associated genes showed significant enrichment in biological processes including vesicle maturation, proton transmembrane transport, and synaptic vesicle lumen acidification (Fig. 3 A). Significant enrichment in cellular components was observed for processes such as the proton transport V-type ATPase complex, proton transport by dual-sector ATP synthase complex, and ATPase complex (Fig. 3 A). In molecular functions, processes related to ATPase activity, ion transmembrane movement, and ATPase activation were significantly enriched (Fig. 3 A). Drug sensitivity analysis revealed potential correlations between ATP6AP1 expression levels and its sensitivity to chemotherapeutic agents across 60 human cancer cell lines (NCI-60). ATP6AP1 was found to be associated with sensitivity to various anti-cancer drugs (Fig. 2 B). Specifically, ATP6AP1 showed strong correlations with sensitivity to Pralatrexate (cor = 0.32, p = 0.011), Nitazoxanide (cor = 0.35, p = 0.007), Hydrastinine HCl (cor = 0.37, p = 0.003), GW-5074 (cor = 0.31, p = 0.016), XL-147 (cor = 0.35, p = 0.005), OSI-027 (cor = 0.4, p = 0.001), and Quizartinib (cor = 0.41, p = 0.001). Statistical Analysis All experimental results were repeated more than three times and are expressedas mean ± standard deviation. Significance analysis between two groups was performed using a t-test. Analysis of variance (ANOVA) was primarily used for the analysis of multiple group data, and chi-square tests were applied for categorical data. All statistical graphs of the experimental data were generated using Graphpad Prism (version 9.0). A p-value < 0.05 was considered statistically significant. Discussion Stratified treatment of BRCA can significantly improve patient survival rates. However, poor treatment outcomes and adverse prognoses are common characteristics of advanced BRCA. Early distant micro-metastasis is one of the significant causes. Furthermore, ongoing genetic alterations within advanced cancer cells considerably enhance their potential for drug resistance to chemotherapy and immunotherapy, leading to unfavorable prognoses in approximately 30% of breast cancer patients after systemic treatment [ 14 – 16 ] . The ability of cells to rapidly adapt to diverse environmental changes and stimuli by controlling mRNA translation during gene expression has been demonstrated in numerous studies, posing a significant challenge for BRCA treatment [ 17 ] . Therefore, identifying coregenes involved in these changes is crucial for understanding the cancer progression process and improving the survival rates of BRCA patients. ATP6AP1, also known as Ac45, is involved in the V-ATPase complex, where it regulates the binding of subunits to phospholipids, thereby promoting the formation of the V-ATPase complex [ 18 ] . Previous studies have found that it can regulate pH and plays an important role in maintaining the acidic environment of cellular lysosomes [ 19 , 20 ] . Its mutations are not only associated with various benign diseases but are also highly correlated with the occurrence and development of tumors. For instance, one study discovered that ATP6AP1 expression is significantly elevated in colorectal cancer and is associated with clinical pathological features [ 21 ] . Further mechanistic analysis revealed that abnormal ATP6AP1 in colorectal cancer is typically linked to the infiltration of immune cellsand cancer-associated fibroblasts. Moreover, a high ATP6AP1 expression group showed a significant enrichment of cytoplasmic vesicular lumens, endopeptidase regulator activity, and endopeptidase inhibitor activity. Another study found thatthe anti-tumor effect in malignant granular cell tumors might be due to the functional loss of ATP6AP1/2 genes [ 22 ] . These findings collectively suggest that ATP6AP1 may not only participate in the invasion and metastasis of BRCA but also influence the treatment response in BRCA. Researchers have long identified geographical economics, hormones, obesity, and race as contributing factors to BRCA [ 23 – 25 ] . In this study, we investigated the potential role of ATP6AP1 in the clinical treatment of BRCA. Analysis using multiple bioinformatics databases revealed that ATP6AP1 expression was significantly higher in both BRCA patient tissues and BRCA cells compared tonormal tissue cells. Further investigation indicated that patients with higher ATP6AP1 expression had a poorer prognosis. The relationship between abnormal gene expression and the clinical pathological characteristics of tumor patients has been demonstrated in numerous studies [ 26 – 29 ] . In this study, to further explorethe relationship between ATP6AP1 expression and clinical pathological features,we downloaded clinical pathological characteristic information from bioinformatics databases and analyzed the correlation. The results showed that high ATP6AP1 expression was highly correlated with lymph node metastasis in BRCA patients, suggesting that patients with elevated ATP6AP1 expression may already have lymph node involvement. Therefore, developing multidisciplinary, multi-modal combined treatments based on the number of affected lymph nodes in advanced BRCA patients is crucial. These experimental results indicate that ATP6AP1 can serve as a prognostic and stratification marker for BRCA patients, providing a theoretical basis for developing personalized treatment plans. To deeply explore the specific mechanisms of ATP6AP1 in BRCA, this study identified and performed enrichment analysis of genes highly correlated with ATP6AP1. The results showed that ATP6AP1 protein may participate in regulating biological processes such as vesicle maturation, proton transmembrane transport, and synaptic vesicle acidification. Furthermore, we found that it not only participates in the assembly of the V-ATPase complex but may also be involved in the activation of ATPase; However, detailed functions and mechanisms require further experimental validation. Drug resistance to chemotherapeutic agents in advanced BRCA patients significantly limits treatment efficacy and is a major cause of poor patient prognosis [ 30 – 32 ] . Previous reports have indicated that ATP6AP1 may be involved in tamoxifen and doxorubicin resistance in BRCA patients, but the specific detailed mechanisms remain unclear [ 33 , 34 ] . To further identify resistance mechanisms and effective drugs, we performed a bulk analysis of several commonly used drugs. The results showed that Pralatrexate, Nitazoxanide, Hydrastinine HCl, GW-5074, XL-147, OSI-027, and Quizartinib exhibited significant sensitivity in cells with high ATP6AP1 expression. Among these, Pralatrexate, a novel dihydrofolate reductase inhibitor, is widely used in the treatment of peripheral T-cell lymphoma. Whether its mechanism is also involved in the anti-tumor drug resistance response in BRCA patients requires further in-depth study [ 35 , 36 ] . Additionally, XL-147 and OSI-027 are widely used in clinical anti-tumor therapy, primarily exerting their effects by inhibiting the PI3K and mTOR pathways, which may explain why BRCA responds to these drugs [ 37 , 38 ] . Quizartinib, a selective type II second-generation FLT3 inhibitor, has been applied in the clinical treatment of acute myeloid leukemia but has not been tested in solid tumors, presenting a potential therapeutic avenue for BRCA.The aforementioned studies all indicate that ATP6AP1 can regulate BRCA invasion and metastasis, exert a pro-tumorigenic role in BRCA, and thus can serve as an inhibitor for BRCA, potentially representing a therapeutic target for BRCA. In summary, we investigated the potential relationship between ATP6AP1 expression and clinical pathological characteristics in BRCA, and deeply explored its function and mechanism in BRCA proliferation, migration, and metastasis. The results of this study indicate that elevated ATP6AP1 plays a crucial role in BRCA cell growth and metastasis. Furthermore, as an important component of the V-ATPase complex, ATP6AP1 holds significant potential for drug development. Clinically, ATP6AP1 may serve as one of the important indicators for stratified treatment of BRCA patients, providing a theoretical basis for formulating personalized diagnosis and treatment plans. Declarations Data availability The datasets used and analysed during the current study available from the corresponding author on reasonable request. AUTHOR CONTRIBUTION He Li conceived and designed the study. He Li analyzed the data and wrote the manuscript.Tao Ke and Xuefeng Gu carried out the major experiments. Tianwei Qian performed statistical analysis of the experimental data. Kailü Sun contributed to data collection and statistical analysis. Acknowledgments Not applicable. Clinical trial registration Not applicable. This study did not involve human participants or clinical interventions. Ethics approval, Consent to Participate, and Consent to Publish Not applicable. This study exclusively utilized established human cell lines, without involvement of human subjects, animal models, or clinical specimens. Funding This work was supported by the Science and Technology Program of the Changshu Health Commission, Jiangsu Province, China (SUBSIDIZE NUMBER:CSWS202109). DECLARATION OF INTERESTS The authors declare no competing interests. References TAO X, LI T, GANDOMKAR Z, et al. Incidence, mortality, survival, and disease burden of breast cancer in China compared to other developed countries. [J]. Asia-Pac J Clin Oncol. 2023;19(6):645–54. CAO W, CHEN H, YU Y, et al. Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. [J] Chin Med J. 2021;134(7):783–91. LI Y, ZHAO X, LIU Q, et al. Bioinformatics reveal macrophages marker genes signature in breast cancer to predict prognosis. [J] Annals Med. 2021;53(1):1019–31. KOREN S, BENTIRES-ALJ M. Breast Tumor Heterogeneity: Source of Fitness, Hurdle for Therapy. [J] Mol cell. 2015;60(4):537–46. XU Q, CHEN S, HU Y, et al. Landscape of Immune Microenvironment Under Immune Cell Infiltration Pattern in Breast Cancer. [J]. Front Immunol. 2021;12:711433. DIMITROV B, HIMMELREICH N, HIPGRAVE EDERVEEN A L, et al. Cutis laxa, exocrine pancreatic insufficiency and altered cellular metabolomics as additional symptoms in a new patient with ATP6AP1-CDG. [J]. Mol Genet Metab. 2018;123(3):364–74. GUMM A J, BASEL D G, THAKRAR P, et al. Liver failure and x-linkedimmunodeficiency type 47. [J] Pediatr transplantation. 2020;24(8):e13808. TVINA A, THOMSEN A. Prenatal and postnatal phenotypeof a pathologic variant in the ATP6AP1 gene. [J]. Eur J Med Genet. 2020;63(6):103881. JANSEN E J R, TIMAL S. ATP6AP1 deficiency causes an immunodeficiency with hepatopathy, cognitive impairment and abnormal protein glycosylation. [J] Nat Commun. 2016;7:11600. TIAN Y, GAO M, HUANG L, et al. ATP6AP1 is a potential prognostic biomarker and is associated with iron metabolism in breast cancer. [J]. Front Genet. 2022;13:958290. LI A, LIAO B, WU K et al. SSR4 Promote Gastric Cancer Progression by Regulating Mitochondrial Oxidative Phosphorylation via NDUFB11 and ATP6AP1. [J]. Molecular carcinogenesis, 2025. PAREJA F, BRANDES A H, BASILI T, et al. Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors. [J] Nat Commun. 2018;9(1):3533. WANG Z, JENSEN M A, ZENKLUSEN JC. A Practical Guide to The Cancer Genome Atlas (TCGA). [J]. Methods in molecular biology. (Clifton N J). 2016;1418:111–41. XIONG X, DING ZHENGL. Breast cancer: pathogenesis and treatments. [J] Signal Transduct Target therapy. 2025;10(1):49. PISANI P, BRAY F, PARKIN DM. Estimates of the world-wide prevalence of cancer for 25 sites in the adult population. [J]. Int J Cancer. 2002;97(1):72–81. GONZALEZ-ANGULO A M, MORALES-VASQUEZ F, HORTOBAGYI GN. Overview of resistance to systemic therapy in patients with breast cancer. [J]. Adv Exp Med Biol. 2007;608:1–22. PAPADOPOLI LEELJ, JEWER D. Cancer Plasticity: The Role of mRNATranslation. [J] Trends cancer. 2021;7(2):134–45. WANG L, WU D, ROBINSON C V, et al. Structures of a Complete Human V-ATPase Reveal Mechanisms of Its Assembly. [J] Mol cell. 2020;80(3):501–11. SANTOS-PEREIRA C, RODRIGUES L R, CÔRTE-REAL M. Emerging insights on the role of V-ATPase in human diseases: Therapeutic challenges and opportunities. [J] Med Res reviews. 2021;41(4):1927–64. VASANTHAKUMAR T, RUBINSTEIN JL. Structure and Roles of V-typeATPases,[J]. Trends Biochem Sci. 2020;45(4):295–307. ZHANG S, WANG Y, ZHANG X, et al. ATP6AP1 as a potential prognostic biomarker in CRC by comprehensive analysis and verification. [J] Sci Rep. 2024;14(1):4018. TORRADO C, CAMAÑO M, HINDI N et al. Antiangiogenics Malignant GranularCell Tumors: Rev Literature [J] Cancers, 2023,15(21). LEE JE. Diet Before and After Breast Cancer. [J]. Adv Exp Med Biol. 2021;1187:545–66. BARNARD M E, BOEKE C E. TAMIMI R M. Established breast cancer risk factorsand risk of intrinsic tumor subtypes. [J]. Biochim Biophys Acta. 2015;1856(1):73–85. HURSON A N, AHEARN T U KOKAH, et al. Risk factors for breast cancer subtypes by race and ethnicity: a scoping review. [J]. J Natl Cancer Inst. 2024;116(12):1992–2002. ANG C S, SUN M Y, HUITZIL-MELENDEZ D F, et al. c-MET and HGF mRNA expression in hepatocellular carcinoma: correlation with clinicopathological features and survival. [J] Anticancer Res. 2013;33(8):3241–5. WAHAB R, GOPALAN V, ISLAM F, et al. Expression of GAEC1 mRNA and protein and its association with clinical and pathological parameters of patients with colorectal adenocarcinoma. [J]. Exp Mol Pathol. 2018;104(1):71–5. FAN X, ZOU X, LIU C, et al. Identify miRNA-mRNA regulation pairs to explore potential pathogenesis of lung adenocarcinoma. [J] Aging. 2022;14(20):8357–73. MOAZZEZY N, EBRAHIMI F, SISAKHT MM, et al. Relationship between erb-B2 mRNA Expression in Blood and Tissue of Invasive Ductal Carcinoma Breast Cancer Patients and Clinicopathological Characteristics of the Tumors. [J]. Asian Pac J cancer prevention: APJCP. 2016;17(1):249–54. WU G, XIAO M. Drug resistance in breast cancer: Mechanisms and strategies for management. [J]. Drug Resist updates: reviews commentaries Antimicrob anticancer Chemother. 2025;83:101288. LIU S, ZHANG X, WANG W, et al. Metabolic reprogramming and therapeutic resistance in primary and metastatic breast cancer. [J]. Mol Cancer. 2024;23(1):261. KHAN M M, YALAMARTY S S K, RAJMALANI B A, et al. Recent strategies to overcome breast cancer resistance. [J]. Crit Rev Oncol/Hematol. 2024;197:104351. YAN Z, HUANG A, MA D, et al. ATP6AP1 promotes cell proliferation and tamoxifen resistance in luminal breast cancer by inducing autophagy. [J] Cell death disease. 2025;16(1):201. FEI Y, YAN X, LIANG M, et al. Lysosomal gene ATP6AP1 promotes doxorubicin resistance via up-regulating autophagic flux in breast cancer. [J]. Cancer Cell Int. 2024;24(1):394. ALTıNAY S, KURAL A, ÖZMEN A, et al. Pralatrexate for Peripheral T-Cell Lymphoma (PTCL): Chance Only Supports The Prepared Mind. [J]. Anti-cancer Agents Med Chem. 2023;23(3):298–305. O'CONNOR O A PROB, PINTER-BROWN L, et al. Pralatrexate in patients with relapsed or refractory peripheral T-cell lymphoma: results from the pivotal PROPEL study[J]. J Clin oncology: official J Am Soc Clin Oncol. 2011;29(9):1182–9. ZHU K, WU Y, HE P et al. PI3K/AKT/mTOR-Targeted Therapy for Breast Cancer[J]. Cells, 2022,11(16). YANG J, NIE J, MA X, et al. Targeting PI3K in cancer: mechanisms and advances in clinical trials. [J]. Mol Cancer. 2019;18(1):26. Additional Declarations No competing interests reported. Supplementary Files OriginalWesternBlotImages.tif.rar Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8734268\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":592359648,\"identity\":\"c009f003-9650-44b0-bec3-04a466bb237e\",\"order_by\":0,\"name\":\"He Li\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYBACPmYeBoaEChsefiBHAogZGwhpYQNpeXAmTU6ygWgtDDwMjA/bDhsbHCBaCzvvwQeJbYcTN58/Y3jjB4ON7IYDzM8e4HcYX7JBwrn0xG03cowtexjSjDccYDM3IOAXM4mEMmugFiCDh+Fw4oYDPGwSBLSY/0hgY07c3H/GTPIPw3+itJgxJLQ5Gxsw5JhJ8zAcIEqLsUQCMJAlbqQVW8sYJBvPPMxmhlcLP/8Zw48/QFHZf3jjzTcVdrJ9x5uf4dWCBkBBxUyC+lEwCkbBKBgF2AEAgn9DZTpv21cAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Changshu Hospital Affiliated to Soochow University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"He\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":592359649,\"identity\":\"49d79629-5dc1-49d2-8a66-744b40f8dff2\",\"order_by\":1,\"name\":\"Ke Tao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Changshu Hospital Affiliated to Soochow University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ke\",\"middleName\":\"\",\"lastName\":\"Tao\",\"suffix\":\"\"},{\"id\":592359650,\"identity\":\"f4de22ae-59e3-4a45-9377-c1878ea57f22\",\"order_by\":2,\"name\":\"Xuefeng Gu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Changshu Hospital Affiliated to Soochow University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuefeng\",\"middleName\":\"\",\"lastName\":\"Gu\",\"suffix\":\"\"},{\"id\":592359651,\"identity\":\"9f3e4727-82bc-4cf4-9ff1-44d9fad27205\",\"order_by\":3,\"name\":\"Tianwei Qian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Changshu Hospital Affiliated to Soochow University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tianwei\",\"middleName\":\"\",\"lastName\":\"Qian\",\"suffix\":\"\"},{\"id\":592359652,\"identity\":\"b775a79d-eaa8-40e8-8cc3-ceb2e5e0dece\",\"order_by\":4,\"name\":\"Kailv Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Changshu Hospital Affiliated to Soochow University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kailv\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-01-29 17:54:30\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8734268/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8734268/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":102855771,\"identity\":\"99279717-cbe9-49cb-906e-fa6735bd6e22\",\"added_by\":\"auto\",\"created_at\":\"2026-02-17 14:57:30\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":109730,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eATP6AP1 expression is increased in Breast cancer cells and correlates with poor prognosis. (A-B) Public database shows elevated expression of ATP6AP1in BRCA. (C) Immunohistochemical staining shows elevated expression of ATP6AP1 in BRCA. (D-E) ATP6AP1 expression in BRCA cells was significantly higher than that in normal cells and tissue. (F-G) Effect of ATP6AP1 on OS and PFS in BRCA patients.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8734268/v1/84f0056d66e2876f1ff339ac.png\"},{\"id\":102855773,\"identity\":\"ce481ed4-2f1d-4efa-9236-3fd71385aec8\",\"added_by\":\"auto\",\"created_at\":\"2026-02-17 14:57:30\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":236152,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eATP6AP1 promotes cell proliferation, migration, and invasion inBRCA. (A) Validation of western blot assay for transfection with sh-ATP6AP1 in MDA-MB-231 and MCF7 cells. (B) Cloning assay for BRCA cell viability. (C) Detection of cellular wound healing capacity by scratch assay. (D) Transwell assay for cell migration and invasion. (E) EDU assay was used to evaluate cellular proliferation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8734268/v1/9fd1dd1ed600ed28372d5515.png\"},{\"id\":102855800,\"identity\":\"4b19d407-fdc8-4b44-95c4-f7a27044e3c7\",\"added_by\":\"auto\",\"created_at\":\"2026-02-17 14:57:37\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":128797,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eKEGG/GO functional enrichment and drug sensitivity. (A) Functional enrichment of PDLIM7 and related genes KEGG/GO. (B) PDLIM7 and drug correlation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8734268/v1/dd91458739dd138dc6d64710.png\"},{\"id\":105728054,\"identity\":\"ab4db91f-821d-470c-a27e-cb3c089519d3\",\"added_by\":\"auto\",\"created_at\":\"2026-03-30 11:08:51\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1094740,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8734268/v1/2d6e05e8-0c3f-4e9d-812a-9fbaed0955c1.pdf\"},{\"id\":102855776,\"identity\":\"627bdede-d9d5-49ae-9711-2ca47d50d75c\",\"added_by\":\"auto\",\"created_at\":\"2026-02-17 14:57:33\",\"extension\":\"rar\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1395995,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OriginalWesternBlotImages.tif.rar\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8734268/v1/3415227f6db4512b385f4968.rar\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Investigating the Role of ATP6AP1 in Modulating Breast Cancer Proliferation, Migration, and Drug Sensitivity\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eBC as one of the most frequently diagnosed malignancies in women, is also a leading cause of cancer-related mortality, accounting for approximately 11.7% of all cancer deaths\\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u003c/sup\\u003e. With ongoing modernization and evolving lifestyles, the incidence of BC continues to rise\\u003csup\\u003e[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. Although advancements in diagnostic tools and their widespread adoption have led to improved rates of early BC detection, allowing for curative surgical resection in patients with early-stage, localized tumors and a relatively favorable prognosis, patients for whom early diagnosis is challenging or who have rapidly progressing tumors and miss the surgical window still face a comparatively poorer outcome\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR4\\\" citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]\\u003c/sup\\u003e. This underscores the critical importance of identifying key therapeutic targets and prognostic biomarkers, which will further facilitate the development of precise and individualized treatment strategies for BC patients.\\u003c/p\\u003e \\u003cp\\u003eThe ATP6AP1 gene encodes for the ATP hydrolysis-driven proton transporter subunit of V-ATPases. As an accessory subunit of V-ATPases, ATP6AP1 not only participates in the regulation of numerous normal physiological processes but is also significantly implicated in the pathogenesis of various diseases\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR7\\\" citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. For instance, a study identified that missense mutations in ATP6AP1 are highly associated with a spectrum of neurocognitive disorders, including hypogammaglobulinemia and liver disease\\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. Another investigation demonstrated that progressive supranuclear palsy (PSP), a rare neurodegenerative disorder primarily affecting the central nervous system, is strongly correlated with reduced levels of ATP6AP1 and ATP6AP2\\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e. In the context of cancer, however, ATP6AP1, as a subunit of the V-ATPase complex, facilitates tumor cell growth and metastasis in hypoxic and acidic microenvironments by increasing proton (H+) secretion\\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]\\u003c/sup\\u003e. For example, Li's research revealed that elevated SSR4 expression in gastric cancer may enhance the function of mitochondrial respiratory chain complex I (CI) and complex V (CV) by regulating the expression of NDUFB11 and ATP6AP1, thereby promoting mitochondrial oxidative phosphorylation and consequently contributing to GC metastasis and dissemination\\u003csup\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/sup\\u003e. Similarly, a study employing whole-exome sequencing and targeted sequencing analysis found that mutations or depletion of ATP6AP1 or ATP6AP2 in granulosa cell tumors can confer oncogenic properties, providing a critical link between the regulation of intracellular pH and tumorigenesis\\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eTo elucidate the potential relationship between ATP6AP1 expression and its impact on BRCA cells, as well as its association with patient prognosis, we first characterized ATP6AP1 expression in public databases such as TCGA and GEPIA2. Subsequently, we conducted analyses of clinical relevance, survival outcomes, and drug sensitivity based on relevant expression profiles and clinicopathological data retrieved from these public databases. Finally, we validated the effects of ATP6AP1 on BRCA cells through in vitro experiments, thereby providing data support for understanding the mechanisms underlying the development, progression, and invasion-metastasis of BRCA.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003eATP6AP1 differential expression and survival analysis\\u003c/p\\u003e \\u003cp\\u003eWe utilized the online database GEPIA2 (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://gepia2.cancer-pku.cn/#general\\u003c/span\\u003e\\u003cspan address=\\\"http://gepia2.cancer-pku.cn/#general\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to analyze the expression of ATP6AP1 in BRCAand to perform survival analyses.\\u003c/p\\u003e \\u003cp\\u003eWe utilized the online database ENCORI (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://rnasysu.com/encori/panGeneDiffExp.php\\u003c/span\\u003e\\u003cspan address=\\\"https://rnasysu.com/encori/panGeneDiffExp.php\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to analyze the differential expression and perform survival analysis of ATP6AP1 in BRCA.\\u003c/p\\u003e \\u003cp\\u003eWe used the online database The Human Protein Atlas (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.proteinatlas.org/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.proteinatlas.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to investigate the protein expression and distribution of ATP6AP1 in BRCA.\\u003c/p\\u003e \\u003cp\\u003eAnalysis of BRCA expression and clinicopathologic correlation\\u003c/p\\u003e \\u003cp\\u003eUsing the GDC Data Transfer Tool\\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e, raw RNA-sequencing and clinical information data for breast cancer were downloaded from The Cancer Genome Atlas (TCGA) database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://portal.gdc.cancer.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://portal.gdc.cancer.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). From an initial cohort of1236 samples, normal and duplicate samples were excluded, as were those withincomplete data, resulting in a final dataset of 832 tumor samples. The merge function in R was used to integrate the expression and clinical data for thesesamples. ATP6AP1 expression was dichotomized into high and low groups based on its median expression value. Subsequently, chi-squared tests were performed to investigate the association between ATP6AP1 expression and various clinicopathological features.\\u003c/p\\u003e \\u003cp\\u003eCell culture\\u003c/p\\u003e \\u003cp\\u003eBreast cancer cell lines and normal breast cell were purchased from Wuhan Pronasisi Life Science Co., Ltd. The cell lines MCF10A, MDA-MB-231, MDA-MB-468, and MCF7 were cultured in DMEM medium supplemented with10% fetal bovine serum (Gibco, USA) and 1% penicillin-streptomycin at 37\\u0026deg;C in a humidified incubator with 5% CO2.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQRT-PCR\\u003c/h2\\u003e \\u003cp\\u003eFor RNA extraction, cells were lysed with 1 mL of TRIzol reagent to obtain a homogenized sample. Subsequently, 0.2 mL of pre-chilled chloroform was added, followed by centrifugation at 12,000 rpm for 15 minutes at 4\\u0026deg;C. The upper aqueous phase (approximately 0.5 mL) was carefully aspirated and mixedwith an equal volume (0.5 mL) of isopropanol. The mixture was incubated at room temperature for 10 minutes. Following this, centrifugation was performed at 12,000 rpm for 10 minutes at 4\\u0026deg;C. The resulting RNA pellet was dissolved in 40 \\u0026micro;L of RNase-free water, and reverse transcription was performed.\\u003c/p\\u003e \\u003cp\\u003eReal-time quantitative polymerase chain reaction (RT-qPCR) was conductedusing ATP6AP1-specific primers (Forward: CAGCGACTTGCAGCTCTCTAC, Reverse: TGAAATCCTCAATGCTCAGCTTG). The housekeeping gene GAPDH (Forward: GGAGCGAGATCCCTCCAAAAT, Reverse: GGCTGTTGTCATACTTCTCATGG) was used as an internal control for normalization.\\u003c/p\\u003e \\u003cp\\u003eWestern blot\\u003c/p\\u003e \\u003cp\\u003eBreast cancer cells were lysed using a lysis buffer containing 1% protease inhibitor cocktail on ice for 30 minutes. The lysates were then centrifuged at 12,000 rpm for 15 minutes at 4\\u0026deg;C, and the supernatant was collected. Protein concentration was determined using the bicinchoninic acid assay. Proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 6% non-fat dry milk for 2 hours at room temperature. Primary antibodies, rabbit anti-human ATP6AP1 (1:1000 dilution) and rabbit anti-human GAPDH (1:5000 dilution), were added and incubated overnight at 4\\u0026deg;C. The membranes were washed three times with TBST for 10 minutes each. Subsequently, secondary antibodies were added and incubated for 1 hour at room temperature. After three washes with TBST for 10 minutes each, signals were visualized using a chemiluminescence imaging system. Data were analyzed, and the expression levels of the target protein ATP6AP1 were normalized to GAPDH as an internal control.\\u003c/p\\u003e \\u003cp\\u003eWound healing assay\\u003c/p\\u003e \\u003cp\\u003eTo investigate whether ATP6AP1 influences the lateral migration ability of breast cancer MDA-MB-231 and MCF7 cell lines, cells with successful ATP6AP1 knockout were digested and resuspended in DMEM cell culture medium. They were then seeded into 6-well plates. Once the cells reached 70\\u0026ndash;80% confluency, a straight scratch was introduced using a 10\\u0026micro;L pipette tip. The cells were washed with PBS to remove floating debris and dead cells, and then cultured in serum-free DMEM. All images were captured using an inverted phase-contrast microscope (Carl Zeiss, Germany) at 100x magnification 24 hours post-scratch.\\u003c/p\\u003e \\u003cp\\u003eColony Formation Assay\\u003c/p\\u003e \\u003cp\\u003eBreast cancer cells were digested with trypsin, resuspended, and prepared into corresponding cell suspensions. After counting with a cell counting chamber, the cells were seeded into 6-well culture plates and gently swirled to ensure uniform distribution. Approximately 800\\u0026ndash;1000 cells per well were plated for each experimental group, with three replicate wells per group. Following inoculation, the plates were placed in a 37\\u0026deg;C cell culture incubator. The medium was changed every 3\\u0026ndash;4 days during this period, and the cell status was observed. After 14 days, the formation of cell colonies was observed under an inverted microscope. The cells were then washed three times with PBS. An appropriate amount of 4% paraformaldehyde was added to each well to fix the cells for 30minutes. The cells were washed again three times with PBS. 500 \\u0026micro;L of crystalviolet staining solution was added to each fixed well, staining the cells for 30 minutes. The cells were washed several times with ddH2O, air-dried, and then photographed for colony counting.\\u003c/p\\u003e \\u003cp\\u003eTranswell assay for cell migration capacity\\u003c/p\\u003e \\u003cp\\u003eSuccessfully knocked-out MDA-MB-231 and MCF7 cells were harvested, resuspended in serum-free medium, and counted. 600\\u0026micro;L of DMEM complete medium containing 10% fetal bovine serum was added to the lower chamber. 200\\u0026micro;L of cell suspension containing the same number of cells was seeded into the upper chamber. The plates were then placed in the incubator for continuousculture for 24 hours. Non-migrated cells in the upper chamber were removed with a sterile cotton swab. Cells on the membrane surface were fixed with 4%paraformaldehyde and stained with crystal violet for 10 minutes. Images were captured and cell numbers were counted under a microscope.\\u003c/p\\u003e \\u003cp\\u003eDrug Sensitivity Analysis\\u003c/p\\u003e \\u003cp\\u003eDrug sensitivity profiles will be acquired from Cellminer (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://discover.nci.nih.gov/cellminer/\\u003c/span\\u003e\\u003cspan address=\\\"https://discover.nci.nih.gov/cellminer/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). Pearson correlation will be applied to assess associations between ATP6AP1 sensitivity and various drug responses. Drugs demonstrating a correlation strength exceeding 0.3 and a statistical significance of p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 will be deemed relevant. Visualization of these significant drug associations will be performed utilizing the R ggplot2 package.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eATP6AP1 is upregulated in breast cancer tissue samples and cell lines and is associated with poor prognosis.\\u003c/p\\u003e \\u003cp\\u003eTo investigate the expression of ATP6AP1 in breast cancer cells and tissues, we first analyzed its expression in breast cancer and normal tissues using public databases. The results revealed significantly higher ATP6AP1 expression in BRCA compared to normal mammary tissue (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA-B). Immunohistochemical staining further corroborated this finding, demonstrating markedly lower ATP6AP1 expression in normal MCF10A breast tissue than in BRCA tissues. Notably, ATP6AP1 primarily localized to the cytoplasm within BRCA samples (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Subsequently, we employed qRT-PCR to assess ATP6AP1 expression in normal cells and three breast cancer cell lines (MDA-MB-231, MDA-MB-468, MCF7), observing significantly elevated ATP6AP1 levels in breast cancer cells relative to their normal counterparts (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). Western blot analysis also indicated substantially lower ATP6AP1 expression in normal breast tissue compared to cancerous tissue. Collectively, these findings suggest a potential involvement of ATP6AP1 in the pathogenesis and progression of breast cancer.\\u003c/p\\u003e \\u003cp\\u003eFurthermore, we analyzed the impact of ATP6AP1 expression on overall survival OS in breast cancer patients using database analysis. The results indicated that patients in the high ATP6AP1 expression group exhibited significantly poorer OS compared to those in the low ATP6AP1 expression group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF-G).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eATP6AP1 is upregulated in breast cancer tissue samples and cell lines and is associated with poor prognosis.\\u003c/p\\u003e \\u003cp\\u003eIn this study, 832 BRCA patients were stratified into high and low ATP6AP1 expression groups to analyze correlations with clinical characteristics. The results showed a strong association between high ATP6AP1 expression and lymph node metastasis.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003e1 Association of ATPAP1 expression with clinicopathologic features of BRCA patients\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLow group(n=)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eHigh group(n=)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eP\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGender\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eMale (n\\u0026thinsp;=\\u0026thinsp;10)\\u003c/p\\u003e \\u003cp\\u003eFemale (n\\u0026thinsp;=\\u0026thinsp;822)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e8\\u003c/p\\u003e \\u003cp\\u003e485\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e2\\u003c/p\\u003e \\u003cp\\u003e337\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e=\\u0026thinsp;0.179\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRace\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eBlack(n\\u0026thinsp;=\\u0026thinsp;166)\\u003c/p\\u003e \\u003cp\\u003eAsian(n\\u0026thinsp;=\\u0026thinsp;53)\\u003c/p\\u003e \\u003cp\\u003eAmerican(n\\u0026thinsp;=\\u0026thinsp;1)\\u003c/p\\u003e \\u003cp\\u003eWhite(n\\u0026thinsp;=\\u0026thinsp;612)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e108\\u003c/p\\u003e \\u003cp\\u003e33\\u003c/p\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003cp\\u003e315\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e58\\u003c/p\\u003e \\u003cp\\u003e20\\u003c/p\\u003e \\u003cp\\u003e0\\u003c/p\\u003e \\u003cp\\u003e261\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e=\\u0026thinsp;0.249\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge, years\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026lt;\\u0026thinsp;60 (n\\u0026thinsp;=\\u0026thinsp;476)\\u003c/p\\u003e \\u003cp\\u003e\\u0026ge;\\u0026thinsp;60(n\\u0026thinsp;=\\u0026thinsp;357)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e280\\u003c/p\\u003e \\u003cp\\u003e213\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e195\\u003c/p\\u003e \\u003cp\\u003e144\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e=\\u0026thinsp;0.835\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTumor Stage\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eT1-2 (n\\u0026thinsp;=\\u0026thinsp;697)\\u003c/p\\u003e \\u003cp\\u003eT3-4 (n\\u0026thinsp;=\\u0026thinsp;135)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e415\\u003c/p\\u003e \\u003cp\\u003e78\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e282\\u003c/p\\u003e \\u003cp\\u003e57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e=\\u0026thinsp;0.703\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLymph Node Stage\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eN0 (n\\u0026thinsp;=\\u0026thinsp;402)\\u003c/p\\u003e \\u003cp\\u003eN1 (n\\u0026thinsp;=\\u0026thinsp;281)\\u003c/p\\u003e \\u003cp\\u003eN2 (n\\u0026thinsp;=\\u0026thinsp;84)\\u003c/p\\u003e \\u003cp\\u003eN3(n\\u0026thinsp;=\\u0026thinsp;53)\\u003c/p\\u003e \\u003cp\\u003eN4(n\\u0026thinsp;=\\u0026thinsp;12)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e245\\u003c/p\\u003e \\u003cp\\u003e149\\u003c/p\\u003e \\u003cp\\u003e51\\u003c/p\\u003e \\u003cp\\u003e42\\u003c/p\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e157\\u003c/p\\u003e \\u003cp\\u003e132\\u003c/p\\u003e \\u003cp\\u003e33\\u003c/p\\u003e \\u003cp\\u003e11\\u003c/p\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e=\\u0026thinsp;0.006*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMetastasis Stage\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eM0(n\\u0026thinsp;=\\u0026thinsp;681)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e404\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e277\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e=\\u0026thinsp;0.289\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eM1(n\\u0026thinsp;=\\u0026thinsp;15)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eM2(n\\u0026thinsp;=\\u0026thinsp;136)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e83\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eATP6AP1 promotes BRCA cell proliferation, migration, and invasion.\\u003c/p\\u003e \\u003cp\\u003eTo investigate the role of ATP6AP1 in the development and progression of BRCA, we initially assessed the expression of ATP6AP1 in BRCA cells. Subsequently, we used Western blot to validate the efficacy of transfecting sh1-ATP6AP1, sh2-ATP6AP1, and sh3-ATP6AP1. The results indicated that sh3-ATP6AP1 demonstrated a statistically significant difference compared to the control group and exhibited the highest knockdown efficiency (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). Based on these findings, we selected MDA-MB-231 and MCF7 cells with stable sh3-ATP6AP1 knockdown for subsequent functional experiments.\\u003c/p\\u003e \\u003cp\\u003eCell proliferation was assessed by colony formation assay. The results showed that, compared to the control group, cells in the sh3-ATP6AP1 group exhibited significantly reduced viability (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB), indicating that the knockdown of ATP6AP1 significantly inhibited the proliferative capacity of BRCA cells.\\u003c/p\\u003e \\u003cp\\u003eTo investigate the effect of ATP6AP1 on BRCA metastasis, we performed wound healing assays in MDA-MB-231 and MCF7 cells to assess cell migration capacity. The results showed that, compared to the control group, the wound healing ability in the sh-ATP6AP1 group was significantly inhibited (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003eInvasive capacity of MDA-MB-231 and MCF7 cells was assessed using Transwell assays. The results showed that the sh1-ATP6AP1 group significantly inhibited cellular invasion (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003eSubsequent EdU assays further validated BRCA cell proliferation, revealinga significant decrease in the proliferation capacity of the sh3-ATP6AP1 group compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). This indicates that ATP6AP1 knockdown significantly inhibited BRCA cell proliferation.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eKEGG/GO functional enrichment and drug sensitivity analysis.\\u003c/p\\u003e \\u003cp\\u003eKEGG pathway enrichment analysis of ATP6AP1-associated genes revealed that pathways such as autophagy were the most enriched (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Furthermore, Gene Ontology (GO) analysis of ATP6AP1-associated genes showed significant enrichment in biological processes including vesicle maturation, proton transmembrane transport, and synaptic vesicle lumen acidification (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Significant enrichment in cellular components was observed for processes such as the proton transport V-type ATPase complex, proton transport by dual-sector ATP synthase complex, and ATPase complex (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). In molecular functions, processes related to ATPase activity, ion transmembrane movement, and ATPase activation were significantly enriched (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003eDrug sensitivity analysis revealed potential correlations between ATP6AP1 expression levels and its sensitivity to chemotherapeutic agents across 60 human cancer cell lines (NCI-60). ATP6AP1 was found to be associated with sensitivity to various anti-cancer drugs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Specifically, ATP6AP1 showed strong correlations with sensitivity to Pralatrexate (cor\\u0026thinsp;=\\u0026thinsp;0.32, p\\u0026thinsp;=\\u0026thinsp;0.011), Nitazoxanide (cor\\u0026thinsp;=\\u0026thinsp;0.35, p\\u0026thinsp;=\\u0026thinsp;0.007), Hydrastinine HCl (cor\\u0026thinsp;=\\u0026thinsp;0.37, p\\u0026thinsp;=\\u0026thinsp;0.003), GW-5074 (cor\\u0026thinsp;=\\u0026thinsp;0.31, p\\u0026thinsp;=\\u0026thinsp;0.016), XL-147 (cor\\u0026thinsp;=\\u0026thinsp;0.35, p\\u0026thinsp;=\\u0026thinsp;0.005), OSI-027 (cor\\u0026thinsp;=\\u0026thinsp;0.4, p\\u0026thinsp;=\\u0026thinsp;0.001), and Quizartinib (cor\\u0026thinsp;=\\u0026thinsp;0.41, p\\u0026thinsp;=\\u0026thinsp;0.001).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eAll experimental results were repeated more than three times and are expressedas mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. Significance analysis between two groups was performed using a t-test. Analysis of variance (ANOVA) was primarily used for the analysis of multiple group data, and chi-square tests were applied for categorical data. All statistical graphs of the experimental data were generated using Graphpad Prism (version 9.0). A p-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eStratified treatment of BRCA can significantly improve patient survival rates. However, poor treatment outcomes and adverse prognoses are common characteristics of advanced BRCA. Early distant micro-metastasis is one of the significant causes. Furthermore, ongoing genetic alterations within advanced cancer cells considerably enhance their potential for drug resistance to chemotherapy and immunotherapy, leading to unfavorable prognoses in approximately 30% of breast cancer patients after systemic treatment\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR15\\\" citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e. The ability of cells to rapidly adapt to diverse environmental changes and stimuli by controlling mRNA translation during gene expression has been demonstrated in numerous studies, posing a significant challenge for BRCA treatment\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, identifying coregenes involved in these changes is crucial for understanding the cancer progression process and improving the survival rates of BRCA patients.\\u003c/p\\u003e \\u003cp\\u003eATP6AP1, also known as Ac45, is involved in the V-ATPase complex, where it regulates the binding of subunits to phospholipids, thereby promoting the formation of the V-ATPase complex\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e. Previous studies have found that it can regulate pH and plays an important role in maintaining the acidic environment of cellular lysosomes\\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e. Its mutations are not only associated with various benign diseases but are also highly correlated with the occurrence and development of tumors. For instance, one study discovered that ATP6AP1 expression is significantly elevated in colorectal cancer and is associated with clinical pathological features\\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e. Further mechanistic analysis revealed that abnormal ATP6AP1 in colorectal cancer is typically linked to the infiltration of immune cellsand cancer-associated fibroblasts. Moreover, a high ATP6AP1 expression group showed a significant enrichment of cytoplasmic vesicular lumens, endopeptidase regulator activity, and endopeptidase inhibitor activity. Another study found thatthe anti-tumor effect in malignant granular cell tumors might be due to the functional loss of ATP6AP1/2 genes\\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e. These findings collectively suggest that ATP6AP1 may not only participate in the invasion and metastasis of BRCA but also influence the treatment response in BRCA.\\u003c/p\\u003e \\u003cp\\u003eResearchers have long identified geographical economics, hormones, obesity, and race as contributing factors to BRCA\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR24\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]\\u003c/sup\\u003e. In this study, we investigated the potential role of ATP6AP1 in the clinical treatment of BRCA. Analysis using multiple bioinformatics databases revealed that ATP6AP1 expression was significantly higher in both BRCA patient tissues and BRCA cells compared tonormal tissue cells. Further investigation indicated that patients with higher ATP6AP1 expression had a poorer prognosis. The relationship between abnormal gene expression and the clinical pathological characteristics of tumor patients has been demonstrated in numerous studies\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR27 CR28\\\" citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]\\u003c/sup\\u003e. In this study, to further explorethe relationship between ATP6AP1 expression and clinical pathological features,we downloaded clinical pathological characteristic information from bioinformatics databases and analyzed the correlation. The results showed that high ATP6AP1 expression was highly correlated with lymph node metastasis in BRCA patients, suggesting that patients with elevated ATP6AP1 expression may already have lymph node involvement. Therefore, developing multidisciplinary, multi-modal combined treatments based on the number of affected lymph nodes in advanced BRCA patients is crucial. These experimental results indicate that ATP6AP1 can serve as a prognostic and stratification marker for BRCA patients, providing a theoretical basis for developing personalized treatment plans.\\u003c/p\\u003e \\u003cp\\u003eTo deeply explore the specific mechanisms of ATP6AP1 in BRCA, this study identified and performed enrichment analysis of genes highly correlated with ATP6AP1. The results showed that ATP6AP1 protein may participate in regulating biological processes such as vesicle maturation, proton transmembrane transport, and synaptic vesicle acidification. Furthermore, we found that it not only participates in the assembly of the V-ATPase complex but may also be involved in the activation of ATPase; However, detailed functions and mechanisms require further experimental validation. Drug resistance to chemotherapeutic agents in advanced BRCA patients significantly limits treatment efficacy and is a major cause of poor patient prognosis\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR31\\\" citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]\\u003c/sup\\u003e. Previous reports have indicated that ATP6AP1 may be involved in tamoxifen and doxorubicin resistance in BRCA patients, but the specific detailed mechanisms remain unclear\\u003csup\\u003e[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]\\u003c/sup\\u003e. To further identify resistance mechanisms and effective drugs, we performed a bulk analysis of several commonly used drugs. The results showed that Pralatrexate, Nitazoxanide, Hydrastinine HCl, GW-5074, XL-147, OSI-027, and Quizartinib exhibited significant sensitivity in cells with high ATP6AP1 expression. Among these, Pralatrexate, a novel dihydrofolate reductase inhibitor, is widely used in the treatment of peripheral T-cell lymphoma. Whether its mechanism is also involved in the anti-tumor drug resistance response in BRCA patients requires further in-depth study\\u003csup\\u003e[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]\\u003c/sup\\u003e. Additionally, XL-147 and OSI-027 are widely used in clinical anti-tumor therapy, primarily exerting their effects by inhibiting the PI3K and mTOR pathways, which may explain why BRCA responds to these drugs\\u003csup\\u003e[\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]\\u003c/sup\\u003e. Quizartinib, a selective type II second-generation FLT3 inhibitor, has been applied in the clinical treatment of acute myeloid leukemia but has not been tested in solid tumors, presenting a potential therapeutic avenue for BRCA.The aforementioned studies all indicate that ATP6AP1 can regulate BRCA invasion and metastasis, exert a pro-tumorigenic role in BRCA, and thus can serve as an inhibitor for BRCA, potentially representing a therapeutic target for BRCA.\\u003c/p\\u003e \\u003cp\\u003eIn summary, we investigated the potential relationship between ATP6AP1 expression and clinical pathological characteristics in BRCA, and deeply explored its function and mechanism in BRCA proliferation, migration, and metastasis. The results of this study indicate that elevated ATP6AP1 plays a crucial role in BRCA cell growth and metastasis. Furthermore, as an important component of the V-ATPase complex, ATP6AP1 holds significant potential for drug development. Clinically, ATP6AP1 may serve as one of the important indicators for stratified treatment of BRCA patients, providing a theoretical basis for formulating personalized diagnosis and treatment plans.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and analysed during the current study available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAUTHOR CONTRIBUTION\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHe Li conceived and designed the study. He Li analyzed the data and wrote the manuscript.Tao Ke and Xuefeng Gu carried out the major experiments. Tianwei Qian performed statistical analysis of the experimental data. Kail\\u0026uuml; Sun contributed to data collection and statistical analysis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eClinical trial registration\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable. This study did not involve human participants or clinical interventions.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval, Consent to Participate, and Consent to Publish\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable. This study exclusively utilized established human cell lines, without involvement of human subjects, animal models, or clinical specimens.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Science and Technology Program of the Changshu Health Commission, Jiangsu Province, China (SUBSIDIZE NUMBER:CSWS202109).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDECLARATION OF INTERESTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eTAO X, LI T, GANDOMKAR Z, et al. Incidence, mortality, survival, and disease burden of breast cancer in China compared to other developed countries. [J]. Asia-Pac J Clin Oncol. 2023;19(6):645\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCAO W, CHEN H, YU Y, et al. Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. [J] Chin Med J. 2021;134(7):783\\u0026ndash;91.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLI Y, ZHAO X, LIU Q, et al. Bioinformatics reveal macrophages marker genes signature in breast cancer to predict prognosis. [J] Annals Med. 2021;53(1):1019\\u0026ndash;31.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKOREN S, BENTIRES-ALJ M. Breast Tumor Heterogeneity: Source of Fitness, Hurdle for Therapy. [J] Mol cell. 2015;60(4):537\\u0026ndash;46.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXU Q, CHEN S, HU Y, et al. Landscape of Immune Microenvironment Under Immune Cell Infiltration Pattern in Breast Cancer. [J]. Front Immunol. 2021;12:711433.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDIMITROV B, HIMMELREICH N, HIPGRAVE EDERVEEN A L, et al. Cutis laxa, exocrine pancreatic insufficiency and altered cellular metabolomics as additional symptoms in a new patient with ATP6AP1-CDG. [J]. Mol Genet Metab. 2018;123(3):364\\u0026ndash;74.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGUMM A J, BASEL D G, THAKRAR P, et al. Liver failure and x-linkedimmunodeficiency type 47. [J] Pediatr transplantation. 2020;24(8):e13808.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTVINA A, THOMSEN A. Prenatal and postnatal phenotypeof a pathologic variant in the ATP6AP1 gene. [J]. Eur J Med Genet. 2020;63(6):103881.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJANSEN E J R, TIMAL S. ATP6AP1 deficiency causes an immunodeficiency with hepatopathy, cognitive impairment and abnormal protein glycosylation. [J] Nat Commun. 2016;7:11600.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTIAN Y, GAO M, HUANG L, et al. ATP6AP1 is a potential prognostic biomarker and is associated with iron metabolism in breast cancer. [J]. Front Genet. 2022;13:958290.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLI A, LIAO B, WU K et al. SSR4 Promote Gastric Cancer Progression by Regulating Mitochondrial Oxidative Phosphorylation via NDUFB11 and ATP6AP1. [J]. Molecular carcinogenesis, 2025.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePAREJA F, BRANDES A H, BASILI T, et al. Loss-of-function mutations in ATP6AP1 and ATP6AP2 in granular cell tumors. [J] Nat Commun. 2018;9(1):3533.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWANG Z, JENSEN M A, ZENKLUSEN JC. A Practical Guide to The Cancer Genome Atlas (TCGA). [J]. Methods in molecular biology. (Clifton N J). 2016;1418:111\\u0026ndash;41.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXIONG X, DING ZHENGL. Breast cancer: pathogenesis and treatments. [J] Signal Transduct Target therapy. 2025;10(1):49.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePISANI P, BRAY F, PARKIN DM. Estimates of the world-wide prevalence of cancer for 25 sites in the adult population. [J]. Int J Cancer. 2002;97(1):72\\u0026ndash;81.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGONZALEZ-ANGULO A M, MORALES-VASQUEZ F, HORTOBAGYI GN. Overview of resistance to systemic therapy in patients with breast cancer. [J]. Adv Exp Med Biol. 2007;608:1\\u0026ndash;22.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePAPADOPOLI LEELJ, JEWER D. Cancer Plasticity: The Role of mRNATranslation. [J] Trends cancer. 2021;7(2):134\\u0026ndash;45.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWANG L, WU D, ROBINSON C V, et al. Structures of a Complete Human V-ATPase Reveal Mechanisms of Its Assembly. [J] Mol cell. 2020;80(3):501\\u0026ndash;11.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSANTOS-PEREIRA C, RODRIGUES L R, C\\u0026Ocirc;RTE-REAL M. Emerging insights on the role of V-ATPase in human diseases: Therapeutic challenges and opportunities. [J] Med Res reviews. 2021;41(4):1927\\u0026ndash;64.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVASANTHAKUMAR T, RUBINSTEIN JL. Structure and Roles of V-typeATPases,[J]. Trends Biochem Sci. 2020;45(4):295\\u0026ndash;307.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZHANG S, WANG Y, ZHANG X, et al. ATP6AP1 as a potential prognostic biomarker in CRC by comprehensive analysis and verification. [J] Sci Rep. 2024;14(1):4018.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTORRADO C, CAMA\\u0026Ntilde;O M, HINDI N et al. Antiangiogenics Malignant GranularCell Tumors: Rev Literature [J] Cancers, 2023,15(21).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLEE JE. Diet Before and After Breast Cancer. [J]. Adv Exp Med Biol. 2021;1187:545\\u0026ndash;66.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBARNARD M E, BOEKE C E. TAMIMI R M. Established breast cancer risk factorsand risk of intrinsic tumor subtypes. [J]. Biochim Biophys Acta. 2015;1856(1):73\\u0026ndash;85.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHURSON A N, AHEARN T U KOKAH, et al. Risk factors for breast cancer subtypes by race and ethnicity: a scoping review. [J]. J Natl Cancer Inst. 2024;116(12):1992\\u0026ndash;2002.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eANG C S, SUN M Y, HUITZIL-MELENDEZ D F, et al. c-MET and HGF mRNA expression in hepatocellular carcinoma: correlation with clinicopathological features and survival. [J] Anticancer Res. 2013;33(8):3241\\u0026ndash;5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWAHAB R, GOPALAN V, ISLAM F, et al. Expression of GAEC1 mRNA and protein and its association with clinical and pathological parameters of patients with colorectal adenocarcinoma. [J]. Exp Mol Pathol. 2018;104(1):71\\u0026ndash;5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFAN X, ZOU X, LIU C, et al. Identify miRNA-mRNA regulation pairs to explore potential pathogenesis of lung adenocarcinoma. [J] Aging. 2022;14(20):8357\\u0026ndash;73.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMOAZZEZY N, EBRAHIMI F, SISAKHT MM, et al. Relationship between erb-B2 mRNA Expression in Blood and Tissue of Invasive Ductal Carcinoma Breast Cancer Patients and Clinicopathological Characteristics of the Tumors. [J]. Asian Pac J cancer prevention: APJCP. 2016;17(1):249\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWU G, XIAO M. Drug resistance in breast cancer: Mechanisms and strategies for management. [J]. Drug Resist updates: reviews commentaries Antimicrob anticancer Chemother. 2025;83:101288.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLIU S, ZHANG X, WANG W, et al. Metabolic reprogramming and therapeutic resistance in primary and metastatic breast cancer. [J]. Mol Cancer. 2024;23(1):261.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKHAN M M, YALAMARTY S S K, RAJMALANI B A, et al. Recent strategies to overcome breast cancer resistance. [J]. Crit Rev Oncol/Hematol. 2024;197:104351.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYAN Z, HUANG A, MA D, et al. ATP6AP1 promotes cell proliferation and tamoxifen resistance in luminal breast cancer by inducing autophagy. [J] Cell death disease. 2025;16(1):201.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFEI Y, YAN X, LIANG M, et al. Lysosomal gene ATP6AP1 promotes doxorubicin resistance via up-regulating autophagic flux in breast cancer. [J]. Cancer Cell Int. 2024;24(1):394.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eALTıNAY S, KURAL A, \\u0026Ouml;ZMEN A, et al. Pralatrexate for Peripheral T-Cell Lymphoma (PTCL): Chance Only Supports The Prepared Mind. [J]. Anti-cancer Agents Med Chem. 2023;23(3):298\\u0026ndash;305.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eO'CONNOR O A PROB, PINTER-BROWN L, et al. Pralatrexate in patients with relapsed or refractory peripheral T-cell lymphoma: results from the pivotal PROPEL study[J]. J Clin oncology: official J Am Soc Clin Oncol. 2011;29(9):1182\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZHU K, WU Y, HE P et al. PI3K/AKT/mTOR-Targeted Therapy for Breast Cancer[J]. Cells, 2022,11(16).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYANG J, NIE J, MA X, et al. Targeting PI3K in cancer: mechanisms and advances in clinical trials. [J]. Mol Cancer. 2019;18(1):26.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"ATP6AP1, BRCA, Migration, Drug sensitivity\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8734268/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8734268/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eBreast cancer (BRCA) remains one of the most prevalent malignancies affecting women globally. Despite significant advancements in diagnostic tools and therapeutic strategies, the marked heterogeneity of BRCA leads to considerable variability in patient prognosis. ATP6AP1, functioning as a subunit of the V-ATPase (vacuolar-type H+-ATPase), is a transmembrane protein crucial for the assembly and regulation of this proton pump. To elucidate the role of ATP6AP1 in BRCA, we conducted an in-depth analysis of multiple public databases. This investigation aimed to establish correlations between ATP6AP1 expression and clinicopathological features, alongside performing survival prognostic analyses. The expression levels of ATP6AP1 in breast cancer tissues and cell lines were subsequently validated using quantitative reverse transcription polymerase chain reaction (qrt-PCR), Western blotting, and immunohistochemistry (IHC). Further experiments, including clone formation, scratch, Transwell migration/invasion assays, and EdU proliferation assays, were employed to assess the impact of ATP6AP1 on cancer cell proliferation, migration, and invasion. Additionally, the relationship between ATP6AP1 and drug sensitivity was predicted using the CellMiner database. Our overarching goal was to delineate the potential functions of ATP6AP1 in BRCA and to understand its implications for drug responsiveness. We observed significantly elevated ATP6AP1 expression in BRCA tissues and cell lines, which strongly correlated with poor patient prognosis. Crucially, the knockdown of ATP6AP1 markedly suppressed the viability and proliferative capacity of BRCA cells. In conclusion, ATP6AP1 emerges as a prognostic biomarker for BRCA and represents a promising therapeutic target.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Investigating the Role of ATP6AP1 in Modulating Breast Cancer Proliferation, Migration, and Drug Sensitivity\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-02-17 14:55:31\",\"doi\":\"10.21203/rs.3.rs-8734268/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"8215ef50-671b-4f84-bcca-6908b12b582d\",\"owner\":[],\"postedDate\":\"February 17th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-03-23T06:11:10+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-02-17 14:55:31\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8734268\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8734268\",\"identity\":\"rs-8734268\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}