{"paper_id":"4ca1f9b7-6e92-4272-9ba2-cd6029b823fa","body_text":"RNA-binding protein PCBP1regulated dry eye disease via ferroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article RNA-binding protein PCBP1regulated dry eye disease via ferroptosis Li Yang, Shengjia Hu, Pingping Yu, Muzhi Chen, Xinchang Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4776606/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Dry eye disease (DED) is a medical condition which is characterized by a wide range of symptoms and clinical signs related to insufficient or poor-quality of tears. In this study, we investigated a potential protein and related mechanisms involved in DED process. Methods Bioinformatics technology was conducted to find potential protein. PCR and Elisa assay were performed to detect gene and protein level in the tear samples collected from patients. Ex vivo DED model was built by hyperosmotic stress‑induced cell model and knockdown of aimed gene was achieved by lentivirus vector-mediated shRNA. CCK8 assay and flow cytometry was conducted to detect cell viability and apoptosis. Western blot was performed to detect oxidative stress-related proteins. Then ROS and iron level within cells were also detected by assay kit. Results The expression of PolyC-RNA binding protein 1 (PCBP1) of tear samples was higher in DED patients compared with non-DED controls both in gene and protein level. In ex vivo DED model, PCBP1 could decrease corneal epithelial cell proliferation and increase cell apoptosis. Moreover, PCBP1 also decreased oxidative stress-related protein level as well as increased ROS and iron level within cells. Conclusion PCBP1 could influence dry eye disease via ferroptosis by regulating cell viability and oxidative stress process. dry eye disease PCBP1 oxidative stress ferroptosis corneal epithelial cell Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Dry eye syndrome, also known as dry eye disease (DED), affects approximately 10–30% of the population in China[ 1 ]. It is characterized by reduced tear production, abnormalities in tear film stability, excessive tear evaporation, or an imbalance in tear composition[ 2 , 3 ]. Individuals with DED often experience symptoms such as dryness, redness, pain, blurred vision, light sensitivity, and a burning sensation[ 4 ]. Severe DED can lead to corneal damage, including ulcers, erosions, or even permanent scarring[ 5 ]. Moreover, the persistent discomfort and pain can be emotionally distressing, significantly reducing quality of life and affecting daily activities[ 6 ]. In clinical practice, common therapeutic approaches include prescribed medications like artificial tears and anti-inflammatory eye drops; lifestyle modifications such as wearing moisture chamber spectacles and engaging in specific exercises; and physiotherapy techniques like meibomian gland massage and acupuncture[ 7 – 9 ]. Although current treatments primarily focus on symptomatic relief, a substantial number of patients with complex medical conditions or pathogenic factors rarely achieve significant efficacy[ 10 ]. Therefore, investigating the mechanisms of this disease may lead to more effective treatment options for DED. Several biochemical mechanisms contribute to the development of DED. Chronic inflammation, widely confirmed to affect tear secretion, stability, and quality, triggers immune system abnormalities and infections[ 11 ]. Additionally, abnormal ocular surface structures, such as meibomian gland dysfunction, may increase tear evaporation[ 12 ]. Furthermore, alterations in certain chemical components within the body, such as hormonal fluctuations, particularly in females, medication side effects, and nutritional deficiencies, are also associated with DED[ 13 – 14 ]. These factors often interact, exacerbating DED. Recent studies report that oxidative stress plays a significant role in the development and progression of dry eye disease (DED)[ 15 ]. Oxidative stress occurs when there is an imbalance between the production of reactive oxygen species (ROS) and antioxidants[ 16 ]. In DED, this imbalance leads to increased production of ROS such as superoxide radicals and hydrogen peroxide, resulting in damage to the cornea, conjunctiva, and meibomian gland[ 17 ]. Furthermore, ROS can induce cellular dysfunction and injury by oxidizing lipids, proteins, and DNA, thereby triggering inflammatory responses that exacerbate the disruption of the ocular microenvironment[ 18 – 19 ]. Additionally, oxidative stress can activate the ocular immune system, amplifying inflammation in DED[ 19 ]. Poly (rC) binding protein 1 (PCBP-1), a prominent member of the PCBP protein family, is expressed in various human tissues. Initially identified as part of the heterogeneous nuclear ribonucleoprotein complex hnRNP E1, PCBP1 influences various cellular processes, including mRNA stability, translation, and transcription, which affect gene expression[ 20 ]. The loss of PCBP1 is linked to cell cycle delays, DNA damage, and reduced viability[ 21 ]. PCBP1 also acts as an iron molecular chaperone, controlling the chemical reactions in cells related to iron perception and transport[22,23]. Ferroptosis, a type of cell death discovered relatively recently, differs from traditional forms like apoptosis and necrosis[24]. It is characterized by iron-dependent lipid peroxide accumulation within cells[ 25 ]. Recent research indicates that ferroptosis may play a role in DED. One study revealed that cells from the lacrimal glands of DED patients were more susceptible to ferroptosis compared to those from healthy individuals[ 26 ]. Another study demonstrated that inhibiting ferroptosis reduced DED symptoms in an animal model[27]. Notably, oxidative stress is a primary driver of ferroptosis, particularly due to lipid peroxidation and iron's role in ROS formation via the Fenton reaction[ 28 ]. Given the unknown specific mechanisms by which ferroptosis and oxidative stress influence DED, thorough investigations are crucial. Therefore, this paper seeks to identify a key protein via bioinformatics analysis and further explore its involvement in DED through ferroptosis or oxidative stress in a DED model. protein was involved in DED via ferroptosis or oxidative stress in DED model. Methods Bioinformatics analysis Potential protein was discovered via bioinformatics technology and related data was available via ProteomeXchange with identifier PXD012917. The PANTHER (Protein ANalysis THrough Evolutionary Relationships) Classification System was designed to classify proteins to facilitate high-throughput analysis. We further performed t-test to screen the differentially expressed proteins in the DED patient group and control group. The threshold values for identifying differentially expressed proteins was fold change (FC) ≥ 1.5 or ≤ 0.67. Gene Ontology (GO) enrichment analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) of differentially expressed proteins were performed with the KEGG Ortholog Based Annotation System ( https://kobas.cbi.pku.edu.cn/genelist ). Study population and tear collection The study participants comprised 6 DED patients and 6 non-DED controls. The protocol of the clinical study conformed to the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of the second affiliated hospital of Zhejiang Chinese Medical University (2020-KL-011-01). Tear samples were taken after informed consent were signed. Non-stimulated tear samples of 12 patients in total were collected by using the Schirmer strip method with 10 mm filter paper, and approximately 7 µL tear sample per patient was placed in microtubes and stored at −-80°C for further examination. RNA Isolation and Quantitative Real-Time PCR Total RNA from tears was isolated using PicoPure RNA isolation kit (Arcturus, Mountain View, CA) according to manufacturer’s protocol. RNA was transcribed to cDNA using a reverse transcription kit (PrimeScript RT reagent kit; TaKaRa, Shiga, Japan). Quantitative real-time PCR was performed with a StepOne Real-Time detection system (Applied Biosystems, Foster City, CA) using an SYBR Premix Ex Taq Kit (Takara). The amplification program included an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10s and 60°C for 30s. Subsequently, a melt curve analysis was performed to access amplification specificity. Differential gene expression was calculated according to the comparative threshold cycle (CT) method and normalized to GAPDH expression as an internal control. The primers were used as listed: GAPDH, TGACTTCAACAGCGACACCCA and CACCCTGTT GCTGTAGCCAAA; PCBP1, CGGAAAGGAAGTAGGAAGG and AAAGATGGC ATTGGTGGG. Elisa assay Tear samples were analyzed to determine the concentrations of PCBP1 according to the manufacturer’s protocol. Briefly, plates were treated with coating antibody at 4°C overnight, washed with PBS, and blocked with assay buffer at room temperature for 2 h. Biotin-conjugated detector antibodies were added to microwells and the plates were incubated at room temperature for 2 h. After incubation, plates were washed 5 times and added with HRP. After 1 h of incubation at room temperature, plates were washed and TMB substrate solution was added to all wells for color formation. Plates were incubated at room temperature and then stop solution was added. Absorbance of each microwell was read using 450 nm or 620 nm. Hyperosmotic stress‑induced cell model The human immortalized corneal epithelial cells (HCE, CP-H128) were purchased from Procell (Wuhan, China). HCE were cultured on plates in a humidified atmosphere containing 5% carbon dioxide (CO 2 ) at 37°C. Dulbecco’s modified Eagle’s medium/F12 containing 5µg/mL insulin, 10 ng/mL human epidermal growth factor, 10% fetal bovine serum, and 1% penicillin/streptomycin was used as the culture medium. HCE were then treated for 24 hours in hyperosmolar condition by adding 94 mM sodium chloride to induce ex vivo DED model. Lentivirus-mediated knockdown of PCBP1 Lentivirus vectors for PCBP1 shRNA were used to examine the functions of PCBP1. A third generation of the self-inactivating lentiviral vector was used to express short hairpin RNA (shRNA) targeting the PCBP1 sequence (PCBP1-shRNA lentivirus). A non-targeting sequence was used as a negative control lentivirus. HCE were infected with PCBP1-shRNA lentivirus vectors (shPCBP1) and NC lentivirus vectors (shCtrl). After 5 days of transfection, HCE were collected to determine the knock-down effect by Western blot analysis. Flow cytometry Cell apoptosis was determined by flow cytometry. Briefly, HCE were grown to confluence in 35-mm dishes as described above, followed with the addition of 200 ng/mL netrin-1 and incubation for 72 h at 37℃. Afterwards, 0.05% trypsin in PBS buffer was applied to detach the cells from the plate, pelleted (centrifugation for 5min at 300 g), washed for twice in PBS with 1% bovine serum albumin (BSA), resuspended in the same buffer and fixed with 70% ice-cold ethanol. The data were acquired using a FACS can flow cytometer (BD Bio-sciences, Franklin Lakes, USA). ROS Detection The production of ROS in HCE was measured following the protocol of the manufacturer. Differentially-treated HCE as described above were washed with PBS once and then were incubated with dihydroethidium (CA1420, Solarbio, China) at 37°C for 30 minutes. Then washed and detected fluorescence (Ex = 370 nm and Em = 420 nm). Cell Viability Assay Cell viability was assessed using a Cell Counting Assay Kit-8 (Dojindo Molecular Technologies, Kumamoto, Japan) according to the manufacturer’s protocol. Differentially-treated HCE as described above were seeded at density of 2000 cells per well in 96-well plates. At the time points of day1, day2, day3, day4 and day5, the medium was replaced by Cell Counting Assay Kit-8 constituted media and incubated for 4 hours at 37°C in the dark. Absorbance at 450 nm was measured using a microplate reader (Bio-Tek, Winooski, VT). Western blot analysis Differentially-treated HCE as described above were extracted with cold lysis buffer comprising 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, and protease and phosphatase inhibitor cocktails. Equal amounts of protein extracts were subjected to electrophoresis on 8% or 10% SDS-PAGE and then electrophoretically transferred to PVDF membrane. After blocking in 1% BSA, the membranes were incubated with primary antibodies of PCBP1(ab168377, 1:1000, Abcam), FTH1(ab155282, 1:2000, Abcam), GPX4 (ab240277, 1:2000, Abcam), SLC9A11 (17398-1-AP, 1:2000, Proteintech) and GAPDH (AF7021, 1:2000, Affinity) overnight at 4°C. After 3 washes with Tris-buffered saline with 0.05% Tween-20 for 10 minutes. The membranes were incubated with HRP-conjugated goat anti-rabbit (S0001, 1:3000, Affinity) for 1 hour. The results were visualized by enhanced chemiluminescence reagents and recorded with an imaging system (ChemiDoc XRS, Bio-Rad, Hercules, CA, USA). Iron analysis An Iron Assay Kit (ab83366, Abcam, Cambridge, UK) was used for chromatic determination of cellular iron levels. Iron assay buffer was added to ice for sufficient homogenization, centrifuged at 4°C 16,000×g for 10 min, and the supernatant was left for later use. 50 µL samples were added to 96-well plates, replenished to 100 µL with iron assay buffer. Next, 5 µL buffer was added for divalent iron assays and 5 µL iron reducer was added to incubate at 37°C for 30 min. Then, 100 µL of iron probe was added per well at 37°C for 60 min and determined at 593 nm. The concentration of iron in the sample was calculated according to the standard curve. Statistical Analysis All summary data are reported as means ± SD. Statistical analysis was performed with unpaired t-test for two-group comparisons or one-way analysis of variance for more than two group comparisons using GraphPad Prism 6.0 software. P < 0.05 was considered statistically significant. Results PCBP1 was highly expressed in DED patients The database analysis indicated that polyC-RNA binding protein 1 (PCBP1) was differentially expressed between DED patients and non-DED controls (Fig. 1 A-B). To further validate these bioinformatics findings, tear samples from 12 subjects, including 6 DED patients and 6 non-DED controls, were collected. qPCR analysis revealed that PCBP1 expression was significantly higher in DED patients (p < 0.001) (Fig. 1 C-D). Additionally, ELISA results confirmed that PCBP1 concentration was elevated in DED patients (p < 0.001) (Fig. 1 E). These results provided initial evidence that PCBP1 might be associated with DED, underscoring the need for further studies to elucidate molecular mechanisms. PCBP1 decreased HCE proliferation in ex vivo DED model To explore the role of PCBP1 in DED, an ex vivo DED model was developed in human corneal epithelial cells (HCEs), and PCBP1 knockdown was performed using a lentivirus vector-mediated shRNA. Western blot analysis confirmed the successful knockdown of PCBP1, and showed an upregulation of PCBP1 protein levels in HCEs with the ex vivo DED model compared to normal HCEs (Fig. 2 A). The CCK8 assay demonstrated that HCE proliferation in the ex vivo DED model was decreased compared to normal HCEs, but PCBP1 knockdown partially restored HCE proliferation (Fig. 2 B). These findings suggest that PCBP1 may reduce HCE proliferative capacity during DED. PCBP1 increased HCE apoptosis in ex vivo DED model Flow Flow cytometry analysis showed that apoptosis levels were higher in HCEs in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown reduced apoptosis levels (Fig. 3 A-B). This result indicated that PCBP1 could induce apoptosis in HCEs during DED. PCBP1 increased ROS of HCE in ex vivo DED model ROS analysis revealed that ROS levels were higher in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown decreased ROS production in the model (Fig. 4 ), suggesting that PCBP1 may increase ROS levels and cause oxidative stress-mediated injuries in cells. PCBP1 decreased ferroptosis-related protein in ex vivo DED model FerroptosisFerroptosis, characterized by oxidative stress from iron accumulation, involves oxidative stress-related proteins like GPX4, SLC7A11, and FTH1, which protect cells from lipid peroxidation[ 29 ]. Western blot analysis showed that the protein levels of GPX4, SLC7A11, and FTH1 were downregulated in HCEs in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown alleviated this effect by upregulating their levels (Fig. 5 ). These findings suggest that PCBP1 might induce oxidative stress in HCEs through ferroptosis during DED. PCBP1 increased iron level in ex vivo DED model To further investigate the ferroptosis-related mechanisms during DED, the level of free iron in cells was examined. The results indicated that free iron was increased in HCEs in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown reduced iron levels (Fig. 6 ). This finding suggests that PCBP1 is likely to induce apoptosis in HCEs via ferroptosis. Discussion Dry eye disease (DED) is a complex condition that affects millions worldwide. Chronic inflammation is considered a primary pathogenic factor in DED, with dysregulated cell death triggering and amplifying this inflammation[ 30 ]. During DED progression, the normal structure and function of corneal epithelial cells are compromised due to tear film instability and increased tear osmolality. This disruption induces the release of various innate inflammatory factors, further contributing to DED[ 31 ]. Despite this understanding, much of DED’s pathogenesis, particularly at the molecular level, remains unexplored. This study focuses on the role of the polyC-RNA binding protein 1 (PCBP1) in DED, examining its potential involvement in oxidative stress and ferroptosis within corneal epithelial cells. We initially observed that PCBP1 expression was significantly higher in DED patients compared to non-DED controls based on bioinformatics analysis. PolyC-RNA binding protein 1 (PCBP1) is an RNA-binding protein involved in various biological processes, including gene transcription, RNA stability, and translation regulation [ 32 ]. PCBP1 is known to play a crucial role in the regulation of the immune response, particularly in the context of inflammatory diseases and cancer. Ansa-Addo et al. demonstrated that PCBP1 acts as a global regulatory node, disrupting immunosuppression in cancer by balancing regulatory T cells (Tregs) and effector T cells, which are key regulators in disease pathogenesis and progression[ 33 ]. This regulation is vital for understanding the pathogenesis of many diseases, including DED[ 34 ]. In a recent study, PCBP1 was shown to enhance the production of granulocyte-macrophage colony-stimulating factor (GM-CSF) by helper T cells (Th1)[35]. Based on these findings, we hypothesized that PCBP1 could play a significant role in the pathogenesis of DED and might serve as a promising biomarker. Further research indicated that PCBP1 expression was significantly elevated in both corneal and conjunctival epithelial cells of DED patients, suggesting its involvement in the disease's progression[ 36 ]. In a DED mouse model, inhibiting PCBP1 expression was found to reduce apoptosis in corneal epithelial cells, alleviate inflammation, and mitigate the pathological symptoms of DED [ 37 ]. Moreover, additional studies have suggested that environmental factors such as light exposure, tobacco, and alcohol could induce DED by modulating PCBP1 expression, thereby complicating the investigation of PCBP1-related regulatory mechanisms [ 38 ]. To better understand how PCBP1 contributes to DED pathogenesis, we utilized an ex vivo DED model induced by hyperosmotic stress. In this model, PCBP1 was successfully knocked down using a lentivirus vector-mediated shRNA. The downregulation of PCBP1 led to decreased cell proliferative ability, suggesting its role in the regeneration and maintenance of the corneal epithelium, a critical aspect of ocular health. Conversely, PCBP1 knockdown also increased cell apoptosis, indicating that elevated PCBP1 levels may contribute to the loss of corneal epithelial cells, a hallmark of DED. One of the most intriguing findings of this study is the link between PCBP1 and ferroptosis, a form of cell death characterized by iron-dependent lipid peroxidation. A vicious cycle of ocular surface inflammation and corneal epithelial defects has been shown to promote DED development. Although ferroptosis is closely associated with various human diseases, such as acute kidney injury, neurological disorders, and various tumors, its role in DED has been less studied[ 39 , 40 ]. Here, we present evidence that ferroptosis occurs in DED. As an iron chaperone, PCBP1 is crucial in maintaining iron homeostasis by binding and delivering iron to ferritin and other iron-dependent proteins in mammalian cells[ 41 , 42 ]. Recent studies have confirmed that PCBP1 selectively coordinates Fe-GSH formation[ 43 ]. We observed that PCBP1 knockdown decreased the levels of ferroptosis-related proteins, suggesting its pivotal role in mediating ferroptosis in DED. Furthermore, PCBP1 knockdown reduced oxidative stress-related proteins, providing additional evidence of its involvement in oxidative stress, a known contributor to DED pathogenesis. Oxidative stress leads to cellular damage and inflammation, exacerbating DED symptoms. Moreover, PCBP1 knockdown also resulted in reduced levels of reactive oxygen species (ROS) and iron, aligning with the observed decreases in ferroptosis-related proteins and oxidative stress markers. This suggests that PCBP1 may regulate ROS and iron homeostasis, impacting the redox balance within corneal epithelial cells. The findings regarding the impact of PCBP1 on ferroptosis are particularly noteworthy. Ferroptosis is a form of cell death characterized by distinct molecular pathways, and its link with dry eye disease (DED) has been underexplored. Understanding PCBP1's role in ferroptosis could open new avenues for therapeutic interventions targeting this specific cell death mechanism. Moreover, changes in reactive oxygen species (ROS) and iron levels following PCBP1 knockdown provide further evidence of its role in regulating oxidative stress, a well-established factor in DED that contributes to ocular surface damage and inflammation. Identifying PCBP1 as a potential modulator of ROS and iron levels suggests that targeting this protein could offer a novel approach to mitigate oxidative stress in DED. This study lays a solid foundation for further research in this area. The elevated expression of PCBP1 in DED patients underscores its potential significance in the disease's development. PCBP1 appears to affect various aspects of corneal epithelial cell function, including cell viability, apoptosis, and particularly its roles in ferroptosis and oxidative stress. Future investigations could delve deeper into the specific molecular pathways through which PCBP1 influences ferroptosis and oxidative stress. Additionally, exploring the therapeutic potential of targeting PCBP1 or related pathways in DED could yield significant clinical implications. Conclusion PCBP1 emerged as a key player in the complex pathogenesis of DED. Its involvement in ferroptosis and oxidative stress added a novel dimension to our understanding of DED mechanisms. Further research in this area has the potential to lead to innovative therapeutic strategies for this ocular condition. Declarations Conflict of interest We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript. Ethical approval The protocol of the clinical study conformed to the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of the second affiliated hospital of Zhejiang Chinese Medical University (2020-KL-011-01). Gene Ontology (GO) enrichment analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) of differentially expressed proteins were performed with the KEGG Ortholog Based Annotation System ( https://kobas.cbi.pku.edu.cn/genelist ). Consent of publication Not applicable. Consent to participant Not applicable. Funding This work was supported by the National Natural Science Foundation of China (grant number 82074341) and the Medical and Health Science and Technology Program of Zhejiang Province (grant number 2022ZH037). Author Contribution Li Yang: Writing original draft, Data curation, Conceptualization. Shengjia Hu: Validation, Formal analysis. Pingping Yu and Muzhi Chen: Investigation. Xinchang Wang: Resources, Funding acquisition. All authors diligently reviewed and granted their approval for the concluding version of the manuscript. Data availability Not applicable. References Tsubota K, Yokoi N, Watanabe H, et al. A New Perspective on Dry Eye Classification: Proposal by the Asia Dry Eye Society. Eye & contact lens 2020;46 Suppl 1:S2-s13. Tsubota K, Pflugfelder SC, Liu Z, et al. Defining Dry Eye from a Clinical Perspective. International journal of molecular sciences 2020;21. Craig JP, Nichols KK, Akpek EK, et al. TFOS DEWS II Definition and Classification Report. The ocular surface 2017;15:276-283. Huang R, Su C, Fang L, et al. Dry eye syndrome: comprehensive etiologies and recent clinical trials. International ophthalmology 2022;42:3253-3272. Bustamante-Arias A, Ruiz Lozano RE, Rodriguez-Garcia A. Dry eye disease, a prominent manifestation of systemic autoimmune disorders. European journal of ophthalmology 2022;32:3142-3162. Hirabayashi KJ, Akpek EK, Ahmad S. Outcome Measures to Assess Dry Eye Severity: A Review. Ocular immunology and inflammation 2022;30:282-289. Mohamed HB, Abd El-Hamid BN, Fathalla D, et al. Current trends in pharmaceutical treatment of dry eye disease: A review. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences 2022;175:106206. Mittal R, Patel S, Galor A. Alternative therapies for dry eye disease. Current opinion in ophthalmology 2021;32:348-361. Lin ZS, Yu DS, Zhao JL, et al. [Effect of acupuncture on dry eye and tear inflammatory factors]. Zhongguo zhen jiu = Chinese acupuncture & moxibustion 2022;42:1379-1383. Gomes JAP, Santo RM. The impact of dry eye disease treatment on patient satisfaction and quality of life: A review. The ocular surface 2019;17:9-19. Rao SK, Mohan R, Gokhale N, et al. Inflammation and dry eye disease-where are we? International journal of ophthalmology 2022;15:820-827. McCann P, Abraham AG, Mukhopadhyay A, et al. Prevalence and Incidence of Dry Eye and Meibomian Gland Dysfunction in the United States: A Systematic Review and Meta-analysis. JAMA ophthalmology 2022;140:1181-1192. Gorimanipalli B, Khamar P, Sethu S, et al. Hormones and dry eye disease. Indian journal of ophthalmology 2023;71:1276-1284. Pellegrini M, Senni C, Bernabei F, et al. The Role of Nutrition and Nutritional Supplements in Ocular Surface Diseases. Nutrients 2020;12. Dogru M, Kojima T, Simsek C, et al. Potential Role of Oxidative Stress in Ocular Surface Inflammation and Dry Eye Disease. Investigative ophthalmology & visual science 2018;59:Des163-des168. Forman HJ, Zhang H. Targeting oxidative stress in disease: promise and limitations of antioxidant therapy. Nature reviews Drug discovery 2021;20:689-709. Navel V, Sapin V, Henrioux F, et al. Oxidative and antioxidative stress markers in dry eye disease: A systematic review and meta-analysis. Acta ophthalmologica 2022;100:45-57. Perez-Garmendia R, Lopez de Eguileta Rodriguez A, Ramos-Martinez I, et al. Interplay between Oxidative Stress, Inflammation, and Amyloidosis in the Anterior Segment of the Eye; Its Pathological Implications. Oxidative medicine and cellular longevity 2020;2020:6286105. Honisch C, Rodella U, Gatto C, et al. Oxidative Stress and Antioxidant-Based Interventional Medicine in Ophthalmology. Pharmaceuticals (Basel, Switzerland) 2023;16. Zhang, T., Huang, X. H., Dong, L., Hu, D., Ge, C., Zhan, Y. Q., Xu, W. X., Yu, M., Li, W., Wang, X., Tang, L., Li, C. Y., & Yang, X. M. (2010). PCBP-1 regulates alternative splicing of the CD44 gene and inhibits invasion in human hepatoma cell line HepG2 cells. Molecular cancer, 9, 72. Lin L, Li H, Shi D, et al. Depletion of C12orf48 inhibits gastric cancer growth and metastasis via up-regulating Poly r(C)-Binding Protein (PCBP) 1. BMC Cancer. 2022;22(1):123. Published 2022 Jan 31. Yue L, Luo Y, Jiang L, Sekido Y, Toyokuni S. PCBP2 knockdown promotes ferroptosis in malignant mesothelioma. Pathol Int. 2022;72(4):242-251. Jiang L, Zheng H, Ishida M, et al. Elaborate cooperation of poly(rC)-binding proteins 1/2 and glutathione in ferroptosis induced by plasma-activated Ringer's lactate. Free Radic Biol Med. 2024;214:28-41. Li J, Cao F, Yin HL, et al. Ferroptosis: past, present and future. Cell death & disease 2020;11:88. Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nature reviews Molecular cell biology 2021;22:266-282. Liu X, Cui Z, Chen X, et al. Ferroptosis in the Lacrimal Gland Is Involved in Dry Eye Syndrome Induced by Corneal Nerve Severing. Investigative ophthalmology & visual science 2023;64:27. Zuo X, Zeng H, Wang B, et al. AKR1C1 Protects Corneal Epithelial Cells Against Oxidative Stress-Mediated Ferroptosis in Dry Eye. Investigative ophthalmology & visual science 2022;63:3. Su LJ, Zhang JH, Gomez H, et al. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxidative medicine and cellular longevity 2019;2019:5080843. Forcina GC, Dixon SJ. GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis. Proteomics 2019;19:e1800311. Messmer EM, Ahmad S, Benitez Del Castillo JM, et al. Management of inflammation in dry eye disease: Recommendations from a European panel of experts. Eur J Ophthalmol. 2023;33(3):1294-1307. Wei Y, Asbell PA. The core mechanism of dry eye disease is inflammation [published correction appears in Eye Contact Lens. 2014 Sep;40(5):311]. Eye Contact Lens. 2014;40(4):248-256. Craig JP, Nichols KK, Akpek EK, et al. TFOS DEWS II Definition and Classification Report. Ocul Surf. 2017 Jul;15(3):276-283. Ansa-Addo EA, et al. RNA binding protein PCBP1 is an intracellular immune checkpoint for shaping T cell responses in cancer immunity. Sci. Adv. 2020;6(22):eaaz3865. doi: 10.1126/sciadv.aaz3865. Ratay, M. L., Glowacki, A. J., Balmert, S. C., Acharya, A. P., Polat, J., Andrews, L. P., Fedorchak, M. V., Schuman, J. S., Vignali, D. A. A., & Little, S. R. (2017). Treg-recruiting microspheres prevent inflammation in a murine model of dry eye disease. Journal of controlled release : official journal of the Controlled Release Society, 258, 208–217. Wang, Z., Yin, W., Zhu, L., Li, J., Yao, Y., Chen, F., Sun, M., Zhang, J., Shen, N., Song, Y., & Chang, X. (2018). Iron Drives T Helper Cell Pathogenicity by Promoting RNA-Binding Protein PCBP1-Mediated Proinflammatory Cytokine Production. Immunity, 49(1), 80–92.e7. Wei Y, Asbell PA. The core mechanism of dry eye disease is inflammation. Eye Contact Lens. 2014 Jul;40(4):248-56. Zhou X, You F, Chen H, et al. Poly(C)-binding protein 1 (PCBP1) mediates housekeeping degradation of mitochondrial antiviral signaling (MAVS). Cell Res. 2012 Apr;22(4):717-27. Zhao H, Wei Z, Shen G, et al. Poly (rC)-binding proteins as pleiotropic regulators in hematopoiesis and hematological malignancy[J]. Frontiers in Oncology, 2022, 12: 1045797. Mou Y, Wang J, Wu J, et al... Ferroptosis, a new form of cell death: opportunities and challenges in cancer. J Hematol Oncol. 2019; 12: 34 Weiland A, Wang Y, Wu W, et al... Ferroptosis and its role in diverse brain diseases. Mol Neurobiol. 2019; 56: 4880–4893. Ryu MS, et al. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis. J. Clin. Invest. 2017;127(5):1786–1797. doi: 10.1172/JCI90519 Philpott CC. Coming into view: Eukaryotic iron chaperones and intracellular iron delivery. J. Biol. Chem. 2012;287(17):13518–13523. doi: 10.1074/jbc.R111.326876. Patel SJ, Frey AG, Palenchar DJ, Achar S, Bullough KZ, Vashisht A, et al. A PCBP1-BolA2 chaperone complex delivers iron for cytosolic [2Fe-2S] cluster assembly. Nat Chem Biol 2019;15:872–881. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4776606\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":334636909,\"identity\":\"344f24c5-7c1e-4df9-879f-ff11d355df8c\",\"order_by\":0,\"name\":\"Li Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the Second Affiliated Hospital of Zhejiang Chinese Medical University (The Xin Hua Hospital of Zhejiang Province)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Li\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":334636910,\"identity\":\"f27a9e07-96cf-4bcc-8682-288241a27a0b\",\"order_by\":1,\"name\":\"Shengjia Hu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the Second Affiliated Hospital of Zhejiang Chinese Medical University (The Xin Hua Hospital of Zhejiang Province)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shengjia\",\"middleName\":\"\",\"lastName\":\"Hu\",\"suffix\":\"\"},{\"id\":334636911,\"identity\":\"e78f7eb7-1c5e-4e62-b4f9-2b3118e8e661\",\"order_by\":2,\"name\":\"Pingping Yu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the Second Affiliated Hospital of Zhejiang Chinese Medical University (The Xin Hua Hospital of Zhejiang Province)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Pingping\",\"middleName\":\"\",\"lastName\":\"Yu\",\"suffix\":\"\"},{\"id\":334636912,\"identity\":\"288e6836-58c5-4075-aeef-f2cdf1650b53\",\"order_by\":3,\"name\":\"Muzhi Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chinese Medical University (The Xin Hua Hospital of Zhejiang Province)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Muzhi\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":334636913,\"identity\":\"7fecc537-b6ca-4f17-a67e-0dcfd1ef928e\",\"order_by\":4,\"name\":\"Xinchang Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAp0lEQVRIiWNgGAWjYNACAxsefvYG0rSkyUj2HCDNmsM2BjcciFTLz3/84eeCgvM8DDcYGD98zCFCi+SMHGPpGQa3eRhnNzBLztxGhBaDGzwM0jxALcwyB9iYeYnScv744988Bud42CQSiNVyIMEMaMsBHh6itQD9YmbNY5DMI8FzsJk4vwBD7PFtnj929vbHmw9++EiMFiTA2ECa+lEwCkbBKBgFuAEA8RgvNSj0eGsAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Chinese Medical University (The Xin Hua Hospital of Zhejiang Province)\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Xinchang\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-07-21 11:47:22\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4776606/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4776606/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":63290057,\"identity\":\"71878d2e-e26e-4422-ab76-59358605eadc\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 14:09:53\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":80675,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A-B) The analysis of PCBP1 based on the database. (C) Tear samples from 12 subjects were collected to analyze the PCBP1 mRNA level. (D) qPCR analysis PCBP1 expression(***p \\u0026lt; 0.001). (E) Elisa analyzed PCBP1 concentration in DED patients and non-DED controls (***p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FIgure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/ec51261c0dfddd47804a0138.jpg\"},{\"id\":63288960,\"identity\":\"76ffea91-7ee8-4577-ae80-daf28baa16fa\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 14:01:53\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":57016,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A) Western blot analysis to confirm the PCBP1 protein levelof PCBP1 shRNA group. (B) The proliferation of HCE in ex vivo DED model while PCBP1 knockdown by CCK8 assay. Means ± SD (n = 3, ***p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/1269d827fcb74d0215da05de.jpg\"},{\"id\":63288962,\"identity\":\"edc8db3c-c6fc-4b3f-acdd-c4f6131648c6\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 14:01:53\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":73661,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A) Flow cytometry analysis for PCBP1 knockdown in ex vivo DED model and normal HCE. (B) Quantification analysis of apoptotic/necrotic cell populations (n = 3, ***p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/3764ef0dbb59b969ec07b183.jpg\"},{\"id\":63290059,\"identity\":\"7659fd42-c807-48d7-bc7b-ef8e6c774b6b\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 14:09:53\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":348459,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFluorescence images of HCE cells in ex vivo DED model and normal HCE. (scale bars: 50 μm).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/b28c26e8f8c6ac34275ffb99.jpg\"},{\"id\":63288959,\"identity\":\"428d8e9b-08b0-40d3-b49b-0540922996bd\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 14:01:53\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":52310,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eWestern blot analysis of GPX4, SLC7A11 and FTH1protein levels in HCE. Means ± SD (n = 3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/f422109e88a787a00ca7bfc6.jpg\"},{\"id\":63290058,\"identity\":\"d801e671-7f7b-4ec8-bf42-598b1502dfb1\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 14:09:53\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":73279,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe level of free iron in HCE cells was examined. Means ± SD (n = 3, ***p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/e8b7b2f647c5e52f47ecacec.jpg\"},{\"id\":63472121,\"identity\":\"54ab6831-7fb9-4322-8a47-9ff374e75b3c\",\"added_by\":\"auto\",\"created_at\":\"2024-08-28 13:27:40\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1152040,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4776606/v1/8e40d7e4-6032-4364-b3a1-4c085641139c.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"RNA-binding protein PCBP1regulated dry eye disease via ferroptosis\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eDry eye syndrome, also known as dry eye disease (DED), affects approximately 10\\u0026ndash;30% of the population in China[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. It is characterized by reduced tear production, abnormalities in tear film stability, excessive tear evaporation, or an imbalance in tear composition[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Individuals with DED often experience symptoms such as dryness, redness, pain, blurred vision, light sensitivity, and a burning sensation[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Severe DED can lead to corneal damage, including ulcers, erosions, or even permanent scarring[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Moreover, the persistent discomfort and pain can be emotionally distressing, significantly reducing quality of life and affecting daily activities[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIn clinical practice, common therapeutic approaches include prescribed medications like artificial tears and anti-inflammatory eye drops; lifestyle modifications such as wearing moisture chamber spectacles and engaging in specific exercises; and physiotherapy techniques like meibomian gland massage and acupuncture[\\u003cspan additionalcitationids=\\\"CR8\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Although current treatments primarily focus on symptomatic relief, a substantial number of patients with complex medical conditions or pathogenic factors rarely achieve significant efficacy[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Therefore, investigating the mechanisms of this disease may lead to more effective treatment options for DED.\\u003c/p\\u003e \\u003cp\\u003eSeveral biochemical mechanisms contribute to the development of DED. Chronic inflammation, widely confirmed to affect tear secretion, stability, and quality, triggers immune system abnormalities and infections[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Additionally, abnormal ocular surface structures, such as meibomian gland dysfunction, may increase tear evaporation[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Furthermore, alterations in certain chemical components within the body, such as hormonal fluctuations, particularly in females, medication side effects, and nutritional deficiencies, are also associated with DED[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. These factors often interact, exacerbating DED.\\u003c/p\\u003e \\u003cp\\u003eRecent studies report that oxidative stress plays a significant role in the development and progression of dry eye disease (DED)[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Oxidative stress occurs when there is an imbalance between the production of reactive oxygen species (ROS) and antioxidants[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. In DED, this imbalance leads to increased production of ROS such as superoxide radicals and hydrogen peroxide, resulting in damage to the cornea, conjunctiva, and meibomian gland[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Furthermore, ROS can induce cellular dysfunction and injury by oxidizing lipids, proteins, and DNA, thereby triggering inflammatory responses that exacerbate the disruption of the ocular microenvironment[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Additionally, oxidative stress can activate the ocular immune system, amplifying inflammation in DED[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003ePoly (rC) binding protein 1 (PCBP-1), a prominent member of the PCBP protein family, is expressed in various human tissues. Initially identified as part of the heterogeneous nuclear ribonucleoprotein complex hnRNP E1, PCBP1 influences various cellular processes, including mRNA stability, translation, and transcription, which affect gene expression[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. The loss of PCBP1 is linked to cell cycle delays, DNA damage, and reduced viability[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. PCBP1 also acts as an iron molecular chaperone, controlling the chemical reactions in cells related to iron perception and transport[22,23].\\u003c/p\\u003e \\u003cp\\u003eFerroptosis, a type of cell death discovered relatively recently, differs from traditional forms like apoptosis and necrosis[24]. It is characterized by iron-dependent lipid peroxide accumulation within cells[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Recent research indicates that ferroptosis may play a role in DED. One study revealed that cells from the lacrimal glands of DED patients were more susceptible to ferroptosis compared to those from healthy individuals[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Another study demonstrated that inhibiting ferroptosis reduced DED symptoms in an animal model[27]. Notably, oxidative stress is a primary driver of ferroptosis, particularly due to lipid peroxidation and iron's role in ROS formation via the Fenton reaction[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eGiven the unknown specific mechanisms by which ferroptosis and oxidative stress influence DED, thorough investigations are crucial. Therefore, this paper seeks to identify a key protein via bioinformatics analysis and further explore its involvement in DED through ferroptosis or oxidative stress in a DED model. protein was involved in DED via ferroptosis or oxidative stress in DED model.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBioinformatics analysis\\u003c/h2\\u003e \\u003cp\\u003ePotential protein was discovered via bioinformatics technology and related data was available via ProteomeXchange with identifier PXD012917. The PANTHER (Protein ANalysis THrough Evolutionary Relationships) Classification System was designed to classify proteins to facilitate high-throughput analysis. We further performed t-test to screen the differentially expressed proteins in the DED patient group and control group. The threshold values for identifying differentially expressed proteins was fold change (FC)\\u0026thinsp;\\u0026ge;\\u0026thinsp;1.5 or \\u0026le;\\u0026thinsp;0.67. Gene Ontology (GO) enrichment analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) of differentially expressed proteins were performed with the KEGG Ortholog Based Annotation System (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://kobas.cbi.pku.edu.cn/genelist\\u003c/span\\u003e\\u003cspan address=\\\"https://kobas.cbi.pku.edu.cn/genelist\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStudy population and tear collection\\u003c/h2\\u003e \\u003cp\\u003eThe study participants comprised 6 DED patients and 6 non-DED controls. The protocol of the clinical study conformed to the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of the second affiliated hospital of Zhejiang Chinese Medical University (2020-KL-011-01). Tear samples were taken after informed consent were signed. Non-stimulated tear samples of 12 patients in total were collected by using the Schirmer strip method with 10 mm filter paper, and approximately 7 \\u0026micro;L tear sample per patient was placed in microtubes and stored at \\u0026minus;-80\\u0026deg;C for further examination.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA Isolation and Quantitative Real-Time PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA from tears was isolated using PicoPure RNA isolation kit (Arcturus, Mountain View, CA) according to manufacturer\\u0026rsquo;s protocol. RNA was transcribed to cDNA using a reverse transcription kit (PrimeScript RT reagent kit; TaKaRa, Shiga, Japan). Quantitative real-time PCR was performed with a StepOne Real-Time detection system (Applied Biosystems, Foster City, CA) using an SYBR Premix Ex Taq Kit (Takara). The amplification program included an initial denaturation step at 95\\u0026deg;C for 10 minutes, followed by 40 cycles of 95\\u0026deg;C for 10s and 60\\u0026deg;C for 30s. Subsequently, a melt curve analysis was performed to access amplification specificity. Differential gene expression was calculated according to the comparative threshold cycle (CT) method and normalized to GAPDH expression as an internal control. The primers were used as listed: GAPDH, TGACTTCAACAGCGACACCCA and CACCCTGTT GCTGTAGCCAAA; PCBP1, CGGAAAGGAAGTAGGAAGG and AAAGATGGC ATTGGTGGG.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eElisa assay\\u003c/h2\\u003e \\u003cp\\u003eTear samples were analyzed to determine the concentrations of PCBP1 according to the manufacturer\\u0026rsquo;s protocol. Briefly, plates were treated with coating antibody at 4\\u0026deg;C overnight, washed with PBS, and blocked with assay buffer at room temperature for 2 h. Biotin-conjugated detector antibodies were added to microwells and the plates were incubated at room temperature for 2 h. After incubation, plates were washed 5 times and added with HRP. After 1 h of incubation at room temperature, plates were washed and TMB substrate solution was added to all wells for color formation. Plates were incubated at room temperature and then stop solution was added. Absorbance of each microwell was read using 450 nm or 620 nm.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHyperosmotic stress‑induced cell model\\u003c/h2\\u003e \\u003cp\\u003eThe human immortalized corneal epithelial cells (HCE, CP-H128) were purchased from Procell (Wuhan, China). HCE were cultured on plates in a humidified atmosphere containing 5% carbon dioxide (CO\\u003csub\\u003e2\\u003c/sub\\u003e) at 37\\u0026deg;C. Dulbecco\\u0026rsquo;s modified Eagle\\u0026rsquo;s medium/F12 containing 5\\u0026micro;g/mL insulin, 10 ng/mL human epidermal growth factor, 10% fetal bovine serum, and 1% penicillin/streptomycin was used as the culture medium. HCE were then treated for 24 hours in hyperosmolar condition by adding 94 mM sodium chloride to induce ex vivo DED model.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLentivirus-mediated knockdown of PCBP1\\u003c/h2\\u003e \\u003cp\\u003eLentivirus vectors for PCBP1 shRNA were used to examine the functions of PCBP1. A third generation of the self-inactivating lentiviral vector was used to express short hairpin RNA (shRNA) targeting the PCBP1 sequence (PCBP1-shRNA lentivirus). A non-targeting sequence was used as a negative control lentivirus. HCE were infected with PCBP1-shRNA lentivirus vectors (shPCBP1) and NC lentivirus vectors (shCtrl). After 5 days of transfection, HCE were collected to determine the knock-down effect by Western blot analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFlow cytometry\\u003c/h2\\u003e \\u003cp\\u003eCell apoptosis was determined by flow cytometry. Briefly, HCE were grown to confluence in 35-mm dishes as described above, followed with the addition of 200 ng/mL netrin-1 and incubation for 72 h at 37℃. Afterwards, 0.05% trypsin in PBS buffer was applied to detach the cells from the plate, pelleted (centrifugation for 5min at 300 g), washed for twice in PBS with 1% bovine serum albumin (BSA), resuspended in the same buffer and fixed with 70% ice-cold ethanol. The data were acquired using a FACS can flow cytometer (BD Bio-sciences, Franklin Lakes, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eROS Detection\\u003c/h2\\u003e \\u003cp\\u003eThe production of ROS in HCE was measured following the protocol of the manufacturer. Differentially-treated HCE as described above were washed with PBS once and then were incubated with dihydroethidium (CA1420, Solarbio, China) at 37\\u0026deg;C for 30 minutes. Then washed and detected fluorescence (Ex\\u0026thinsp;=\\u0026thinsp;370 nm and Em\\u0026thinsp;=\\u0026thinsp;420 nm).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell Viability Assay\\u003c/h2\\u003e \\u003cp\\u003eCell viability was assessed using a Cell Counting Assay Kit-8 (Dojindo Molecular Technologies, Kumamoto, Japan) according to the manufacturer\\u0026rsquo;s protocol. Differentially-treated HCE as described above were seeded at density of 2000 cells per well in 96-well plates. At the time points of day1, day2, day3, day4 and day5, the medium was replaced by Cell Counting Assay Kit-8 constituted media and incubated for 4 hours at 37\\u0026deg;C in the dark. Absorbance at 450 nm was measured using a microplate reader (Bio-Tek, Winooski, VT).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blot analysis\\u003c/h2\\u003e \\u003cp\\u003eDifferentially-treated HCE as described above were extracted with cold lysis buffer comprising 50 mM Tris\\u0026ndash;HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, and protease and phosphatase inhibitor cocktails. Equal amounts of protein extracts were subjected to electrophoresis on 8% or 10% SDS-PAGE and then electrophoretically transferred to PVDF membrane. After blocking in 1% BSA, the membranes were incubated with primary antibodies of PCBP1(ab168377, 1:1000, Abcam), FTH1(ab155282, 1:2000, Abcam), GPX4 (ab240277, 1:2000, Abcam), SLC9A11 (17398-1-AP, 1:2000, Proteintech) and GAPDH (AF7021, 1:2000, Affinity) overnight at 4\\u0026deg;C. After 3 washes with Tris-buffered saline with 0.05% Tween-20 for 10 minutes. The membranes were incubated with HRP-conjugated goat anti-rabbit (S0001, 1:3000, Affinity) for 1 hour. The results were visualized by enhanced chemiluminescence reagents and recorded with an imaging system (ChemiDoc XRS, Bio-Rad, Hercules, CA, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIron analysis\\u003c/h2\\u003e \\u003cp\\u003eAn Iron Assay Kit (ab83366, Abcam, Cambridge, UK) was used for chromatic determination of cellular iron levels. Iron assay buffer was added to ice for sufficient homogenization, centrifuged at 4\\u0026deg;C 16,000\\u0026times;g for 10 min, and the supernatant was left for later use. 50 \\u0026micro;L samples were added to 96-well plates, replenished to 100 \\u0026micro;L with iron assay buffer. Next, 5 \\u0026micro;L buffer was added for divalent iron assays and 5 \\u0026micro;L iron reducer was added to incubate at 37\\u0026deg;C for 30 min. Then, 100 \\u0026micro;L of iron probe was added per well at 37\\u0026deg;C for 60 min and determined at 593 nm. The concentration of iron in the sample was calculated according to the standard curve.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eAll summary data are reported as means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD. Statistical analysis was performed with unpaired t-test for two-group comparisons or one-way analysis of variance for more than two group comparisons using GraphPad Prism 6.0 software. P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePCBP1 was highly expressed in DED patients\\u003c/h2\\u003e \\u003cp\\u003eThe database analysis indicated that polyC-RNA binding protein 1 (PCBP1) was differentially expressed between DED patients and non-DED controls (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA-B). To further validate these bioinformatics findings, tear samples from 12 subjects, including 6 DED patients and 6 non-DED controls, were collected. qPCR analysis revealed that PCBP1 expression was significantly higher in DED patients (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC-D). Additionally, ELISA results confirmed that PCBP1 concentration was elevated in DED patients (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). These results provided initial evidence that PCBP1 might be associated with DED, underscoring the need for further studies to elucidate molecular mechanisms.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePCBP1 decreased HCE proliferation in ex vivo DED model\\u003c/h2\\u003e \\u003cp\\u003eTo explore the role of PCBP1 in DED, an ex vivo DED model was developed in human corneal epithelial cells (HCEs), and PCBP1 knockdown was performed using a lentivirus vector-mediated shRNA. Western blot analysis confirmed the successful knockdown of PCBP1, and showed an upregulation of PCBP1 protein levels in HCEs with the ex vivo DED model compared to normal HCEs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The CCK8 assay demonstrated that HCE proliferation in the ex vivo DED model was decreased compared to normal HCEs, but PCBP1 knockdown partially restored HCE proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). These findings suggest that PCBP1 may reduce HCE proliferative capacity during DED.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePCBP1 increased HCE apoptosis in ex vivo DED model\\u003c/h2\\u003e \\u003cp\\u003eFlow Flow cytometry analysis showed that apoptosis levels were higher in HCEs in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown reduced apoptosis levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-B). This result indicated that PCBP1 could induce apoptosis in HCEs during DED.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePCBP1 increased ROS of HCE in ex vivo DED model\\u003c/h2\\u003e \\u003cp\\u003eROS analysis revealed that ROS levels were higher in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown decreased ROS production in the model (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e), suggesting that PCBP1 may increase ROS levels and cause oxidative stress-mediated injuries in cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePCBP1 decreased ferroptosis-related protein in ex vivo DED model\\u003c/h2\\u003e \\u003cp\\u003eFerroptosisFerroptosis, characterized by oxidative stress from iron accumulation, involves oxidative stress-related proteins like GPX4, SLC7A11, and FTH1, which protect cells from lipid peroxidation[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Western blot analysis showed that the protein levels of GPX4, SLC7A11, and FTH1 were downregulated in HCEs in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown alleviated this effect by upregulating their levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). These findings suggest that PCBP1 might induce oxidative stress in HCEs through ferroptosis during DED.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePCBP1 increased iron level in ex vivo DED model\\u003c/h2\\u003e \\u003cp\\u003eTo further investigate the ferroptosis-related mechanisms during DED, the level of free iron in cells was examined. The results indicated that free iron was increased in HCEs in the ex vivo DED model compared to normal HCEs, while PCBP1 knockdown reduced iron levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). This finding suggests that PCBP1 is likely to induce apoptosis in HCEs via ferroptosis.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eDry eye disease (DED) is a complex condition that affects millions worldwide. Chronic inflammation is considered a primary pathogenic factor in DED, with dysregulated cell death triggering and amplifying this inflammation[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. During DED progression, the normal structure and function of corneal epithelial cells are compromised due to tear film instability and increased tear osmolality. This disruption induces the release of various innate inflammatory factors, further contributing to DED[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Despite this understanding, much of DED\\u0026rsquo;s pathogenesis, particularly at the molecular level, remains unexplored. This study focuses on the role of the polyC-RNA binding protein 1 (PCBP1) in DED, examining its potential involvement in oxidative stress and ferroptosis within corneal epithelial cells.\\u003c/p\\u003e \\u003cp\\u003eWe initially observed that PCBP1 expression was significantly higher in DED patients compared to non-DED controls based on bioinformatics analysis. PolyC-RNA binding protein 1 (PCBP1) is an RNA-binding protein involved in various biological processes, including gene transcription, RNA stability, and translation regulation [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. PCBP1 is known to play a crucial role in the regulation of the immune response, particularly in the context of inflammatory diseases and cancer. Ansa-Addo et al. demonstrated that PCBP1 acts as a global regulatory node, disrupting immunosuppression in cancer by balancing regulatory T cells (Tregs) and effector T cells, which are key regulators in disease pathogenesis and progression[\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. This regulation is vital for understanding the pathogenesis of many diseases, including DED[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. In a recent study, PCBP1 was shown to enhance the production of granulocyte-macrophage colony-stimulating factor (GM-CSF) by helper T cells (Th1)[35]. Based on these findings, we hypothesized that PCBP1 could play a significant role in the pathogenesis of DED and might serve as a promising biomarker. Further research indicated that PCBP1 expression was significantly elevated in both corneal and conjunctival epithelial cells of DED patients, suggesting its involvement in the disease's progression[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. In a DED mouse model, inhibiting PCBP1 expression was found to reduce apoptosis in corneal epithelial cells, alleviate inflammation, and mitigate the pathological symptoms of DED [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Moreover, additional studies have suggested that environmental factors such as light exposure, tobacco, and alcohol could induce DED by modulating PCBP1 expression, thereby complicating the investigation of PCBP1-related regulatory mechanisms [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eTo better understand how PCBP1 contributes to DED pathogenesis, we utilized an ex vivo DED model induced by hyperosmotic stress. In this model, PCBP1 was successfully knocked down using a lentivirus vector-mediated shRNA. The downregulation of PCBP1 led to decreased cell proliferative ability, suggesting its role in the regeneration and maintenance of the corneal epithelium, a critical aspect of ocular health. Conversely, PCBP1 knockdown also increased cell apoptosis, indicating that elevated PCBP1 levels may contribute to the loss of corneal epithelial cells, a hallmark of DED.\\u003c/p\\u003e \\u003cp\\u003eOne of the most intriguing findings of this study is the link between PCBP1 and ferroptosis, a form of cell death characterized by iron-dependent lipid peroxidation. A vicious cycle of ocular surface inflammation and corneal epithelial defects has been shown to promote DED development. Although ferroptosis is closely associated with various human diseases, such as acute kidney injury, neurological disorders, and various tumors, its role in DED has been less studied[\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Here, we present evidence that ferroptosis occurs in DED. As an iron chaperone, PCBP1 is crucial in maintaining iron homeostasis by binding and delivering iron to ferritin and other iron-dependent proteins in mammalian cells[\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Recent studies have confirmed that PCBP1 selectively coordinates Fe-GSH formation[\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eWe observed that PCBP1 knockdown decreased the levels of ferroptosis-related proteins, suggesting its pivotal role in mediating ferroptosis in DED. Furthermore, PCBP1 knockdown reduced oxidative stress-related proteins, providing additional evidence of its involvement in oxidative stress, a known contributor to DED pathogenesis. Oxidative stress leads to cellular damage and inflammation, exacerbating DED symptoms. Moreover, PCBP1 knockdown also resulted in reduced levels of reactive oxygen species (ROS) and iron, aligning with the observed decreases in ferroptosis-related proteins and oxidative stress markers. This suggests that PCBP1 may regulate ROS and iron homeostasis, impacting the redox balance within corneal epithelial cells.\\u003c/p\\u003e \\u003cp\\u003eThe findings regarding the impact of PCBP1 on ferroptosis are particularly noteworthy. Ferroptosis is a form of cell death characterized by distinct molecular pathways, and its link with dry eye disease (DED) has been underexplored. Understanding PCBP1's role in ferroptosis could open new avenues for therapeutic interventions targeting this specific cell death mechanism. Moreover, changes in reactive oxygen species (ROS) and iron levels following PCBP1 knockdown provide further evidence of its role in regulating oxidative stress, a well-established factor in DED that contributes to ocular surface damage and inflammation. Identifying PCBP1 as a potential modulator of ROS and iron levels suggests that targeting this protein could offer a novel approach to mitigate oxidative stress in DED.\\u003c/p\\u003e \\u003cp\\u003eThis study lays a solid foundation for further research in this area. The elevated expression of PCBP1 in DED patients underscores its potential significance in the disease's development. PCBP1 appears to affect various aspects of corneal epithelial cell function, including cell viability, apoptosis, and particularly its roles in ferroptosis and oxidative stress. Future investigations could delve deeper into the specific molecular pathways through which PCBP1 influences ferroptosis and oxidative stress. Additionally, exploring the therapeutic potential of targeting PCBP1 or related pathways in DED could yield significant clinical implications.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003ePCBP1 emerged as a key player in the complex pathogenesis of DED. Its involvement in ferroptosis and oxidative stress added a novel dimension to our understanding of DED mechanisms. Further research in this area has the potential to lead to innovative therapeutic strategies for this ocular condition.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e \\u003cp\\u003eWe certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eEthical approval\\u003c/strong\\u003e \\u003cp\\u003eThe protocol of the clinical study conformed to the ethical guidelines of the Declaration of Helsinki and was approved by the Ethics Committee of the second affiliated hospital of Zhejiang Chinese Medical University (2020-KL-011-01). Gene Ontology (GO) enrichment analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) of differentially expressed proteins were performed with the KEGG Ortholog Based Annotation System (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://kobas.cbi.pku.edu.cn/genelist\\u003c/span\\u003e\\u003cspan address=\\\"https://kobas.cbi.pku.edu.cn/genelist\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/p\\u003e\\u003cp\\u003e \\u003ch2\\u003eConsent of publication\\u003c/h2\\u003e \\u003cp\\u003e Not applicable.\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eConsent to participant\\u003c/strong\\u003e \\u003cp\\u003eNot applicable.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis work was supported by the National Natural Science Foundation of China (grant number 82074341) and the Medical and Health Science and Technology Program of Zhejiang Province (grant number 2022ZH037).\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eLi Yang: Writing original draft, Data curation, Conceptualization. Shengjia Hu: Validation, Formal analysis. Pingping Yu and Muzhi Chen: Investigation. Xinchang Wang: Resources, Funding acquisition. All authors diligently reviewed and granted their approval for the concluding version of the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eData availability\\u003c/h2\\u003e \\u003cp\\u003eNot applicable.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eTsubota K, Yokoi N, Watanabe H, et al. A New Perspective on Dry Eye Classification: Proposal by the Asia Dry Eye Society. Eye \\u0026amp; contact lens 2020;46 Suppl 1:S2-s13.\\u003c/li\\u003e\\n\\u003cli\\u003eTsubota K, Pflugfelder SC, Liu Z, et al. Defining Dry Eye from a Clinical Perspective. International journal of molecular sciences 2020;21.\\u003c/li\\u003e\\n\\u003cli\\u003eCraig JP, Nichols KK, Akpek EK, et al. TFOS DEWS II Definition and Classification Report. The ocular surface 2017;15:276-283.\\u003c/li\\u003e\\n\\u003cli\\u003eHuang R, Su C, Fang L, et al. Dry eye syndrome: comprehensive etiologies and recent clinical trials. International ophthalmology 2022;42:3253-3272.\\u003c/li\\u003e\\n\\u003cli\\u003eBustamante-Arias A, Ruiz Lozano RE, Rodriguez-Garcia A. Dry eye disease, a prominent manifestation of systemic autoimmune disorders. European journal of ophthalmology 2022;32:3142-3162.\\u003c/li\\u003e\\n\\u003cli\\u003eHirabayashi KJ, Akpek EK, Ahmad S. Outcome Measures to Assess Dry Eye Severity: A Review. Ocular immunology and inflammation 2022;30:282-289.\\u003c/li\\u003e\\n\\u003cli\\u003eMohamed HB, Abd El-Hamid BN, Fathalla D, et al. Current trends in pharmaceutical treatment of dry eye disease: A review. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences 2022;175:106206.\\u003c/li\\u003e\\n\\u003cli\\u003eMittal R, Patel S, Galor A. Alternative therapies for dry eye disease. Current opinion in ophthalmology 2021;32:348-361.\\u003c/li\\u003e\\n\\u003cli\\u003eLin ZS, Yu DS, Zhao JL, et al. [Effect of acupuncture on dry eye and tear inflammatory factors]. Zhongguo zhen jiu = Chinese acupuncture \\u0026amp; moxibustion 2022;42:1379-1383.\\u003c/li\\u003e\\n\\u003cli\\u003eGomes JAP, Santo RM. The impact of dry eye disease treatment on patient satisfaction and quality of life: A review. The ocular surface 2019;17:9-19.\\u003c/li\\u003e\\n\\u003cli\\u003eRao SK, Mohan R, Gokhale N, et al. Inflammation and dry eye disease-where are we? International journal of ophthalmology 2022;15:820-827.\\u003c/li\\u003e\\n\\u003cli\\u003eMcCann P, Abraham AG, Mukhopadhyay A, et al. Prevalence and Incidence of Dry Eye and Meibomian Gland Dysfunction in the United States: A Systematic Review and Meta-analysis. JAMA ophthalmology 2022;140:1181-1192.\\u003c/li\\u003e\\n\\u003cli\\u003eGorimanipalli B, Khamar P, Sethu S, et al. Hormones and dry eye disease. Indian journal of ophthalmology 2023;71:1276-1284.\\u003c/li\\u003e\\n\\u003cli\\u003ePellegrini M, Senni C, Bernabei F, et al. The Role of Nutrition and Nutritional Supplements in Ocular Surface Diseases. Nutrients 2020;12.\\u003c/li\\u003e\\n\\u003cli\\u003eDogru M, Kojima T, Simsek C, et al. Potential Role of Oxidative Stress in Ocular Surface Inflammation and Dry Eye Disease. Investigative ophthalmology \\u0026amp; visual science 2018;59:Des163-des168.\\u003c/li\\u003e\\n\\u003cli\\u003eForman HJ, Zhang H. Targeting oxidative stress in disease: promise and limitations of antioxidant therapy. Nature reviews Drug discovery 2021;20:689-709.\\u003c/li\\u003e\\n\\u003cli\\u003eNavel V, Sapin V, Henrioux F, et al. Oxidative and antioxidative stress markers in dry eye disease: A systematic review and meta-analysis. Acta ophthalmologica 2022;100:45-57.\\u003c/li\\u003e\\n\\u003cli\\u003ePerez-Garmendia R, Lopez de Eguileta Rodriguez A, Ramos-Martinez I, et al. Interplay between Oxidative Stress, Inflammation, and Amyloidosis in the Anterior Segment of the Eye; Its Pathological Implications. Oxidative medicine and cellular longevity 2020;2020:6286105.\\u003c/li\\u003e\\n\\u003cli\\u003eHonisch C, Rodella U, Gatto C, et al. Oxidative Stress and Antioxidant-Based Interventional Medicine in Ophthalmology. Pharmaceuticals (Basel, Switzerland) 2023;16.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, T., Huang, X. H., Dong, L., Hu, D., Ge, C., Zhan, Y. Q., Xu, W. X., Yu, M., Li, W., Wang, X., Tang, L., Li, C. Y., \\u0026amp; Yang, X. M. (2010). PCBP-1 regulates alternative splicing of the CD44 gene and inhibits invasion in human hepatoma cell line HepG2 cells. Molecular cancer, 9, 72. \\u003c/li\\u003e\\n\\u003cli\\u003eLin L, Li H, Shi D, et al. Depletion of C12orf48 inhibits gastric cancer growth and metastasis via up-regulating Poly r(C)-Binding Protein (PCBP) 1. BMC Cancer. 2022;22(1):123. Published 2022 Jan 31. \\u003c/li\\u003e\\n\\u003cli\\u003eYue L, Luo Y, Jiang L, Sekido Y, Toyokuni S. PCBP2 knockdown promotes ferroptosis in malignant mesothelioma. Pathol Int. 2022;72(4):242-251. \\u003c/li\\u003e\\n\\u003cli\\u003eJiang L, Zheng H, Ishida M, et al. Elaborate cooperation of poly(rC)-binding proteins 1/2 and glutathione in ferroptosis induced by plasma-activated Ringer\\u0026apos;s lactate. Free Radic Biol Med. 2024;214:28-41.\\u003c/li\\u003e\\n\\u003cli\\u003eLi J, Cao F, Yin HL, et al. Ferroptosis: past, present and future. Cell death \\u0026amp; disease 2020;11:88.\\u003c/li\\u003e\\n\\u003cli\\u003eJiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nature reviews Molecular cell biology 2021;22:266-282.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu X, Cui Z, Chen X, et al. Ferroptosis in the Lacrimal Gland Is Involved in Dry Eye Syndrome Induced by Corneal Nerve Severing. Investigative ophthalmology \\u0026amp; visual science 2023;64:27.\\u003c/li\\u003e\\n\\u003cli\\u003eZuo X, Zeng H, Wang B, et al. AKR1C1 Protects Corneal Epithelial Cells Against Oxidative Stress-Mediated Ferroptosis in Dry Eye. Investigative ophthalmology \\u0026amp; visual science 2022;63:3.\\u003c/li\\u003e\\n\\u003cli\\u003eSu LJ, Zhang JH, Gomez H, et al. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxidative medicine and cellular longevity 2019;2019:5080843.\\u003c/li\\u003e\\n\\u003cli\\u003eForcina GC, Dixon SJ. GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis. Proteomics 2019;19:e1800311.\\u003c/li\\u003e\\n\\u003cli\\u003eMessmer EM, Ahmad S, Benitez Del Castillo JM, et al. Management of inflammation in dry eye disease: Recommendations from a European panel of experts. Eur J Ophthalmol. 2023;33(3):1294-1307. \\u003c/li\\u003e\\n\\u003cli\\u003eWei Y, Asbell PA. The core mechanism of dry eye disease is inflammation [published correction appears in Eye Contact Lens. 2014 Sep;40(5):311]. Eye Contact Lens. 2014;40(4):248-256. \\u003c/li\\u003e\\n\\u003cli\\u003eCraig JP, Nichols KK, Akpek EK, et al. TFOS DEWS II Definition and Classification Report. Ocul Surf. 2017 Jul;15(3):276-283. \\u003c/li\\u003e\\n\\u003cli\\u003eAnsa-Addo EA, et al. RNA binding protein PCBP1 is an intracellular immune checkpoint for shaping T cell responses in cancer immunity. Sci. Adv. 2020;6(22):eaaz3865. doi: 10.1126/sciadv.aaz3865.\\u003c/li\\u003e\\n\\u003cli\\u003eRatay, M. L., Glowacki, A. J., Balmert, S. C., Acharya, A. P., Polat, J., Andrews, L. P., Fedorchak, M. V., Schuman, J. S., Vignali, D. A. A., \\u0026amp; Little, S. R. (2017). Treg-recruiting microspheres prevent inflammation in a murine model of dry eye disease. Journal of controlled release : official journal of the Controlled Release Society, 258, 208\\u0026ndash;217. \\u003c/li\\u003e\\n\\u003cli\\u003eWang, Z., Yin, W., Zhu, L., Li, J., Yao, Y., Chen, F., Sun, M., Zhang, J., Shen, N., Song, Y., \\u0026amp; Chang, X. (2018). Iron Drives T Helper Cell Pathogenicity by Promoting RNA-Binding Protein PCBP1-Mediated Proinflammatory Cytokine Production. Immunity, 49(1), 80\\u0026ndash;92.e7. \\u003c/li\\u003e\\n\\u003cli\\u003eWei Y, Asbell PA. The core mechanism of dry eye disease is inflammation. Eye Contact Lens. 2014 Jul;40(4):248-56. \\u003c/li\\u003e\\n\\u003cli\\u003eZhou X, You F, Chen H, et al. Poly(C)-binding protein 1 (PCBP1) mediates housekeeping degradation of mitochondrial antiviral signaling (MAVS). Cell Res. 2012 Apr;22(4):717-27. \\u003c/li\\u003e\\n\\u003cli\\u003eZhao H, Wei Z, Shen G, et al. Poly (rC)-binding proteins as pleiotropic regulators in hematopoiesis and hematological malignancy[J]. Frontiers in Oncology, 2022, 12: 1045797.\\u003c/li\\u003e\\n\\u003cli\\u003eMou Y, Wang J, Wu J, et al... Ferroptosis, a new form of cell death: opportunities and challenges in cancer. J Hematol Oncol. 2019; 12: 34\\u003c/li\\u003e\\n\\u003cli\\u003eWeiland A, Wang Y, Wu W, et al... Ferroptosis and its role in diverse brain diseases. Mol Neurobiol. 2019; 56: 4880\\u0026ndash;4893.\\u003c/li\\u003e\\n\\u003cli\\u003eRyu MS, et al. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis. J. Clin. Invest. 2017;127(5):1786\\u0026ndash;1797. doi: 10.1172/JCI90519\\u003c/li\\u003e\\n\\u003cli\\u003ePhilpott CC. Coming into view: Eukaryotic iron chaperones and intracellular iron delivery. J. Biol. Chem. 2012;287(17):13518\\u0026ndash;13523. doi: 10.1074/jbc.R111.326876.\\u003c/li\\u003e\\n\\u003cli\\u003ePatel SJ, Frey AG, Palenchar DJ, Achar S, Bullough KZ, Vashisht A, et al. A PCBP1-BolA2 chaperone complex delivers iron for cytosolic [2Fe-2S] cluster assembly. Nat Chem Biol 2019;15:872\\u0026ndash;881.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"dry eye disease, PCBP1, oxidative stress, ferroptosis, corneal epithelial cell\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4776606/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4776606/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eDry eye disease (DED) is a medical condition which is characterized by a wide range of symptoms and clinical signs related to insufficient or poor-quality of tears. In this study, we investigated a potential protein and related mechanisms involved in DED process.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eBioinformatics technology was conducted to find potential protein. PCR and Elisa assay were performed to detect gene and protein level in the tear samples collected from patients. Ex vivo DED model was built by hyperosmotic stress‑induced cell model and knockdown of aimed gene was achieved by lentivirus vector-mediated shRNA. CCK8 assay and flow cytometry was conducted to detect cell viability and apoptosis. Western blot was performed to detect oxidative stress-related proteins. Then ROS and iron level within cells were also detected by assay kit.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eThe expression of PolyC-RNA binding protein 1 (PCBP1) of tear samples was higher in DED patients compared with non-DED controls both in gene and protein level. In ex vivo DED model, PCBP1 could decrease corneal epithelial cell proliferation and increase cell apoptosis. Moreover, PCBP1 also decreased oxidative stress-related protein level as well as increased ROS and iron level within cells.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003ePCBP1 could influence dry eye disease via ferroptosis by regulating cell viability and oxidative stress process.\\u003c/p\\u003e\",\"manuscriptTitle\":\"RNA-binding protein PCBP1regulated dry eye disease via ferroptosis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-08-26 14:01:48\",\"doi\":\"10.21203/rs.3.rs-4776606/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"e62e81f4-4690-4b83-bd4c-5649ac10eb73\",\"owner\":[],\"postedDate\":\"August 26th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-08-28T13:19:33+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-08-26 14:01:48\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4776606\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4776606\",\"identity\":\"rs-4776606\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}