{"paper_id":"4c2ee2aa-ee1b-421c-b8e9-09cabcca241e","body_text":"Antiproliferative and Antimetastatic Effects of Xihuang Pill (XHP) Extract on Breast Cancer Cells: Involvement of EHBP1L1 Gene Regulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Antiproliferative and Antimetastatic Effects of Xihuang Pill (XHP) Extract on Breast Cancer Cells: Involvement of EHBP1L1 Gene Regulation Junlong Guo, Ruiqi Zou, Shaoqiang Chen, Guolian Pang, Yuxin Liang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6120346/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Xihuang Pill (XHP), a traditional Chinese medicine formula, is widely used in China as an adjunctive treatment for various cancers, particularly breast cancer (BC). This study aimed to explore the potential mechanisms underlying the therapeutic effects of XHP in BC. BC cell lines (MDA-MB-231 and T-47D) were treated with XHP extract to assess its effects on cellular biological behavior. Gene expression profiles of MDA-MB-231 cells treated with XHP extract were analyzed using gene chip technology. Differentially expressed genes were subsequently subjected to functional annotation and pathway enrichment analysis using the IPA and DAVID databases. The results demonstrated that XHP extract inhibited cell proliferation and metastasis, induced apoptosis, and modulated the cell cycle, thereby exhibiting significant anti-cancer effects. Gene expression profiling identified eight significantly down regulated genes following XHP extract treatment, among which EHBP1L1 was identified as one of the most markedly suppressed genes. EHBP1L1 is associated with the proliferation and metastasis of BC cells. Dual-luciferase reporter assays confirmed the binding of EHBP1L1 with miR-137-3p. In conclusion, this study demonstrates that XHP extract effectively inhibits the proliferation and migration of breast cancer cells in vitro, influencing key cellular processes such as the cell cycle and apoptosis. XHP significantly regulated the expression of several genes, including EHBP1L1, SPACA6, and CKAP2L. EHBP1L1 was identified as a critical gene involved in breast cancer cell proliferation and metastasis, highlighting its potential as a therapeutic target. Breast cancer Xihuang pill Gene chip EHBP1L1 microRNA-137 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Breast cancer (BC) is one of the most common malignant tumors threatening women's health worldwide. In 2022, BC accounted for 11.6% of all cancer cases and 6.9% of cancer related deaths globally [ 1 ] . According to the latest data from the National Central Cancer Registry of China (NCCR), the incidence and mortality rates of breast cancer in China also rank among the top five [ 2 ] . Current treatments for BC primarily include lumpectomy, mastectomy, radiation therapy, endocrine therapy, and chemotherapy [ 3 ] . While these approaches have significantly improved patient survival, each approach has inherent limitations and adverse effects, such as fatigue, estrogen deprivation and cardiotoxicity [ 4 ] . Thus, there is a pressing need for complementary therapies to mitigate these shortcomings. Traditional Chinese medicine (TCM) has demonstrated efficacy in alleviating BC related complications, reducing chemotherapy side effects, and alleviating cancer pain [ 5 , 6 ] . It is increasingly recognized as an adjunctive treatment to conventional BC therapies. Among TCM formulas, Xihuang pill (XHP) has been clinically utilized for centuries. XHP, comprising Calculus Bovis , Moschus , Olibanum , and Myrrha [ 7 ] , was first documented by Wang Hongxu during the Qing Dynasty in Wai Ke Zheng Zhi Quan Sheng Ji and is currently applied in cancer treatment [ 8 ] . Previous researches have highlighted the therapeutic potential of XHP in glioblastoma [ 9 ] , lung cancer [ 10 ] , gastric cancer [ 11 ] , colorectal cancer [ 12 ] , liver cancer [ 13 ] , and BC [ 14 ] . However, studies investigating the molecular mechanisms underlying XHP’s effects on BC are limited, and the specific genes involved remain largely unknown. Existing researches on XHP have adopted two main approaches. The first approach involves isolating and analyzing its active ingredients using techniques such as chromatography and mass spectrometry to explore their individual functions. While this approach provides insights into specific bioactive compounds, it may overlook the holistic interactions inherent in TCM formulations. The second approach examines XHP as a whole, investigating the effects of its populations. This method aligns with the holistic principles of TCM and considers the synergistic interactions of XHP’s components in cancer treatment. Despite these advancements, molecular studies in XHP’s role in BC remain unclear. To address this gap, our study focuses on elucidating the anti-breast cancer mechanisms of XHP extract. We employed gene chip technology, a high-throughput tool widely used in cancer research for analyzing gene expression [ 15 ] , detecting gene mutations [ 16 ] , and investigating genome structure [ 17 ] . This method allows for the simultaneous assessment of thousands of genes, providing insights into their roles in tumor development and progression. By comparing gene expression profiles of untreated BC cells and BC cells treated with XHP extract, we aimed to identify specific genes and pathways involved in XHP’s therapeutic effects. In this study, we conducted in vitro experiments to investigate the effects of XHP extract on BC and utilized gene chip analysis to identify key genes associated with its anti-cancer activity. These genes were subsequently subjected to further experimental validation to uncover their roles in the underlying mechanisms of XHP. Methods Preparation of XHP Extract XHP was obtained from Tong Ren Tang Technologies Co., Ltd. (Beijing, China). The XHP extract was prepared following a method previously established by our research team. Briefly, XHP was immersed in pre-cooled DMEM (4 ℃) and allowed to soak for 24 hours in a sterile, sealed container. The mixture was then subjected to ultrasonic agitation for 2 hours and incubated at 37 ℃ for 48 hours. After incubation, the supernatant was filtered through a 0.22 µm microporous filter to obtain the XHP extract. Cell lines, Culture, Plasmid Construction and Lentivirus Production Breast cancer cell lines MDA-MB-231 and T-47D were purchased from ATCC, and cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS). The lentiviral expression vectors carrying short hairpin RNA (shRNA) targeting candidate genes along with corresponding negative controls, were synthesized and cloned into GV493 vector (pFU-GW-016) containing BsmBI restriction sites (purchased from Shanghai Genechem Co., Ltd). The recombinant vectors were confirmed by DNA sequencing. The shRNA target sequences for each gene are listed in Table 1 . Table 1 shRNA sequence information used in high-content screening gene symbol RNAi target sequences CKAP2L #1CTATATGAAGAGGCCATTAAA #2GCTGATGTCACAACCGTAAAT #3CATAAGCCAGAGGCCTAATTT EHBP1L1 #1GGCCAAAGAGTGGACATTTAT #2ATTTATTTGTCACCGAGGGTG #3CCAGGAAGTCACCACTGGCTA MSS51 #1TCAAACCTGAACAGGTCTATT #2CTGCTACTTCGTGACTATAAG #3TCCCATGTGGAGACATTTCTT RCSD1 #1CCTGAACATGACAGCCAAGAA #2CAGTAAACCAACCCGAAGGAA #3CGGTTCTCAAATATCAGTTAA SPACA6 #1CCAAAGGAGGAGATCACCTAT #2CGGAGAAAATGAAGAAGGTCA #3GCGGGCGGAGACAGAGTTGCA To produce lentivirus, the viral vector was transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) along with two helper plasmids, psPAX2 and pMD2.G. Lentiviral particles were harvested 72 hours post-transfection. The culture medium was then subjected to rapid centrifugation to remove cell debris, followed by filtration through 0.45 µm cellulose acetate filters. The virus titer was determined by fluorescence-activated cell sorting (FACS) analysis of GFP-positive 293T cells, yielding a titer of approximately 1×10 9 transducing units (TU)/mL. The lentivirus was subsequently stored at -80 ℃ for further use. CCK-8 Assay and IC50 (Half maximal inhibitory concentration) Determination of XHW Extract Cells were cultured in a 96-well plate at a density of 2000 cells per well. On the following day, 20 µL of CCK-8 reagent (5 mg/mL) was added to each well, and the cells incubated for 4 hours. After incubation, the culture medium was removed, and 100 µL of DMSO was added to dissolve the formazan crystals. The plate was then shaken for 2–5 minutes, and absorbance was measured at 490 nm using a microplate reader. For the IC50 determination, MDA-MB231 cells were seeded at a density of 3,000 cells per well in a 96-well plate, with 100 µL of culture medium per well. The cells were treated with varying concentration of XHP extract, divided into nine groups: 0 g/L, 1 g/L, 2 g/L, 5 g/L, 10 g/L, 20 g/L, 50 g/L, 75 g/L, and 100 g/L. After 72 hours of drug treatment, 10 µL of CCK-8 reagent was added to each well 2–4 hours before the end of incubation. The optical density (OD) at 450 nm was then measured using a microplate reader. The resulting data were logarithmically processed, and the IC50 value was calculated based on dose-response curves. MTT Assay Cells were seeded into 96-well plates at a density of 2,000–3,000 cells per well and cultured for 24 hours. After treatment with various concentrations of XHP extract, MTT reagent (5 mg/mL) was added 2–24 hours before detection, with three biological replicates for each group. The absorbance was measured at 490 nm using a microplate reader on each day of culture (24, 48, 72, 96 and 120 hours) to assess cell viability. BrdU Assay Cells were seeded into 96-well plates at a density of 3,000 cells per well and cultured for 24 hours. After treatment, BrdU reagent (Roche Brdu kit, Roche, Switzerland) was added and incubated for an additional 4 days. The reagent was added 2–24 hours before detection, with three biological replicates for each group. Absorbance was measured at 450 nm on the first and fourth days of culture to assess cell proliferation. Cell Apoptosis Assay Cells were planted into 6-well plates at a density of at least 5×10 5 cells per well, and apoptosis was induced when the confluence reached 70%. The cells were digested with trypsin, resuspended in complete medium to form a cell suspension, and collected into 5 ml centrifuge tubes. Each group had three biological replicates. Annexin V-APC and PI staining (double staining) flow cytometry were used to detect the effect of XHP on breast cancer cell apoptosis. Annexin V-APC staining (single staining) flow cytometry was used to detect the effect of EHBP1L1 knockout on breast cancer cell apoptosis. Colony Formation Assay The cells in the logarithmic growth phase were digested with trypsin, resuspended in complete medium, and counted. The cells were seeded into 6-well plates at a density of 400–1000 cells/well, with three biological replicates for each group. After 14 days of culture, cell colonies were photographed using a fluorescence microscope. Crystal violet dye was added to stain the colonies, and the images were captured with a digital camera. The number of colonies was then counted. Cell Cycle Detection Cells were seeded into 6-well plates at a density of at least 10 6 cells per well, and apoptosis was induced when the confluence reached 80%. Cells were prepared as a single-cell suspension and washed. After washing, the cells were stained with propidium iodide (PI) and analyzed by Fluorescence-activated cell sorting (FACS) to determine the distribution of cells in different phases of the cell cycle. RNA Extraction and Quantitative Real‑Time PCR Total RNA was extracted using the Trizol reagent (Pufei, China) and quantified with a NanoDrop ND-2000 spectrophotometer. RNA samples were deemed suitable for further analysis if they met the following criteria: 1.7 < A260 / A280 < 2.2, RIN ≥ 7.0, and 28 S/18 S ≥ 0.7. Total RNA is required for preparing gene chip expression. Reverse transcription was performed using a Prime Script RT reagent (Takara, Otsu, Japan), followed by quantitative real-time PCR using SYBR Premix Ex Taq™ (Takara, Otsu, Japan). Relative mRNA expression levels were normalized to GAPDH using the 2 −ΔΔCT method [ 18 ] . Primers were synthesized by Gene Chem (Shanghai, China), and their sequences are shown in Table 2 . Table 2 RT-qPCR primer sequences of DEGs gene symbol primer type primer sequence product size (bp) CCDC3 forward primer AGTCAATTTCCAAGATGCCA 157 reverse primer CGAGGAGCACATGAGCCTAC CKAP2L forward primer GCAAGACTCAAACAGAACCACA 297 reverse primer GACACTGCTCGCTCAATCCTC EHBP1L1 forward primer GAAGCCAAAGTCAGTGAAGGT 161 reverse primer TCTCAGCAAAGTCATCCAAGTT MSS51 forward primer ACAGGAGGGTTTGTCAAGAGC 183 reverse primer GCACAGCATCCAATGTAGCA RCSD1 forward primer ACCAGCCAGTAAACCAACCC 139 reverse primer GCCCCAGGCAGTAGAGCAG SPACA6 forward primer TCTGACGCCCAGCAATCT 94 reverse primer GTACCATCGAAAGAACATCCAC GAPDH forward primer TGACTTCAACAGCGACACCCA 121 reverse primer CACCCTGTTGCTGTAGCCAAA Gene Chip and Analysis of the Differentially Expressed Genes (DEGs) Gene expression profiling was performed using Gene Chip™ 3'IVT PLUS Reagent Kit (Thermo Fisher Scientifc, USA). Qualified RNA samples were used for microarray experiments, with three biological replicates per group. For data preprocessing, we removed the lowest 20% of probe sets by signal intensity in both sample groups to eliminate background noise. The coefficient of variation (CV) method was applied (CV = Standard Deviation/Mean) to calculate the variation within each sample group for the same probe set, and probe sets with a CV greater than 25% in both groups were filtered out. Initially, there were 49,395 probes; after filtering, 39,272 probes remained. DEGs were selected based on the criteria of | Fold Change | ≥ 2.0 and FDR (false discovery rate) < 0.05. IPA Analysis of DEGs The IPA analysis of differentially expressed genes (DEGs) was performed using Qiagen’s Ingenuity Pathway Analysis algorithm ( www.qiagen.com/ingenuity , Qiagen, Redwood City, CA, USA). The activation z-score and P value were calculated following established protocols. gene ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of DEGs were conducted using the Database for Annotation, Visualization and Integrated Discovery (DAVID) [ 19 ] . High Content Screening (HCS) Cells were infected with lentivirus expressing siRNA and green fluorescent protein (GFP). Target cells were seeded into 48-well culture plates one day before infection. On the day of infection, lentiviral particles were added according to the experimental groups. After 2–3 days, GFP expression was observed under a fluorescence microscope (fluorescence rate should reach 50–80%). Once cell confluence reached 80%, cells were collected. The Celigo imaging cytometer (Nexcelom Bioscience, USA) was used to capture images and automatically count cells. Continuous readings over 5 days generated a cell growth curve to assess cell proliferation. Dual-Luciferase Assay Gene mutation sequences for the EHBP1L1 gene were designed and inserted into the psiCHECK-2 vector at the XhoI and NotI restriction sites. This vector was transfected into target cells, and after 48 hours of culture, luciferase activity was measured. The luminescence signals of both firefly luciferase and renilla luciferase were detected using a dual-luciferase assay kit (Promega, USA) on a multifunctional microplate reader. Statistical Analyses Each experiment was repeated three times. Data are presented as mean ± standard deviation (SD). One-way ANOVA and Student's t-test were used to assess differences between groups, with a two-tailed P value of < 0.05 considered statistically significant. Statistical analyses were conducted with GraphPad version 9.0.0. Results IC50 Value and Inhibitory Effect of XHP Extract on the Growth of BC cells in Vitro After treating MDA-MB-231 cells with varying concentrations of XHP extract for 72 hours, the OD values of each group were measured using the CCK-8 assay kit. The IC50 value of XHP extract on MDA-MB-231 cells was determined to be 15.08 g/L (Fig. 1 A). This IC50 value was then used for subsequent experiments with XHP extract in MDA-MB231 cells. Based on the IC50 concentration, two breast cancer cell lines (MDA-MB-231 and T-47D) were treated with 15.08 g/L XHP extract. The microscopic results showed that XHP extract inhibited the growth of both cell lines at this concentration (Fig. 1 B). The BrdU assay showed that XHP extract significantly inhibited cell proliferation in both cell lines compared to the Ctrl group at day 4 (Fig. 1 C). Further analysis using CCK-8 assays confirmed that the proliferation of BC cells treated with XHP extract was significantly reduced compared to the Ctrl group (Fig. 1 D). In the apoptosis assay, the number of apoptotic cells in the XHP-treated group was higher than that in the control group significantly, indicating that XHP promotes apoptosis of BC cells (Fig. 1 E and 1 F). The colony formation assay, observed under a microscope at 100× magnification, showed that cells in the XHP-treated group were dispersed, while cells in the Ctrl group formed clusters. The number of colonies formed in the XHP-treated group was significantly lower than in the control group, indicating that XHP can inhibit the clonogenic ability of BC cells (Fig. 1 G and 1 H). Preparation of Gene Chip and Bioinformatics Analysis to Identify DEGs Based on the results of various cell function assays with XHP extract in the two cell lines, the MDA-MB-231 cell was selected for the gene chip experiment. Consistent with the cell function assays, the cells were treated with 15.08 g/L XHP extract for 72 hours. After treatment, RNA was extracted from each group of cells for gene chip analysis. As shown in Fig. 2 A, both the XHP and Ctrl group demonstrated a high degree of comparability, with intraclass correlation coefficients for both groups exceeding 0.99. This indicates that the quality of the gene chips met the necessary criteria for subsequent analysis. The gene chip data were categorized into upregulated and downregulated DEGs, with 360 genes identified as upregulated and 461 as downregulated. The distribution of these genes was depicted in the volcano plot (Fig. 2 B). We performed bioinformatics analysis on the DEGs identified from the gene chip using Ingenuity Pathway Analysis (IPA) ( https://www.qiagen.com/zh-us/products/discovery-and-translational-research/next-generation-sequencing/informatics-and-data/interpretation-content-databases/ingenuity-pathway-analysis ) and the DAVID database ( https://david.ncifcrf.gov/ ). The enriched terms were predominantly associated with processes such as cell proliferation, cell death, and the cell cycle in tumor cell lines, which aligns with the observed anti-proliferative effects of the XHP extract on breast cancer cells. Subsequently, we analyzed the upregulated and downregulated DEGs separately using the DAVID database. The results of the \"disease and function analysis\" and \"classical pathway analysis\" of the DEGs, based on IPA software were presented in Fig. 2 C and 2 D. GO and KEGG enrichment analysis of the upregulated genes (Fig. 2 E and 2 F) revealed no significant association with tumor cell growth. In contrast, the analysis of downregulated genes (Fig. 2 G and 2 H) highlighted their involvement in processes such as cell division and cell senescence, which is consistent with the IPA software analysis. Based on these findings, this study primarily focuses on exploring the functions of the downregulated genes affected by the XHP extract. RT-qPCR and HCS of DEGs Based on the above research, downregulated DEGs were ranked by fold change and significance, resulting in the selection of 6 genes for further investigation. The basic information of these genes is provided in Table 3 . Although 6 genes were identified from the DEGs, it was deemed necessary to narrow the focus for subsequent studies. Therefore, RT-qPCR and HCS were employed to further screen these genes and identify the final targets for further research. Initially, RT-qPCR was conducted on these 6 genes. The expression levels of these genes were compared between the XHP group and the Ctrl group. The RT-qPCR results revealed that the mRNA levels of CKAP2L, EHBP1L1, MSS51, RCSD1, and SPACA6 were significantly reduced in the XHP group compared to the Ctrl group (Fig. 3 A-F). Table 3 Genes selected for further screening and their biological functions gene symbol biological function P value CCDC3 Involved in the negative regulation of tumor necrosis factor-mediated signaling pathways and lipid metabolic processes, and is localized in the endoplasmic reticulum and extracellular space. 1.38246E-13 CKAP2L A microtubule-associated protein required for mitotic spindle formation and cell cycle progression in neural progenitor cells, associated with spindle organization defects. 2.21179E-15 EHBP1L1 Acts as a Rab effector protein and plays a role in vesicle transport, involved in the organization of the actin cytoskeleton. 4.66828E-14 MSS51 A skeletal muscle-specific gene that regulates cellular metabolism, associated with metal ion binding. 1.04892E-10 RCSD1 Possesses actin-binding activity, involved in the cellular response to hyperosmotic stress. 1.94974E-11 SPACA6 A sperm protein required for sperm-egg membrane fusion during fertilization, localized in the acrosomal vesicle. 4.68469E-11 Next, HCS was conducted on the genes identified through RT-qPCR to evaluate the effects of gene knockdown on the proliferation rate of breast cancer cells and to further identify genes with potential inhibitory effects on proliferation. Based on the fluorescence signals expressed by cells in each group, photographs were taken and cell counts were performed every 24 hours. After 5 days of culture, distinct differences in cell proliferation were observed among the various gene knockdown groups. In some groups, a significant inhibition of cell proliferation was evident under the fluorescence microscope, while in others, the inhibitory effect was less pronounced (Fig. 3 G). Cell counts were plotted over time to show changes in cell proliferation (Fig. 3 H). The proliferation of cells in the shCtrl group remained unaffected, whereas the proliferation of cells in the shPC group was significantly reduced, confirming the reliability of the experimental system. Differences in proliferation fold change of each group after 5 days of cell culture are shown in Table 4 . The statistical line plot of cell count showed that CKAP2L, EHBP1L1, MSS51, and RCSD1 gene knockdown group had significantly lower cell count than the shCtrl group ( P = 0.0060, 0.0002, 0.01876, 0.00762, 0.00032). which confirmed that CKAP2L, EHBP1L1, MSS51 and RCSD1 gene knockdown significantly inhibited BC cell proliferation. Table 4 Differences in proliferation fold change of each group after 5 days of cell culture. gene symbol group name fold change conclusion shCtrl 1 shPC 14.14 inhibition CKAP2L shCKAP2L 3.53 inhibition EHBP1L1 shEHBP1L1 16.42 inhibition MSS51 shMSS51 4.32 inhibition RCSD1 shRCSD1 2.68 inhibition SPACA6 shSPACA6 1.06 Based on the fold changes in cell count observed during the 5-day HCS cell proliferation assay, knocking down the EHBP1L1 gene had the most significant impact on cell proliferation. Therefore, the EHBP1L1 gene was chosen for further investigation in subsequent cell function experiments. Effect of EHBP1L1 Gene Knockdown on the BC Functions The MTT assay demonstrated that knockdown of EHBP1L1 led to decreased cell viability in both MDA-MB-231 and T-47D cells (Fig. 4 A). Cell cycle analysis revealed that MDA-MB-231 cells underwent cell cycle arrest in the S phase following EHBP1L1 knockdown, while T-47D cells showed no significant cell cycle arrest (Fig. 4 B and 4 C). Similarly, the colony formation assay indicated a reduced ability to form colonies in both cell lines following EHBP1L1 knockdown. Visual inspection of the six-well plates revealed noticeable differences in cell growth between the shCtrl and shEHBP1L1 groups. The shCtrl group showed more robust cell growth, while the shEHBP1L1 group displayed poorer proliferation. Additionally, under the microscope, smaller colony sizes were observed in the shEHBP1L1 group (Fig. 4 D). The number of cell colonies formed was significantly lower in the shEHBP1L1 group compared to the shCtrl group, with consistent results in both cell lines (Fig. 4 E). As expected, cell apoptosis analysis showed a significantly higher apoptosis rate in the shEHBP1L1 group compare to the shCtrl group in both cell lines (Fig. 4 F and 4 G). These results collectively demonstrate that knockdown of EHBP1L1 significantly inhibits the viability and proliferation of BC cells (MDA-MB-231 and T-47D), suggesting that EHBP1L1 deficiency affects BC cell survival by inhibiting proliferation and promoting apoptosis. Notably, this effect exhibited more significant cell cycle regulation characteristics in the more aggressive triple-negative breast cancer (MDA-MB-231). Prediction and Validation of miRNA Binding Sites in the EHBP1L1 gene Building on the findings regarding the EHBP1L1 gene, we next focused on predicting and validating potential miRNA binding sites. Bioinformatics tools and databases were used to identify miRNA binding sites within the EHBP1L1 gene. According to the TargetScan database ( https://www.targetscan.org ), a binding site for miR-137-3p was predicted in the 3'UTR region of EHBP1L1 (Fig. 5 A). To validate this prediction, a dual-luciferase assay was conducted. The results showed that the fluorescence intensity of cells co-transfected with the wild-type EHBP1L1 plasmid and miR-137-3p was significantly lower than that of the group co-transfected with the wild-type EHBP1L1 plasmid and negative microRNA mimics (Fig. 5 B). This suggests that miR-137-3p can bind to the 3'UTR region of EHBP1L1. Discussion Breast cancer remains one of the most prevalent and challenging malignancies worldwide. The global incidence of breast cancer has risen significantly, with an increase of 1.28 times since 1990 [ 20 ] . Given this alarming rise, there is an urgent need to identify more effective strategies for both the prevention and treatment of breast cancer. In this regard, TCM, particularly XHP, has gained increasing attention as an adjunctive treatment for cancer. XHP has shown promise in improving patient quality of life for cancer patients, reducing the side effects associated with chemotherapy, and enhancing therapeutic efficacy [ 21 ] . Previous reports and clinical practice have demonstrated that XHP is effective against various types of cancer. It exerts its effects in multiple forms, including aqueous extracts [ 22 ] , capsules [ 23 ] , extracted drug-containing mouse serum [ 24 ] , and its potential active components [ 8 , 24 ] . XHP has not only improved the survival rates of breast cancer patients but has also reducing the side effects of conventional treatments like chemotherapy and radiotherapy [ 25 ] . However, while the potential of XHP in BC therapy is widely recognized, the molecular mechanisms underlying its action have yet to be fully explored. Gene chips have become an essential tool in cancer research, offering detailed insights into the molecular mechanisms of cancer progression. By analyzing data from online databases such as TCGA and GEO [ 26 , 27 ] , and utilizing bioinformatics tools like IPA and DAVID [ 28 , 29 ] , researchers can gain a deeper understanding of the genetic alterations that contribute to cancer. The integration of gene chip data with cell and animal models [ 30 , 31 ] has provided more comprehensive insights into the roles of mRNA, miRNA, and lncRNA in cancer biology [ 32 – 34 ] . Our findings demonstrate that XHP extract significantly inhibits the proliferation and survival of BC cells, particularly in the MDA-MB-231 cell line, a highly aggressive triple-negative BC model. This was evidenced by reduced cell viability, increased apoptosis, decreased colony formation, and cell cycle arrest in the XHP treated groups. These results align with previous studies suggesting the anti-proliferative and pro-apoptotic effects of TCM formulations, further reinforcing the role of XHP as a promising therapeutic agent for BC [ 22 ] . The fact that the MDA-MB-231 cell line was more sensitive to XHP treatment than the T-47D cell line suggests that XHP may be particularly effective in targeting more aggressive and treatment-resistant subtypes of BC, further emphasizing its potential as a therapeutic adjunct for high-risk patients. To elucidate the molecular underpinnings of XHP’s action, we performed gene chip analysis to identify differentially expressed genes (DEGs) in XHP-treated BC cells. The results revealed a robust set of upregulated and downregulated genes associated with processes such as cell proliferation, apoptosis, and the cell cycle. Notably, the downregulated genes were enriched in pathways related to cell division and cellular senescence, further suggesting that XHP inhibits BC cell growth by disrupting cell cycle progression and promoting cell death. Among these, genes like CKAP2L, EHBP1L1, MSS51, and RCSD1 were identified as potential molecular targets responsible for the anti-cancer effects of XHP. RT-qPCR and high-content screening (HCS) assays further confirmed that these genes are significantly downregulated in XHP-treated BC cells. Knockdown of these genes resulted in a notable reduction in cell proliferation, indicating their potential role in mediating the anti-proliferative effects of XHP. Among the identified genes, EHBP1L1 emerged as a key gene of interest, as its downregulation significantly affecting BC cell proliferation. EHBP1L1 has been implicated in various cellular processes, including vesicle trafficking, cell migration, and mitotic progression [ 35 , 36 ] . This suggests that EHBP1L1 may play a critical role in the regulation of BC cell proliferation and that its suppression by XHP could contribute to the observed growth inhibition. Further studies are required to validate EHBP1L1 as a therapeutic target in BC and to better understand its precise molecular role. Interestingly, EHBP1L1 has complementary binding sites with miR-137-3p, a microRNA implicated in various cancer-related process. miR-137-3p has been shown to play a role in inhibiting cancer cell proliferation by targeting key oncogenes [ 37 , 38 ] . Although our study identified this potential interaction, we did not further validate the functional role of miR-137-3p in regulating EHBP1L1 expression and its subsequent effects on BC cell proliferation. Additionally, the regulation role of XHP on the miR-137-3p/EHBP1L1 axis was not fully explored in this study. These aspects represent important directions for future research to confirm the functional significance of this molecular interaction and its potential for therapeutic intervention. EHBP1L1 is a protein recently discovered to be closely associated with actin cytoskeleton reorganization, cytoskeletal remodeling, and intracellular material transport [ 35 , 39 ] . It directly binds to Rab8 and BIN1, playing a crucial role in apical transport and maintaining plasma membrane integrity [ 40 ] . Rab8 overexpression has been associated with enhanced cell invasiveness, promoting the formation of actin-containing filopodia and lamellipodia [ 41 , 42 ] . Therefore, the suppression of EHBP1L1 by XHP could disrupt these processes, inhibiting BC cell migration and invasion. This highlights the potential of XHP in targeting both the proliferation and metastasis of breast cancer cells. In conclusion, our study provides valuable insights into the anti-cancer mechanisms of XHP in breast cancer. By identifying key genes such as EHBP1L1, which may mediate the anti-proliferative effects of XHP, we offer a molecular basis for its potential therapeutic application. Furthermore, the interaction between EHBP1L1 and miR-137-3p adds an interesting layer of complexity that warrants further investigation. Future studies should focus on validating the role of miR-137-3p in the regulation of EHBP1L1 and exploring the therapeutic potential of targeting this axis. These findings not only provide scientific evidence for the clinical use of XHP but also contribute to the modernization and scientific validation of TCM theories. Further clinical and functional studies will be crucial for translating these insights into practical therapeutic strategies. Declarations Ethics approval and consent to participate This study was approved by the Research Ethics Committee of the First Hospital of Hunan University of Chinese Medicine. Consent for publication All the authors agreed to publish the manuscript. Availability of data and materials Not applicable. Competing interests The authors declare no conflict of interests. Funding This work was supported in part by the Hunan Natural Science Foundation Project (2025JJ90033, 2022J30455), National Natural Science Foundation of China Youth Project (81703917), Hunan Traditional Chinese Medicine Research Program(D2022112), Hunan Health Commission Research Project (202211004197), Hunan Clinical Medical Technology Innovation Guidance Project (2021SK51409), and Hunan University of Traditional Chinese Medicine's Discipline Construction Project of \"Exposing the List and Taking the Lead\" (22JBZ037). Authors' contributions Junlong Guo and Ruiqi Zou performed most of the experiments and participated in the original preparation of the draft. Shaoqiang Chen and Yuting He assisted with experiment execution and data analysis. Pang Guolian and Liang Yuxing were responsible for the preparation and collection of specimens. Jing Li and Sunan Yong studied the preparation of the extract of the Xihuang pill. Xiaobing Xie contributed to the data analysis. Ping Li contributed to the conception and design of the study and revision of the manuscript. Acknowledgements We would like to express our sincere gratitude to all the individuals and institutions that supported this study. Special thanks to Dr. Qinglin Shen from the department of Oncology, Jiangxi Provincial People’s Hospital, for his invaluable guidance and support throughout the course of this research. all the members of the medical laboratory center of the First Hospital of Hunan University of Chinese Medicine for their laboratories and valuable experience. We gratefully thank all the laboratory members of the medical laboratory center of the first hospital of Hunan University of Traditional Chinese Medicine. References Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024. 74(3): 229-263. Zheng RS, Chen R, Han BF, et al. [Cancer incidence and mortality in China, 2022]. Zhonghua Zhong Liu Za Zhi. 2024. 46(3): 221-231. Trayes KP, Cokenakes S. Breast Cancer Treatment. Am Fam Physician. 2021. 104(2): 171-178. Di Nardo P, Lisanti C, Garutti M, et al. Chemotherapy in patients with early breast cancer: clinical overview and management of long-term side effects. Expert Opin Drug Saf. 2022. 21(11): 1341-1355. Li L, Wang R, Zhang A, et al. Evidence on Efficacy and Safety of Chinese Medicines Combined Western Medicines Treatment for Breast Cancer With Endocrine Therapy. Front Oncol. 2021. 11: 661925. Wang Y, Liu S, Zhang Y, et al. Effect of traditional Chinese medicine on postoperative depression of breast cancer: a systematic review and meta-analysis. Front Pharmacol. 2023. 14: 1019049. Chen Z, Li Z, Yang S, Wei Y, An J. The prospect of Xihuang pill in the treatment of cancers. Heliyon. 2023. 9(4): e15490. Zhang YZ, Yang JY, Wu RX, et al. Network Pharmacology-Based Identification of Key Mechanisms of Xihuang Pill in the Treatment of Triple-Negative Breast Cancer Stem Cells. Front Pharmacol. 2021. 12: 714628. Xu L, Duan H, Zou Y, et al. Xihuang Pill-destabilized CD133/EGFR/Akt/mTOR cascade reduces stemness enrichment of glioblastoma via the down-regulation of SOX2. Phytomedicine. 2023. 114: 154764. Tu H, Li J, Xu W, Wang Z, Wang L. Target and Mechanism of the Xihuang Pill Based on Network Pharmacology for Lung Squamous Cell Carcinoma. Altern Ther Health Med. 2023. 29(7): 148-154. Wang J, Hou D, Peng Y, Xiong J, Xiong L, Tan X. Efficacy and safety of Xihuang pill for gastric cancer: A protocol for systematic review and meta-analysis. Medicine (Baltimore). 2021. 100(19): e25726. Yu D, An GY. Clinical Effects of Xihuang Pill Combined with Chemotherapy in Patients with Advanced Colorectal Cancer. Evid Based Complement Alternat Med. 2017. 2017: 5936086. Zhao X, Hao J, Chen S. Network Pharmacology-Based Strategy for Predicting Therapy Targets of Traditional Chinese Medicine Xihuang Pill on Liver Cancer. Evid Based Complement Alternat Med. 2020. 2020: 6076572. Li D, Fan H, Dong J, et al. Based on BATMAN-TCM to Explore the Molecular Mechanism of Xihuang Pill Regulating Immune Function to Treat Breast Precancerous Lesions. Breast Cancer (Dove Med Press). 2021. 13: 725-742. Shin SU, Lee J, Kim JH, et al. Gene expression profiling of calcifications in breast cancer. Sci Rep. 2017. 7(1): 11427. Pongor L, Kormos M, Hatzis C, Pusztai L, Szabó A, Győrffy B. A genome-wide approach to link genotype to clinical outcome by utilizing next generation sequencing and gene chip data of 6,697 breast cancer patients. Genome Med. 2015. 7: 104. Sung E, Turan N, Ho PW, et al. Detection of endocrine disruptors - from simple assays to whole genome scanning. Int J Androl. 2012. 35(3): 407-14. Kubista M, Andrade JM, Bengtsson M, et al. The real-time polymerase chain reaction. Mol Aspects Med. 2006. 27(2-3): 95-125. Sherman BT, Hao M, Qiu J, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022. 50(W1): W216-W221. Xu Y, Gong M, Wang Y, Yang Y, Liu S, Zeng Q. Global trends and forecasts of breast cancer incidence and deaths. Sci Data. 2023. 10(1): 334. Hong W, Tang H, Wang D, et al. Xihuang pill suppresses breast cancer malignancy by inhibiting TGF-β signaling and acquires chemotherapy benefits. J Ethnopharmacol. 2025. 337(Pt 3): 119000. Zheng W, Han S, Jiang S, et al. Multiple effects of Xihuang pill aqueous extract on the Hs578T triple-negative breast cancer cell line. Biomed Rep. 2016. 5(5): 559-566. Ge A, Yang K, Deng X, Zhao D, Ge J, Liu L. The efficacy and safety of Xihuang Pill/capsule in adjuvant treatment of breast cancer: A systematic review and meta-analysis of 26 randomized controlled trials. J Ethnopharmacol. 2022. 295: 115357. Chen C, Yuan S, Chen X, Xie J, Wei Z. Xihuang pill induces pyroptosis and inhibits progression of breast cancer cells via activating the cAMP/PKA signalling pathway. Am J Cancer Res. 2023. 13(4): 1347-1362. Mao D, Feng L, Huang S, Zhang S, Peng W, Zhang S. Meta-Analysis of Xihuang Pill Efficacy When Combined with Chemotherapy for Treatment of Breast Cancer. Evid Based Complement Alternat Med. 2019. 2019: 3502460. Xie ZC, Dang YW, Wei DM, et al. Clinical significance and prospective molecular mechanism of MALAT1 in pancreatic cancer exploration: a comprehensive study based on the GeneChip, GEO, Oncomine, and TCGA databases. Onco Targets Ther. 2017. 10: 3991-4005. Ge L, Sun Q, Xia L, Xu X. Clinical significance and prospective molecular mechanism of NUF2 in gastric cancer exploration: A comprehensive study based on the GeneChip, GEO, Oncomine, and TCGA databases. Medicine (Baltimore). 2022. 101(26): e29802. Ahlborn GJ, Nelson GM, Ward WO, et al. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite. Toxicol Appl Pharmacol. 2008. 227(3): 400-16. Ma YY, Zhang GJ, Liu PF, et al. Comprehensive Genomic Analysis of Puerarin in Inhibiting Bladder Urothelial Carcinoma Cell Proliferation and Migration. Recent Pat Anticancer Drug Discov. 2024. 19(4): 516-529. Huan J, Wang L, Xing L, et al. Insights into significant pathways and gene interaction networks underlying breast cancer cell line MCF-7 treated with 17β-estradiol (E2). Gene. 2014. 533(1): 346-55. Wu H, Qin W, Lu S, et al. Long noncoding RNA ZFAS1 promoting small nucleolar RNA-mediated 2'-O-methylation via NOP58 recruitment in colorectal cancer. Mol Cancer. 2020. 19(1): 95. Chen L, Feng J, Wu S, et al. Decreased RIG-I expression is associated with poor prognosis and promotes cell invasion in human gastric cancer. Cancer Cell Int. 2018. 18: 144. Wang Y, Zhang H, Li X, Chen W. Differential expression profile analysis of lncRNA UCA1α regulated mRNAs in bladder cancer. J Cell Biochem. 2018. 119(2): 1841-1854. Lee HM, Wong W, Fan B, et al. Detection of increased serum miR-122-5p and miR-455-3p levels before the clinical diagnosis of liver cancer in people with type 2 diabetes. Sci Rep. 2021. 11(1): 23756. Liu Z, Xu E, Zhao HT, Cole T, West AB. LRRK2 and Rab10 coordinate macropinocytosis to mediate immunological responses in phagocytes. EMBO J. 2020. 39(20): e104862. Venditti M, Donizetti A, Aniello F, Minucci S. EH domain binding protein 1-like 1 (EHBP1L1), a protein with calponin homology domain, is expressed in the rat testis. Zygote. 2020. 28(6): 441-446. Ding X, Zhang J, Feng Z, Tang Q, Zhou X. MiR-137-3p Inhibits Colorectal Cancer Cell Migration by Regulating a KDM1A-Dependent Epithelial-Mesenchymal Transition. Dig Dis Sci. 2021. 66(7): 2272-2282. Wang Y, Guo Y, Lu Y, Sun Y, Xu D. The effects of endosulfan on cell migration and invasion in prostate cancer cells via the KCNQ1OT1/miR-137-3p/PTP4A3 axis. Sci Total Environ. 2022. 845: 157252. Guilherme A, Soriano NA, Bose S, et al. EHD2 and the novel EH domain binding protein EHBP1 couple endocytosis to the actin cytoskeleton. J Biol Chem. 2004. 279(11): 10593-605. Nakajo A, Yoshimura S, Togawa H, et al. EHBP1L1 coordinates Rab8 and Bin1 to regulate apical-directed transport in polarized epithelial cells. J Cell Biol. 2016. 212(3): 297-306. Bravo-Cordero JJ, Marrero-Diaz R, Megías D, et al. MT1-MMP proinvasive activity is regulated by a novel Rab8-dependent exocytic pathway. EMBO J. 2007. 26(6): 1499-510. Peränen J. Rab8 GTPase as a regulator of cell shape. Cytoskeleton (Hoboken). 2011. 68(10): 527-39. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6120346\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":421736475,\"identity\":\"49cd5978-e20c-4bb5-8f54-8f2cac9d757a\",\"order_by\":0,\"name\":\"Junlong Guo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Junlong\",\"middleName\":\"\",\"lastName\":\"Guo\",\"suffix\":\"\"},{\"id\":421736476,\"identity\":\"2a9c82a3-e5f7-44b6-b7f4-7d5c857d554e\",\"order_by\":1,\"name\":\"Ruiqi Zou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ruiqi\",\"middleName\":\"\",\"lastName\":\"Zou\",\"suffix\":\"\"},{\"id\":421736477,\"identity\":\"9470a175-7546-4b4e-b7a0-dce2292181eb\",\"order_by\":2,\"name\":\"Shaoqiang Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shaoqiang\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":421736478,\"identity\":\"499e0085-053c-4714-8a31-4df4a1110ca9\",\"order_by\":3,\"name\":\"Guolian Pang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the First People’s Hospital of Qujing\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guolian\",\"middleName\":\"\",\"lastName\":\"Pang\",\"suffix\":\"\"},{\"id\":421736479,\"identity\":\"2d173b49-7e32-4722-8dc3-1883c49cd9cb\",\"order_by\":4,\"name\":\"Yuxin Liang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuxin\",\"middleName\":\"\",\"lastName\":\"Liang\",\"suffix\":\"\"},{\"id\":421736480,\"identity\":\"bedf84d0-c0c0-4dee-8922-8d09ae670aba\",\"order_by\":5,\"name\":\"Yuting He\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuting\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":421736481,\"identity\":\"b2546dbf-3424-408f-9809-70e27569886b\",\"order_by\":6,\"name\":\"Jing Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":421736482,\"identity\":\"848ad5fc-efec-45c9-938c-557bca5312eb\",\"order_by\":7,\"name\":\"Xiaobing Xie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaobing\",\"middleName\":\"\",\"lastName\":\"Xie\",\"suffix\":\"\"},{\"id\":421736483,\"identity\":\"a5cdced6-cc72-4899-9e14-417c8cc8142c\",\"order_by\":8,\"name\":\"Sunan Yong\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sunan\",\"middleName\":\"\",\"lastName\":\"Yong\",\"suffix\":\"\"},{\"id\":421736484,\"identity\":\"383c0470-80b0-4663-92a1-8369c65196a3\",\"order_by\":9,\"name\":\"Ping Li\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIie3QsQrCMBCA4SuBulya9br5CIGCU97EJVM2wQcoUhB0EV3t21QO3MRX6CMILiIdrJC9NwrmX3LDfZAEIJX6wQoF0H0HoxT3IpJHQuU+D1ZG4kn2jnOSkZm+8PrNm4oRLNRuKbhY4bk9Blqw7nq4hlUzTdCyPriRFN5mDYsJUbVFS3KCL0dWycn4Ft2E8szjJ3vJW4y58RMHNubE3D9qN00AECDbxdlPr0cCg2w1lUql/rQPJKs22phplCcAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"The First Hospital of Hunan University of Chinese Medicine\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Ping\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-02-27 11:08:10\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6120346/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6120346/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":77560996,\"identity\":\"570c1f60-e5a1-4587-acba-aaa0eee426aa\",\"added_by\":\"auto\",\"created_at\":\"2025-03-03 06:42:10\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4858963,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eInhibitory effect of XHP extract on the growth of MDA-MB-231 and T-47D cells. A \\u003c/strong\\u003eThe IC50 value of XHP extract for MDA-MB-231 cells was determined using the CCK-8 assay. The concentration values of the XHP extract were logarithmically transformed, and the OD values for each concentration group were compared to the solvent control group. The cell inhibition rate was calculated, and a scatter plot was generated with Log(concentration) on the x-axis and the cell inhibition rate on the y-axis. \\u003cstrong\\u003eB\\u003c/strong\\u003e After 72 hours of treatment with 15.08 g/L XHP extract, cell growth was observed under a microscope at 100x magnification. The number of cells in the XHP-treated group was reduced compared to the control group in both cell lines. \\u003cstrong\\u003eC\\u003c/strong\\u003e The BrdU assay indicates that the proliferation rate of cells in the XHP group was significantly lower than that in the control (Ctrl) group. \\u003cstrong\\u003eD\\u003c/strong\\u003e The CCK-8 assay indicates that the proliferation rate of cells in the XHP group was significantly reduced compared to the Ctrl group. \\u003cstrong\\u003eE, F \\u003c/strong\\u003eCell apoptosis was detected by flow cytometry with Annexin V-APC and PI double staining. In the scatter plot, apoptotic cells were located in the right half of the plot, and there were more apoptotic cells in the XHP-treated group than in the control group in both cell lines. The histogram further confirms that the number of apoptotic cells was higher in the XHP group compared to the control group, with a statistically significant difference.\\u003cstrong\\u003e G, H\\u003c/strong\\u003e The colony formation assay digital photographs show a significantly lower number of colonies in the XHP-treated group (top) than in the control group (bottom). The histogram further confirms that the number of colonies in the XHP group was significantly lower in the Ctrl group, with a statistically significant difference. All P values were calculated by unpaired two-tailed Student’s t-tests. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05; **\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001; ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt;0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6120346/v1/bdfc1dd2be4b6a2060e943d6.jpg\"},{\"id\":77561255,\"identity\":\"677e2098-1b0f-4592-a24d-90448f1c325a\",\"added_by\":\"auto\",\"created_at\":\"2025-03-03 06:50:10\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4049177,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eQuality control and bioinformatics analysis of the gene chip. A\\u003c/strong\\u003eThe Pearson correlation coefficient distribution plot shows the level of correlation of signal intensity between all chips, and each square represents the degree of correlation between two samples corresponding to the ordinate and abscissa. There were significant differences between the XHP and Control groups, whereas the data within each group were in good agreement and met the criteria for continued analysis. \\u003cstrong\\u003eB \\u003c/strong\\u003eThe volcano plot shows the relative expression levels of genes between the two groups, with red dots indicating significantly differentially expressed genes highlighting significantly differentially expressed genes (|Fold Change|≥2.0, FDR\\u0026lt;0.05) as red dots. Downregulated genes are shown on the left and upregulated genes on the right. \\u003cstrong\\u003eC, D \\u003c/strong\\u003eThe differentially expressed genes screened in the microarray were analyzed by IPA. Results of disease and function analysis (C) and classical pathway analysis (D) of differentially expressed genes were obtained. \\u003cstrong\\u003eE-H\\u003c/strong\\u003eBioinformatics analysis of differentially expressed genes (DEGs) is performed using the DAVID database for Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and is Genomes (KEGG) pathway analysis. The up-regulated genes (E, F) and down-regulated genes (G, H) selected from the microarray were subjected to GO analysis and KEGG analysis, respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6120346/v1/b537f8ab258c00677706825b.jpg\"},{\"id\":77560998,\"identity\":\"52572af6-e7a9-42ab-970d-6b4f86c60745\",\"added_by\":\"auto\",\"created_at\":\"2025-03-03 06:42:10\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3297365,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eResults of RT-PCR and HCS analysis of the selected DEGs. A-F \\u003c/strong\\u003eThe RT-PCR results of the selected DEGs. Gene expression levels were normalized to GAPDH as the internal control. The results show that except for CCDC3, the expression of all genes was significantly reduced in the XHP-treated group. \\u003cstrong\\u003eG\\u003c/strong\\u003e HCS results of the selected DEGs. Gene knockdown was performed, and cells were cultured for 5 days, with fluorescence images captured daily. Cell growth was significantly inhibited in the shEHBP1L1 group during the culture period, while changes in cell growth were less pronounced in the other gene knockdown groups.\\u003cstrong\\u003e H \\u003c/strong\\u003eDaily cell counts for each group were plotted in a line graph, which revealed that, except for the shSPACA6 group, cell numbers in all other knockdown groups were significantly lower compared to the shCtrl group. All P values were calculated by unpaired two-tailed Student’s t-tests. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05; **\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001; ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt;0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6120346/v1/e979cd74572e4c4aa04e2c5c.jpg\"},{\"id\":77561253,\"identity\":\"dbd70aab-51c9-4d6b-bc5d-8bf96d5d825b\",\"added_by\":\"auto\",\"created_at\":\"2025-03-03 06:50:10\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3847815,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffect of EHBP1L1 gene knockdown on the function of breast cancer cell lines.\\u003c/strong\\u003e \\u003cstrong\\u003eA\\u003c/strong\\u003e The MDA-MB-231 and T-47D cells were infected with shRNA lentivirus, cultured for 5 days, and treated with MTT for 4 hours. The absorbance of the shEHBP1L1 and the control group (shCtrl) at a wavelength of 490nm light was compared with time. OD490 here reflects the number of viable cells.\\u003cstrong\\u003e B, C\\u003c/strong\\u003e Cell cycle detection by PI-FACS. After MDA-MB-231 and T-47D cells were infected with shRNA lentivirus and cultured for 6 days, the results of the number of cells in each cycle between the shEHBP1L1 group and the control group (shCtrl) were observed. The stacking histograms show the percentage of cells in the G1, S, and G2/M phases, with a statistically significant difference. \\u003cstrong\\u003eD, E \\u003c/strong\\u003eComparison of the number of clones formed between the shEHBP1L1 group and control group (shCtrl) after infecting MDA-MB-231 and T-47D cells with shRNA lentivirus. The histogram showed that the number of colonies in the EHBP1L1 knockdown group was significantly lower than that in the shCtrl group, with a statistically significant difference. \\u003cstrong\\u003eF, G\\u003c/strong\\u003e Cell apoptosis was detected by flow cytometry (Annexin V-APC staining). shRNA virus-infected cells, after 5 days of culture, shEHBP1L1 group and shCtrl group apoptosis rate comparison. The histogram showed that the number of apoptotic cells in the EHBP1L1 knockdown group was significantly higher than that in the shCtrl group, with a statistically significant difference. All P values were calculated by unpaired two-tailed Student’s t-tests. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05; **\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001; ***\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6120346/v1/c6719a99f7901d7f07c126e2.jpg\"},{\"id\":77561021,\"identity\":\"35bdbe4e-aa06-4056-8205-36514ead8271\",\"added_by\":\"auto\",\"created_at\":\"2025-03-03 06:42:13\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":823574,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePrediction and validation of the binding sites between miR-137-3p and the EHBP1L1 gene. A \\u003c/strong\\u003eThe TargetScan database predicts a binding site for miR-137-3p in the 3'UTR region of the EHBP1L1 gene. \\u003cstrong\\u003eB\\u003c/strong\\u003e A dual luciferase reporter assay was used to verify the binding between miR-137-3p and the EHBP1L1 gene. The luciferase activity of EHBP1L1 wild type (EHBP1L1-WT) and miR-137 co-transfection group was decreased, indicating that EHBP1L1-WT can bind to miR-137. In contrast, the EHBP1L1 mutant (EHBP1L1-MUT) could not bind to miR-137. The results confirmed the specific binding between the two genes. All P values were calculated by unpaired two-tailed Student’s t-tests. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.05; **\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.001; ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt;0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6120346/v1/1153c8e49e6a719b4cf138f0.jpg\"},{\"id\":87981802,\"identity\":\"2f636a35-8669-411f-bbe9-52044d70be00\",\"added_by\":\"auto\",\"created_at\":\"2025-07-31 06:17:35\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":18026766,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6120346/v1/2e0f9f4e-b649-46a5-a653-14bea719d976.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Antiproliferative and Antimetastatic Effects of Xihuang Pill (XHP) Extract on Breast Cancer Cells: Involvement of EHBP1L1 Gene Regulation\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eBreast cancer (BC) is one of the most common malignant tumors threatening women's health worldwide. In 2022, BC accounted for 11.6% of all cancer cases and 6.9% of cancer related deaths globally\\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u003c/sup\\u003e. According to the latest data from the National Central Cancer Registry of China (NCCR), the incidence and mortality rates of breast cancer in China also rank among the top five\\u003csup\\u003e[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. Current treatments for BC primarily include lumpectomy, mastectomy, radiation therapy, endocrine therapy, and chemotherapy\\u003csup\\u003e[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]\\u003c/sup\\u003e. While these approaches have significantly improved patient survival, each approach has inherent limitations and adverse effects, such as fatigue, estrogen deprivation and cardiotoxicity\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. Thus, there is a pressing need for complementary therapies to mitigate these shortcomings.\\u003c/p\\u003e \\u003cp\\u003eTraditional Chinese medicine (TCM) has demonstrated efficacy in alleviating BC related complications, reducing chemotherapy side effects, and alleviating cancer pain\\u003csup\\u003e[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. It is increasingly recognized as an adjunctive treatment to conventional BC therapies. Among TCM formulas, Xihuang pill (XHP) has been clinically utilized for centuries. XHP, comprising \\u003cem\\u003eCalculus Bovis\\u003c/em\\u003e, \\u003cem\\u003eMoschus\\u003c/em\\u003e, \\u003cem\\u003eOlibanum\\u003c/em\\u003e, and \\u003cem\\u003eMyrrha\\u003c/em\\u003e\\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e, was first documented by Wang Hongxu during the Qing Dynasty in \\u003cem\\u003eWai Ke Zheng Zhi Quan Sheng Ji\\u003c/em\\u003e and is currently applied in cancer treatment\\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. Previous researches have highlighted the therapeutic potential of XHP in glioblastoma\\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e, lung cancer\\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e, gastric cancer\\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]\\u003c/sup\\u003e, colorectal cancer\\u003csup\\u003e[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/sup\\u003e, liver cancer\\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e, and BC\\u003csup\\u003e[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]\\u003c/sup\\u003e. However, studies investigating the molecular mechanisms underlying XHP\\u0026rsquo;s effects on BC are limited, and the specific genes involved remain largely unknown.\\u003c/p\\u003e \\u003cp\\u003eExisting researches on XHP have adopted two main approaches. The first approach involves isolating and analyzing its active ingredients using techniques such as chromatography and mass spectrometry to explore their individual functions. While this approach provides insights into specific bioactive compounds, it may overlook the holistic interactions inherent in TCM formulations. The second approach examines XHP as a whole, investigating the effects of its populations. This method aligns with the holistic principles of TCM and considers the synergistic interactions of XHP\\u0026rsquo;s components in cancer treatment. Despite these advancements, molecular studies in XHP\\u0026rsquo;s role in BC remain unclear.\\u003c/p\\u003e \\u003cp\\u003eTo address this gap, our study focuses on elucidating the anti-breast cancer mechanisms of XHP extract. We employed gene chip technology, a high-throughput tool widely used in cancer research for analyzing gene expression\\u003csup\\u003e[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/sup\\u003e, detecting gene mutations\\u003csup\\u003e[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e, and investigating genome structure\\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. This method allows for the simultaneous assessment of thousands of genes, providing insights into their roles in tumor development and progression. By comparing gene expression profiles of untreated BC cells and BC cells treated with XHP extract, we aimed to identify specific genes and pathways involved in XHP\\u0026rsquo;s therapeutic effects.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we conducted in vitro experiments to investigate the effects of XHP extract on BC and utilized gene chip analysis to identify key genes associated with its anti-cancer activity. These genes were subsequently subjected to further experimental validation to uncover their roles in the underlying mechanisms of XHP.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of XHP Extract\\u003c/h2\\u003e \\u003cp\\u003eXHP was obtained from Tong Ren Tang Technologies Co., Ltd. (Beijing, China). The XHP extract was prepared following a method previously established by our research team. Briefly, XHP was immersed in pre-cooled DMEM (4 ℃) and allowed to soak for 24 hours in a sterile, sealed container. The mixture was then subjected to ultrasonic agitation for 2 hours and incubated at 37 ℃ for 48 hours. After incubation, the supernatant was filtered through a 0.22 \\u0026micro;m microporous filter to obtain the XHP extract.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCell lines, Culture, Plasmid Construction and Lentivirus Production\\u003c/h3\\u003e\\n\\u003cp\\u003eBreast cancer cell lines MDA-MB-231 and T-47D were purchased from ATCC, and cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS).\\u003c/p\\u003e \\u003cp\\u003eThe lentiviral expression vectors carrying short hairpin RNA (shRNA) targeting candidate genes along with corresponding negative controls, were synthesized and cloned into GV493 vector (pFU-GW-016) containing BsmBI restriction sites (purchased from Shanghai Genechem Co., Ltd). The recombinant vectors were confirmed by DNA sequencing. The shRNA target sequences for each gene are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eshRNA sequence information used in high-content screening\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003egene symbol\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRNAi target sequences\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCKAP2L\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#1CTATATGAAGAGGCCATTAAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#2GCTGATGTCACAACCGTAAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#3CATAAGCCAGAGGCCTAATTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eEHBP1L1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#1GGCCAAAGAGTGGACATTTAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#2ATTTATTTGTCACCGAGGGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#3CCAGGAAGTCACCACTGGCTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMSS51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#1TCAAACCTGAACAGGTCTATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#2CTGCTACTTCGTGACTATAAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#3TCCCATGTGGAGACATTTCTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRCSD1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#1CCTGAACATGACAGCCAAGAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#2CAGTAAACCAACCCGAAGGAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#3CGGTTCTCAAATATCAGTTAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSPACA6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#1CCAAAGGAGGAGATCACCTAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#2CGGAGAAAATGAAGAAGGTCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e#3GCGGGCGGAGACAGAGTTGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo produce lentivirus, the viral vector was transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) along with two helper plasmids, psPAX2 and pMD2.G. Lentiviral particles were harvested 72 hours post-transfection. The culture medium was then subjected to rapid centrifugation to remove cell debris, followed by filtration through 0.45 \\u0026micro;m cellulose acetate filters. The virus titer was determined by fluorescence-activated cell sorting (FACS) analysis of GFP-positive 293T cells, yielding a titer of approximately 1\\u0026times;10\\u003csup\\u003e9\\u003c/sup\\u003e transducing units (TU)/mL. The lentivirus was subsequently stored at -80 ℃ for further use.\\u003c/p\\u003e\\n\\u003ch3\\u003eCCK-8 Assay and IC50 (Half maximal inhibitory concentration) Determination of XHW Extract\\u003c/h3\\u003e\\n\\u003cp\\u003eCells were cultured in a 96-well plate at a density of 2000 cells per well. On the following day, 20 \\u0026micro;L of CCK-8 reagent (5 mg/mL) was added to each well, and the cells incubated for 4 hours. After incubation, the culture medium was removed, and 100 \\u0026micro;L of DMSO was added to dissolve the formazan crystals. The plate was then shaken for 2\\u0026ndash;5 minutes, and absorbance was measured at 490 nm using a microplate reader.\\u003c/p\\u003e \\u003cp\\u003eFor the IC50 determination, MDA-MB231 cells were seeded at a density of 3,000 cells per well in a 96-well plate, with 100 \\u0026micro;L of culture medium per well. The cells were treated with varying concentration of XHP extract, divided into nine groups: 0 g/L, 1 g/L, 2 g/L, 5 g/L, 10 g/L, 20 g/L, 50 g/L, 75 g/L, and 100 g/L. After 72 hours of drug treatment, 10 \\u0026micro;L of CCK-8 reagent was added to each well 2\\u0026ndash;4 hours before the end of incubation. The optical density (OD) at 450 nm was then measured using a microplate reader. The resulting data were logarithmically processed, and the IC50 value was calculated based on dose-response curves.\\u003c/p\\u003e\\n\\u003ch3\\u003eMTT Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eCells were seeded into 96-well plates at a density of 2,000\\u0026ndash;3,000 cells per well and cultured for 24 hours. After treatment with various concentrations of XHP extract, MTT reagent (5 mg/mL) was added 2\\u0026ndash;24 hours before detection, with three biological replicates for each group. The absorbance was measured at 490 nm using a microplate reader on each day of culture (24, 48, 72, 96 and 120 hours) to assess cell viability.\\u003c/p\\u003e\\n\\u003ch3\\u003eBrdU Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eCells were seeded into 96-well plates at a density of 3,000 cells per well and cultured for 24 hours. After treatment, BrdU reagent (Roche Brdu kit, Roche, Switzerland) was added and incubated for an additional 4 days. The reagent was added 2\\u0026ndash;24 hours before detection, with three biological replicates for each group. Absorbance was measured at 450 nm on the first and fourth days of culture to assess cell proliferation.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell Apoptosis Assay\\u003c/h2\\u003e \\u003cp\\u003eCells were planted into 6-well plates at a density of at least 5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well, and apoptosis was induced when the confluence reached 70%. The cells were digested with trypsin, resuspended in complete medium to form a cell suspension, and collected into 5 ml centrifuge tubes. Each group had three biological replicates. Annexin V-APC and PI staining (double staining) flow cytometry were used to detect the effect of XHP on breast cancer cell apoptosis. Annexin V-APC staining (single staining) flow cytometry was used to detect the effect of EHBP1L1 knockout on breast cancer cell apoptosis.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eColony Formation Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eThe cells in the logarithmic growth phase were digested with trypsin, resuspended in complete medium, and counted. The cells were seeded into 6-well plates at a density of 400\\u0026ndash;1000 cells/well, with three biological replicates for each group. After 14 days of culture, cell colonies were photographed using a fluorescence microscope. Crystal violet dye was added to stain the colonies, and the images were captured with a digital camera. The number of colonies was then counted.\\u003c/p\\u003e\\n\\u003ch3\\u003eCell Cycle Detection\\u003c/h3\\u003e\\n\\u003cp\\u003eCells were seeded into 6-well plates at a density of at least 10\\u003csup\\u003e6\\u003c/sup\\u003e cells per well, and apoptosis was induced when the confluence reached 80%. Cells were prepared as a single-cell suspension and washed. After washing, the cells were stained with propidium iodide (PI) and analyzed by Fluorescence-activated cell sorting (FACS) to determine the distribution of cells in different phases of the cell cycle.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA Extraction and Quantitative Real‑Time PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted using the Trizol reagent (Pufei, China) and quantified with a NanoDrop ND-2000 spectrophotometer. RNA samples were deemed suitable for further analysis if they met the following criteria: 1.7\\u0026thinsp;\\u0026lt;\\u0026thinsp;A260 / A280\\u0026thinsp;\\u0026lt;\\u0026thinsp;2.2, RIN\\u0026thinsp;\\u0026ge;\\u0026thinsp;7.0, and 28 S/18 S\\u0026thinsp;\\u0026ge;\\u0026thinsp;0.7. Total RNA is required for preparing gene chip expression. Reverse transcription was performed using a Prime Script RT reagent (Takara, Otsu, Japan), followed by quantitative real-time PCR using SYBR Premix Ex Taq\\u0026trade; (Takara, Otsu, Japan). Relative mRNA expression levels were normalized to GAPDH using the 2\\u003csup\\u003e\\u0026minus;ΔΔCT\\u003c/sup\\u003e method\\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e. Primers were synthesized by Gene Chem (Shanghai, China), and their sequences are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eRT-qPCR primer sequences of DEGs\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003egene symbol\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eprimer type\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eprimer sequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eproduct size (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCCDC3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGTCAATTTCCAAGATGCCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e157\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGAGGAGCACATGAGCCTAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCKAP2L\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCAAGACTCAAACAGAACCACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e297\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGACACTGCTCGCTCAATCCTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eEHBP1L1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAAGCCAAAGTCAGTGAAGGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e161\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCTCAGCAAAGTCATCCAAGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMSS51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eACAGGAGGGTTTGTCAAGAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e183\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCACAGCATCCAATGTAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRCSD1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eACCAGCCAGTAAACCAACCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e139\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCCCCAGGCAGTAGAGCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSPACA6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCTGACGCCCAGCAATCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e94\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTACCATCGAAAGAACATCCAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eforward primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGACTTCAACAGCGACACCCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e121\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ereverse primer\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCACCCTGTTGCTGTAGCCAAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGene Chip and Analysis of the Differentially Expressed Genes (DEGs)\\u003c/h2\\u003e \\u003cp\\u003eGene expression profiling was performed using Gene Chip\\u0026trade; 3'IVT PLUS Reagent Kit (Thermo Fisher Scientifc, USA). Qualified RNA samples were used for microarray experiments, with three biological replicates per group. For data preprocessing, we removed the lowest 20% of probe sets by signal intensity in both sample groups to eliminate background noise. The coefficient of variation (CV) method was applied (CV\\u0026thinsp;=\\u0026thinsp;Standard Deviation/Mean) to calculate the variation within each sample group for the same probe set, and probe sets with a CV greater than 25% in both groups were filtered out. Initially, there were 49,395 probes; after filtering, 39,272 probes remained. DEGs were selected based on the criteria of | Fold Change | \\u0026ge; 2.0 and FDR (false discovery rate)\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIPA Analysis of DEGs\\u003c/h2\\u003e \\u003cp\\u003eThe IPA analysis of differentially expressed genes (DEGs) was performed using Qiagen\\u0026rsquo;s Ingenuity Pathway Analysis algorithm (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.qiagen.com/ingenuity\\u003c/span\\u003e\\u003cspan address=\\\"http://www.qiagen.com/ingenuity\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e, Qiagen, Redwood City, CA, USA). The activation z-score and P value were calculated following established protocols. gene ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of DEGs were conducted using the Database for Annotation, Visualization and Integrated Discovery (DAVID)\\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHigh Content Screening (HCS)\\u003c/h2\\u003e \\u003cp\\u003eCells were infected with lentivirus expressing siRNA and green fluorescent protein (GFP). Target cells were seeded into 48-well culture plates one day before infection. On the day of infection, lentiviral particles were added according to the experimental groups. After 2\\u0026ndash;3 days, GFP expression was observed under a fluorescence microscope (fluorescence rate should reach 50\\u0026ndash;80%). Once cell confluence reached 80%, cells were collected. The Celigo imaging cytometer (Nexcelom Bioscience, USA) was used to capture images and automatically count cells. Continuous readings over 5 days generated a cell growth curve to assess cell proliferation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDual-Luciferase Assay\\u003c/h2\\u003e \\u003cp\\u003eGene mutation sequences for the EHBP1L1 gene were designed and inserted into the psiCHECK-2 vector at the XhoI and NotI restriction sites. This vector was transfected into target cells, and after 48 hours of culture, luciferase activity was measured. The luminescence signals of both firefly luciferase and renilla luciferase were detected using a dual-luciferase assay kit (Promega, USA) on a multifunctional microplate reader.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analyses\\u003c/h2\\u003e \\u003cp\\u003eEach experiment was repeated three times. Data are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD). One-way ANOVA and Student's t-test were used to assess differences between groups, with a two-tailed P value of \\u0026lt;\\u0026thinsp;0.05 considered statistically significant. Statistical analyses were conducted with GraphPad version 9.0.0.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eIC50 Value and Inhibitory Effect of XHP Extract on the Growth of BC cells in Vitro\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAfter treating MDA-MB-231 cells with varying concentrations of XHP extract for 72 hours, the OD values of each group were measured using the CCK-8 assay kit. The IC50 value of XHP extract on MDA-MB-231 cells was determined to be 15.08 g/L (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). This IC50 value was then used for subsequent experiments with XHP extract in MDA-MB231 cells. Based on the IC50 concentration, two breast cancer cell lines (MDA-MB-231 and T-47D) were treated with 15.08 g/L XHP extract. The microscopic results showed that XHP extract inhibited the growth of both cell lines at this concentration (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). The BrdU assay showed that XHP extract significantly inhibited cell proliferation in both cell lines compared to the Ctrl group at day 4 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Further analysis using CCK-8 assays confirmed that the proliferation of BC cells treated with XHP extract was significantly reduced compared to the Ctrl group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). In the apoptosis assay, the number of apoptotic cells in the XHP-treated group was higher than that in the control group significantly, indicating that XHP promotes apoptosis of BC cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF). The colony formation assay, observed under a microscope at 100\\u0026times; magnification, showed that cells in the XHP-treated group were dispersed, while cells in the Ctrl group formed clusters. The number of colonies formed in the XHP-treated group was significantly lower than in the control group, indicating that XHP can inhibit the clonogenic ability of BC cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eG and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eH).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of Gene Chip and Bioinformatics Analysis to Identify DEGs\\u003c/h2\\u003e \\u003cp\\u003eBased on the results of various cell function assays with XHP extract in the two cell lines, the MDA-MB-231 cell was selected for the gene chip experiment. Consistent with the cell function assays, the cells were treated with 15.08 g/L XHP extract for 72 hours. After treatment, RNA was extracted from each group of cells for gene chip analysis. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, both the XHP and Ctrl group demonstrated a high degree of comparability, with intraclass correlation coefficients for both groups exceeding 0.99. This indicates that the quality of the gene chips met the necessary criteria for subsequent analysis. The gene chip data were categorized into upregulated and downregulated DEGs, with 360 genes identified as upregulated and 461 as downregulated. The distribution of these genes was depicted in the volcano plot (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). We performed bioinformatics analysis on the DEGs identified from the gene chip using Ingenuity Pathway Analysis (IPA) (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.qiagen.com/zh-us/products/discovery-and-translational-research/next-generation-sequencing/informatics-and-data/interpretation-content-databases/ingenuity-pathway-analysis\\u003c/span\\u003e\\u003cspan address=\\\"https://www.qiagen.com/zh-us/products/discovery-and-translational-research/next-generation-sequencing/informatics-and-data/interpretation-content-databases/ingenuity-pathway-analysis\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) and the DAVID database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://david.ncifcrf.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://david.ncifcrf.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The enriched terms were predominantly associated with processes such as cell proliferation, cell death, and the cell cycle in tumor cell lines, which aligns with the observed anti-proliferative effects of the XHP extract on breast cancer cells. Subsequently, we analyzed the upregulated and downregulated DEGs separately using the DAVID database. The results of the \\\"disease and function analysis\\\" and \\\"classical pathway analysis\\\" of the DEGs, based on IPA software were presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eGO and KEGG enrichment analysis of the upregulated genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF) revealed no significant association with tumor cell growth. In contrast, the analysis of downregulated genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH) highlighted their involvement in processes such as cell division and cell senescence, which is consistent with the IPA software analysis. Based on these findings, this study primarily focuses on exploring the functions of the downregulated genes affected by the XHP extract.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRT-qPCR and HCS of DEGs\\u003c/h2\\u003e \\u003cp\\u003eBased on the above research, downregulated DEGs were ranked by fold change and significance, resulting in the selection of 6 genes for further investigation. The basic information of these genes is provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. Although 6 genes were identified from the DEGs, it was deemed necessary to narrow the focus for subsequent studies. Therefore, RT-qPCR and HCS were employed to further screen these genes and identify the final targets for further research. Initially, RT-qPCR was conducted on these 6 genes. The expression levels of these genes were compared between the XHP group and the Ctrl group. The RT-qPCR results revealed that the mRNA levels of CKAP2L, EHBP1L1, MSS51, RCSD1, and SPACA6 were significantly reduced in the XHP group compared to the Ctrl group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-F).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eGenes selected for further screening and their biological functions\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003egene symbol\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ebiological function\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eP value\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCCDC3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eInvolved in the negative regulation of tumor necrosis factor-mediated signaling pathways and lipid metabolic processes, and is localized in the endoplasmic reticulum and extracellular space.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1.38246E-13\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCKAP2L\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eA microtubule-associated protein required for mitotic spindle formation and cell cycle progression in neural progenitor cells, associated with spindle organization defects.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2.21179E-15\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eEHBP1L1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eActs as a Rab effector protein and plays a role in vesicle transport, involved in the organization of the actin cytoskeleton.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4.66828E-14\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMSS51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eA skeletal muscle-specific gene that regulates cellular metabolism, associated with metal ion binding.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1.04892E-10\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRCSD1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePossesses actin-binding activity, involved in the cellular response to hyperosmotic stress.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1.94974E-11\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSPACA6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eA sperm protein required for sperm-egg membrane fusion during fertilization, localized in the acrosomal vesicle.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4.68469E-11\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eNext, HCS was conducted on the genes identified through RT-qPCR to evaluate the effects of gene knockdown on the proliferation rate of breast cancer cells and to further identify genes with potential inhibitory effects on proliferation. Based on the fluorescence signals expressed by cells in each group, photographs were taken and cell counts were performed every 24 hours. After 5 days of culture, distinct differences in cell proliferation were observed among the various gene knockdown groups. In some groups, a significant inhibition of cell proliferation was evident under the fluorescence microscope, while in others, the inhibitory effect was less pronounced (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG). Cell counts were plotted over time to show changes in cell proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eH). The proliferation of cells in the shCtrl group remained unaffected, whereas the proliferation of cells in the shPC group was significantly reduced, confirming the reliability of the experimental system. Differences in proliferation fold change of each group after 5 days of cell culture are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e. The statistical line plot of cell count showed that CKAP2L, EHBP1L1, MSS51, and RCSD1 gene knockdown group had significantly lower cell count than the shCtrl group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0060, 0.0002, 0.01876, 0.00762, 0.00032). which confirmed that CKAP2L, EHBP1L1, MSS51 and RCSD1 gene knockdown significantly inhibited BC cell proliferation.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab4\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 4\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eDifferences in proliferation fold change of each group after 5 days of cell culture.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003egene symbol\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003egroup name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003efold change\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003econclusion\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshCtrl\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshPC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14.14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003einhibition\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCKAP2L\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshCKAP2L\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e3.53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003einhibition\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eEHBP1L1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshEHBP1L1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e16.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003einhibition\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMSS51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshMSS51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4.32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003einhibition\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRCSD1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshRCSD1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2.68\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003einhibition\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSPACA6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eshSPACA6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1.06\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eBased on the fold changes in cell count observed during the 5-day HCS cell proliferation assay, knocking down the EHBP1L1 gene had the most significant impact on cell proliferation. Therefore, the EHBP1L1 gene was chosen for further investigation in subsequent cell function experiments.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEffect of EHBP1L1 Gene Knockdown on the BC Functions\\u003c/h2\\u003e \\u003cp\\u003eThe MTT assay demonstrated that knockdown of EHBP1L1 led to decreased cell viability in both MDA-MB-231 and T-47D cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Cell cycle analysis revealed that MDA-MB-231 cells underwent cell cycle arrest in the S phase following EHBP1L1 knockdown, while T-47D cells showed no significant cell cycle arrest (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Similarly, the colony formation assay indicated a reduced ability to form colonies in both cell lines following EHBP1L1 knockdown. Visual inspection of the six-well plates revealed noticeable differences in cell growth between the shCtrl and shEHBP1L1 groups. The shCtrl group showed more robust cell growth, while the shEHBP1L1 group displayed poorer proliferation. Additionally, under the microscope, smaller colony sizes were observed in the shEHBP1L1 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD). The number of cell colonies formed was significantly lower in the shEHBP1L1 group compared to the shCtrl group, with consistent results in both cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE). As expected, cell apoptosis analysis showed a significantly higher apoptosis rate in the shEHBP1L1 group compare to the shCtrl group in both cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThese results collectively demonstrate that knockdown of EHBP1L1 significantly inhibits the viability and proliferation of BC cells (MDA-MB-231 and T-47D), suggesting that EHBP1L1 deficiency affects BC cell survival by inhibiting proliferation and promoting apoptosis. Notably, this effect exhibited more significant cell cycle regulation characteristics in the more aggressive triple-negative breast cancer (MDA-MB-231).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePrediction and Validation of miRNA Binding Sites in the EHBP1L1 gene\\u003c/h2\\u003e \\u003cp\\u003eBuilding on the findings regarding the EHBP1L1 gene, we next focused on predicting and validating potential miRNA binding sites. Bioinformatics tools and databases were used to identify miRNA binding sites within the EHBP1L1 gene. According to the TargetScan database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.targetscan.org\\u003c/span\\u003e\\u003cspan address=\\\"https://www.targetscan.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), a binding site for miR-137-3p was predicted in the 3'UTR region of EHBP1L1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). To validate this prediction, a dual-luciferase assay was conducted. The results showed that the fluorescence intensity of cells co-transfected with the wild-type EHBP1L1 plasmid and miR-137-3p was significantly lower than that of the group co-transfected with the wild-type EHBP1L1 plasmid and negative microRNA mimics (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). This suggests that miR-137-3p can bind to the 3'UTR region of EHBP1L1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eBreast cancer remains one of the most prevalent and challenging malignancies worldwide. The global incidence of breast cancer has risen significantly, with an increase of 1.28 times since 1990\\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e. Given this alarming rise, there is an urgent need to identify more effective strategies for both the prevention and treatment of breast cancer. In this regard, TCM, particularly XHP, has gained increasing attention as an adjunctive treatment for cancer. XHP has shown promise in improving patient quality of life for cancer patients, reducing the side effects associated with chemotherapy, and enhancing therapeutic efficacy\\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003ePrevious reports and clinical practice have demonstrated that XHP is effective against various types of cancer. It exerts its effects in multiple forms, including aqueous extracts\\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e, capsules\\u003csup\\u003e[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]\\u003c/sup\\u003e, extracted drug-containing mouse serum\\u003csup\\u003e[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]\\u003c/sup\\u003e, and its potential active components\\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]\\u003c/sup\\u003e. XHP has not only improved the survival rates of breast cancer patients but has also reducing the side effects of conventional treatments like chemotherapy and radiotherapy\\u003csup\\u003e[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]\\u003c/sup\\u003e. However, while the potential of XHP in BC therapy is widely recognized, the molecular mechanisms underlying its action have yet to be fully explored.\\u003c/p\\u003e \\u003cp\\u003eGene chips have become an essential tool in cancer research, offering detailed insights into the molecular mechanisms of cancer progression. By analyzing data from online databases such as TCGA and GEO\\u003csup\\u003e[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]\\u003c/sup\\u003e, and utilizing bioinformatics tools like IPA and DAVID\\u003csup\\u003e[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]\\u003c/sup\\u003e, researchers can gain a deeper understanding of the genetic alterations that contribute to cancer. The integration of gene chip data with cell and animal models\\u003csup\\u003e[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]\\u003c/sup\\u003e has provided more comprehensive insights into the roles of mRNA, miRNA, and lncRNA in cancer biology\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR33\\\" citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eOur findings demonstrate that XHP extract significantly inhibits the proliferation and survival of BC cells, particularly in the MDA-MB-231 cell line, a highly aggressive triple-negative BC model. This was evidenced by reduced cell viability, increased apoptosis, decreased colony formation, and cell cycle arrest in the XHP treated groups. These results align with previous studies suggesting the anti-proliferative and pro-apoptotic effects of TCM formulations, further reinforcing the role of XHP as a promising therapeutic agent for BC\\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e. The fact that the MDA-MB-231 cell line was more sensitive to XHP treatment than the T-47D cell line suggests that XHP may be particularly effective in targeting more aggressive and treatment-resistant subtypes of BC, further emphasizing its potential as a therapeutic adjunct for high-risk patients.\\u003c/p\\u003e \\u003cp\\u003eTo elucidate the molecular underpinnings of XHP\\u0026rsquo;s action, we performed gene chip analysis to identify differentially expressed genes (DEGs) in XHP-treated BC cells. The results revealed a robust set of upregulated and downregulated genes associated with processes such as cell proliferation, apoptosis, and the cell cycle. Notably, the downregulated genes were enriched in pathways related to cell division and cellular senescence, further suggesting that XHP inhibits BC cell growth by disrupting cell cycle progression and promoting cell death. Among these, genes like CKAP2L, EHBP1L1, MSS51, and RCSD1 were identified as potential molecular targets responsible for the anti-cancer effects of XHP. RT-qPCR and high-content screening (HCS) assays further confirmed that these genes are significantly downregulated in XHP-treated BC cells. Knockdown of these genes resulted in a notable reduction in cell proliferation, indicating their potential role in mediating the anti-proliferative effects of XHP.\\u003c/p\\u003e \\u003cp\\u003eAmong the identified genes, EHBP1L1 emerged as a key gene of interest, as its downregulation significantly affecting BC cell proliferation. EHBP1L1 has been implicated in various cellular processes, including vesicle trafficking, cell migration, and mitotic progression\\u003csup\\u003e[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]\\u003c/sup\\u003e. This suggests that EHBP1L1 may play a critical role in the regulation of BC cell proliferation and that its suppression by XHP could contribute to the observed growth inhibition. Further studies are required to validate EHBP1L1 as a therapeutic target in BC and to better understand its precise molecular role.\\u003c/p\\u003e \\u003cp\\u003eInterestingly, EHBP1L1 has complementary binding sites with miR-137-3p, a microRNA implicated in various cancer-related process. miR-137-3p has been shown to play a role in inhibiting cancer cell proliferation by targeting key oncogenes\\u003csup\\u003e[\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]\\u003c/sup\\u003e. Although our study identified this potential interaction, we did not further validate the functional role of miR-137-3p in regulating EHBP1L1 expression and its subsequent effects on BC cell proliferation. Additionally, the regulation role of XHP on the miR-137-3p/EHBP1L1 axis was not fully explored in this study. These aspects represent important directions for future research to confirm the functional significance of this molecular interaction and its potential for therapeutic intervention.\\u003c/p\\u003e \\u003cp\\u003eEHBP1L1 is a protein recently discovered to be closely associated with actin cytoskeleton reorganization, cytoskeletal remodeling, and intracellular material transport\\u003csup\\u003e[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]\\u003c/sup\\u003e. It directly binds to Rab8 and BIN1, playing a crucial role in apical transport and maintaining plasma membrane integrity\\u003csup\\u003e[\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]\\u003c/sup\\u003e. Rab8 overexpression has been associated with enhanced cell invasiveness, promoting the formation of actin-containing filopodia and lamellipodia\\u003csup\\u003e[\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, the suppression of EHBP1L1 by XHP could disrupt these processes, inhibiting BC cell migration and invasion. This highlights the potential of XHP in targeting both the proliferation and metastasis of breast cancer cells.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, our study provides valuable insights into the anti-cancer mechanisms of XHP in breast cancer. By identifying key genes such as EHBP1L1, which may mediate the anti-proliferative effects of XHP, we offer a molecular basis for its potential therapeutic application. Furthermore, the interaction between EHBP1L1 and miR-137-3p adds an interesting layer of complexity that warrants further investigation. Future studies should focus on validating the role of miR-137-3p in the regulation of EHBP1L1 and exploring the therapeutic potential of targeting this axis. These findings not only provide scientific evidence for the clinical use of XHP but also contribute to the modernization and scientific validation of TCM theories. Further clinical and functional studies will be crucial for translating these insights into practical therapeutic strategies.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was approved by the Research Ethics Committee of the First Hospital of Hunan University of Chinese Medicine.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll the authors agreed to publish the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no conflict of interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported in part by the Hunan Natural Science Foundation Project (2025JJ90033, 2022J30455), National Natural Science Foundation of China Youth Project (81703917), Hunan Traditional Chinese Medicine Research Program(D2022112), Hunan Health Commission Research Project (202211004197), Hunan Clinical Medical Technology Innovation Guidance Project (2021SK51409), and Hunan University of Traditional Chinese Medicine's Discipline Construction Project of \\\"Exposing the List and Taking the Lead\\\" (22JBZ037).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors' contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJunlong Guo and Ruiqi Zou performed most of the experiments and participated in the original preparation of the draft. Shaoqiang Chen and Yuting He assisted with experiment execution and data analysis. Pang Guolian and Liang Yuxing were responsible for the preparation and collection of specimens. Jing Li and Sunan Yong studied the preparation of the extract of the Xihuang pill. Xiaobing Xie contributed to the data analysis. Ping Li contributed to the conception and design of the study and revision of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe would like to express our sincere gratitude to all the individuals and institutions that supported this study. Special thanks to Dr. Qinglin Shen from the department of Oncology, Jiangxi Provincial People’s Hospital, for his invaluable guidance and support throughout the course of this research. all the members of the medical laboratory center of the First Hospital of Hunan University of Chinese Medicine for their laboratories and valuable experience. We gratefully thank all the laboratory members of the medical laboratory center of the first hospital of Hunan University of Traditional Chinese Medicine.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024. 74(3): 229-263.\\u003c/li\\u003e\\n\\u003cli\\u003eZheng RS, Chen R, Han BF, et al. [Cancer incidence and mortality in China, 2022]. Zhonghua Zhong Liu Za Zhi. 2024. 46(3): 221-231.\\u003c/li\\u003e\\n\\u003cli\\u003eTrayes KP, Cokenakes S. Breast Cancer Treatment. Am Fam Physician. 2021. 104(2): 171-178.\\u003c/li\\u003e\\n\\u003cli\\u003eDi Nardo P, Lisanti C, Garutti M, et al. Chemotherapy in patients with early breast cancer: clinical overview and management of long-term side effects. Expert Opin Drug Saf. 2022. 21(11): 1341-1355.\\u003c/li\\u003e\\n\\u003cli\\u003eLi L, Wang R, Zhang A, et al. Evidence on Efficacy and Safety of Chinese Medicines Combined Western Medicines Treatment for Breast Cancer With Endocrine Therapy. Front Oncol. 2021. 11: 661925.\\u003c/li\\u003e\\n\\u003cli\\u003eWang Y, Liu S, Zhang Y, et al. Effect of traditional Chinese medicine on postoperative depression of breast cancer: a systematic review and meta-analysis. Front Pharmacol. 2023. 14: 1019049.\\u003c/li\\u003e\\n\\u003cli\\u003eChen Z, Li Z, Yang S, Wei Y, An J. The prospect of Xihuang pill in the treatment of cancers. Heliyon. 2023. 9(4): e15490.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang YZ, Yang JY, Wu RX, et al. Network Pharmacology-Based Identification of Key Mechanisms of Xihuang Pill in the Treatment of Triple-Negative Breast Cancer Stem Cells. Front Pharmacol. 2021. 12: 714628.\\u003c/li\\u003e\\n\\u003cli\\u003eXu L, Duan H, Zou Y, et al. Xihuang Pill-destabilized CD133/EGFR/Akt/mTOR cascade reduces stemness enrichment of glioblastoma via the down-regulation of SOX2. Phytomedicine. 2023. 114: 154764.\\u003c/li\\u003e\\n\\u003cli\\u003eTu H, Li J, Xu W, Wang Z, Wang L. Target and Mechanism of the Xihuang Pill Based on Network Pharmacology for Lung Squamous Cell Carcinoma. Altern Ther Health Med. 2023. 29(7): 148-154.\\u003c/li\\u003e\\n\\u003cli\\u003eWang J, Hou D, Peng Y, Xiong J, Xiong L, Tan X. Efficacy and safety of Xihuang pill for gastric cancer: A protocol for systematic review and meta-analysis. Medicine (Baltimore). 2021. 100(19): e25726.\\u003c/li\\u003e\\n\\u003cli\\u003eYu D, An GY. Clinical Effects of Xihuang Pill Combined with Chemotherapy in Patients with Advanced Colorectal Cancer. Evid Based Complement Alternat Med. 2017. 2017: 5936086.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao X, Hao J, Chen S. Network Pharmacology-Based Strategy for Predicting Therapy Targets of Traditional Chinese Medicine Xihuang Pill on Liver Cancer. Evid Based Complement Alternat Med. 2020. 2020: 6076572.\\u003c/li\\u003e\\n\\u003cli\\u003eLi D, Fan H, Dong J, et al. Based on BATMAN-TCM to Explore the Molecular Mechanism of Xihuang Pill Regulating Immune Function to Treat Breast Precancerous Lesions. Breast Cancer (Dove Med Press). 2021. 13: 725-742.\\u003c/li\\u003e\\n\\u003cli\\u003eShin SU, Lee J, Kim JH, et al. Gene expression profiling of calcifications in breast cancer. Sci Rep. 2017. 7(1): 11427.\\u003c/li\\u003e\\n\\u003cli\\u003ePongor L, Kormos M, Hatzis C, Pusztai L, Szab\\u0026oacute; A, Győrffy B. A genome-wide approach to link genotype to clinical outcome by utilizing next generation sequencing and gene chip data of 6,697 breast cancer patients. Genome Med. 2015. 7: 104.\\u003c/li\\u003e\\n\\u003cli\\u003eSung E, Turan N, Ho PW, et al. Detection of endocrine disruptors - from simple assays to whole genome scanning. Int J Androl. 2012. 35(3): 407-14.\\u003c/li\\u003e\\n\\u003cli\\u003eKubista M, Andrade JM, Bengtsson M, et al. The real-time polymerase chain reaction. Mol Aspects Med. 2006. 27(2-3): 95-125.\\u003c/li\\u003e\\n\\u003cli\\u003eSherman BT, Hao M, Qiu J, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022. 50(W1): W216-W221.\\u003c/li\\u003e\\n\\u003cli\\u003eXu Y, Gong M, Wang Y, Yang Y, Liu S, Zeng Q. Global trends and forecasts of breast cancer incidence and deaths. Sci Data. 2023. 10(1): 334.\\u003c/li\\u003e\\n\\u003cli\\u003eHong W, Tang H, Wang D, et al. Xihuang pill suppresses breast cancer malignancy by inhibiting TGF-\\u0026beta; signaling and acquires chemotherapy benefits. J Ethnopharmacol. 2025. 337(Pt 3): 119000.\\u003c/li\\u003e\\n\\u003cli\\u003eZheng W, Han S, Jiang S, et al. Multiple effects of Xihuang pill aqueous extract on the Hs578T triple-negative breast cancer cell line. Biomed Rep. 2016. 5(5): 559-566.\\u003c/li\\u003e\\n\\u003cli\\u003eGe A, Yang K, Deng X, Zhao D, Ge J, Liu L. The efficacy and safety of Xihuang Pill/capsule in adjuvant treatment of breast cancer: A systematic review and meta-analysis of 26 randomized controlled trials. J Ethnopharmacol. 2022. 295: 115357.\\u003c/li\\u003e\\n\\u003cli\\u003eChen C, Yuan S, Chen X, Xie J, Wei Z. Xihuang pill induces pyroptosis and inhibits progression of breast cancer cells via activating the cAMP/PKA signalling pathway. Am J Cancer Res. 2023. 13(4): 1347-1362.\\u003c/li\\u003e\\n\\u003cli\\u003eMao D, Feng L, Huang S, Zhang S, Peng W, Zhang S. Meta-Analysis of Xihuang Pill Efficacy When Combined with Chemotherapy for Treatment of Breast Cancer. Evid Based Complement Alternat Med. 2019. 2019: 3502460.\\u003c/li\\u003e\\n\\u003cli\\u003eXie ZC, Dang YW, Wei DM, et al. Clinical significance and prospective molecular mechanism of MALAT1 in pancreatic cancer exploration: a comprehensive study based on the GeneChip, GEO, Oncomine, and TCGA databases. Onco Targets Ther. 2017. 10: 3991-4005.\\u003c/li\\u003e\\n\\u003cli\\u003eGe L, Sun Q, Xia L, Xu X. Clinical significance and prospective molecular mechanism of NUF2 in gastric cancer exploration: A comprehensive study based on the GeneChip, GEO, Oncomine, and TCGA databases. Medicine (Baltimore). 2022. 101(26): e29802.\\u003c/li\\u003e\\n\\u003cli\\u003eAhlborn GJ, Nelson GM, Ward WO, et al. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite. Toxicol Appl Pharmacol. 2008. 227(3): 400-16.\\u003c/li\\u003e\\n\\u003cli\\u003eMa YY, Zhang GJ, Liu PF, et al. Comprehensive Genomic Analysis of Puerarin in Inhibiting Bladder Urothelial Carcinoma Cell Proliferation and Migration. Recent Pat Anticancer Drug Discov. 2024. 19(4): 516-529.\\u003c/li\\u003e\\n\\u003cli\\u003eHuan J, Wang L, Xing L, et al. Insights into significant pathways and gene interaction networks underlying breast cancer cell line MCF-7 treated with 17\\u0026beta;-estradiol (E2). Gene. 2014. 533(1): 346-55.\\u003c/li\\u003e\\n\\u003cli\\u003eWu H, Qin W, Lu S, et al. Long noncoding RNA ZFAS1 promoting small nucleolar RNA-mediated 2\\u0026apos;-O-methylation via NOP58 recruitment in colorectal cancer. Mol Cancer. 2020. 19(1): 95.\\u003c/li\\u003e\\n\\u003cli\\u003eChen L, Feng J, Wu S, et al. Decreased RIG-I expression is associated with poor prognosis and promotes cell invasion in human gastric cancer. Cancer Cell Int. 2018. 18: 144.\\u003c/li\\u003e\\n\\u003cli\\u003eWang Y, Zhang H, Li X, Chen W. Differential expression profile analysis of lncRNA UCA1\\u0026alpha; regulated mRNAs in bladder cancer. J Cell Biochem. 2018. 119(2): 1841-1854.\\u003c/li\\u003e\\n\\u003cli\\u003eLee HM, Wong W, Fan B, et al. Detection of increased serum miR-122-5p and miR-455-3p levels before the clinical diagnosis of liver cancer in people with type 2 diabetes. Sci Rep. 2021. 11(1): 23756.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu Z, Xu E, Zhao HT, Cole T, West AB. LRRK2 and Rab10 coordinate macropinocytosis to mediate immunological responses in phagocytes. EMBO J. 2020. 39(20): e104862.\\u003c/li\\u003e\\n\\u003cli\\u003eVenditti M, Donizetti A, Aniello F, Minucci S. EH domain binding protein 1-like 1 (EHBP1L1), a protein with calponin homology domain, is expressed in the rat testis. Zygote. 2020. 28(6): 441-446.\\u003c/li\\u003e\\n\\u003cli\\u003eDing X, Zhang J, Feng Z, Tang Q, Zhou X. MiR-137-3p Inhibits Colorectal Cancer Cell Migration by Regulating a KDM1A-Dependent Epithelial-Mesenchymal Transition. Dig Dis Sci. 2021. 66(7): 2272-2282.\\u003c/li\\u003e\\n\\u003cli\\u003eWang Y, Guo Y, Lu Y, Sun Y, Xu D. The effects of endosulfan on cell migration and invasion in prostate cancer cells via the KCNQ1OT1/miR-137-3p/PTP4A3 axis. Sci Total Environ. 2022. 845: 157252.\\u003c/li\\u003e\\n\\u003cli\\u003eGuilherme A, Soriano NA, Bose S, et al. EHD2 and the novel EH domain binding protein EHBP1 couple endocytosis to the actin cytoskeleton. J Biol Chem. 2004. 279(11): 10593-605.\\u003c/li\\u003e\\n\\u003cli\\u003eNakajo A, Yoshimura S, Togawa H, et al. EHBP1L1 coordinates Rab8 and Bin1 to regulate apical-directed transport in polarized epithelial cells. J Cell Biol. 2016. 212(3): 297-306.\\u003c/li\\u003e\\n\\u003cli\\u003eBravo-Cordero JJ, Marrero-Diaz R, Meg\\u0026iacute;as D, et al. MT1-MMP proinvasive activity is regulated by a novel Rab8-dependent exocytic pathway. EMBO J. 2007. 26(6): 1499-510.\\u003c/li\\u003e\\n\\u003cli\\u003ePer\\u0026auml;nen J. Rab8 GTPase as a regulator of cell shape. Cytoskeleton (Hoboken). 2011. 68(10): 527-39.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Breast cancer, Xihuang pill, Gene chip, EHBP1L1, microRNA-137\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6120346/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6120346/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eXihuang Pill (XHP), a traditional Chinese medicine formula, is widely used in China as an adjunctive treatment for various cancers, particularly breast cancer (BC). This study aimed to explore the potential mechanisms underlying the therapeutic effects of XHP in BC.\\u003c/p\\u003e \\u003cp\\u003eBC cell lines (MDA-MB-231 and T-47D) were treated with XHP extract to assess its effects on cellular biological behavior. Gene expression profiles of MDA-MB-231 cells treated with XHP extract were analyzed using gene chip technology. Differentially expressed genes were subsequently subjected to functional annotation and pathway enrichment analysis using the IPA and DAVID databases.\\u003c/p\\u003e \\u003cp\\u003eThe results demonstrated that XHP extract inhibited cell proliferation and metastasis, induced apoptosis, and modulated the cell cycle, thereby exhibiting significant anti-cancer effects. Gene expression profiling identified eight significantly down regulated genes following XHP extract treatment, among which EHBP1L1 was identified as one of the most markedly suppressed genes. EHBP1L1 is associated with the proliferation and metastasis of BC cells. Dual-luciferase reporter assays confirmed the binding of EHBP1L1 with miR-137-3p.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, this study demonstrates that XHP extract effectively inhibits the proliferation and migration of breast cancer cells in vitro, influencing key cellular processes such as the cell cycle and apoptosis. XHP significantly regulated the expression of several genes, including EHBP1L1, SPACA6, and CKAP2L. EHBP1L1 was identified as a critical gene involved in breast cancer cell proliferation and metastasis, highlighting its potential as a therapeutic target.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Antiproliferative and Antimetastatic Effects of Xihuang Pill (XHP) Extract on Breast Cancer Cells: Involvement of EHBP1L1 Gene Regulation\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-03-03 06:42:05\",\"doi\":\"10.21203/rs.3.rs-6120346/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"b0948c38-5894-4cc1-811c-a1ee1c36f072\",\"owner\":[],\"postedDate\":\"March 3rd, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-07-31T06:09:19+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-03-03 06:42:05\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6120346\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6120346\",\"identity\":\"rs-6120346\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}