{"paper_id":"4d17d7d6-7d30-442c-87d2-8676c31c65b8","body_text":"Putative trehalose biosynthesis proteins function as differential floridoside-6-phosphate synthases to participate in the abiotic stress response in the red alga Pyropia haitanensis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Putative trehalose biosynthesis proteins function as differential floridoside-6-phosphate synthases to participate in the abiotic stress response in the red alga Pyropia haitanensis Minxiu Sun, Zhujun Zhu, Juanjuan Chen, Rui Yang, Qijun Luo, Wei Wu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.10286/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Jul, 2019 Read the published version in BMC Plant Biology → Version 1 posted 10 You are reading this latest preprint version Abstract Background The heteroside floridoside is a primary photosynthetic product that is known to contribute to osmotic acclimation in almost all orders of Rhodophyta. However, the encoding genes and enzymes responsible for the synthesis of floridoside and its isomeric form, l- or d-isofloridoside, are poorly studied. Results Here, four putative trehalose-6-phosphate synthase (TPS) genes, designated as PhTPS1, PhTPS2, PhTPS3, and PhTPS4, were cloned and characterized from the red alga Pyropia haitanensis (Bangiophyceae). The deduced amino acid sequence is similar to the annotated TPS proteins of other organisms, especially the UDP-galactose substrate binding sites of PhTPS1, 2, which are highly conserved. Of these, PhTPS1, 4 are involved in the biosynthesis of floridoside and isofloridoside, with isofloridoside being the main product. PhTPS3 is an isofloridoside phosphate synthase, while PhTPS2 exhibits no activity. When challenged by desiccation, high temperature, and salt stress, PhTPS members were expressed to different degrees, but the responses to thermal stress and desiccation were stronger. Conclusions Thus, in P. haitanensis, PhTPSs encode the enzymatical activity of floridoside and isofloridoside phosphate synthase and are crucial for the abiotic stress defense response. Plant Physiology and Morphology Pyropia haitanensis (Iso)floridoside Trehalose-6-phosphate synthase Floridoside-6-phosphate synthase Abiotic stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Red algae, which are ancient and highly populous eukaryotes, are widely distributed in coastal and continental areas from the tropics to the poles [1]. During photosynthesis, red algae fix inorganic carbon via the common plant enzyme ribulose-bisphosphate-carboxylase/oxygenase. However, the subsequent carbon flow into low-molecular-weight carbohydrates is much more diverse compared to other algal groups [2]. Galactosyl glycerol (GalG) is a low-molecular-weight carbohydrate that is the primary and most common soluble photosynthetic molecule in red algae. It is prevalent in the majority of Rhodophyta; for example, Cyanidiophyceae and Porphyridiophyceae only accumulate GalG [3], and its content in marine algae usually ranges from 1.5% to 8% on a dry-weight basis. GalG has three different structures, including floridoside [α-d-galactopyranosyl-(1, 2)-glycerol], d-isofloridoside, and l-isofloridoside. The biosynthesis of GalG has long interested researchers. Using classical radioisotopes, previous studies have shown that exogenous inorganic 14 C can be rapidly taken up and assimilated into floridoside [4], demonstrating that there must be enzymes that synthesize it. Marin et al . (1998) reported glucosyl-glycerol-phosphate synthase (GGPS) genes synthesizing similar compound-glucosyl-glycerol-phosphates in the cyanobacterium Synechocystis sp. [5]. The floridoside phosphate synthase (FPS) genes catalyzing the synthesis of (iso) floridosides were first reported by Pade et al . [6] They found two genes ( Gasu_26940 and Gasu_10960 ) in the red alga Galdieria sulphuraria that were annotated as trehalose 6-phosphate synthase (TPS)-like enzymes, but functioned as floridoside and isofloridoside phosphate synthase. However, among macroalgae, it remains unclear whether (iso)floridoside is synthesized by the same enzymes and pathway as in the unicellular G. sulphuraria . It is believed that floridoside biosynthesis involves the transfer of a galactosyl-unit from UDP-Gal to glycerol-3-phosphate (G3P). It is well known that isofloridoside has d- and l-isomeric forms and should thus be determined by the configuration of glycerol-3-phosphate [7]. The biosynthesis of floridoside and l-isofloridoside is initiated by a condensation reaction of l-glycerol-3-P and UDP-galactose, resulting in floridoside-P (sn-2) and l-isofloridoside-P (sn-1), respectively. These are subsequently de-phosphorylated by specific phosphatases. In both anabolic pathways, l-glycerol-3-P serves as a precursor, while d-glycerol-3-P should be the only source of sn-l glycerol-P (d-glycerol) in intermediary metabolism for the biosynthesis of d-isofloridoside. It is thus uncertain whether two floridoside phosphate synthases are sufficient to yield three structures of GalG-P or if more enzymes or multiple enzyme functions are required. Previous research revealed that the biosynthesis of trehalose and (iso)floridoside involves similar substrates and reaction mechanisms. The two genes ( Gasu_26940 and Gasu_10960 ) discovered by Pade et al . (2015) were initially annotated as TPS in the genome of G. sulphuraria . Using BlastP searches, several genes were also annotated as TPS in other red algae. For example, two putative TPS genes were screened out from the library of Pyropia yezoensis and Saccharina japonica (SjaTPS) by Deng et al . [8,9] and were even cloned in vitro. It was reported that Rhizoma salviae possesses key enzymes for synthesizing low-molecular-weight sugars, but functional studies were not able to verify if the enzyme with the gene annotated as TPS has the ability to synthesize trehalose [10]. Hence, due to the lack of information on FPS genes, it is likely that the annotation of many genes remains inaccurate at present, and it is thus necessary to explore more FPS genes by functionally verifying the genes annotated as TPS in red algae. The function of floridoside is similar to that of sucrose in higher plants. It is a stable and low-molecular-weight intermediate that serves as a dynamic carbon pool used by the cells as a carbon precursor in the biosynthesis of starch and cell wall polysaccharides [11]. Additionally, floridoside is accumulated at high amounts under stress conditions, such as high salinity, desiccation, and high temperature, and also functions in adjusting osmotic pressure, which is similar to trehalose in plants [12]. However, floridoside and isofloridoside have different functions. It was reported that floridoside acts as an osmoregulator in most red algae. Within Bangiales, floridoside is metabolically much more active than isofloridoside. Studies on the effects of salinity on the concentration of heterosides in Bangiales show that only floridoside plays an important role in osmotic acclimation, whereas the amount of isofloridoside remains almost unchanged [13,14]. Moreover, heteroside patterns in red algae vary according to the differences in biogeographic regions, species and seasons. These findings suggest that the enzyme activities for catalyzing the biosynthesis of (iso)floridoside or the expression of genes responsible for the enzymes may differ under different stresses, species, or even seasons. In order to elucidate the reason for the diversity of floridoside molecules in red algae, genes encoding the floridoside biosynthetic enzymes, their expression profiles, and the activities of these enzymes should be analyzed. In previous research on Pyropia haitanensis , and we found that the contents of floridoside and isofloridoside varied markedly under desiccation and high temperature stress[15]. However, the genes encoding (iso)floridoside biosynthetic enzymes remain unknown. Therefore, in this study, we retrieved four unigenes annotated as putative TPS-related genes from the transcriptome data of P. haitanensis . We attempted to identify these genes and evaluated their activity under different stresses to reveal their functions. Results Protein sequences and alignments Four putative trehalose-6-phosphate synthase genes from P. haitanensis were cloned and named as PhTPS1, PhTPS2, PhTPS3, and PhTPS4 . Their GenBank accession no. are KF147832.1, KM519457.1, KM519458.1, and KF245464.1, respectively. The open reading frames (ORFs) of PhTPS1–4 are 3462 bp, 4029 bp, 3324 bp, and 3024 bp in length and encode polypeptides of 1154 aa, 1343 aa,1108 aa, and 1008 aa, respectively (Fig. 1). The molecular weights of the PhTPS1 – 4 deduced amino acid sequences are 124, 145, 117, and 112 kDa, with a theoretical isoelectric point (pI) of 6.73, 6.05, 5.99, and 5.77, respectively. By searching in the NCBI Conserved Domain Search tool, two conserved structural domains named TPS domain (Glyco_transf_20) and TPP domain (Trehalose_PPase) were discovered in PhTPS1, PhTPS2, and PhTPS3 (Fig. 1). The TPS domain in the three PhTPS comprises the main length of the protein and is present near the N-terminal and is annotated as trehalose-6-phosphate synthase. The TPP domain annotated as trehalose-6-phosphate phosphatase (TPP domain) is located at the C-terminal, whereas in PhTPS4, with the exception of the two domains, there is a special domain named CBM20 at the N-terminal known to be involved in starch binding. Currently, only the crystal structures of Escherichia coli TPS (PDI No. 1GZ5) [17] and Candida albicans TPS (PDI No. 5HUT) [18] proteins have been elucidated. Here, we compared the data of these two proteins and used multiple sequence alignment to evaluate the TPS domains from different species and GGPS domain sequences from cyanobacteria. It was found that the TPS domains of PhTPS1–3 were homologous with the C. albicans TPS (PDI No. 5HUT) protein, with 53%, 50%, and 34% identity, respectively. However, PhTPS4 showed a low identity of only 10%. Based on the alignment, we found nine sites conserved with the UDP-glucose substrate binding sites, and four sites conserved with the glucose-6-phosphate binding sites (Additional file 1: Figure S1). Sites G157, D274, H298, R406, D505, M507, N508, L509, and E513 of PhTPS1, and sites G181, D410, H434, R542, D641, M643, N644, L645, and E649 of PhTPS2 were associated with the substrate UDP-glucose binding sites and are highly conserved, without any mutated sites. However, in the two proteins PhTPS3 and PhTPS4, there are three different sites. For example, in PhTPS3, D201, H225, and N441 are changed to N, Y, and S, respectively. In PhTPS4, the mutated sites are G198K, R464D, and M564L, but the other six sites (D328, H352, D562, N565, L566, E570) are conserved. For the substrate glucose-6-phosphate binding sites, only four sites in PhTPS1 (R136, Y213, W222, and R440) are highly conserved. In PhTPS2-4, site mutations were present, including Y247H and R580Q in PhTPS2, R63H and Y141F in PhTPS3, while R501 in PhTPS4 is deleted. In addition to the binding sites of the two substrates, multiple sequence alignment showed that the sequences of the four PhTPS members were highly similar to the highly conserved fragments (homology > 90%) of other species TPSs and cyanobacteria GGPSs. An insert fragment (309–397 aa) was found in PhTPS2. This insert was also found in P. yezoensis TPS-3 (contig_27879) (350–427 aa, with 48% identity with the PhTPS2 insertion fragment). No other species were detected. Phylogenetic analysis of trehalose-6-phosphate synthase in P. haitanensis . In this study, a phylogenetic tree of the fused protein from bacteria, fungi, algal, animals, and higher plants was constructed based on the TPS/TPP, TPS, and GGPS domain to investigate the evolutionary relationships among them (Fig. 2). Single domain TPS proteins were mainly located in the group of prokaryotic sequences. TPS/TPP fused proteins existed extensively. The tree is separated into two main clades. The TPSs of animals and some prokaryotes and the GGPSs of the cyanobacteria form one clade. In this clade, the special GGPSs are grouped at the end of a single branch. The TPSs of some prokaryotes, fungi, algae, and higher plants form another cluster. Prokaryotic fused TPS/TPP proteins are located between the single domain prokaryotic sequences and all of the eukaryotic sequences. The TPS genes of plants are divided into two very distant clades that belong to plant Class I enzymes and plant Class II enzymes. It is clear that the proteins from red algae are closely related to each other, but group in clusters; for example, P. yezoensis , Chondrus crispus , G. sulphuraria, and C yanidioschyzon merolae . PhTPS1 and 2 are close to the proteins of P. yezoensis (Contig 4636 and Contig 27879) with homologies of 81.28% and 72.3%. Four clusters, namely, PhTPS1–4 are dispersed along different branches instead of clustering together. The cluster including PhTPS1–2 is along the branch with plant Class I, and PhTPS3–4 is along the branch with plant Class II. PhTPS4 is relatively distant from the other three PhTPSs and is closely associated with Class II proteins. It forms a small cluster with some red and brown algae. Some TPS proteins containing the N-terminus CBM20 domain were noted. They are relatively close in the phylogenetic tree, involving proteins from red algae, diatoms, and brown alga ( S. japonica ); for example, P. umbilicalis (OSX79290.1, 85.84%), G. sulphuraria (EME31717.1, 48.05%), and C . merolae CM3596 (BAM80147.1, 41.25%) from Rhodophyta, S. japonica (AGT20052.1, 23.45%) from Phaeophyta, and Phaeodactylum tricornutum CCAP 1055/1 (XP_002180425.1, 28.36%) from Bacillariophyta, but are not found in the TPS genes of other species. The phylogenetic tree of the only TPS and TPP domain were also constructed, respectively (Additional file 2: Figure S2A, B). It could be found that the phylogenetic tree for only TPS domain is nearly the same as that of TPS/TPP. While, the phylogenetic tree for only TPP domain is different from that of TPS/TPP. Instead of forming two large clades, all clades branched from the root and the clades position changed. For example, the PhTPP domains are divided into three clades. The clades of PhTPP 1 and PhTPP 3 are separated by plant Class I. Among them, the cluster of red alga including PhTPP 1and plant Class I to form a clade. Besides, the species of each small clade is basically the same. Expression and enzymatic function of PhTPS1–4 proteins. To verify the function of four proteins from P. haitanensis PhTPS1–4, we expressed their TPS domain by E. coli and separated the purified proteins by SDS-PAGE. We observed bands in the position of the corresponding molecular weight (PhTPS1, 77.9 kDa; PhTPS2, 82.3 kDa; PhTPS3, 65.4 kDa; PhTPS4, 75.9 kDa). To confirm the expression, four recombinant His-tagged proteins were confirmed by Western blotting using an anti-His-tag-antibody (Fig. 3). To detect the biochemical activity of PhTPS1–4, UDP-Gal and G3P were allowed to react with them, and the resulting products were respectively analyzed (Fig. 4). First, the retention times of the two purified standards, floridoside (retention time = 20.83 min) and isofloridoside (retention time = 26.14 min), were obtained and identified using the [M-H] − ions at m/z 253.0925 by HPLC-MS. In MS/MS spectra, the characteristic fragment ion at m/z 89.02 and 119.03 from [M-H] − ions were also utilized for qualitative analysis of floridoside and isofloridoside [16]. It was found that the reaction products floridoside and isofloridoside were generated which were catalyzed by PhTPS1 and PhTPS4 using HPLC-MS. While catalyzing by PhTPS3, only the isofloridoside was produced. However, the floridoside and isofloridoside were not detected after catalyzing by PhTPS2. Quantitative analysis of the catalytic products of PhTPS1, PhTPS3, and PhTPS4 showed that the conversion ratios of the four enzymes were all low. The enzyme activities of PhTPS1 and PhTPS4 producing floridoside were 0.26 and 0.22 μmol·h −1 ·mg −1 , respectively. The enzyme activities of PhTPS1 and PhTPS4 producing isofloridoside were 0.50 and 0.61 μmol·h −1 ·mg −1 , respectively. The enzyme activity of PhTPS3 was 0.23 μmol·h −1 ·mg −1 , and only the isofloridoside was biosynthesized (Table 3). Expression of PhTPS1 – 4 under different abiotic stimuli The expression of four PhTPS genes was analyzed under desiccation, high temperature, and different salinity treatments (Fig. 5). Following 35°C high temperature stress treatment for 30 min, the expression of PhTPS1–4 was significantly increased. The increase in PhTPS3 and PhTPS4 was the most obvious, reaching 20.5- and 26.6-fold ( P < 0.01) that of the control, followed by PhTPS1 , which was increased by 9.2-fold ( P < 0.01) that of the control. After recovery under normal temperature for 1 h following the thermal shock, the upregulation of PhTPS2, PhTPS3, and PhTPS4 was reduced, but the upregulation of PhTPS1 was significantly enhanced, reaching 11.5-fold that of the control. Compared with recovery for 1 h, recovery for 3 h did not elicit any major changes (Fig. 5A). During the first 1 h of desiccation, the expression of four PhTPSs increased significantly and remained at high levels throughout the process. Among them, PhTPS1 and PhTPS4 showed the strongest responses. When treated for 1 h, the increased expression multiple reached more than 30 times ( P < 0.01), and the expression level gradually decreased with the extension of desiccation time. However, the up-regulation of PhTPS2 and PhTPS3 was slightly weaker than that of PhTPS1 and PhTPS4 , and the up-regulation peaked at 2 h, but the up-regulation remained at around 5–12 fold of the control during the entire desiccation process (Fig. 5B). The expression of the PhTPS1–4 genes was examined when the P. haitanensis thalli were grown under different NaCl concentrations ranging from 500 mM to 1400 mM (Fig. 5C). Pyropia haitanensis is mainly grown in the East China sea, and the seaweed used in this study is from Xiangshan, China, where the salinity is 500 mM. Therefore, here we compare gene expression under different salinity stress concentrations with that under 500 mM NaCl as a control. According to the results, the expressions of four PhTPS genes varied under different salinity stresses, but their overall expression was not very high. Among them, PhTPS4 was most sensitive to changes in salinity, and under 700 mM NaCl, PhTPS4 showed slight salt-stimulated expression and was upregulated to 1.86-fold that of the 500 mM NaCl group ( P < 0.01). The levels of PhTPS1 , PhTPS3, and PhTPS4 were increased under 1400 mM NaCl stress, being 2.22-, 2.04-, and 2.16-fold higher than that of the 500 mM NaCl group ( P < 0.01). PhTPS3 and PhTPS4 all reacted relatively strongly at high salinity. PhTPS2 was not upregulated with the increase in salinity in comparison to the 500 mM NaCl group. The accumulation of (iso)floridoside in P. haitanensis under various NaCl concentrations ranged from 500 mM to 1400 mM for 1 h. LC–MS revealed that floridoside and isofloridoside all accumulated (Fig. 5D). The concentration of isofloridoside rose proportionally with the external NaCl from 500 mM to 700 mM ( P < 0.01), but decreased under highly hypersaline conditions. Floridoside plays a rather minor role as an osmolyte, because its change trend was the same as isofloridoside under salt stress and even decreased at a high salt concentration. Methods Materials Experiments were performed with gametophytic P. haitanensis HML collected at Hepu, Xiangshan Harbor, Zhejiang Province, China (29°09ʹ18″N, 121°54ʹ05″W). Young fronds were collected, dried in the shade, and stored at −20°C. Before experiments, the thalli were rehydrated with sterile seawater and then healthy samples were cultivated at 20°C for 24 h under 40 μmol photons m −2 s −1 with a 12 h:12 h (L:D) photoperiod. Total RNA isolation and cDNA synthesis The total RNA was isolated from P. haitanensis HML gametophytes with RNAisoPlus Reagent (TaKaRa Bio Inc., Otsu, Japan) according to the manufacturer’s protocol. The cDNA for the full-length sequence cloning and transcriptional analysis was synthetized by using SMARTer TM rapid amplification of cDNA ends (RACE) cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA, USA) and TaKaRa PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan) according to the instruction manual, respectively. Full-length cDNA cloning of PhTPS Based on the gametophyte transcriptome analysis of P. haitanensis (data not shown), four fragment sequences were annotated as trehalose-6-phosphate synthase genes ( PhTPS1–4 ). Gene-specific primers, indicated in Table 1, were designed to clone the complete open reading frame (ORF) of PhTPS1–4 using the 5ʹ- and 3ʹ-RACE method (SMART RACE cDNA Amplification Kit, Clontech). All of the PCR products were then cloned into the pMD18-T vector (TaKaRa, Dalian, China) for sequencing (Sangon Biotech, Shanghai, China). Analysis of PhTPS deduced amino acid sequences The ORF in PhTPS1–4 was analyzed using ORF Finder in the NCBI database. The theoretical molecular weights and pIs of the PhTPS1–4 deduced amino acid sequences were calculated by the Compute pI/Mw tool at https://web.expasy.org/compute_pi/ . The conserved structural domains were constructed in NCBI Conserved Domain Search. Multiple sequence alignment and phylogenetic tree construction Gene sequences annotated as trehalose-6-phosphate synthase from bacteria, algae, fungi, plants, and animals were retrieved and collected from a search in the NCBI database. Gene sequences annotated as glucosyl glycerol-phosphate synthase from cyanobacteria were also collected. The ORFs of all TPS and GGPS gene sequences were obtained in the NCBI ORF Finder and translated into amino acid sequences using MEGA 5.1.0 software. The conserved domains of all TPS and GGPS amino acid sequences were analyzed in NCBI Conserved Domain Search. Multiple sequence alignment of TPS and GGPS from different species was performed by Vector NTIAdvance 11.5.1 software with default parameters and then edited by GeneDoc software to show the function-related conserved sites in these sequences. Sequences of TPS, TPP, TPS/TPP and GGPS from different species were aligned using the ClustalW algorithm, and a phylogenetic tree was constructed using the neighbor-joining distance method with 1,000 bootstrap replicates. PRABI ( https://geno3d-prabi.ibcp.fr/cgi-bin/geno3d_automat.pl?page=/GENO3D/geno3d_home.html ) was used for PhTPS1–4 protein sequence homology alignment. Preparation of the recombinant TPS domain protein of PhTPS The primers shown in Table 2 were used to clone the TPS domain of PhTPS1–4. The PCR procedure was 95°C for 3 min; followed by 35 cycles of 95°C for 30 s, T m for 35 s, 72°C for 2 min, and then 72°C for 10 min. The amplicon was inserted into the commercial pET-28a (TaKaRa) vector or modified pET-28a-sumo vector, and then transformed into E. coli BL21. The expression of the target protein was induced in the presence of 0.1 mM isopropyl thio- β -galactoside at 20°C for 16–24 h. The cells were then harvested, lysed, and centrifuged. The purification of the target protein in the supernatant was operated successively by using the 6×His-Tagged Protein Purification Kit (Cwbio, Beijing, China) and the AKTAxpress TM system with a HiLoad TM 16/600 Superdex TM 200 pg column (GE-Healthcare, USA). The eluted protein solution (50 mM Tris/HCl, 200 mM NaCl, pH 8.0) was assessed by both 10% SDS-PAGE and Western blotting with the anti-His tag antibody (Sigma Aldrich). The E. coli with empty pET-28a or pET-28a-sumo vector was used as the negative control. Prior to the activity assay, the eluted protein solution was incubated with the sumo protease (More Biotech, China) to cut off the sumo-His tag, which was at the N-terminal of the target protein. The final working protein solution (50 mM Tris/HCl, 200 mM NaCl, pH 8.0) was obtained using a Ni-agarose column to remove the cleaved sumo-His tag and the sumo protease in the mixture. The target protein concentration in the final solution was determined by a Bio-Rad DC Protein Assay (Hercules, CA, USA) and 10% SDS-PAGE. Enzyme activity measurement The enzyme activity of the TPS domain of PhTPS1–4 was determined in 100 μL of working solution containing 10 mM MgSO 4 , 100 mM UDP-galactose (Sigma Aldrich, Taufkirchen, Germany), and 40 mM G3P (Sigma Aldrich) according to the method of Pade et al . [6] Reaction mixtures were incubated for 16 h at 30°C and then heated at 100°C for 5 min to terminate the reaction. The reaction mixture was then treated with 1 U of alkaline phosphatase (CIAP; Fermentas) for 2 h at 37°C to dephosphorylate the intermediate (iso)floridoside phosphate. After reaction, the mixed solution was extracted, purified, lyophilized, and re-dissolved in 200 μL methanol for HPLC–MS analysis. The enzyme activity corresponded to 1 μmol (iso)floridoside produced in 1 min by 1 mg of protein. HPLC–MS/MS analysis The reaction solution above was analyzed on an UltiMate TM 3000 HPLC system with a Q Exactive hybrid quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific, USA) using a Xbridge Amide column (100 mm × 3 mm, 3.5 μm, Waters) at 25°C. The constant solvent system was 90% acetonitrile (A)–10% water (10 mM CH 3 COONH 4 ). The flow rate was 0.3 mL min −1 for 35 min and the injection volume was 10 μL. The Q Exactive hybrid quadrupole-Orbitrap mass spectrometer was operated in the data dependent mode, automatically switching between full scan MS and MS/MS acquisition with electrospray ionization (ESI) in the negative ionization mode. The mass range was scanned from 50 to 600. The MS/MS parameters were set as follows: Automatic Gain Control (AGC) target 2 × 10 5 ; maximum ion time 120 ms; isolation width 4.0 m / z . The typical mass spectrometric conditions were: a sheath gas pressure (N 2 ) flow-rate, 25 L/min; auxiliary gas pressure (N 2 ) flow-rate, 5 Abs; spray voltage, 2.5 kV; vaporizer temperature, 300°C; and capillary temperature, 350°C; collision gas pressure, 1.5 mTorr. The quantification of (iso)floridoside was performed on a Finnigan Surveyor and TSQ Quantum Access system (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA), referring to Chen et al . [16]. The calibration curves for (iso)floridoside quantification were constructed with standard compounds extracted directly from P. haitanensis. Sample treatment All treatments were performed at a density of 500 mg thalli per 150 mL sterile seawater. For the desiccation treatment, the thalli were subjected to desiccation for 0, 1, 2, 3, and 4 h under 20°C, 100 μmol·photons·m −2 ·s −1 , and 75% humidity. For the high temperature stress treatment, the thalli were cultured at 35°C for 30 min and then transferred to 20°C to recover for 1 and 3 h. For the salt stress treatment, the thalli were cultured in medium supplemented with 500, 700, 100, and 1400 mM NaCl for 1 h under 20°C. All samples were collected, frozen rapidly in liquid nitrogen, and stored at −80°C for RNA isolation. Salt stress-treated samples were processed according to the method of Chen <em>et al</em>. [16] and analyzed by LC–MS.</p> Real-time quantitative (qRT) PCR analysis of PhTPS under different stresses The qRT-PCR analysis was performed with SYBR Premix Ex Taq (TaKaRa) on a Mastercycler EP realplex real-time PCR system (Eppendorf, Hamburg, Germany). The specific qRT-PCR primers for PhTPS1 – 4 are listed in Table 2. Ph18S was used as an internal reference gene. The PCR procedure was as follows: 95°C for 3 min; 40 cycles of 95°C for 10 s, Tm°C for 18 s, 72°C for 15 s, and a dissociation curve analysis to determine target specificity. All reactions were performed in triplicate. Relative gene quantification was performed using the comparative 2 -ΔΔCt method and normalized to Ph18S. Statistical analysis The data for the qRT-RCR results were obtained from at least three independent biological experiments. LC–MS analysis was performed in biological triplication and technical triplication for validation. Each treatment was evaluated using analysis of variance (ANOVA) in SPSS 22.0 (IBM Corp., Armonk, NY, USA). Comparisons among three groups were made using one-way ANOVA with Tukey’s multiple comparison tests. Declarations Acknowledgments We thank LetPub (www.letpub.com ) for its linguistic assistance during the preparation of this manuscript. Funding This work was funded by National Key R&D Program of China (2018YFD0900305) for collecting samples; NSFC (31872540, 41706170, 31772871) for analyzing data; National Science Foundation of Zhejiang (LY18C190004, LY17D060002) for analyzing data; Major Scientific and Technological Project of Zhejiang Province (2016C02055-6B) for culturing algae; China Agriculture Research System (CARS-50) for culturing algae; Zhejiang education department innovation team for providing instrument; Ningbo Programs for Science and Technology Development (2017C110026) for writing the manuscript; K.C. Wong Magna Fund in Ningbo University for providing instrument. Author’s contributions M.X.S performed the experiments; J.Z.Z analyzed the phylogenetic tree and multiple sequence alignment; J.J.C. performed most of the LC-MS detection and analyzed the data; R.Y. performed the physiological experiments; Q.J.L. collected the samples; W.W analyzed quantitative data; X.J.Y. supervised and complemented the writing; H.M.C. conceived the project and wrote the article. Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate Materials were collected from our experimental base at the coast of Xiangshan harbor in Zhejiang province, China. Sampling was permitted by the local government (Xiangshan County Government) and the local department of fisheries (Ningbo Ocean & Fishery Bureau). Consent for publication Not applicable Competing interests The authors declare that they have no competing interests. References 1. Liddle LB, Cole KM, Sheath RG. Biology of the red algae. BioScience.1991; 41(11):796‒7. 2.Eggert A, Karsten U. Low molecular weight carbohydrates in red algae–an ecophysiological and biochemical perspective. Red Algae in the Genomic Age. 2010;13:443‒56. 3.Luley-Goedl C, Nidetzky B. Glycosides as compatible solutes: biosynthesis and applications. Nat Prod Rep. 2011;28(5):875‒96. 4.Li SY, Shabtai Y, Arad S. Floridoside as a carbon precursor for the synthesis of cell-wall polysaccharide in the red microalga Porphyridium sp. (Rhodophyta). J Phycol. 2002;38(5):931‒8. 5.Marin K, Zuther E, Kerstan T, Kunert A, Hagemann M. The ggpS gene from Synechocystis sp. strain PCC 6803 encoding glucosyl-glycerol-phosphate synthase is involved in osmolyte synthesis. J Bacteriol. 1998;180(18):4843‒9. 6.Pade N, Linka N, Ruth W, Weber APM, Hagemann M. Floridoside and isofloridoside are synthesized by trehalose 6-phosphate synthase-like enzymes in the red alga Galdieria sulphuraria . New Phytol. 2015;205(3):1227‒38. 7.Meng JX, Rosell KG, Srivastava LM. Chemical characterization of floridosides from Porphyra perforata . Carbohyd Res. 1987;161(2):171‒80. 8.Deng DY, Zhao G, Xuan JS, Yang JL, Duan LD, Weng ML, Wang B. Construction and characterization of a bacterial artificial chromosome library of marine macroalga Porphyra yezoensis (Rhodophyta). Plant Mol Biol Rep. 2004;22(4):375‒86. 9.Deng YY, Wang XL, Guo H, Duan DL. A trehalose-6-phosphate synthase gene from Saccharina japonica (Laminariales, Phaeophyceae). Mol Biol Rep. 2013;41(1):529‒36. 10.Wang GL, Ge Z, Feng YB, Xuan JS, Sun JW, Guo BT, Jiang GY, Weng ML, Yao JT, Wang B. Cloning and comparative studies of seaweed trehalose-6-phosphate synthase genes. Mar Drugs. 2010;8(7):2065‒79. 11.Arad S, Levy-Ontman O. Red microalgal cell-wall polysaccharides: biotechnological aspects. Curr Opin Biotech. 2010;21(3):358‒64. 12.Barbier GG, Oesterhelt C, Larson MD, Halgren RG, Wilkerson CG, Garavito RM, Bening C, Weber, APM. Comparative genomics of two closely related unicellular thermo-acidophilic red algae, Galdieria sulphuraria and Cyanidioschyzon merolae , reveals the molecular basis of the metabolic flexibility of Galdieria sulphuraria and significant differences in carbohydratemetabolism of both algae. Plant Physiol. 2005;137(2):460‒74. 13.Kauss H, Jeblick W. Influence of free fatty acids, lysophosphatidylcholine, platelet-activating factor, acylcarnitine, and echinocandin B on 1,3-β-d-glucan synthase and callose synthesis. Plant Physiol. 1986;80(1):7‒13. 14.Ekman P, Yu SK, Pedersen M. Effects of altered salinity, darkness and algal nutrient status on floridoside and starch content, α-galactosidase activity and agar yield of cultivated Gracilaria sordida . British Phycol J. 1991;26(2):123‒31. 15.Lai XJ, Yang R, Luo QJ, Chen JJ, Chen HM, Yan XJ. Glycerol-3-phosphate metabolism plays a role in stress response in the red alga Pyropia haitanensis . J Phycol. 2015;51(2):321‒31. 16.Chen JJ, Song DD, Luo QJ, Mou T, Yang R, Chen HM, He S, Yan XJ. Determination of floridoside and isofloridoside in red algae by high-performance liquid chromatography–tandem mass spectrometry. Anal Lett. 2014;47(14):2307‒16. 17.Gibson RP, Turkenburg JP, Charnock SJ, Lloyd RM, Davies GJ. Insights into trehalose synthesis provided by the structure of the retaining glucosyltransferase OtsA. Chem Biol. 2002;9(12):1337‒46. 18.Miao Y, Tenor JL, Toffaletti DL, Maskarinec SA, Liu J, Lee RE, Perfect JR, Brennan RG. Structural and in vivo studies on trehalose-6-phosphate synthase from pathogenic fungi provide insights into its catalytic mechanism, biological necessity, and potential for novel antifungal drug design. Mbio 2017;8(4):e00643‒17. 19.Hagemann M, Pade N. Heterosides–compatible solutes occurring in prokaryotic and eukaryotic phototrophs. Plant Biol. 2015;17(5):927‒34. 20.Hideyuki N, Hachiro O, Saheye N, Kazutosi N. Physiological studies on floridean starch, floridoside and trehalose in a red alga, Serraticardia maxima . Bot Mag. 1969;82(978):462‒73. 21.Machovic M, Svensson B, Macgregor EA, Janecek S. A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21. FEBS J. 2005;272(21):5497‒513. 22.Christiansen CM, Hachem MA, Janecek S, Viksonielsen A, Blennow A, Svensson B. The carbohydrate-binding module family 20‒diversity, structure, and function. FEBS J. 2009;276(18):5006‒29. 23.Meng JX, Srivastava LM. Partial purification and characterization of floridoside phosphate synthase from Porphyra perforata . Phytochemistry. 1991;30(6):1763‒6. 24.Karsten U. Seasonal variation in heteroside concentrations of field‒collected Porphyra species (Rhodophyta) from different biogeographic regions. New Phytol. 1999;143(3):561‒71. 25.Avonce N, Wuyts J, Verschooten K, Vandesteene L, Dijck PV. The Cytophaga hutchinsonii ChTPSP: first characterized bifunctional TPS–TPP protein as putative ancestor of all eukaryotic trehalose biosynthesis proteins. Mol Biol Evol. 2010;27(2):359‒69. 26. Yu S, Pedersen M. The effect of salinity changes on the activity of α-galactosidase of the red algae Gracilaria sordida and G. tenuistipitata . Bot Mar. 1990;33(5):385‒91. 27.Reed RH, Collins JC, Russell G. The effects of salinity upon cellular volume of the marine red alga Porphyra purpurea (Roth) C.Ag. J Exp Bot. 1980;31(6):1521‒37. 28.Qian FJ, Luo QJ, Yang R, Zhu ZJ, Chen HM, Yan XJ. The littoral red alga Pyropia haitanensis uses rapid accumulation of floridoside as the desiccation acclimation strategy. J Appl Phycol. 2015;27(1):621‒32. Tables Table 1 PCR primers for the amplification and cloning of PhTPS1 – 4 . Primers Sequence (5’ → 3’) Restriction enzymes Tm ( °C ) PCR products PhTPS1 -ORF 5’ GGAATTC CATATG GACCTTCCATCCCTCAGCAGT NdeI 60.4 1758 bp PhTPS1 -ORF 3’ CCC AAGCTT CTA CATCGCCGTCACCAGTTC HindIII 60.4 PhTPS2 -ORF 5’ GGAATTC CATATG ACGGGTGACGGGCTGAAC NdeI 61.0 2196 bp PhTPS2 -ORF 3’ CCG CTCGAG TCA GGGCTGTGACTCCCATTC XhoI 62.0 PhTPS3 -ORF 5’ GGAATT CCATATG AGCCGCTCCTACAATCCC NdeI 57.3 1407 bp PhTPS3 -ORF 3’ CCC AAGCTT TCA CTTGGTGGATGAACGAA HindIII 56.7 PhTPS4 -ORF 5’ GGAATTC CATATG GACACGATGGACGGCTCTATG NdeI 60.3 1659 bp PhTPS4 -ORF 3’ CCG CTCGAG CTA ACCCACCTTGACAACCACC XhoI 60.9 The underlined bases indicate the restriction sites, and the red bases indicate the added stop codons. Table 2 The primers for qRT-PCR. Primers Sequence (5’ → 3’) Tm ( °C ) PCR products PhTPS1 -Q 5’ AGTTTCCGTTTGTGTGGGTG 58.0 132bp PhTPS1 -Q 3’ CCGTTGTAGTAGAGGTGGGC PhTPS2 -Q 5’ TGCTGGGGGTGGAAGGG 59.0 196bp PhTPS2 -Q 3’ GGGGAAGGGGGTGTGGAG PhTPS3 -Q 5’ CTGCCCACTCGTTTTCCA 57.0 142bp PhTPS3 -Q 3’ CCGGCTCAATTTCTTCCAG PhTPS4 -Q 5’ TGTATGATGGGGACCGAACG 58.0 184bp PhTPS4 -Q 3’ GCCACGGAATGTGAAGGAAG Ph18S -Q 5’ AGTTAGGGGATCGAAGACGA 55.0 153bp Ph18S -Q 3’ CAGCCTTGCGACCATACTC Table 3. Quantitative determination of PhTPS 1-4 catalytic products Enzyme Product (μM) Enzyme activity (μmol·h −1 ·mg −1 ) Floridoside Isofloridoside Floridoside Isofloridoside PhTPS1 142.8±18.5 275.1±17.2 0.26±0.02 0.50 ±0.02 PhTPS2 ND ND ND ND PhTPS3 ND 196.0±23.1 ND 0.23 ±0.03 PhTPS4 119.6±16.1 272.3±14.2 0.22 ±0.02 0.61 ±0.01 Note: ND, none detected. Additional file legend The following materials are available in the online version of this article. Additional file 1: Figure S1. Multiple sequence alignments of the deduced amino acid sequences of the trehalose-6-phosphate synthase (TPS) domains for PhTPSs with primary sequences of the TPS domains for other species and GGPS domains for cyanobacteria. The conserved residues are marked by a star. The accession numbers corresponding to the protein sequence of the different species can be searched in Table S1. * indicates glucose-6-phosphate binding sites, # indicates UDP-glucose binding sites. The light blue background indicates the unique cyanobacteria GGPS protein residues; the yellow frame indicates the low conserved residues of red algae, brown algae, and diatoms. The pink frame indicates the sequences of the four TPS members of P. haitanensis . (PDF 655 kb) Additional file 2: Figure S2. The phylogenetic tree of the only TPS and TPP protein are constructed, respectively. (A) A NJ tree was constructed to show the phylogenetic relationships of the TPS proteins using the functional-related amino acid sequences from prokaryotes, red algae, diatoms, brown algae, fungi, green algae, plants, and animals. (B) A NJ tree was constructed to show the phylogenetic relationships of the TPP proteins using the functional-related amino acid sequences from prokaryotes, red algae, diatoms, brown algae, fungi, green algae, plants, and animals. Their accession numbers are indicated in Table S1. There were 1,000 bootstrap replicates. The red triangle shows PhTPS1–4. The functional domain in each sequence was retrieved using the Conserved Domain tool in NCBI and is marked by a superscript. (PDF 295 kb) Additional file 3: Table S1 TPS and GGPS related genes and proteins in different organisms. (PDF 129 kb) Supplementary Files supplement1.pdf supplement2.pdf supplement3.pdf Cite Share Download PDF Status: Published Journal Publication published 19 Jul, 2019 Read the published version in BMC Plant Biology → Version 1 posted Editorial decision: Accept 08 Jul, 2019 Review # 2 received at journal 04 Jul, 2019 Review # 1 received at journal 04 Jul, 2019 Reviewer # 2 agreed at journal 20 Jun, 2019 Editor assigned by journal 14 Jun, 2019 Reviewers invited by journal 14 Jun, 2019 Reviewer # 1 agreed at journal 14 Jun, 2019 Submission checks completed at journal 12 Jun, 2019 Editor invited by journal 12 Jun, 2019 First submitted to journal 20 May, 2019 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-1315\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research article\",\"associatedPublications\":[],\"authors\":[{\"id\":96192,\"identity\":\"f8ea357c-942d-4d5d-8aa2-02d3e6b5b0ba\",\"order_by\":1,\"name\":\"Minxiu Sun\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYBAC+/PNBx8kVLDxsLE3EKvnxrFkgw9n+OT4eA4Qq+VAjprkzDY5YzmJBCJ1MDacYTbmOWOW2Cb5eOMNhhqbaIJamJl7Dz7mqUhLbJNOK7ZgOJaW20BICxvDuWSgLceAWnLMJBgbDhPWwsOQYybN2/Yf6LAzRGqRAGoBep/NmE2Ch0gtBhLgQGaTY+MB+iWBGL8Y8EOjUr798MYbH2psCGtBtTGBFOUQLaTqGAWjYBSMgpEBAMZcPrunsrp2AAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0001-5368-7019\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Minxiu\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":96193,\"identity\":\"e80fc73c-3f84-42dc-b090-0bd7614c41d0\",\"order_by\":2,\"name\":\"Zhujun Zhu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo Institute of Oceanography\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhujun\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"},{\"id\":96194,\"identity\":\"2626df87-9288-4cc5-a4cf-f56a186d998e\",\"order_by\":3,\"name\":\"Juanjuan Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Juanjuan\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":96195,\"identity\":\"c8383cc7-a930-450f-a2d3-53ddbabf34da\",\"order_by\":4,\"name\":\"Rui Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rui\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":96196,\"identity\":\"bb8ce907-8869-4115-9e21-7c7ed1f8e9b0\",\"order_by\":5,\"name\":\"Qijun Luo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qijun\",\"middleName\":\"\",\"lastName\":\"Luo\",\"suffix\":\"\"},{\"id\":96197,\"identity\":\"fb3b2584-71b1-4b76-b70b-cfd5687289af\",\"order_by\":6,\"name\":\"Wei Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wei\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":96198,\"identity\":\"5b6beac5-b159-4ff0-8042-8a3aacf903f6\",\"order_by\":7,\"name\":\"Xiaojun Yan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaojun\",\"middleName\":\"\",\"lastName\":\"Yan\",\"suffix\":\"\"},{\"id\":96199,\"identity\":\"a1f60f5a-447c-43ed-988b-b584cdd84617\",\"order_by\":8,\"name\":\"Haimin Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ningbo University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Haimin\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2019-06-12 14:07:45\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.2.10286/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.2.10286/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12870-019-1928-2\",\"type\":\"published\",\"date\":\"2019-07-19T12:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":2614171,\"identity\":\"aaec16a0-7bfd-4373-ab3e-7e99890a3c28\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":461139,\"visible\":true,\"origin\":\"\",\"legend\":\"Conserved domains in the P. haitanensis TPS family. The black bar indicates the amino acid sequence length of the complete ORF of PhTPS1–4; the red arrows on the bar indicate the recombinant expression region; the green, purple, and orange area on the bar show the CBM20, TPS, and TPP functional domains, respectively; the light pink area in the domains indicates that the related sequence segment had low homology with the conserved superfamily recorded in NCBI.\",\"description\":\"\",\"filename\":\"figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/figure_1.jpg\"},{\"id\":2614172,\"identity\":\"2efeb5b2-636a-4156-8397-6352b9ee9dda\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2290475,\"visible\":true,\"origin\":\"\",\"legend\":\"Phylogenetic analysis and structural evolution of TPS、TPS/TPP and GGPS proteins from different species. A NJ tree was constructed to show the phylogenetic relationships of the TPS、TPS/TPP and GGPS proteins using the functional-related full amino acid sequences from prokaryotes, red algae, diatoms, brown algae, fungi, green algae, plants, and animals. Their accession numbers are indicated in Table S1 (Additional file 3: Table S1). There were 1,000 bootstrap replicates. The red triangle shows PhTPS1–4. The functional domain in each sequence was retrieved using the Conserved Domain tool in NCBI and is marked by a superscript.\",\"description\":\"\",\"filename\":\"figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/figure_2.png\"},{\"id\":2614169,\"identity\":\"fa12d561-9cac-4567-a27d-aac83c3092ca\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1119358,\"visible\":true,\"origin\":\"\",\"legend\":\"Analysis of the reaction products of the in vitro translation of the TPS domain from PhTPS1–4 of P. haitanensis using the E. coli BL21 cells expression system by SDS-PAGE. A, Coomassie-stained gel. The arrows indicate proteins of the expected size for PhTPS1–4 (lane M, Maker; lane 1–4, PhTPS1–4, lane 5, negative control, with empty pET-28a or pET-28a-sumo vector). B, Translated proteins were analyzed by western blot using a His-tag-specific antibody.\",\"description\":\"\",\"filename\":\"figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/figure_3.jpg\"},{\"id\":2614173,\"identity\":\"6fe78f15-78bc-414d-ada1-e6481609d51d\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2247576,\"visible\":true,\"origin\":\"\",\"legend\":\"LC–MS analysis of the products catalyzed by PhTPS1–4. A, The synthetic pathway of (iso)floridoside, total ionization chromatogram (TIC), and MS/MS spectra of floridoside and isofloridoside standards. B, TIC of (iso)floridoside produced by PhTPS1–4 catalyzation. C, The breakage of (iso)floridoside and the PhTPS1, 3, 4-catalyzing MS/MS spectra of (iso)floridoside.\",\"description\":\"\",\"filename\":\"figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/figure_4.png\"},{\"id\":2614170,\"identity\":\"72312112-39f1-416e-9721-23e027259a91\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1446535,\"visible\":true,\"origin\":\"\",\"legend\":\"Effects of different abiotic stresses on the expression of PhTPS1–4 and content of (iso)floridoside. A, Relative expression of PhTPS1–4 under high temperature stress. The thalli of P. haitanensis were treated at 35°C for 30 min and subsequently allowed to recover at 20°C for 1 and 3 h. Control, P. haitanensis cultured in sterilized seawater at 20°C; −1/2, Samples exposed to 35°C for 30 min; 1 and 3 h for recovery time. Values denoted with different letters indicate significant differences according to Tukey’s multiple comparison tests. B, Relative expression of PhTPS1–4 under desiccation. The thalli of P. haitanensis were subjected to desiccation for 0, 1, 2, 3, and 4 h under 20°C, 100 μmol photons m−2 s−1, and 75% humidity. C, Relative expression of PhTPS1–4 under 500 to 1400 mM salt stress for 1 h under 20°C. D, Effect of salt stress on the production of (iso)floridoside in P. haitanensis. The thalli of P. haitanensis were cultured in medium supplemented with 500 to 1400 mM NaCl for 1 h under 20°C. The bars in Figure B, C, and D represent the mean of three biological replicates and three technical repetitions (n = 3), and the error bars depict one SD. One-way ANOVA, *P \\u003c 0.05, **P \\u003c 0.01 (relative to the control).\",\"description\":\"\",\"filename\":\"figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/figure_5.jpg\"},{\"id\":13467462,\"identity\":\"2af51d57-4e08-4329-9c72-0770ebedce9d\",\"added_by\":\"auto\",\"created_at\":\"2021-09-16 20:55:18\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1846455,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/45da17e2-f41c-4706-85dc-6a9db53f264e.pdf\"},{\"id\":2614175,\"identity\":\"189e54e0-b9b3-4363-be34-7a9e9038c9fd\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":133020,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplement1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/supplement_1.pdf\"},{\"id\":2614174,\"identity\":\"cccc30c1-a3f2-4adb-b099-39631e241439\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":287339,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplement2.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/supplement_2.pdf\"},{\"id\":2614177,\"identity\":\"a15999b2-2cdc-4de3-9ffb-7727bbd55850\",\"added_by\":\"399a65fa-c8d4-440b-992c-2804352e6ac3\",\"created_at\":\"2020-09-25 20:54:04\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":671725,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplement3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1315/v1/supplement_3.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Putative trehalose biosynthesis proteins function as differential floridoside-6-phosphate synthases to participate in the abiotic stress response in the red alga Pyropia haitanensis\",\"fulltext\":[{\"header\":\"Background\",\"content\":\" \\n\\u003cp\\u003eRed algae, which are ancient and highly populous eukaryotes, are widely distributed\\n in coastal and continental areas from the tropics to the poles [1]. During photosynthesis,\\n red algae fix inorganic carbon via the common plant enzyme ribulose-bisphosphate-carboxylase/oxygenase.\\n However, the subsequent carbon flow into low-molecular-weight carbohydrates is much\\n more diverse compared to other algal groups [2]. \\n Galactosyl glycerol (GalG) is a low-molecular-weight carbohydrate that is the primary\\n and most common soluble photosynthetic molecule in red algae. It is prevalent in the majority of Rhodophyta; for example, Cyanidiophyceae and Porphyridiophyceae\\n only accumulate GalG [3], and its content in marine algae usually ranges from 1.5%\\n to 8% on a dry-weight basis.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eGalG has three different structures, including floridoside [α-d-galactopyranosyl-(1, 2)-glycerol], d-isofloridoside, and l-isofloridoside. The biosynthesis of GalG has long interested researchers. Using classical radioisotopes,\\n previous studies have shown that exogenous inorganic \\u003csup\\u003e14\\u003c/sup\\u003eC can be rapidly taken up and assimilated into floridoside [4], demonstrating that\\n there must be enzymes that synthesize it. Marin \\u003cem\\u003eet al\\u003c/em\\u003e. (1998) reported glucosyl-glycerol-phosphate synthase (GGPS) genes synthesizing similar\\n compound-glucosyl-glycerol-phosphates in the cyanobacterium \\u003cem\\u003eSynechocystis \\u003c/em\\u003esp. [5]. The floridoside phosphate synthase (FPS) genes catalyzing the synthesis of\\n (iso) floridosides were first reported by Pade \\u003cem\\u003eet al\\u003c/em\\u003e. [6] They found two genes (\\u003cem\\u003eGasu_26940\\u003c/em\\u003e and \\u003cem\\u003eGasu_10960\\u003c/em\\u003e) in the red alga \\u003cem\\u003eGaldieria sulphuraria\\u003c/em\\u003e that were annotated as trehalose 6-phosphate synthase (TPS)-like enzymes, but functioned\\n as floridoside and isofloridoside phosphate synthase. However, among macroalgae, it\\n remains unclear whether (iso)floridoside is synthesized by the same enzymes and pathway\\n as in the unicellular \\u003cem\\u003eG. sulphuraria\\u003c/em\\u003e. It is believed that floridoside biosynthesis involves the transfer of a galactosyl-unit\\n from UDP-Gal to glycerol-3-phosphate (G3P). It is well known that isofloridoside has\\n d- and l-isomeric forms and should thus be determined by the configuration of glycerol-3-phosphate\\n [7]. The biosynthesis of floridoside and l-isofloridoside is initiated by a condensation reaction of l-glycerol-3-P and UDP-galactose, resulting in floridoside-P (sn-2) and l-isofloridoside-P (sn-1), respectively. These are subsequently de-phosphorylated by\\n specific phosphatases. In both anabolic pathways, l-glycerol-3-P serves as a precursor, while d-glycerol-3-P should be the only source of sn-l glycerol-P (d-glycerol) in intermediary metabolism for the biosynthesis of d-isofloridoside. It is thus uncertain whether two floridoside phosphate synthases\\n are sufficient to yield three structures of GalG-P or if more enzymes or multiple\\n enzyme functions are required.\\u003c/p\\u003e\\n \\n\\u003cp\\u003ePrevious research revealed that the biosynthesis of trehalose and (iso)floridoside\\n involves similar substrates and reaction mechanisms. The two genes (\\u003cem\\u003eGasu_26940\\u003c/em\\u003e and \\u003cem\\u003eGasu_10960\\u003c/em\\u003e) discovered by Pade \\u003cem\\u003eet al\\u003c/em\\u003e. (2015) were initially annotated as TPS in the genome of \\u003cem\\u003eG. sulphuraria\\u003c/em\\u003e. Using BlastP searches, several genes were also annotated as TPS in other red algae.\\n For example, two putative TPS genes were screened out from the library of \\u003cem\\u003ePyropia yezoensis\\u003c/em\\u003e and \\u003cem\\u003eSaccharina japonica\\u003c/em\\u003e (SjaTPS) by Deng \\u003cem\\u003eet al\\u003c/em\\u003e. [8,9] and were even cloned \\u003cem\\u003ein vitro.\\u003c/em\\u003e It was reported that \\u003cem\\u003eRhizoma salviae\\u003c/em\\u003e possesses key enzymes for synthesizing low-molecular-weight sugars, but functional\\n studies were not able to verify if the enzyme with the gene annotated as TPS has the\\n ability to synthesize trehalose [10]. Hence, due to the lack of information on FPS\\n genes, it is likely that the annotation of many genes remains inaccurate at present,\\n and it is thus necessary to explore more FPS genes by functionally verifying the genes\\n annotated as TPS in red algae.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eThe function of floridoside is similar to that of sucrose in higher plants. It is\\n a stable and low-molecular-weight intermediate that serves as a dynamic carbon pool\\n used by the cells as a carbon precursor in the biosynthesis of starch and cell wall\\n polysaccharides [11]. Additionally, floridoside is accumulated at high amounts under stress conditions, such as high salinity, desiccation, and high temperature, and also functions in adjusting\\n osmotic pressure, which is similar to trehalose in plants [12]. However, floridoside\\n and isofloridoside have different functions. It was reported that floridoside acts\\n as an osmoregulator in most red algae. Within Bangiales, floridoside is metabolically\\n much more active than isofloridoside. Studies on the effects of salinity on the concentration\\n of heterosides in Bangiales show that only floridoside plays an important role in\\n osmotic acclimation, whereas the amount of isofloridoside remains almost unchanged\\n [13,14]. \\n Moreover, heteroside patterns in red algae vary according to the differences in biogeographic\\n regions, species and seasons. These findings suggest that the enzyme activities for catalyzing the biosynthesis\\n of (iso)floridoside or the expression of genes responsible for the enzymes may differ under different\\n stresses, species, or even seasons. \\n In order to elucidate the reason for the diversity of floridoside molecules in red\\n algae, genes encoding the floridoside biosynthetic enzymes, their expression profiles,\\n and the activities of these enzymes should be analyzed.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eIn previous research on \\u003cem\\u003ePyropia haitanensis\\u003c/em\\u003e, and we found that the contents of floridoside and isofloridoside varied markedly\\n under desiccation and \\n high temperature stress[15]. However, the genes encoding (iso)floridoside biosynthetic enzymes remain unknown.\\n Therefore, in this study, we retrieved four unigenes annotated as putative TPS-related genes from the transcriptome data of \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e. We attempted to identify these genes and evaluated their activity under different\\n stresses to reveal their functions.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\n\\u003ch1\\u003eProtein sequences and alignments\\u003c/g1\\u003e\\n \\n\\u003cp\\u003eFour putative trehalose-6-phosphate synthase genes from \\u003cem\\u003eP. haitanensis \\u003c/em\\u003ewere cloned and named as \\u003cem\\u003ePhTPS1, PhTPS2, PhTPS3,\\u003c/em\\u003e and \\u003cem\\u003ePhTPS4\\u003c/em\\u003e. Their GenBank accession no. are KF147832.1, KM519457.1, KM519458.1, and KF245464.1,\\n respectively. The open reading frames (ORFs) of \\u003cem\\u003ePhTPS1–4\\u003c/em\\u003e are 3462 bp, 4029 bp, 3324 bp, and 3024 bp in length and encode polypeptides of 1154\\n aa, 1343 aa,1108 aa, and 1008 aa, respectively (Fig. 1). The molecular weights of\\n the PhTPS1\\u003cem\\u003e–\\u003c/em\\u003e4 deduced amino acid sequences are 124, 145, 117, and 112 kDa, with a theoretical\\n isoelectric point (pI) of 6.73, 6.05, 5.99, and 5.77, respectively.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eBy searching in the NCBI Conserved Domain Search tool, two conserved structural domains\\n named TPS domain (Glyco_transf_20) and TPP domain (Trehalose_PPase) were discovered\\n in PhTPS1, PhTPS2, and PhTPS3 (Fig. 1). The TPS domain in the three PhTPS comprises\\n the main length of the protein and is present near the N-terminal and is annotated\\n as trehalose-6-phosphate synthase. The TPP domain annotated as trehalose-6-phosphate\\n phosphatase (TPP domain) is located at the C-terminal, whereas in PhTPS4, with the\\n exception of the two domains, there is a special domain named CBM20 at the N-terminal\\n known to be involved in starch binding.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eCurrently, only the crystal structures of \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e TPS (PDI No. 1GZ5) [17] and \\u003cem\\u003eCandida albicans\\u003c/em\\u003e TPS (PDI No. 5HUT) [18] proteins have been elucidated. Here, we compared the data\\n of these two proteins and used multiple sequence alignment to evaluate the TPS domains\\n from different species and GGPS domain sequences from cyanobacteria. It was found\\n that the TPS domains of PhTPS1–3 were homologous with the \\u003cem\\u003eC. albicans\\u003c/em\\u003e TPS (PDI No. 5HUT) protein, with 53%, 50%, and 34% identity, respectively. However,\\n PhTPS4 showed a low identity of only 10%. Based on the alignment, we found nine sites\\n conserved with the UDP-glucose substrate binding sites, and four sites conserved with the glucose-6-phosphate binding sites (Additional file 1: Figure S1). Sites G157, D274, H298, R406, D505, M507, N508, L509,\\n and E513 of PhTPS1, and sites G181, D410, H434, R542, D641, M643, N644, L645, and\\n E649 of PhTPS2 were associated with the substrate UDP-glucose binding sites and are\\n highly conserved, without any mutated sites. However, in the two proteins PhTPS3 and\\n PhTPS4, there are three different sites. For example, in PhTPS3, D201, H225, and N441\\n are changed to N, Y, and S, respectively. In PhTPS4, the mutated sites are G198K,\\n R464D, and M564L, but the other six sites (D328, H352, D562, N565, L566, E570) are\\n conserved. For the substrate glucose-6-phosphate binding sites, only four sites in\\n PhTPS1 (R136, Y213, W222, and R440) are highly conserved. In PhTPS2-4, site mutations\\n were present, including Y247H and R580Q in PhTPS2, R63H and Y141F in PhTPS3, while\\n R501 in PhTPS4 is deleted. In addition to the binding sites of the two substrates,\\n multiple sequence alignment showed that the sequences of the four PhTPS members were\\n highly similar to the highly conserved fragments (homology \\u0026gt; 90%) of other species\\n TPSs and cyanobacteria GGPSs. An insert fragment (309–397 aa) was found in PhTPS2.\\n This insert was also found in \\u003cem\\u003eP. yezoensis\\u003c/em\\u003e TPS-3 (contig_27879) (350–427 aa, with 48% identity with the PhTPS2 insertion fragment).\\n No other species were detected.\\u003c/p\\u003e\\n \\n\\u003ch1\\u003ePhylogenetic analysis of trehalose-6-phosphate synthase in \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e. \\u003c/h1\\u003e\\n \\n\\u003cp\\u003eIn this study, a phylogenetic tree of the fused protein from bacteria, fungi, algal, animals, and higher plants was constructed\\n based on the TPS/TPP, TPS, and GGPS domain to investigate the evolutionary relationships\\n among them (Fig. 2). Single domain TPS proteins were mainly located in the group of\\n prokaryotic sequences. TPS/TPP fused proteins existed extensively.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eThe tree is separated into two main clades. The TPSs of animals and some prokaryotes and the GGPSs of the cyanobacteria form one clade. In this clade, the special GGPSs\\n are grouped at the end of a single branch. The TPSs of some prokaryotes, fungi, algae,\\n and higher plants form another cluster. Prokaryotic fused TPS/TPP proteins are located\\n between the single domain prokaryotic sequences and all of the eukaryotic sequences.\\n The TPS genes of plants are divided into two very distant clades that belong to plant\\n Class I enzymes and plant Class II enzymes. It is clear that the proteins from red algae are closely related to each other, but\\n group in clusters; for example,\\u003cem\\u003e P. yezoensis\\u003c/em\\u003e, \\u003cem\\u003eChondrus\\u003c/em\\u003e\\u003cem\\u003e crispus\\u003c/em\\u003e, \\u003cem\\u003eG. sulphuraria,\\u003c/em\\u003e and C\\u003cem\\u003eyanidioschyzon merolae\\u003c/em\\u003e. PhTPS1 and 2 are close to the proteins of \\u003cem\\u003eP. yezoensis\\u003c/em\\u003e (Contig 4636 and Contig 27879) with homologies of 81.28% and 72.3%. Four clusters,\\n namely, PhTPS1–4 are dispersed along different branches instead of clustering together.\\n The cluster including PhTPS1–2 is along the branch with plant Class I, and PhTPS3–4\\n is along the branch with plant Class II. PhTPS4 is relatively distant from the other\\n three PhTPSs and is closely associated with Class II proteins. It forms a small cluster\\n with some red and brown algae. Some TPS proteins containing the N-terminus CBM20 domain\\n were noted. They are relatively close in the phylogenetic tree, involving proteins\\n from red algae, diatoms, and brown alga (\\u003cem\\u003eS. japonica\\u003c/em\\u003e); for example, \\u003cem\\u003eP. umbilicalis\\u003c/em\\u003e (OSX79290.1, 85.84%), \\u003cem\\u003eG. sulphuraria \\u003c/em\\u003e(EME31717.1, 48.05%), and C\\u003cem\\u003e. merolae\\u003c/em\\u003e CM3596 (BAM80147.1, 41.25%) from Rhodophyta, \\u003cem\\u003eS. japonica\\u003c/em\\u003e(AGT20052.1, 23.45%) from Phaeophyta, and \\u003cem\\u003ePhaeodactylum tricornutum\\u003c/em\\u003eCCAP 1055/1 (XP_002180425.1, 28.36%) from Bacillariophyta, but are not found in the TPS genes of other species.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e\\n The phylogenetic tree of the only TPS and TPP domain were also constructed, respectively\\n (Additional file 2: Figure S2A, B). It could be found that the phylogenetic tree for\\n only TPS domain is nearly the same as that of TPS/TPP. While, the phylogenetic tree\\n for only TPP domain is different from that of TPS/TPP. Instead of forming two large\\n clades, all clades branched from the root and the clades position changed. For example,\\n the PhTPP domains are divided into three clades. The clades of PhTPP 1 and PhTPP 3\\n are separated by plant Class I. Among them, the cluster of red alga including PhTPP\\n 1and plant Class I to form a clade. Besides, the species of each small clade is basically\\n the same. \\u003c/p\\u003e\\n \\n\\u003ch1\\u003eExpression and enzymatic function of PhTPS1–4 proteins. \\u003c/h1\\u003e\\n \\n\\u003cp\\u003eTo verify the function of four proteins from \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e PhTPS1–4, we expressed their TPS domain by \\u003cem\\u003eE. coli\\u003c/em\\u003e and separated the purified proteins by SDS-PAGE. We observed bands in the position\\n of the corresponding molecular weight (PhTPS1, 77.9 kDa; PhTPS2, 82.3 kDa; PhTPS3,\\n 65.4 kDa; PhTPS4, 75.9 kDa). To confirm the expression, four recombinant His-tagged\\n proteins were confirmed by Western blotting using an anti-His-tag-antibody (Fig. 3).\\u003c/p\\u003e\\n \\n\\u003cp\\u003eTo detect the biochemical activity of PhTPS1–4, UDP-Gal and G3P were allowed to react\\n with them, and the resulting products were respectively analyzed (Fig. 4). First,\\n the retention times of the two purified standards, floridoside (retention time = 20.83\\n min) and isofloridoside (retention time = 26.14 min), were obtained and identified\\n using the [M-H]\\u003csup\\u003e−\\u003c/sup\\u003e ions at \\u003cem\\u003em/z\\u003c/em\\u003e 253.0925 by HPLC-MS. \\n In MS/MS spectra, the characteristic fragment ion at \\u003cem\\u003e\\n m/z\\u003c/em\\u003e 89.02 and 119.03 from [M-H]\\u003csup\\u003e−\\u003c/sup\\u003e ions were also utilized for qualitative analysis of floridoside and isofloridoside\\n [16]. It was found that the reaction products floridoside and isofloridoside were\\n generated which were catalyzed by PhTPS1 and PhTPS4 using HPLC-MS. While catalyzing\\n by PhTPS3, only the isofloridoside was produced. However, the floridoside and isofloridoside\\n were not detected after catalyzing by PhTPS2. \\u003c/p\\u003e\\n \\n\\u003cp\\u003eQuantitative analysis of the catalytic products of PhTPS1, PhTPS3, and PhTPS4 showed\\n that the conversion ratios of the four enzymes were all low. The enzyme activities\\n of PhTPS1 and PhTPS4 producing floridoside were 0.26 and 0.22 μmol·h\\u003csup\\u003e−1\\u003c/sup\\u003e·mg\\u003csup\\u003e−1\\u003c/sup\\u003e, respectively. The enzyme activities of PhTPS1 and PhTPS4 producing isofloridoside\\n were 0.50 and 0.61 μmol·h\\u003csup\\u003e−1\\u003c/sup\\u003e·mg\\u003csup\\u003e−1\\u003c/sup\\u003e, respectively. The enzyme activity of PhTPS3 was 0.23 μmol·h\\u003csup\\u003e−1\\u003c/sup\\u003e·mg\\u003csup\\u003e−1\\u003c/sup\\u003e, and only the isofloridoside was biosynthesized (Table 3).\\u003c/p\\u003e\\n \\n\\u003ch1\\u003eExpression of \\u003cem\\u003ePhTPS1\\u003c/em\\u003e–\\u003cem\\u003e4 \\u003c/em\\u003eunder different abiotic stimuli\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe expression of four \\u003cem\\u003ePhTPS\\u003c/em\\u003e genes was analyzed under desiccation, high temperature, and different salinity treatments\\n (Fig. 5). Following 35°C \\n high temperature stress treatment for 30 min, the expression of \\u003cem\\u003ePhTPS1–4 \\u003c/em\\u003ewas significantly increased. The increase in \\u003cem\\u003ePhTPS3\\u003c/em\\u003e and \\u003cem\\u003ePhTPS4\\u003c/em\\u003e was the most obvious, reaching 20.5- and 26.6-fold (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01) that of the control, followed by \\u003cem\\u003ePhTPS1\\u003c/em\\u003e, which was increased by 9.2-fold (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01) that of the control. After recovery under normal temperature for 1 h following\\n the thermal shock, the upregulation of \\u003cem\\u003ePhTPS2, PhTPS3, \\u003c/em\\u003eand \\u003cem\\u003ePhTPS4\\u003c/em\\u003e was reduced, but the upregulation of \\u003cem\\u003ePhTPS1\\u003c/em\\u003e was significantly enhanced, reaching 11.5-fold that of the control. Compared with\\n recovery for 1 h, recovery for 3 h did not elicit any major changes (Fig. 5A).\\u003c/p\\u003e\\n \\n\\u003cp\\u003eDuring the first 1 h of desiccation, the expression of four \\u003cem\\u003ePhTPSs\\u003c/em\\u003e increased significantly and remained at high levels throughout the process. Among\\n them, \\u003cem\\u003ePhTPS1\\u003c/em\\u003e and \\u003cem\\u003ePhTPS4\\u003c/em\\u003e showed the strongest responses. When treated for 1 h, the increased expression multiple\\n reached more than 30 times (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01), and the expression level gradually decreased with the extension of desiccation\\n time. However, the up-regulation of \\u003cem\\u003ePhTPS2\\u003c/em\\u003e and \\u003cem\\u003ePhTPS3\\u003c/em\\u003e was slightly weaker than that of \\u003cem\\u003ePhTPS1\\u003c/em\\u003e and \\u003cem\\u003ePhTPS4\\u003c/em\\u003e, and the up-regulation peaked at 2 h, but the up-regulation remained at around 5–12\\n fold of the control during the entire desiccation process (Fig. 5B).\\u003c/p\\u003e\\n \\n\\u003cp\\u003eThe expression of the PhTPS1–4 genes was examined when the \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e thalli were grown under different NaCl concentrations ranging from \\n 500 mM to 1400 mM (Fig. 5C). \\u003cem\\u003ePyropia haitanensis\\u003c/em\\u003e is mainly grown in the East China sea, and the seaweed used in this study is from\\n Xiangshan, China, where the salinity is \\n 500 mM. Therefore, here we compare gene expression under different salinity stress concentrations\\n with that under \\n 500 mM NaCl as a control. According to the results, the expressions of four \\u003cem\\u003ePhTPS\\u003c/em\\u003e genes varied under different salinity stresses, but their overall expression was not very high. Among them, \\u003cem\\u003ePhTPS4\\u003c/em\\u003e was most sensitive to changes in salinity, and under \\n 700 mM NaCl, \\u003cem\\u003ePhTPS4\\u003c/em\\u003e showed slight salt-stimulated expression and was upregulated to 1.86-fold that of\\n the \\n 500 mM NaCl group (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01). The levels of \\u003cem\\u003ePhTPS1\\u003c/em\\u003e, \\u003cem\\u003ePhTPS3, \\u003c/em\\u003eand \\u003cem\\u003ePhTPS4 \\u003c/em\\u003ewere increased under \\n 1400 mM NaCl stress, being 2.22-, 2.04-, and 2.16-fold higher than that of the \\n 500 mM NaCl group (\\u003cem\\u003eP\\u003c/em\\u003e \\u003cem\\u003e\\u0026lt;\\u003c/em\\u003e 0.01). \\u003cem\\u003ePhTPS3\\u003c/em\\u003e and \\u003cem\\u003ePhTPS4\\u003c/em\\u003e all reacted relatively strongly at high salinity. \\u003cem\\u003ePhTPS2\\u003c/em\\u003e was not upregulated with the increase in salinity in comparison to the \\n 500 mM NaCl group.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eThe accumulation of (iso)floridoside in \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e under various NaCl concentrations ranged from \\n 500 mM to 1400 mM for 1 h. LC–MS revealed that floridoside and isofloridoside all accumulated (Fig.\\n 5D). The concentration of isofloridoside rose proportionally with the external NaCl\\n from \\n 500 mM to 700 mM (\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01), but decreased under highly hypersaline conditions. Floridoside plays a rather\\n minor role as an osmolyte, because its change trend was the same as isofloridoside\\n under salt stress and even decreased at a high salt concentration.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eMaterials\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eExperiments were performed with gametophytic \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e HML collected at Hepu, Xiangshan Harbor, Zhejiang Province, China (29°09ʹ18″N, 121°54ʹ05″W).\\n Young fronds were collected, dried in the shade, and stored at −20°C. Before experiments,\\n the thalli were rehydrated with sterile seawater and then healthy samples were cultivated\\n at 20°C for 24 h under 40 μmol photons m\\u003csup\\u003e−2\\u003c/sup\\u003e s\\u003csup\\u003e−1\\u003c/sup\\u003e with a 12 h:12 h (L:D) photoperiod.\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eTotal RNA isolation and cDNA synthesis\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe total RNA was isolated from \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e HML gametophytes with RNAisoPlus Reagent (TaKaRa Bio Inc., Otsu, Japan) according\\n to the manufacturer’s protocol. The cDNA for the full-length sequence cloning and\\n transcriptional analysis was synthetized by using SMARTer\\u003csup\\u003eTM\\u003c/sup\\u003e rapid amplification of cDNA ends (RACE) cDNA Amplification Kit (Clontech Laboratories,\\n Inc., Palo Alto, CA, USA) and TaKaRa PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan)\\n according to the instruction manual, respectively.\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eFull-length cDNA cloning of \\u003cem\\u003ePhTPS\\u003c/em\\u003e\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eBased on the gametophyte transcriptome analysis of\\u003cem\\u003e P. haitanensis\\u003c/em\\u003e (data not shown), four fragment sequences were annotated as trehalose-6-phosphate\\n synthase genes (\\u003cem\\u003ePhTPS1–4\\u003c/em\\u003e). Gene-specific primers, indicated in Table 1, were designed to clone the complete\\n open reading frame (ORF) of \\u003cem\\u003ePhTPS1–4\\u003c/em\\u003e using the 5ʹ- and 3ʹ-RACE method (SMART RACE cDNA Amplification Kit, Clontech). All\\n of the PCR products were then cloned into the pMD18-T vector (TaKaRa, Dalian, China)\\n for sequencing (Sangon Biotech, Shanghai, China).\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eAnalysis of \\u003cem\\u003ePhTPS\\u003c/em\\u003e deduced amino acid sequences\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe ORF in \\u003cem\\u003ePhTPS1–4 \\u003c/em\\u003ewas analyzed using ORF Finder in the NCBI database. The theoretical molecular weights\\n and pIs of the \\u003cem\\u003ePhTPS1–4 \\u003c/em\\u003ededuced amino acid sequences were calculated by the Compute pI/Mw tool at \\u003ca href=\\\"https://web.expasy.org/compute_pi/\\\"\\u003e\\u003ca href=\\\"https://web.expasy.org/compute_pi/\\\"\\u003ehttps://web.expasy.org/compute_pi/\\u003c/a\\u003e\\u003c/a\\u003e. The conserved structural domains were constructed in NCBI Conserved Domain Search.\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eMultiple sequence alignment and phylogenetic tree construction\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eGene sequences annotated as trehalose-6-phosphate synthase from bacteria, algae, fungi,\\n plants, and animals were retrieved and collected from a search in the NCBI database.\\n Gene sequences annotated as glucosyl glycerol-phosphate synthase from cyanobacteria\\n were also collected. The ORFs of all TPS and GGPS gene sequences were obtained in\\n the NCBI ORF Finder and translated into amino acid sequences using MEGA 5.1.0 software.\\n The conserved domains of all TPS and GGPS amino acid sequences were analyzed in NCBI\\n Conserved Domain Search.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eMultiple sequence alignment of TPS and GGPS from different species was performed by\\n Vector NTIAdvance 11.5.1 software with default parameters and then edited by GeneDoc\\n software to show the function-related conserved sites in these sequences. Sequences\\n of TPS, TPP, TPS/TPP and GGPS from different species were aligned using the ClustalW\\n algorithm, and a phylogenetic tree was constructed using the neighbor-joining distance\\n method with 1,000 bootstrap replicates. PRABI (\\u003ca href=\\\"https://geno3d-prabi.ibcp.fr/cgi-bin/geno3d_automat.pl?page=/GENO3D/geno3d_home.html\\\"\\u003e\\u003ca href=\\\"https://geno3d-prabi.ibcp.fr/cgi-bin/geno3d_automat.pl?page=/GENO3D/geno3d_home.html\\\"\\u003ehttps://geno3d-prabi.ibcp.fr/cgi-bin/geno3d_automat.pl?page=/GENO3D/geno3d_home.html\\u003c/a\\u003e\\u003c/a\\u003e) was used for PhTPS1–4 protein sequence homology alignment.\\u003c/p\\u003e\\n \\n\\u003ch1\\u003ePreparation of the recombinant TPS domain protein of PhTPS\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe primers shown in Table 2 were used to clone the TPS domain of PhTPS1–4. The PCR\\n procedure was 95°C for 3 min; followed by 35 cycles of 95°C for 30 s, \\u003cem\\u003eT\\u003c/em\\u003e\\u003csub\\u003em\\u003c/sub\\u003e for 35 s, 72°C for 2 min, and then 72°C for 10 min. The amplicon was inserted into\\n the commercial pET-28a (TaKaRa) vector or modified pET-28a-sumo vector, and then transformed into \\u003cem\\u003eE. \\u003c/em\\u003e\\u003cem\\u003ecoli \\u003c/em\\u003eBL21. The expression of the target protein was induced in the presence of 0.1 mM isopropyl\\n thio-\\u003cem\\u003eβ\\u003c/em\\u003e-galactoside at 20°C for 16–24 h. The cells were then harvested, lysed, and centrifuged.\\n The purification of the target protein in the supernatant was operated successively by using the 6×His-Tagged Protein Purification Kit (Cwbio, Beijing, China) and the\\n AKTAxpress\\u003csup\\u003eTM\\u003c/sup\\u003e system with a HiLoad\\u003csup\\u003eTM\\u003c/sup\\u003e16/600 Superdex\\u003csup\\u003eTM\\u003c/sup\\u003e 200 pg column (GE-Healthcare, USA). The eluted protein solution (50 mM Tris/HCl, 200 mM NaCl, pH 8.0) was assessed by both 10% SDS-PAGE and Western blotting with the anti-His tag antibody\\n (Sigma Aldrich). The \\u003cem\\u003eE. \\u003c/em\\u003e\\u003cem\\u003ecoli \\u003c/em\\u003ewith empty pET-28a or pET-28a-sumo vector was used as the negative control.\\u003c/p\\u003e\\n \\n\\u003cp\\u003ePrior to the activity assay, the eluted protein solution was incubated with the sumo\\n protease (More Biotech, China) to cut off the sumo-His tag, which was at the N-terminal\\n of the target protein. The final working protein solution (50 mM Tris/HCl, 200 mM NaCl, pH 8.0) was obtained using a Ni-agarose column to remove the cleaved sumo-His tag and the\\n sumo protease in the mixture. The target protein concentration in the final solution\\n was determined by a Bio-Rad DC Protein Assay (Hercules, CA, USA) and 10% SDS-PAGE.\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eEnzyme activity measurement\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe enzyme activity of the TPS domain of PhTPS1–4 was determined in 100 μL of working solution containing 10 mM MgSO\\u003csub\\u003e4\\u003c/sub\\u003e, 100 mM UDP-galactose (Sigma Aldrich, Taufkirchen, Germany), and 40 mM G3P (Sigma Aldrich)\\n according to the method of Pade \\u003cem\\u003eet al\\u003c/em\\u003e. [6] Reaction mixtures were incubated for 16 h at 30°C and then heated at 100°C for 5 min\\n to terminate the reaction. The reaction mixture was then treated with 1 U of alkaline\\n phosphatase (CIAP; Fermentas) for 2 h at 37°C to dephosphorylate the intermediate\\n (iso)floridoside phosphate. After reaction, the mixed solution was extracted, purified, lyophilized, and re-dissolved\\n in 200 μL methanol for HPLC–MS analysis. The enzyme activity corresponded to 1 μmol (iso)floridoside\\n produced in 1 min by 1 mg of protein.\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eHPLC–MS/MS analysis\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe reaction solution above was analyzed on an UltiMate\\u003csup\\u003eTM \\u003c/sup\\u003e3000 HPLC system with a Q Exactive hybrid quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific, USA) using a Xbridge Amide column (100 mm × 3 mm, 3.5 μm,\\n Waters) at 25°C. The constant solvent system was 90% acetonitrile (A)–10% water (10\\n mM CH\\u003csub\\u003e3\\u003c/sub\\u003eCOONH\\u003csub\\u003e4\\u003c/sub\\u003e). The flow rate was 0.3 mL min\\u003csup\\u003e−1\\u003c/sup\\u003e for 35 min and the injection volume was 10 μL.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eThe Q Exactive hybrid quadrupole-Orbitrap mass spectrometer was operated in the data\\n dependent mode, automatically switching between full scan MS and MS/MS acquisition\\n with electrospray ionization (ESI) in the negative ionization mode. The mass range\\n was scanned from 50 to 600. The MS/MS parameters were set as follows: Automatic Gain Control (AGC) target 2\\n × 10\\u003csup\\u003e5\\u003c/sup\\u003e; maximum ion time 120 ms; isolation width 4.0 \\u003cem\\u003em\\u003c/em\\u003e/\\u003cem\\u003ez\\u003c/em\\u003e. The typical mass spectrometric conditions were: a sheath gas pressure (N\\u003csub\\u003e2\\u003c/sub\\u003e) flow-rate, 25 L/min; auxiliary gas pressure (N\\u003csub\\u003e2\\u003c/sub\\u003e) flow-rate, 5 Abs; spray voltage, 2.5 kV; vaporizer temperature, 300°C; and capillary\\n temperature, 350°C; collision gas pressure, 1.5 mTorr.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eThe quantification of (iso)floridoside was performed on a Finnigan Surveyor and TSQ\\n Quantum Access system (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA), referring to Chen \\u003cem\\u003eet al\\u003c/em\\u003e. [16]. The calibration curves for (iso)floridoside quantification were constructed with\\n standard compounds extracted directly from \\u003cem\\u003eP. haitanensis.\\u003c/em\\u003e\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eSample treatment\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eAll treatments were performed at a density of 500 mg thalli per 150 mL sterile seawater.\\n For the desiccation treatment, the thalli were subjected to desiccation for 0, 1, 2, 3, and 4 h under 20°C, 100 μmol·photons·m\\u003csup\\u003e−2\\u003c/sup\\u003e·s\\u003csup\\u003e−1\\u003c/sup\\u003e, and 75% humidity. For the \\n high temperature stress\\n treatment, the thalli were cultured at 35°C for 30 min and then transferred to 20°C to recover for 1 and\\n 3 h. For the salt stress treatment, the thalli were cultured in medium supplemented with \\n \\n 500, 700, 100, and 1400 mM NaCl for 1 h under 20°C. All samples were collected, frozen rapidly in liquid nitrogen, and stored at −80°C for RNA isolation. Salt stress-treated samples were processed according to the method of Chen \\u003cem\\u003eet al\\u003c/em\\u003e. [16] and analyzed by LC–MS.\\u003c/p\\u003e\\n \\n\\u003ch1\\u003eReal-time quantitative (qRT) PCR analysis of \\u003cem\\u003ePhTPS\\u003c/em\\u003e under different stresses \\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe qRT-PCR analysis was performed with SYBR Premix Ex Taq (TaKaRa) on a Mastercycler EP realplex real-time PCR system (Eppendorf,\\n Hamburg, Germany). The specific qRT-PCR primers for \\u003cem\\u003ePhTPS1\\u003c/em\\u003e\\u003cem\\u003e–\\u003c/em\\u003e\\u003cem\\u003e4\\u003c/em\\u003e are listed in Table 2. \\u003cem\\u003ePh18S\\u003c/em\\u003e was used as an internal reference gene. The PCR procedure was as follows: 95°C for\\n 3 min; 40 cycles of 95°C for 10 s, Tm°C for 18 s, 72°C for 15 s, and a dissociation\\n curve analysis to determine target specificity. All reactions were performed in triplicate.\\n Relative gene quantification was performed using the comparative 2\\u003csup\\u003e-ΔΔCt\\u003c/sup\\u003e method and normalized to \\u003cem\\u003ePh18S.\\u003c/em\\u003e\\u003c/p\\u003e\\n \\n\\u003ch1 data-xsweet-outline-level=\\\"0\\\"\\u003eStatistical analysis\\u003c/h1\\u003e\\n \\n\\u003cp data-xsweet-outline-level=\\\"0\\\"\\u003eThe data for the qRT-RCR results were obtained from at least three independent biological\\n experiments. LC–MS analysis was performed in biological triplication and technical\\n triplication for validation. Each treatment was evaluated using analysis of variance\\n (ANOVA) in SPSS 22.0 (IBM Corp., Armonk, NY, USA). Comparisons among three groups\\n were made using one-way ANOVA with Tukey’s multiple comparison tests. \\u003c/p\\u003e\\n \\n\"},{\"header\":\"Declarations\",\"content\":\" \\n\\u003ch1\\u003eAcknowledgments\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eWe thank LetPub \\u003ca href=\\\"http://(www.letpub.com\\\"\\u003e(www.letpub.com\\u003c/a\\u003e) for its linguistic assistance during the preparation of this manuscript.\\u003c/p\\u003e\\n \\n\\u003ch1\\u003eFunding\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eThis work was funded by National Key R\\u0026amp;D Program of China (2018YFD0900305) for collecting samples; NSFC (31872540,\\n 41706170, 31772871) for analyzing data; National Science Foundation of Zhejiang (LY18C190004,\\n LY17D060002) for analyzing data; Major\\u0026nbsp;Scientific\\u0026nbsp;and\\u0026nbsp;Technological\\u0026nbsp;Project of Zhejiang Province\\n (2016C02055-6B) for culturing algae; China Agriculture Research System (CARS-50) for culturing algae; Zhejiang education department innovation team for providing\\n instrument; Ningbo Programs for Science and Technology Development (2017C110026) for writing the manuscript; K.C. Wong Magna Fund in Ningbo University for providing\\n instrument. \\u003c/p\\u003e\\n \\n\\u003ch1\\u003eAuthor’s contributions\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eM.X.S performed the experiments; J.Z.Z analyzed the phylogenetic tree and multiple\\n sequence alignment; J.J.C. performed most of the LC-MS detection and analyzed the\\n data; R.Y. performed the physiological experiments; Q.J.L. collected the samples;\\n W.W analyzed quantitative data; X.J.Y. supervised and complemented the writing; H.M.C.\\n conceived the project and wrote the article.\\u003c/p\\u003e\\n \\n\\u003ch1\\u003eAvailability of data and materials\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eThe datasets used and/or analysed during the current study are available from the\\n corresponding author on reasonable request.\\u003c/p\\u003e\\n \\n\\u003ch1\\u003eEthics approval and consent to participate\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eMaterials were collected from our experimental base at the coast of Xiangshan harbor\\n in Zhejiang province, China. Sampling was permitted by the local government (Xiangshan\\n County Government) and the local department of fisheries (Ningbo Ocean \\u0026amp; Fishery Bureau).\\n \\u003c/p\\u003e\\n \\n\\u003ch1\\u003eConsent for publication\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n \\n\\u003ch1\\u003eCompeting interests\\u003c/h1\\u003e\\n \\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n \"},{\"header\":\"References\",\"content\":\"\\n\\u003cp\\u003e1.\\n Liddle LB, Cole KM, Sheath RG. Biology of the red algae. BioScience.1991; 41(11):796‒7.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e2.Eggert A, Karsten U. Low molecular weight carbohydrates in red algae–an ecophysiological\\n and biochemical perspective. Red Algae in the Genomic Age. 2010;13:443‒56.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e3.Luley-Goedl C, Nidetzky B. Glycosides as compatible solutes: biosynthesis and applications.\\n Nat Prod Rep. 2011;28(5):875‒96.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e4.Li SY, Shabtai Y, Arad S. Floridoside as a carbon precursor for the synthesis of cell-wall\\n polysaccharide in the red microalga \\u003cem\\u003ePorphyridium\\u003c/em\\u003e sp. (Rhodophyta). J Phycol. 2002;38(5):931‒8.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e5.Marin K, Zuther E, Kerstan T, Kunert A, Hagemann M. The ggpS gene from \\u003cem\\u003eSynechocystis\\u003c/em\\u003e sp. strain PCC 6803 encoding glucosyl-glycerol-phosphate synthase is involved in\\n osmolyte synthesis. J Bacteriol. 1998;180(18):4843‒9.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e6.Pade N, Linka N, Ruth W, Weber APM, Hagemann M. Floridoside and isofloridoside are\\n synthesized by trehalose 6-phosphate synthase-like enzymes in the red alga\\u003cem\\u003e Galdieria sulphuraria\\u003c/em\\u003e. New Phytol. 2015;205(3):1227‒38.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e7.Meng JX, Rosell KG, Srivastava LM. Chemical characterization of floridosides from\\n \\u003cem\\u003ePorphyra perforata\\u003c/em\\u003e. Carbohyd Res. 1987;161(2):171‒80.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e8.Deng DY, Zhao G, Xuan JS, Yang JL, Duan LD, Weng ML, Wang B. Construction and characterization\\n of a bacterial artificial chromosome library of marine macroalga \\u003cem\\u003ePorphyra yezoensis \\u003c/em\\u003e(Rhodophyta). Plant Mol Biol Rep. 2004;22(4):375‒86.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e9.Deng YY, Wang XL, Guo H, Duan DL. A trehalose-6-phosphate synthase gene from \\u003cem\\u003eSaccharina japonica\\u003c/em\\u003e (Laminariales, Phaeophyceae). Mol Biol Rep. 2013;41(1):529‒36.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e10.Wang GL, Ge Z, Feng YB, Xuan JS, Sun JW, Guo BT, Jiang GY, Weng ML, Yao JT, Wang B.\\n Cloning and comparative studies of seaweed trehalose-6-phosphate synthase genes. Mar\\n Drugs. 2010;8(7):2065‒79.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e11.Arad S, Levy-Ontman O. Red microalgal cell-wall polysaccharides: biotechnological\\n aspects. Curr Opin Biotech. 2010;21(3):358‒64.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e12.Barbier GG, Oesterhelt C, Larson MD, Halgren RG, Wilkerson CG, Garavito RM, Bening\\n C, Weber, APM. Comparative genomics of two closely related unicellular thermo-acidophilic\\n red algae, \\u003cem\\u003eGaldieria sulphuraria\\u003c/em\\u003e and \\u003cem\\u003eCyanidioschyzon merolae\\u003c/em\\u003e, reveals the molecular basis of the metabolic flexibility of \\u003cem\\u003eGaldieria sulphuraria\\u003c/em\\u003e and significant differences in carbohydratemetabolism of both algae. Plant Physiol.\\n 2005;137(2):460‒74.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e13.Kauss H, Jeblick W. Influence of free fatty acids, lysophosphatidylcholine, platelet-activating\\n factor, acylcarnitine, and echinocandin B on 1,3-β-d-glucan synthase and callose synthesis.\\n Plant Physiol. 1986;80(1):7‒13.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e14.Ekman P, Yu SK, Pedersen M. Effects of altered salinity, darkness and algal nutrient\\n status on floridoside and starch content, α-galactosidase activity and agar yield\\n of cultivated \\u003cem\\u003eGracilaria sordida\\u003c/em\\u003e. British Phycol J. 1991;26(2):123‒31.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e15.Lai XJ, Yang R, Luo QJ, Chen JJ, Chen HM, Yan XJ. Glycerol-3-phosphate metabolism\\n plays a role in stress response in the red alga \\u003cem\\u003ePyropia haitanensis\\u003c/em\\u003e. J Phycol. 2015;51(2):321‒31.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e16.Chen JJ, Song DD, Luo QJ, Mou T, Yang R, Chen HM, He S, Yan XJ. Determination of floridoside\\n and isofloridoside in red algae by high-performance liquid chromatography–tandem mass\\n spectrometry. Anal Lett. 2014;47(14):2307‒16.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e17.Gibson RP, Turkenburg JP, Charnock SJ, Lloyd RM, Davies GJ. Insights into trehalose\\n synthesis provided by the structure of the retaining glucosyltransferase OtsA. Chem\\n Biol. 2002;9(12):1337‒46.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e18.Miao Y, Tenor JL, Toffaletti DL, Maskarinec SA, Liu J, Lee RE, Perfect JR, Brennan\\n RG. Structural and in vivo studies on trehalose-6-phosphate synthase from pathogenic\\n fungi provide insights into its catalytic mechanism, biological necessity, and potential\\n for novel antifungal drug design. Mbio 2017;8(4):e00643‒17.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e19.Hagemann M, Pade N. Heterosides–compatible solutes occurring in prokaryotic and eukaryotic\\n phototrophs. Plant Biol. 2015;17(5):927‒34.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e20.Hideyuki N, Hachiro O, Saheye N, Kazutosi N. Physiological studies on floridean starch,\\n floridoside and trehalose in a red alga, \\u003cem\\u003eSerraticardia maxima\\u003c/em\\u003e. Bot Mag. 1969;82(978):462‒73.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e21.Machovic M, Svensson B, Macgregor EA, Janecek S. A new clan of CBM families based\\n on bioinformatics of starch-binding domains from families CBM20 and CBM21. FEBS J.\\n 2005;272(21):5497‒513.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e22.Christiansen CM, Hachem MA, Janecek S, Viksonielsen A, Blennow A, Svensson B. The\\n carbohydrate-binding module family 20‒diversity, structure, and function. FEBS J. 2009;276(18):5006‒29.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e23.Meng JX, Srivastava LM. Partial purification and characterization of floridoside phosphate\\n synthase from \\u003cem\\u003ePorphyra perforata\\u003c/em\\u003e. Phytochemistry. 1991;30(6):1763‒6.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e24.Karsten U. Seasonal variation in heteroside concentrations of field‒collected \\u003cem\\u003ePorphyra\\u003c/em\\u003e species (Rhodophyta) from different biogeographic regions. New Phytol. 1999;143(3):561‒71.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e25.Avonce N, Wuyts J, Verschooten K, Vandesteene L, Dijck PV. The \\u003cem\\u003eCytophaga hutchinsonii\\u003c/em\\u003e ChTPSP: first characterized bifunctional TPS–TPP protein as putative ancestor of\\n all eukaryotic trehalose biosynthesis proteins. Mol Biol Evol. 2010;27(2):359‒69.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e\\n 26.\\n Yu S, Pedersen M. The effect of salinity changes on the activity of α-galactosidase\\n of the red algae \\u003cem\\u003e\\n Gracilaria sordida\\u003c/em\\u003e and \\u003cem\\u003e\\n G. tenuistipitata\\u003c/em\\u003e. Bot Mar. 1990;33(5):385‒91.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e27.Reed RH, Collins JC, Russell G. The effects of salinity upon cellular volume of the\\n marine red alga \\u003cem\\u003ePorphyra purpurea\\u003c/em\\u003e (Roth) C.Ag. J Exp Bot. 1980;31(6):1521‒37.\\u003c/p\\u003e\\n \\n\\u003cp\\u003e28.Qian FJ, Luo QJ, Yang R, Zhu ZJ, Chen HM, Yan XJ. The littoral red alga \\u003cem\\u003ePyropia haitanensis\\u003c/em\\u003e uses rapid accumulation of floridoside as the desiccation acclimation strategy. J\\n Appl Phycol. 2015;27(1):621‒32.\\u003c/p\\u003e\\n \\n\\n \"},{\"header\":\"Tables\",\"content\":\"\\u003cp style=\\\"text-align: left; line-height: 200%;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eTable 1 \\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003ePCR primers for the amplification and cloning of \\u003cem\\u003ePhTPS1\\u003cspan style=\\\"color: black;\\\"\\u003e\\u0026ndash;\\u003c/span\\u003e4\\u003c/em\\u003e\\u003cstrong\\u003e.\\u003c/strong\\u003e\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003ctable style=\\\"border-collapse: collapse; border: none;\\\" width=\\\"548\\\"\\u003e\\n\\u003ctbody\\u003e\\n\\u003ctr style=\\\"height: 13.8pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003ePrimers\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003eSequence (5\\u0026rsquo;\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: SimSun; color: windowtext; letter-spacing: .5pt;\\\"\\u003e\\u0026rarr;\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;)\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003eRestriction enzymes\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003eTm (\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e\\u0026deg;C\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e)\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 56.7pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"76\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003ePCR products\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 13.8pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS1\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eGGAATTC\\u003cu\\u003eCATATG\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eGACCTTCCATCCCTCAGCAGT\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eNdeI\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e60.4\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 56.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" rowspan=\\\"2\\\" width=\\\"76\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e1758 bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 14.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS1\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eCCC\\u003cu\\u003eAAGCTT\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: red;\\\"\\u003eCTA\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eCATCGCCGTCACCAGTTC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eHindIII\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e60.4\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 13.8pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS2\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eGGAATTC\\u003cu\\u003eCATATG\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eACGGGTGACGGGCTGAAC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eNdeI\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e61.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 56.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" rowspan=\\\"2\\\" width=\\\"76\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e2196 bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 14.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS2\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eCCG\\u003cu\\u003eCTCGAG\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: red;\\\"\\u003eTCA\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eGGGCTGTGACTCCCATTC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eXhoI\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e62.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 13.8pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS3\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eGGAATT\\u003cu\\u003eCCATATG\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eAGCCGCTCCTACAATCCC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eNdeI\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e57.3\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 56.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" rowspan=\\\"2\\\" width=\\\"76\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e1407 bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 13.8pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS3\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eCCC\\u003cu\\u003eAAGCTT\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: red;\\\"\\u003eTCA\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eCTTGGTGGATGAACGAA\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eHindIII\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e56.7\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 14.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS4\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eGGAATTC\\u003cu\\u003eCATATG\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eGACACGATGGACGGCTCTATG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eNdeI\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e60.3\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 56.7pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 14.2pt;\\\" rowspan=\\\"2\\\" width=\\\"76\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e1659 bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 13.8pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 84.35pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"112\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS4\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-ORF\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 157.65pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"210\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: blue;\\\"\\u003eCCG\\u003cu\\u003eCTCGAG\\u003c/u\\u003e\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: red;\\\"\\u003eCTA\\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eACCCACCTTGACAACCACC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 71.7pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"96\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eXhoI\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 40.7pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 13.8pt;\\\" width=\\\"54\\\"\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e60.9\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp style=\\\"text-align: left; line-height: 200%; text-autospace: none;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eThe underlined bases indicate the restriction sites, and the red bases indicate the added stop codons.\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp style=\\\"line-height: 200%; layout-grid-mode: char;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp style=\\\"line-height: 200%;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eTable 2 \\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eThe primers for qRT-PCR.\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003ctable style=\\\"border-collapse: collapse; border: none;\\\" width=\\\"510\\\"\\u003e\\n\\u003ctbody\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003ePrimers\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 163.0pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"217\\\"\\u003e\\n\\u003cp style=\\\"text-align: left; tab-stops: 126.75pt;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003eSequence (5\\u0026rsquo;\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: SimSun; color: windowtext; letter-spacing: .5pt;\\\"\\u003e\\u0026rarr;\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;)\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp; \\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 56.7pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"76\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003eTm (\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e\\u0026deg;C\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e)\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003ePCR products\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS1\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eAGTTTCCGTTTGTGTGGGTG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e58.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" rowspan=\\\"2\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e132bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.75pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS1\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eCCGTTGTAGTAGAGGTGGGC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS2\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eTGCTGGGGGTGGAAGGG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e59.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" rowspan=\\\"2\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e196bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.75pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS2\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eGGGGAAGGGGGTGTGGAG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS3\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eCTGCCCACTCGTTTTCCA\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e57.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" rowspan=\\\"2\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e142bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS3\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eCCGGCTCAATTTCTTCCAG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.75pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS4\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eTGTATGATGGGGACCGAACG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e58.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.75pt;\\\" rowspan=\\\"2\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e184bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS4\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eGCCACGGAATGTGAAGGAAG\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePh18S\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e5\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eAGTTAGGGGATCGAAGACGA\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e55.0\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e153bp\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 18.2pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 78.0pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePh18S\\u003c/span\\u003e\\u003c/em\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; letter-spacing: .5pt;\\\"\\u003e-Q\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext; letter-spacing: .5pt;\\\"\\u003e3\\u0026rsquo;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 177.15pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" colspan=\\\"2\\\" width=\\\"236\\\"\\u003e\\n\\u003cp\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eCAGCCTTGCGACCATACTC\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 42.55pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"57\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; border-bottom: solid black 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 18.2pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 11.0pt; font-family: 'Times New Roman',serif; background: white;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd style=\\\"border: none;\\\" width=\\\"104\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n\\u003ctd style=\\\"border: none;\\\" width=\\\"217\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n\\u003ctd style=\\\"border: none;\\\" width=\\\"19\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n\\u003ctd style=\\\"border: none;\\\" width=\\\"57\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n\\u003ctd style=\\\"border: none;\\\" width=\\\"113\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 14.0pt; font-family: 'Times New Roman',serif;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 14.0pt; font-family: 'Times New Roman',serif;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp style=\\\"text-align: left;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 14.0pt; font-family: 'Times New Roman',serif;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp style=\\\"line-height: 200%;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eTable 3. \\u003c/span\\u003e\\u003c/strong\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eQuantitative determination of PhTPS 1-4 catalytic products\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003ctable style=\\\"width: 409.4pt; border-collapse: collapse; border: none;\\\" width=\\\"546\\\"\\u003e\\n\\u003ctbody\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd style=\\\"width: 55.05pt; border-top: solid windowtext 1.0pt; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt;\\\" rowspan=\\\"2\\\" width=\\\"73\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eEnzyme\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 163.0pt; border: none; border-top: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\\\" colspan=\\\"2\\\" width=\\\"217\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eProduct (\\u0026mu;M)\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 191.35pt; border: none; border-top: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\\\" colspan=\\\"2\\\" width=\\\"255\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eEnzyme activity (\\u0026mu;mol\\u0026middot;h\\u003csup\\u003e\\u0026minus;1\\u003c/sup\\u003e\\u0026middot;mg\\u003csup\\u003e\\u0026minus;1\\u003c/sup\\u003e)\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eFloridoside\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 77.95pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eIsofloridoside\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 99.2pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"132\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eFloridoside\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 92.15pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"123\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003eIsofloridoside\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd style=\\\"width: 55.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"73\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS1\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e142.8\\u0026plusmn;18.5\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 77.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e275.1\\u0026plusmn;17.2\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"132\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e0.26\\u0026plusmn;0.02\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 92.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"123\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e0.50\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e\\u0026plusmn;0.02\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd style=\\\"width: 55.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"73\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS2\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003eND\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 77.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003eND\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"132\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003eND\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 92.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"123\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003eND\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd style=\\\"width: 55.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"73\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS3\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003eND\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 77.95pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e196.0\\u0026plusmn;23.1\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 99.2pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"132\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003eND\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 92.15pt; border: none; padding: 0in 5.4pt 0in 5.4pt;\\\" width=\\\"123\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e0.23\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e\\u0026plusmn;0.03\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr style=\\\"height: 3.5pt;\\\"\\u003e\\n\\u003ctd style=\\\"width: 55.05pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 3.5pt;\\\" width=\\\"73\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003ePhTPS4\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 85.05pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 3.5pt;\\\" width=\\\"113\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e119.6\\u0026plusmn;16.1\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 77.95pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 3.5pt;\\\" width=\\\"104\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e272.3\\u0026plusmn;14.2\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 99.2pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 3.5pt;\\\" width=\\\"132\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e0.22\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e\\u0026plusmn;0.02\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd style=\\\"width: 92.15pt; border: none; border-bottom: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 3.5pt;\\\" width=\\\"123\\\"\\u003e\\n\\u003cp style=\\\"text-align: center;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: windowtext;\\\"\\u003e0.61\\u003c/span\\u003e\\u003cspan style=\\\"font-size: 12.0pt; font-family: 'Times New Roman',serif; color: black;\\\"\\u003e\\u0026plusmn;0.01\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp style=\\\"line-height: 200%;\\\"\\u003e\\u003cspan style=\\\"font-size: 12.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003eNote: ND, none detected.\\u003c/span\\u003e\\u003c/p\\u003e\\n\\u003cp style=\\\"text-align: left; line-height: 200%;\\\"\\u003e\\u003cstrong\\u003e\\u003cspan style=\\\"font-size: 14.0pt; line-height: 200%; font-family: 'Times New Roman',serif;\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\"},{\"header\":\"Additional file legend\",\"content\":\" \\n\\u003cp\\u003eThe following materials are available in the online version of this article.\\u003c/p\\u003e\\n \\n\\u003cp\\u003eAdditional file 1: Figure S1. Multiple sequence alignments of the deduced amino acid sequences of the trehalose-6-phosphate\\n synthase (TPS) domains for PhTPSs with primary sequences of the TPS domains for other\\n species and GGPS domains for cyanobacteria. The conserved residues are marked by a\\n star. The accession numbers corresponding to the protein sequence of the different\\n species can be searched in Table S1. * indicates glucose-6-phosphate binding sites,\\n # indicates UDP-glucose binding sites. The light blue background indicates the unique\\n cyanobacteria GGPS protein residues; the yellow frame indicates the low conserved\\n residues of red algae, brown algae, and diatoms. The pink frame indicates the sequences\\n of the four TPS members of \\u003cem\\u003eP. haitanensis\\u003c/em\\u003e. (PDF 655 kb)\\u003c/p\\u003e\\n \\n\\u003cp\\u003eAdditional file 2: Figure S2. The phylogenetic tree of the only TPS and TPP protein are constructed, respectively.\\n (A) A NJ tree was constructed to show the phylogenetic relationships of the TPS proteins\\n using the functional-related amino acid sequences from prokaryotes, red algae, diatoms,\\n brown algae, fungi, green algae, plants, and animals. (B) A NJ tree was constructed\\n to show the phylogenetic relationships of the TPP proteins using the functional-related\\n amino acid sequences from prokaryotes, red algae, diatoms, brown algae, fungi, green\\n algae, plants, and animals. Their accession numbers are indicated in Table S1. There\\n were 1,000 bootstrap replicates. The red triangle shows PhTPS1–4. The functional domain\\n in each sequence was retrieved using the Conserved Domain tool in NCBI and is marked\\n by a superscript. (PDF 295 kb)\\u003c/p\\u003e\\n \\n\\u003cp\\u003eAdditional file 3: Table S1 \\n TPS and GGPS related genes and proteins in different organisms. (PDF 129 kb)\\u003c/p\\u003e\\n \\n\\n\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-plant-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"pbio\",\"sideBox\":\"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/pbio/default.aspx\",\"title\":\"BMC Plant Biology\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Pyropia haitanensis, (Iso)floridoside, Trehalose-6-phosphate synthase, Floridoside-6-phosphate synthase, Abiotic stress\",\"lastPublishedDoi\":\"10.21203/rs.2.10286/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.2.10286/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"Background\\n\\nThe heteroside floridoside is a primary photosynthetic product that is known to contribute to osmotic acclimation in almost all orders of Rhodophyta. However, the encoding genes and enzymes responsible for the synthesis of floridoside and its isomeric form, l- or d-isofloridoside, are poorly studied.\\n\\nResults\\n\\nHere, four putative trehalose-6-phosphate synthase (TPS) genes, designated as PhTPS1, PhTPS2, PhTPS3, and PhTPS4, were cloned and characterized from the red alga Pyropia haitanensis (Bangiophyceae). The deduced amino acid sequence is similar to the annotated TPS proteins of other organisms, especially the UDP-galactose substrate binding sites of PhTPS1, 2, which are highly conserved. Of these, PhTPS1, 4 are involved in the biosynthesis of floridoside and isofloridoside, with isofloridoside being the main product. PhTPS3 is an isofloridoside phosphate synthase, while PhTPS2 exhibits no activity. When challenged by desiccation, high temperature, and salt stress, PhTPS members were expressed to different degrees, but the responses to thermal stress and desiccation were stronger.\\n\\nConclusions\\n\\nThus, in P. haitanensis, PhTPSs encode the enzymatical activity of floridoside and isofloridoside phosphate synthase and are crucial for the abiotic stress defense response.\",\"manuscriptTitle\":\"Putative trehalose biosynthesis proteins function as differential floridoside-6-phosphate synthases to participate in the abiotic stress response in the red alga Pyropia haitanensis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2019-06-13 18:07:22\",\"doi\":\"10.21203/rs.2.10286/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Accept\",\"date\":\"2019-07-08T12:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2019-07-04T12:00:00+00:00\",\"index\":2,\"fulltext\":\"Recommendation: Accept without revision\\nForm responses:\\n---\\n* Are the methods appropriate and well described?: **Yes**\\n* Does the work include the necessary controls?: **Yes**\\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **Not relevant to this manuscript**\\n* Quality of written English: **Acceptable**\\n* Declaration of competing interests: **I declare no competing interests.**\\n\\nComments to Author:\\n---\\nnone\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2019-07-04T12:00:00+00:00\",\"index\":1,\"fulltext\":\"Recommendation: Accept without revision\\nForm responses:\\n---\\n* Are the methods appropriate and well described?: **Yes**\\n* Does the work include the necessary controls?: **Yes**\\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\\n* Quality of written English: **Acceptable**\\n* Declaration of competing interests: **I declare that I have no competing interests.**\\n\\nComments to Author:\\n---\\nThe authors have revised the manuscript according to previous comments.\"},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2019-06-20T12:00:00+00:00\",\"index\":2,\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2019-06-14T12:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2019-06-14T12:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2019-06-14T12:00:00+00:00\",\"index\":1,\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2019-06-12T12:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2019-06-12T12:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"\",\"date\":\"2019-05-20T12:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-plant-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"pbio\",\"sideBox\":\"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/pbio/default.aspx\",\"title\":\"BMC Plant Biology\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"69c670e1-58d9-4260-a076-e11d57372822\",\"owner\":[],\"postedDate\":\"June 13th, 2019\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":13510,\"name\":\"Plant Physiology and Morphology\"}],\"tags\":[],\"updatedAt\":\"\",\"versionOfRecord\":{\"articleIdentity\":\"rs-1315\",\"link\":\"https://doi.org/10.1186/s12870-019-1928-2\",\"journal\":{\"identity\":\"bmc-plant-biology\",\"isVorOnly\":false,\"title\":\"BMC Plant Biology\"},\"publishedOn\":\"2019-07-19 12:00:00\",\"publishedOnDateReadable\":\"July 19th, 2019\"},\"versionCreatedAt\":\"2019-06-13 18:07:22\",\"video\":\"\",\"vorDoi\":\"10.1186/s12870-019-1928-2\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12870-019-1928-2\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-1315\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"identity\":\"rs-1315\",\"version\":[\"v1\"]},\"buildId\":\"WrCJVZZCHTDjtuVLN7oU0\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}