{"paper_id":"4c0aba61-7912-4f40-b2e0-9d50bd9aa575","body_text":"Potential anti-osteoclastic and anti-inflammatory effects of metformin-encapsulated hyaluronic acid-decorated niosome nanoparticles: possible application for effective treatment of rheumatoid arthritis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Potential anti-osteoclastic and anti-inflammatory effects of metformin-encapsulated hyaluronic acid-decorated niosome nanoparticles: possible application for effective treatment of rheumatoid arthritis Shatha Jassim Hatem, Fadhil Jawad Al-Tu’ma, Maher Abbood Mukheef This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4767562/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Nanodrug delivery systems offer promising solutions to the limitations of conventional treatments for rheumatoid arthritis (RA) and type 2 Diabetes Mellitus (T2DM). Among nanoparticles, niosomes are particularly effective due to their stability, ease of preparation, and ability to reduce systemic toxicity. They provide controlled drug release and enhance the solubility and stability of pharmaceutical compounds. Incorporating hyaluronic acid (HA) into niosomes can further enhance their efficacy by targeting specific cells, improving drug delivery, and increasing therapeutic impact. In this study, metformin, a common T2DM medication, was effectively delivered using HA-coated niosomes, to demonstrate the potential of this approach in treating RA patients with T2DM. Methods Peripheral blood mononuclear cells (PBMCs) were extracted from blood samples of RA patients, RA patients with T2DM, and healthy individuals. Metformin-loaded niosomal nanoparticles (Nio-met NPs) were synthesized using the thin-film hydration method and modified into Hyalo-Nio-met NPs by adding hyaluronic acid. The drug release pattern of metformin was studied, and these NPs were characterized using Dynamic Light Scattering (DLS), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), and Fourier Transform Infrared Spectroscopy (FT-IR). Factors like reactive oxygen species (ROS), interleukin-23 (IL-23), nuclear factor of activated T-cells cytoplasmic 1 (NFATc1), receptor activator of nuclear factor kappa-Β ligand (RANKL), and cyclooxygenase-2 (COX-2) were assessed in both treated and untreated PBMCs. Results The synthesized Hyalo-Nio-met NPs exhibited a spherical morphology with sizes of 179 ± 8.5 nm, a polydispersity index (PDI) of 0.663, and a zeta potential of -9.76 ± 3.4 mV. FT-IR analysis confirmed the effective encapsulation of metformin within the Hyalo-Nio-met NPs. Approximately 68% of the loaded metformin was released from the Hyalo-niosomal NPs after 120 hours. Treatment with Hyalo-Nio-met NPs led to a significant reduction in reactive oxygen species (ROS) level and decreased activity of pro-inflammatory cytokine (IL-23) and inflammation-related genes (NFATc1, RANKL, and COX-2). Conclusion Taken together the Hyalo-Nio-met NPs drug delivery system was acceptable in terms of characteristics and effectively delivery of metformin to the vicinity of PBMCs. The treatment demonstrated a notable reduction in inflammatory markers and an enhancement of anti-inflammatory and antioxidant defenses in the PBMCs from both RA patients and RA patients with T2DM. Rheumatoid arthritis Type 2 Diabetes Mellitus Metformin Niosomal NPs Targeted therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Rheumatoid arthritis often referred to as RA is a term condition known for causing inflammation, in the joints and affecting the whole body ( 1 ). This condition can result in damage leading to health challenges ( 2 ). The development of RA involves a combination of factors, asymptomatic autoimmunity and the progression to visible symptoms over time ( 3 ). Managing RA is a faceted process that heavily relies on medication particularly during the early stages of the illness ( 4 ). There has been discussion about using therapies that target signaling pathways like ERK in cells related to RA treatment ( 5 ). Beyond pain and swelling individuals with arthritis may experience a wide range of symptoms due to extra articular manifestations that impact various organs such as the skin, lungs, heart, eyes and nervous system. For example patients with RA may develop nodules on their skin or experience lung complications like lung disease as part of this conditions effects, beyond the joints ( 6 ). Additionally, lung involvement, including interstitial lung disease, is a common extra-articular manifestation of rheumatoid arthritis ( 7 , 8 ). Furthermore bone marrow edema has been recognized as a predictor of advancement, in RA on X rays linked to the severity of inflammation, joint damage and clinical indicators ( 9 ). Moreover the presence of fatigue has been observed as a prevalent and taxing symptom in RA patients among those with inflammatory conditions ( 10 ). Detecting RA in early stages is essential for treatment results and prognosis. Several studies have explored approaches such as proteomic analysis, mass spectrometry and innovative biomarkers to refine the accuracy of RA diagnosis ( 11 – 13 ). Various genes involve in RA, for instance, RANKL, which stands for Receptor activator of NF-κB ligand, is a crucial molecule involved in various physiological processes. It is known to play a significant role in bone homeostasis and the formation of lymphoid tissues ( 14 ). Figure 1 shows the signaling pathways through which RANKL induces osteoclastogenesis by affecting the NF-κB and MAPKs pathways. Research has shown that rheumatoid arthritis is associated with an increased risk of diabetes ( 15 ). Type 2 Diabetes Mellitus (T2DM) is a metabolic disorder characterized by blood sugar levels due to insulin resistance and inadequate insulin production ( 16 ). T2DM stands as a leading cause of mortality and health issues ( 17 ). In T2DM, a fasting blood sugar level equal to or greater than 7.0 mmol/l or requiring medication is indicative ( 16 ). This progressive epidemic accounts for than 90% of all diabetes instances ( 18 ). Individuals with T2DM face an escalated risk of complications, like heart disease and irregular heart rhythms ( 19 ). Furthermore Type 2 diabetes is linked with lipid levels changes, in how the body processes lipids and heart related conditions ( 20 ). actors that increase the risk of developing Type 2 diabetes consist of lack of activity unhealthy eating patterns and socio economic standing ( 21 ). Both rheumatoid arthritis (RA) and type 2 diabetes mellitus (T2DM) are long term conditions that can impact the body in ways. There are various treatment options for both RA (like methotrexate ( 22 ), rituximab ( 23 )) and T2DM (including SGLT2 inhibitors like empagliflozin ( 24 ), natural compounds like curcumin ( 25 )). These drugs could cause side effects for normal cells or have solubility and absorption limitations One innovative solution to these challenges is the use of nanodrug delivery systems ( 26 ). Different types of these systems including nanoparticles, lipid based systems and polymer nanoparticles have been created to overcome these limitations ( 27 ). These delivery systems are valued for being safe, compatible with the body, and reliable in drug delivery applications ( 27 ). Nanoparticles (NPs) play a crucial role in improving how drugs move through the body reducing side effects and enhancing drug delivery to specific areas affected by disease ( 28 ). They can be administered into the body through methods like injections, skin application, oral ingestion, or through inhalation with promising results in drug delivery effectiveness ( 29 ). Researchers have explored types of nanoparticles like liposomes, niosomes, polymeric particles, micelles, dendrimers, silica particles, magnetic particles, and gold nanoparticles as potential carriers, for delivering drugs effectively ( 30 , 31 ). Among them noisomes offer a range of advantages including high stability, ease of preparation, and relatively low cost of surfactants, making them attractive for various applications ( 32 ). Niosomes have been found to reduce systemic toxicity by encapsulating treatment agents, leading to slow drug release and minimizing clearance from the body ( 33 ). These vesicles are considered novel carriers that can enhance the solubility and stability of various pharmaceutical compounds ( 34 ). To enhance the effects of niosomes, which are non-ionic surfactant vesicles like liposomes, various strategies can be employed based on existing research. One approach to improve niosome efficacy is through the modification of their composition, size, and type, which can influence drug penetration and delivery ( 35 ). Additionally, the use of smart nanocarriers, such as enzyme-responsive nanomaterials, can further enhance controlled drug delivery by incorporating stimuli-responsive elements into the niosome structure (36). Moreover, targeted drug delivery using nanomaterial-based vehicles has shown promise in chronic disease therapy ( 37 ). Researchers are looking to enhance the effectiveness of drug delivery by customizing niosomes with ligands that target organs or tissues. One approach involves using glutathione targeted PEGylated liposomes to deliver drugs to organs, like the retina, which could lead to treatment outcomes ( 38 ). Hyaluronic acid (HA) has gained attention in treating arthritis (RA) because of its biodegradability, compatibility with the body and lack of triggering responses ( 39 ). Studies indicate that HA can target CD44 receptors found in inflamed joints on activated macrophages suggesting its potential as an option for RA ( 40 , 41 ). Moreover HA has been incorporated into formulations, including HA coated nanoparticles designed for drug delivery and therapy, in RA ( 42 , 43 ). In this study, we investigated the potential of HA-coated niosomes for targeted delivery of metformin to PBMCs derived from both RA and T2DM patients. Our study aimed to explore whether HA-coated niosomes could serve as an effective carrier system for developing targeted cellular therapies for these chronic inflammatory conditions and T2DM. Materials and methods Research participants The research plan received approval, from the Institutional Ethics Committee at the College of Medicine, University of Karbala / Karbala – Iraq, and consent was obtained from all participants. Blood samples were taken from a group consisting of 47 healthy control group, 39 rheumatoid arthritis patients, and 36 rheumatoid arthritis patients with T2DM who attended the Orthopedics Outpatient Department at the Faculty of Medicine, Karbala University of Medical Sciences located in Karbala, Iraq. The diagnosis of arthritis was made based on the European League Against Rheumatism (EULAR) 2010 classification criteria. Detailed clinical and demographic information for participants detailed in Table 1 . The exclusion criteria for participants encompassed individuals who were smokers, alcoholics, or afflicted with chronic diseases, as well as those undergoing treatment with NSAIDs, DMARDs, or steroids. Table 1 Demographical and clinical data of healthy controls and rheumatoid arthritis patients. Healthy Controls RA Patients RA Patients With T2DM Sex (M/F) 22/25 17/22 17/19 Age 46.91 ± 10.321 46.34 ± 9.341 48.24 ± 11.739 Body mass index (BMI) 23.245 ± 1.72 27.56 ± 3.714 24.288 ± 3.417 Erythrocyte sedimentation rate (ESR, mm/h) 14.17 ± 4.84 51.37 ± 13.46 52.82 ± 12.65 28-Joint count disease activity score (DAS28) - 5.14 ± 0.24 5.53 ± 0.37 HbA1c ( %) 5.31 ± 0.68 5.52 ± 0.64 11.80 ± 1.81 Fasting glucose 96.98 ± 8.80 106.92 ± 8.17 331.30 ± 108.84 Isolation and culture of peripheral blood mononuclear cells Peripheral blood mononuclear cells (PBMCs) were separated using Histopaque 1077 density gradients (Sigma, Germany) by centrifugation (1500rpm, 5 min). The cells were washed three times with phosphate buffered saline (PBS, pH 7.4) centrifuged, and resuspended in RPMI1640 medium containing 10% bovine serum (FBS, Biochrom, UK) 10 U/mL of penicillin (Sigma, Germany) and 10 µg/ml of streptomycin (Sigma, Germany), at a concentration of 1 × 10 6 cells/ml. These cells were incubated at 37°C with 5% CO₂ until they reached a confluency of 90% following which they were used in experimental procedures. Fabrication of niosomal NPs The fabrication of niosome NPs was conducted using the thin-film hydration method. Initially, a mixture of cholesterol (6 mg) and Span 60 (36 mg) dissolved in Methanol (6 ml) and Chloroform (3 ml) and subjected to a rotary evaporator at 55–60 ◦ C and 0.46 atm for 1 hour to form a lipid film and remove solvents. Subsequently, the film was hydrated with 10 ml of PBS (pH 7.4) under similar conditions for another hour. Ultrasonication for 30 minutes at 24 ◦ C was employed to reduce the size of the fabricated niosomal NPs. For the fabrication of metformin-loaded niosomal NPs (Nio-met NPs), metformin (1.65 mg) was added to the initial mixture. To obtain hyaluronic acid-coated niosomal NPs (Hyalo-Nio NPs) and metformin-loaded hyaluronic acid-coated niosomal NPs (Hyalo-Nio-met NPs), a solution containing 0.1% (w/v) hyaluronic acid in normal saline was gradually added to blank niosomal NPs and Nio-met NPs while stirring, followed by an hour of stirring at ambient temperature to facilitate NP reforming and hyaluronic acid coating. Characterization of niosomal NPs Spectral analysis of the compounds before and after nanoparticle fabrication was studied using an FT-IR spectrophotometer (Shimadzu 8400 S, Kyoto, Japan) in the spectral region of 4000 − 400 cm − 1 , with a spectra resolution of 4 cm − 1 . The size, polydispersity index (PDI), and zeta potential of the fabricated niosomal nanoparticles were analyzed using the Zeta sizer dynamic light scattering system (ZS 90, Malvern Instruments Ltd., Malvern, UK). The surface morphological properties of the fabricated niosomal nanoparticles examined using scanning electron microscopy (SEM, MIRA3, TESCAN, Czech) and atomic force microscopy (AFM, Nanowizard II; JPK instruments; Germany). Release Kinetics of metformin from Niosomal NPs To assess the in-vitro drug release characteristics of Hyalo-Nio-met NPs and Nio-met NPs, the dialysis method was utilized as follows: Initially, 5 mL of nanoparticles were introduced into a dialysis membrane tube (12 kDa) and stirred magnetically at 120 rpm in PBS (pH = 7.4) while incubating at 37°C. At predetermined intervals, 2 mL of the immersion solution was exchanged with an equal volume of fresh PBS, and the absorbance of the released metformin was measured at 234 nm (the maximum wavelength of metformin) using ultraviolet spectrophotometry (PerkinElmer, Fremont, CA, USA). The process allowed for the monitoring of metformin release kinetics from the niosomal nanoparticles over time, providing insights into their controlled drug release behavior. Assessment of PBMCs proliferation To study the effects of metformin, on PBMCs viability an MTT reduction test performed using concentrations of pure metformin (0, 5, 10, 15, 20, and 25 mM) Nio-met NPs (0, 5, 10, 15, 20, and 25 mM), and Hyalo-Nio-met NPs (0, 5, 10, 15, 20, and 25 mM). Initially 1 × 10 5 PBMCs were seeded in each well of a 96 well plate and incubated for 24 hours. Subsequently the cells were exposed to treatment substances for 48 hours. After 48 hours' treatment substances were substituted with a MTT solution (Sigma, Germany) and kept in dark conditions at the 37°C for 4 hours. Following this incubation period, the MTT solution was removed from each well and replaced with DMSO (Merck, Germany). Finally, the optical density of the wells was measured at 570 nm using the EL × 800 Microplate Absorbance Reader (Bio-Tek Instruments), and the proliferation values for pure metformin, Nio-met NPs, and Hyalo-Nio-met NPs were determined using GraphPad Prism software. Evaluation of Reactive Oxygen Species in PBMCs Reactive Oxygen Species (ROS) in the isolated PBMCs were determined spectrofluorimetricaly using 2',7'dichlorofluorescein diacetate (DCFH-DA, Sigma, Germany). The treated and untreated PBMCs were washed with PBS and incubated with 30 µM of DCFH-DA at 37°C in the dark condition. After 30 min were washed and resuspended in PBS and analyzed using a flow cytometer (ACSCalibur, BD Biosciences, USA). Determination of interleukin-23, transforming growth factor beta, and catalase status PBMCs were seeded in a 6-well plate (5 × 10 5 cells per well) and allowed to adhere for 24 hours at 37°C with 5% CO₂. After attachment, the PBMCs were exposed to metformin, Nio-met NPs, and Hyalo-Nio-met NPs for 48 hours at 37°C with 5% CO₂, while a control group of cells remained untreated. The assays were performed according to methods outlined in the manufacturer’s instructions. Subsequently, the levels of interlukin-23 (IL-23) and transforming growth factor beta (TGF-β) in both treated and untreated PBMCs were quantified using an enzyme immunoassay with the human ELISA Kit (Sino Biological Inc., Beijing, China). Catalase (CAT) activity was assessed according to the method of Aebi which is based on the decomposition of H 2 O 2 by CAT. Enzyme activity was expressed as the first order kinetic constant (K) of the rate of disappearance of H 2 O 2 for 15 s as measured by decrease in absorbance at 240 nm. Results were expressed as U/mg ( 44 ). Real-time PCR For the cDNA synthesis, 0.5 µg of total RNA was utilized in the reverse transcription process, employing the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Fermentas) as per the manufacturer's guidelines. The mRNA expression levels of cytokines were quantified using the Rotor-Gene TM 6000 (Corbett). Real-time PCR (RT-PCR) assays were conducted in a 25 µl reaction mixture, comprising 2 µl of the synthesized cDNA, 12.5 µl of 2x Rotor-Gene Probe PCR Master Mix (Qiagen, Germany), 500 nM of each primer, and 250 nM of the TaqMan-probe (FAM, TAMRA). The volume was adjusted to 25 µl with DNase/RNase-free water. The amplification protocol consisted of an initial heating phase (10 min at 94°C), followed by denaturation (94°C for 15 s) and annealing/extension (60°C for 60 s). Cytokine mRNA expressions were standardized to GAPDH (a housekeeping gene), and the relative quantification was determined utilizing the 2-ΔΔCt approach. The sequences of the oligonucleotides for cyclooxygenase 2 (COX-2), NFATc1, RANKL, and GAPDH primers are detailed in Table 2 . Table 2 The forward and reverse primers sequences used for real-time PCR reactions. Genes Forward Reverse NFATc1 AGGCCATCCTCTCCAACACC GTTCTTCCTCCCGATGTCCGTCT RANKL GCTTTTATTACCTGTATGCCAA CTGCTTATTATTCAAGGCATC COX-2 GTCCTCTATATCATCTCGCTA TTCTATTGGCAGAACGACT GAPDH CTTCCAGGAGCGAGATCCCT CCTGTTGCTGTAGCCAAATTCGT Results and discussion Studies have revealed that metformin’s antidiabetic role, by suppressing hepatic glucose production ( 45 ). Metformin is widely prescribed for type 2 diabetes as it effectively controls blood sugar levels and provides cardioprotective protection ( 45 ). Moreover studies suggest that metformin can help manage metabolism and potentially treat conditions like RA by regulating metabolism ( 46 ). Enhancing the effects of metformin using NPs for drug delivery shows promise by optimizing controlled release improving drug targeting and reducing effects ( 47 ). These carriers enhance drug penetration into tissues, specificity and drug availability making them ideal for targeted delivery ( 48 ). Nanocarriers also allow drug release, boosting treatment effectiveness ( 49 ). iosomes, a type of ionic surfactant vesicles, have garnered attention in the pharmaceutical industry due to their ability to encapsulate both hydrophilic and hydrophobic agents ( 50 ). These synthetic vesicles, formed by self-assembly of nonionic surfactants, cholesterol, and some other lipids, offer benefits like breakdown in the body and compatibility with living tissue ( 51 ). Researchers have utilized these nanoparticles in various applications, including transdermal drug delivery ( 52 ), gene delivery ( 53 ), and targeted drug delivery to immune-privileged tissues ( 54 ). Scientists have investigated methods to enhance nano carriers, for drug delivery purposes. For example, the development of folic acid-modified nano-drug carriers has shown promise in the targeted delivery of specific drugs ( 55 ). Various characteristics affects the properties of the NPs. The size of nanoparticles plays a crucial role in their uptake and retention by cells and tissues ( 56 ). For intravenously administered nanoparticles, diameter is a key factor affecting pharmacokinetics and bio-distribution pores in blood vessels ( 57 ). The size of nanoparticles influences their ability to overcome transport barriers in biological tissues, affecting their tissue penetration efficacy ( 58 ). Additionally, nanoparticle size impacts their biological activity, with factors like concentration and size playing primary roles ( 59 ). The DLS analysis showed that the blank niosome NPs had an average diameter of 151 ± 6.2 nm (Table 3 ). However, encapsulation of metformin inside these NPs causes an increase in their average diameter to 168 ± 10.2 nm. The highest diameter among those fabricated belongs to Hyalo-Nio-met NPs (Fig. 2 ) with 179 ± 8.5 nm, due to coating with hyaluronic acid and encapsulation of metformin inside these NPs. The zeta potential of nanoparticles is a critical parameter for characterizing their surface charge properties. It is determined by the presence of charged ions at the NPs surface and in the surrounding solution ( 60 ). Zeta potential plays a key role in expressing the stability of nanoparticles in suspension by influencing the electrostatic repulsion between particles, thus preventing aggregation ( 61 ). Zeta potential values between − 30 mV and + 30 mV are generally considered ideal for achieving better physical stability of nanoparticles ( 62 ). Table 3 lists the obtained zeta potential values for blank niosomes, Nio-met, and Hyalo-Nio-met nanoparticles. PDI is recognized as another key factor in assessing the stability and functionality of NPs for drug delivery applications ( 63 ). PDI significantly influences various aspects of nanoparticles, including their stability, drug release kinetics, cellular uptake, and biodistribution ( 64 ). Maintaining a low PDI (< 0.4) is crucial to achieve a narrow size distribution, which is essential for effective tissue accumulation and renal clearance ( 65 ). The reproducibility and quality of nanoparticles are greatly affected by PDI, as it indicates the width of the particle size distribution and the uniformity of the nanoparticles ( 66 ). Additionally, measuring PDI is vital for evaluating the colloidal properties of nanoparticles, especially in understanding their ability to penetrate biological barriers ( 67 ). Particularly in pharmaceutical applications, the size uniformity of nanoparticles is crucial to ensure consistent performance and efficacy ( 68 ). According to the DLS results listed in Table 3 , the blank niosome, Nio-met, and Hyalo-Nio-met NPs are all within the acceptable range in terms of size, zeta potential, and PDI values. Table 3 The evaluated size, zeta potential, and PDI values of blank niosome, Nio-met, and Hyalo-Nio-met NPs using DLS. Groups Size (nm) Polydispersity Index Zeta potential (mV) Blank niosome 151 ± 6.2 0.426 −13.47 ± 3.8 Nio-met 168 ± 10.2 0.453 −15.21 ± 2.9 Hyalo-Nio-met 179 ± 8.5 0.663 −9.76 ± 3.4 The interaction of nanoparticles with biological systems is controlled by various factors, including size, shape, and surface properties ( 69 ). The shape of nanoparticles has been shown to have significant effects on their interactions with biological materials such as cells and tissues ( 70 ). The morphology of NPs can impact their biological activities, such as cell membrane penetration, wetting, and interactions with proteins ( 71 , 72 ). Furthermore, the morphology of biologically synthesized nanoparticles can influence their toxicity, mechanism of action, and applications as antibacterial and antifungal agents ( 73 , 74 ). Figure 3 demonstrates the SEM images of fabricated blank niosome, Nio-met, and Hyalo-Nio-met NPs. All these nanoparticles show a spherical morphology, with the only difference between them being their size. The AFM images of nanoparticles are shown in Fig. 3 , and these images are consistent with previous DLS results. FTIR is an effective analytical method used for detecting functional chemical groups and characterizing covalent bonding information. The characteristic peaks in the Span 60 spectrum appeared at 3389, 2916, and 1736 cm − 1 , corresponding to OH stretching, carbonyl dimer, and C = O stretching, respectively (Fig. 4 ). For cholesterol, a notable peak at 3435 cm − 1 indicated OH stretching. In the blank niosomes' spectrum, the OH stretching peak from Span 60 was seen at 3388 cm − 1 , while the carbonyl dimer shifted to 2918 cm − 1 and the C = O stretching peak shifted to 1737 cm − 1 . These shifts in the carbonyl groups' peaks suggest hydrogen bonding between Span and cholesterol, indicative of niosome formation. In the spectrum of drug-loaded niosomes, significant peaks were observed at 3370, 2920, and 1738 cm − 1 , likely representing OH stretching, carbonyl dimer, and C = O stretching. These shifts are similar to those seen in blank niosomes and point to interactions that facilitate niosomal formation ( 75 ). The FTIR spectrum of cholesterol exhibited a broad band at 3432 cm − 1 , indicating OH stretching vibration. Symmetric and asymmetric stretching vibrations in CH2 groups of alkyl chains were observed at 2989 cm − 1 and 2882 cm − 1 , respectively. A strong band at 1716 cm − 1 was attributed to the double bond in the second ring of the cholesterol structure (76). Drug release patterns play a key role in the effectiveness of drug therapy. V Different controlled release systems have been created to improve the therapeutic performance of drugs ( 77 ). Factors, like particle size, surface properties and the porous structure of nanoparticles all affect how drugs are released from nanoparticles ( 78 – 80 ). It's highly desirable for drugs to be released steadily from nanoparticles for medical purposes ( 81 ). Niosomes, which are composed of biodegradable and non-immunogenic components, can carry both amphiphilic and lipophilic drugs, making them appealing for drug delivery ( 82 , 83 ). Niosomes are praised for their ability to offer an controlled release of drugs because of their characteristics ( 31 ). Figure 5 shows the 120 hours' release pattern of metformin from the Nio-met, and Hyalo-Nio-met NPs at 37°C and pH 7.4. Both Nio-met, and Hyalo-Nio-met NPs shows biphasic release pattern. The maximum release rates reached 42% and 47% within the first 12 hours of the experiment, followed by a subsequent decrease. This initial high release is attributed to the drug being weakly bound to the surface of the niosomal nanoparticles rather than being encapsulated inside them. MTT is a widely used method for assessing cytotoxicity, viability, and proliferation studies in cell biology ( 84 ). This is based on the ability of mitochondrial enzymes in viable cells to reduce the MTT yellow tetrazolium salt to purple formazan crystals ( 85 ). The effect of metformin, Nio-met, and Hyalo-Nio-met NPs on PBMCs are illustrated in Fig. 6 . The Hyalo-Nio-met composed of Span 60, cholesterol, metformin, and hyaluronic acid. Hyaluronic acid and cholesterol are both natural components find in human body and studies confirmed their safety to normal cells ( 86 ). As illustrated in the Fig. 6 , metformin, Nio-met, and Hyalo-Nio-met NPs exhibit a negligible and insignificant proliferation effect on PBMCs at concentrations of 5 mM. As previously described, niosomal NPs can enhance treatment effectiveness by increasing the solubility and bioavailability of drugs. Additionally, the decoration of hyaluronic acid on their surface facilitates the localization of drug into the PBMCs, thereby enhancing the likelihood of cellular uptake and therapeutic impact. The highly significant result (p < 0.1 *) is observed in the Hyalo-Nio-met treated group at a 15 mM concentration. Based on these findings, 15 mM of metformin, Nio-met NPs, and Hyalo-Nio-met NPs have been selected for use in the subsequent experiments of this study. Reactive Oxygen Species (ROS) are highly reactive molecules that can be generated in cells through both enzymatic and non-enzymatic mechanisms ( 87 ). These molecules have the ability to interact with active substances, organic compounds, and environmental pollutants, outside the cell ( 88 ). Elevated levels of ROS can cause stress, a factor associated with aging and the onset of human illnesses ( 89 ). Oxidative stress happens when there is an imbalance, between ROS and antioxidants, leading to tissue damage and the chronicity of diseases ( 90 ). Furthermore, ROS has been linked to the progression and severity of RA, affecting joint tissue injury ( 91 ). Figure 7 illustrates the ROS level of untreated and treated PBMCs. The treatment of PBMCs with metformin in free form could successfully reduce the ROS level in these cells. The Nio-met treated group showed increased reduction compared to the free form of metformin and eventually, the highest reduction belonged to Hyalo-Nio-met treated group. These results can be interpreted by the role of niosomes in increasing drug solubility and bioavailability, as well as the role of hyaluronic acid in placing these nanoparticles in the vicinity of cells. IL 23 is a cytokine plays an essential role in different inflammatory and autoimmune conditions. Research indicates that IL 23 can activate shared receptors structurally to induce inflammatory responses ( 92 ). It is also recognized as a factor in the development of RA ( 93 ). In RA there is an increased presence of M1 macrophages that produce levels of IL 23 highlighting its involvement in inflammation ( 94 ). Studies have shown elevated levels of IL 23 in the blood of RA patients closely linked to disease activity ( 93 ). TGF beta serves as a regulator in cellular functions like proliferation, differentiation, migration, cell survival, angiogenesis and immunesurveillance ( 95 ). The TGF beta signaling pathway plays a key role in cancer development and progression by influencing interactions, within the tumor microenvironment ( 96 ). TGF-β contributes to increased production of extracellular matrix components and mesenchymal cell activities post inflammatory responses ( 97 ). It regulates fibroblast function, influences inflammatory responses, and modulates tissue repair processes ( 98 , 99 ). The IL-23 and TGF-β levels in PBMCs are illustrated in Fig. 8 . These results show a decrease in IL-23 level and an increase in TGF-β level in treated cells. Catalase is a tetrameric enzyme that plays a crucial role in protecting aerobic cells from oxidative stress by catalyzing the decomposition of hydrogen peroxide into water and oxygen ( 100 ). Various research studies have explored the significance of catalase in RA and its potential as a treatment target. They discovered catalase activity in the blood plasma of RA patients compared to those who're healthy hinting at a possible imbalance in antioxidant defenses ( 101 ). likewise there have been observations of reduced catalase activity among individuals with RA indicating a connection, between stress and the development of RA ( 102 ). Table 4 listed the catalase level in PBMCs isolated from healthy individuals, RA patients, and RA patients with T2DM. Generally, the treated PBMCs demonstrated higher level of catalase compared to untreated group. The highest increase in catalase level belongs to the Hyalo-Nio-met NPs treated group. Table 4 Catalase level in PBMCs isolated from healthy individuals, RA patients, and RA patients with T2DM Catalase level (U/mg protein) Untreated Metformin Nio-met Hyalo-Nio-met Healthy 75 ± 9.3 81 ± 7.3 99 ± 11.2 87 ± 9.5 Rheumatoid Arthritis 43 ± 8.1 64 ± 5.8 93 ± 7.4 109 ± 6.2 Rheumatoid Arthritis + T2DM 28 ± 4.9 62 ± 6.2 85 ± 3.9 117 ± 10.4 The expression of various genes plays a role in RA, so the expression of some of these genes was investigated by real-time PCR. The NFATc1 gene, encoding the nuclear factor of activated T-cells c1, plays a crucial role in various biological processes, particularly in bone homeostasis and cancer. It is essential for osteoclast differentiation ( 103 – 105 ). NFATc1 also interacts with other transcription factors like AP-1 and Mitf to stimulate gene expression in osteoclast precursors ( 106 ). Studies have shown that NFATc1 expression is increased in synovial osteoclast precursors of RA patients, indicating a potential link to the enhanced osteoclast differentiation observed in RA ( 107 ). RANKL, which stands for Receptor activator of NF-κB ligand, is a crucial molecule involved in various physiological processes. It is known to play a significant role in bone homeostasis and the formation of lymphoid tissues ( 14 ). It is encoded by a gene located on chromosome 13q14 and is primarily expressed by osteocytes, activated T-cells, and bone marrow stromal cells ( 108 ). This molecule exists in two forms: membrane-bound RANKL (mRANKL) and soluble RANKL (sRANKL) ( 109 ). It also plays a crucial role in bone erosion in RA by promoting osteoclast formation, function, and survival ( 110 ). Studies have shown that RANKL is highly expressed in synovial fluid B cells of RA patients and is a key cytokine involved in bone destruction ( 111 ). Anti-RANKL antibody treatment has been proposed as a strategy to protect against joint destruction in RA ( 112 ). COX-2 is an inducible enzyme that is involved in pathophysiological processes such as pain, inflammation, and fever ( 113 ). COX-2, expressed in synovial cells of RA patients, plays a crucial role in the inflammatory process within the joints ( 114 ). Selective COX-2 inhibitors have emerged as important options in RA treatment due to their efficacy and reduced gastrointestinal toxicity compared to traditional non-selective nonsteroidal anti-inflammatory drugs ( 115 , 116 ). Changes in the expression of NFATc1, RANKL, and COX-2 genes in untreated and treated PBMCs with metformin, Nio-met NPs, and Hyalo-Nio-met NPs are shown in Fig. 9 for both RA patients and RA patients with T2DM. In both groups there is no statistically significant change in NFATc1 gene expression following treatment with metformin and Nio-met NPs. In RA patients, there is a significant decrease in RANKL gene expression following treatment with Hyalo-Nio-met NPs same results are repeated in RA patients with T2DM. In RA patients, there is a statistically significant decrease in COX-2 gene expression in treatment with metformin and Nio-met NPs. Treatment with Hyalo-Nio-met NPs resulted in a significant decrease in COX-2 gene expression in this group. In RA patients with T2DM, there is a statistically significant decrease in COX-2 gene expression between treatment with Nio-met NPs and Hyalo-Nio-met NPs. The results revealed that when metformin was exposed to PBMCs the NFATc1, RANKL, and COX-2 expressions were reducing. Conclusion This study highlighted the potential of hyaluronic acid-coated niosomal nanoparticles as an effective drug delivery system for metformin, targeting RA and RA patients with T2DM derived PBMCs. The Hyalo-Nio-met NPs exhibited desirable characteristics, including stability and controlled drug release. The decoration of HA on niosomal NPs enhanced the targeting and therapeutic impact of these NPs. The synthesized Hyalo-Nio-met NPs demonstrated a significant reduction in reactive oxygen species (ROS), pro-inflammatory cytokine IL-23, and osteoclastogenesis-related genes (NFATc1, RANKL, and COX-2) in both RA patients and RA patients with T2DM. This indicates a promising reduction in inflammation and an enhancement of anti-inflammatory and antioxidant defenses. Overall, the Hyalo-Nio-met NPs drug delivery system effectively delivered metformin to PBMCs, showing potential as a novel treatment approach for RA with T2DM by reducing systemic toxicity and improving drug delivery to specific cells. Further research and clinical studies are warranted to validate these findings and explore the full therapeutic potential of this nanodrug delivery system. Declarations Competing Interests No potential competing interest was reported by the authors. Ethical Approval and Consent to participate This research protocol was evaluated and approved on 02.11.2023 by Medical Research Bioethical Committee, College of Medicine, University of Kerbala / Kerbala – Iraq. Consent to publication Informed consent was obtained from all individual participants included in the study. Availability of supporting data The data that support the findings of this study are available from the corresponding author, upon reasonable request. Funding Not applicable for the research. Author Contribution Writing - original draft preparation and methodology: Shatha Jassim HatemConceptualization, Supervision: Fadhil Jawad Al-Tu'ma.Reviewing and editing: Maher Abbood Mukheef References Bullock, J., Rizvi, S. A., Saleh, A. M., Ahmed, S. S., Do, D. P., Ansari, R. A., et al. (2019). Rheumatoid arthritis: a brief overview of the treatment. Medical Principles and Practice , 27 (6), 501–507. Tanaka, Y. (2016). Current concepts in the management of rheumatoid arthritis. The Korean Journal of Internal Medicine , 31 (2), 210. Deane, K. D., Norris, J. M., & Holers, V. M. (2010). Preclinical rheumatoid arthritis: identification, evaluation, and future directions for investigation. Rheumatic Disease Clinics , 36 (2), 213–241. Dariushnejad, H., Chodari, L., Sedighi, M., Akbari, S., & Ghorbanzadeh, V. (2022). Rheumatoid arthritis: current therapeutics compendium. Endocrine Regulations , 56 (2), 148–162. Ohori, M. (2008). ERK inhibitors as a potential new therapy for rheumatoid arthritis. Drug news & perspectives , 21 (5), 245–250. Sayah, A., & EnglishIII, J. C. (2005). Rheumatoid arthritis: a review of the cutaneous manifestations. Journal of the American Academy of Dermatology , 53 (2), 191–209. Shaw, M., Collins, B. F., Ho, L. A., & Raghu, G. (2015). Rheumatoid arthritis-associated lung disease. European Respiratory Review , 24 (135), 1–16. Esposito, A. J., Chu, S. G., Madan, R., Doyle, T. J., & Dellaripa, P. F. (2019). Thoracic manifestations of rheumatoid arthritis. Clinics in chest medicine , 40 (3), 545–560. Sudoł-Szopińska, I., Kontny, E., Maśliński, W., Prochorec-Sobieszek, M., Warczyńska, A., & Kwiatkowska, B. (2013). Significance of bone marrow edema in pathogenesis of rheumatoid arthritis. Polish journal of radiology , 78 (1), 57. Basu, N., Jones, G. T., Macfarlane, G. J., & Druce, K. L. (2017). Identification and validation of clinically relevant clusters of severe fatigue in rheumatoid arthritis. Psychosomatic medicine , 79 (9), 1051–1058. Mun, S., Lee, J., Park, A., Kim, H-J., Lee, Y-J., Son, H., et al. (2019). Proteomics approach for the discovery of rheumatoid arthritis biomarkers using mass spectrometry. International journal of molecular sciences , 20 (18), 4368. Balakrishnan, L., Bhattacharjee, M., Ahmad, S., Nirujogi, R. S., Renuse, S., Subbannayya, Y., et al. (2014). Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients. Clinical proteomics , 11 , 1–14. Spasovski, D., Latifi, A., Osmani, B., Krstevska-Balkanov, S., Kafedizska, I., Slaninka-Micevska, M. (2013). Determination of the diagnostic values of asymmetric dimethylarginine as an indicator for evaluation of the endothelial dysfunction in patients with rheumatoid arthritis. Arthritis. ;2013. Mueller, C. G., & Hess, E. (2012). Emerging functions of RANKL in lymphoid tissues. Frontiers in immunology , 3 , 261. Tian, Z., Mclaughlin, J., Verma, A., Chinoy, H., & Heald, A. H. (2021). The relationship between rheumatoid arthritis and diabetes mellitus: a systematic review and meta-analysis. Cardiovascular endocrinology & metabolism , 10 (2), 125–131. Lin, S., Naseri, T., Linhart, C., Morrell, S., Taylor, R., McGarvey, S., et al. (2017). Trends in diabetes and obesity in Samoa over 35 years, 1978–2013. Diabetic Medicine , 34 (5), 654–661. Birabwa, C., Bwambale, M. F., Waiswa, P., & Mayega, R. W. (2019). Quality and barriers of outpatient diabetes care in rural health facilities in Uganda–a mixed methods study. BMC Health Services Research , 19 , 1–10. Ahmed, S. F., Shabayek, M. I., Abdel Ghany, M. E., El-Hefnawy, M. H., & El-Mesallamy, H. O. (2018). Role of CTRP3, CTRP9 and MCP-1 for the evaluation of T2DM associated coronary artery disease in Egyptian postmenopausal females. PLoS One , 13 (12), e0208038. Farmaki, P., Damaskos, C., Garmpis, N., Garmpi, A., Savvanis, S., & Diamantis, E. (2020). Complications of the type 2 diabetes mellitus. Current cardiology reviews , 16 (4), 249–251. Pelin, A. M., Gavat, C. C., Balan, G., Popescu, E., & Georgescu, C. V. (2017). Particularities of Statin Therapy in Diabetic Patients. Revista de Chimie , 68 (4), 720–725. Gudjinu, H. Y., & Sarfo, B. (2017). Risk factors for type 2 diabetes mellitus among out-patients in Ho, the Volta regional capital of Ghana: a case–control study. BMC research notes , 10 , 1–10. Lovell, D. J., Ruperto, N., Goodman, S., Reiff, A., Jung, L., Jarosova, K., et al. (2008). Adalimumab with or without methotrexate in juvenile rheumatoid arthritis. New England Journal of Medicine , 359 (8), 810–820. Bagust, A., Boland, A., Hockenhull, J., Fleeman, N., Greenhalgh, J., Dundar, Y., et al. (2009). Rituximab for the treatment of rheumatoid arthritis. Health Technology Assessment , 13 (Suppl 2), 23–29. Lehrke, M., & Marx, N. (2017). Diabetes mellitus and heart failure. The American journal of cardiology , 120 (1), S37–S47. Pivari, F., Mingione, A., Brasacchio, C., & Soldati, L. (2019). Curcumin and type 2 diabetes mellitus: prevention and treatment. Nutrients , 11 (8), 1837. Gong, Z., Peng, S., Cao, J., Tan, H., Zhao, H., & Bai, J. (2024). Advances in the variations and biomedical applications of stimuli-responsive nanodrug delivery systems. Nanotechnology , 35 (13), 132001. Huang, Y., Cole, S. P., Cai, T., & Cai, Y. (2016). Applications of nanoparticle drug delivery systems for the reversal of multidrug resistance in cancer. Oncology letters , 12 (1), 11–15. McMillan, J., Batrakova, E., & Gendelman, H. E. (2011). Cell delivery of therapeutic nanoparticles. Progress in molecular biology and translational science , 104 , 563–601. Onoue, S., Yamada, S., & Chan, H-K. (2014). Nanodrugs: pharmacokinetics and safety. International journal of nanomedicine . :1025–1037. Cheng, Y., Samia, A. C., Li, J., Kenney, M. E., Resnick, A., & Burda, C. (2010). Delivery and efficacy of a cancer drug as a function of the bond to the gold nanoparticle surface. Langmuir , 26 (4), 2248–2255. Jadid, M. F. S., Jafari-Gharabaghlou, D., Bahrami, M. K., Bonabi, E., & Zarghami, N. (2023). Enhanced anti-cancer effect of curcumin loaded-niosomal nanoparticles in combination with heat-killed Saccharomyces cerevisiae against human colon cancer cells. Journal of Drug Delivery Science and Technology , 80 , 104167. Mandal, S., Banerjee, C., Ghosh, S., Kuchlyan, J., & Sarkar, N. (2013). Modulation of the photophysical properties of curcumin in nonionic surfactant (Tween-20) forming micelles and niosomes: a comparative study of different microenvironments. The Journal of Physical Chemistry B , 117 (23), 6957–6968. Lo, C. T., Jahn, A., Locascio, L. E., & Vreeland, W. N. (2010). Controlled self-assembly of monodisperse niosomes by microfluidic hydrodynamic focusing. Langmuir , 26 (11), 8559–8566. Gharbavi, M., Amani, J., Kheiri-Manjili, H., Danafar, H., & Sharafi, A. (2018). Niosome: a promising nanocarrier for natural drug delivery through blood-brain barrier. Advances in pharmacological sciences. ;2018. Choi, M., & Maibach, H. (2005). Liposomes and niosomes as topical drug delivery systems. Skin pharmacology and physiology , 18 (5), 209–219. Hu, Q., Katti, P. S., & Gu, Z. (2014). Enzyme-responsive nanomaterials for controlled drug delivery. Nanoscale , 6 (21), 12273–12286. Singh, A. P., Biswas, A., Shukla, A., & Maiti, P. (2019). Targeted therapy in chronic diseases using nanomaterial-based drug delivery vehicles. Signal transduction and targeted therapy , 4 (1), 33. Vighi, E., Trifunović, D., Veiga-Crespo, P., Rentsch, A., Hoffmann, D., Sahaboglu, A. (2018). Combination of cGMP analogue and drug delivery system provides functional protection in hereditary retinal degeneration. Proceedings of the National Academy of Sciences. ;115(13):E2997-E3006. Li, C., Liu, R., Song, Y., Chen, Y., Zhu, D., Yu, L., et al. (2022). Hyaluronic acid hydrogels hybridized with au-triptolide nanoparticles for intraarticular targeted multi-therapy of rheumatoid arthritis. Frontiers in Pharmacology , 13 , 849101. Chen, J., Chen, L., She, Z., Zeng, F., & Wu, S. (2024). A multifunctional nanoaggregate-based system for detection of rheumatoid arthritis via Optoacoustic/NIR‐II fluorescent imaging and therapy via inhibiting JAK‐STAT/NF‐κB/NLRP3 pathways. Aggregate , 5 (1), e419. Wang, Z., Yang, J., Yang, Y., Pu, X., Zhao, J., & Zhang, N. (2020). Targeted and combined TPCA-1-gold nanocage therapy for in vivo treatment of inflammatory arthritis. An Official Journal Of The American Association Of Pharmaceutical Scientists , 21 , 1–9. Yu, C., Li, X., Hou, Y., Meng, X., Wang, D., Liu, J., et al. (2019). Hyaluronic acid coated acid-sensitive nanoparticles for targeted therapy of adjuvant-induced arthritis in rats. Molecules , 24 (1), 146. Li, C., Liu, R., Song, Y., Zhu, D., Yu, L., Huang, Q. (2021). Intra-articular Administrated Hydrogels of Hyaluronic Acid Hybridized with Triptolide/Gold Nanoparticles for Targeted Delivery to Rheumatoid Arthritis Combined with Photothermal-chemo Therapy. Res Sq . El-barbary, A. M., Khalek, M. A. A., Elsalawy, A. M., & Hazaa, S. M. (2011). Assessment of lipid peroxidation and antioxidant status in rheumatoid arthritis and osteoarthritis patients. The Egyptian Rheumatologist , 33 (4), 179–185. Foretz, M., Guigas, B., & Viollet, B. (2019). Understanding the glucoregulatory mechanisms of metformin in type 2 diabetes mellitus. Nature Reviews Endocrinology , 15 (10), 569–589. Jiang, L-L., & Liu, L. (2020). Effect of metformin on stem cells: Molecular mechanism and clinical prospect. World journal of stem cells , 12 (12), 1455. Tran, S., DeGiovanni, P-J., Piel, B., & Rai, P. (2017). Cancer nanomedicine: a review of recent success in drug delivery. Clinical and translational medicine , 6 , 1–21. Upadhyay, S., Ganguly, K., & Palmberg, L. (2015). Wonders of nanotechnology in the treatment for chronic lung diseases. Journal of Nanomedicine & Nanotechnology , 6 (6), 1. Xiao, S., Tong, C., Liu, X., Yu, D., Liu, Q., Xue, C., et al. (2006). Preparation of folate-conjugated starch nanoparticles and its application to tumor-targeted drug delivery vector. Chinese science bulletin , 51 , 1693–1697. Ge, X., Wei, M., He, S., & Yuan, W-E. (2019). Advances of non-ionic surfactant vesicles (niosomes) and their application in drug delivery. Pharmaceutics , 11 (2), 55. Ag Seleci, D., Seleci, M., Walter, J-G., Stahl, F., & Scheper, T. (2016). Niosomes as nanoparticular drug carriers: fundamentals and recent applications. Journal of nanomaterials. ;2016. Alnaim, A. S., Shah, H., Nair, A. B., Mewada, V., Patel, S., Jacob, S., et al. (2023). Qbd-based approach to optimize niosomal gel of levosulpiride for transdermal drug delivery. Gels , 9 (3), 213. Al Qtaish, N., Gallego, I., Villate-Beitia, I., Sainz-Ramos, M., López-Méndez, T. B., Grijalvo, S., et al. (2020). Niosome-based approach for in situ gene delivery to retina and brain cortex as immune-privileged tissues. Pharmaceutics , 12 (3), 198. Haddadian, A., Robattorki, F. F., Dibah, H., Soheili, A., Ghanbarzadeh, E., Sartipnia, N., et al. (2022). Niosomes-loaded selenium nanoparticles as a new approach for enhanced antibacterial, anti-biofilm, and anticancer activities. Scientific reports , 12 (1), 21938. Jing, F., Li, G., Wang, Y., Zhu, S., Liu, R., He, J., et al. (2021). Synthesis and characterization of folic acid-modified carboxymethyl chitosan‐ursolic acid targeted nano‐drug carrier for the delivery of ursolic acid and 10‐hydroxycamptothecin. Polymers for Advanced Technologies , 32 (1), 343–354. Jain, P. K., Lee, K. S., El-Sayed, I. H., & El-Sayed, M. A. (2006). Calculated absorption and scattering properties of gold nanoparticles of different size, shape, and composition: applications in biological imaging and biomedicine. The journal of physical chemistry B , 110 (14), 7238–7248. Albanese, A., Tang, P. S., & Chan, W. C. (2012). The effect of nanoparticle size, shape, and surface chemistry on biological systems. Annual review of biomedical engineering , 14 , 1–16. Islam, M. A., Barua, S., & Barua, D. (2017). A multiscale modeling study of particle size effects on the tissue penetration efficacy of drug-delivery nanoparticles. BMC systems biology , 11 , 1–13. Churilov, D., Churilov, G., Polischuk, S., Churilova, V., & Byshova, D. (Eds.). (2020). Influence of the size of nanostructured metals on changes in the functional state of the cell and biological activity. E3S Web of Conferences; : EDP Sciences. Inam, W., Bhadane, R., Akpolat, R. N., Taiseer, R. A., Filippov, S. K., Salo-Ahen, O. M., et al. (2022). Interactions between polymeric nanoparticles and different buffers as investigated by zeta potential measurements and molecular dynamics simulations. View , 3 (4), 20210009. Lee, J-S., Kim, G-H., & Lee, H. G. (2010). Characteristics and antioxidant activity of Elsholtzia splendens extract-loaded nanoparticles. Journal of Agricultural and Food Chemistry , 58 (6), 3316–3321. Gu, M., Luan, J., Song, K., Qiu, C., Zhang, X., & Zhang, M. (2021). Development of paclitaxel loaded pegylated gelatin targeted nanoparticles for improved treatment efficacy in non-small cell lung cancer (NSCLC): an in vitro and in vivo evaluation study. Acta Biochimica Polonica , 68 (4), 583–591. Wilhelm Romero, K., Quirós, M. I., Vargas Huertas, F., Vega-Baudrit, J. R., Navarro-Hoyos, M., & Araya-Sibaja, A. M. (2021). Design of Hybrid Polymeric-Lipid Nanoparticles Using Curcumin as a Model: Preparation, Characterization, and In Vitro Evaluation of Demethoxycurcumin and Bisdemethoxycurcumin-Loaded Nanoparticles. Polymers , 13 (23), 4207. Mato, E., Puras, G., Bell, O., Agirre, M., Hernández, R., Igartua, M., et al. (2015). Selective antitumoral effect of sorafenib loaded PLGA nanoparticles conjugated with cetuximab on undifferentiated/anaplastic thyroid carcinoma cells. J Nanomed Nanotechnol , 6 (281), 2. Hu, B., Pan, C., Sun, Y., Hou, Z., Ye, H., Hu, B., et al. (2008). Optimization of fabrication parameters to produce chitosan – tripolyphosphate nanoparticles for delivery of tea catechins. Journal of agricultural and food chemistry , 56 (16), 7451–7458. Rostamkalaei, S. S., Akbari, J., Saeedi, M., Morteza-Semnani, K., & Nokhodchi, A. (2019). Topical gel of Metformin solid lipid nanoparticles: A hopeful promise as a dermal delivery system. Colloids and Surfaces B: Biointerfaces , 175 , 150–157. Md, S., Alhakamy, N. A., Neamatallah, T., Alshehri, S., Mujtaba, M. A., Riadi, Y., et al. (2021). Development, characterization, and evaluation of α-Mangostin-loaded polymeric nanoparticle gel for topical therapy in skin Cancer. Gels , 7 (4), 230. Kawamura, J., Kitamura, H., Otake, Y., Fuse, S., & Nakamura, H. (2020). Size-controllable and scalable production of liposomes using a v-shaped mixer micro-flow reactor. Organic Process Research & Development , 24 (10), 2122–2127. Kenry, Yeo, T., Manghnani, P. N., Middha, E., Pan, Y., Chen, H., et al. (2020). Mechanistic understanding of the biological responses to polymeric nanoparticles. ACS nano , 14 (4), 4509–4522. Liebert, T., Kostag, M., Wotschadlo, J., & Heinze, T. (2011). Stable cellulose nanospheres for cellular uptake. Macromolecular bioscience , 11 (10), 1387–1392. Liu, X., Yu, M., Kim, H., Mameli, M., & Stellacci, F. (2012). Determination of monolayer-protected gold nanoparticle ligand–shell morphology using NMR. Nature communications , 3 (1), 1182. Ge, C., Tian, J., Zhao, Y., Chen, C., Zhou, R., & Chai, Z. (2015). Towards understanding of nanoparticle–protein corona. Archives of toxicology , 89 , 519–539. Guilger-Casagrande, M., Germano-Costa, T., Bilesky-José, N., Pasquoto-Stigliani, T., Carvalho, L., Fraceto, L. F., et al. (2021). Influence of the capping of biogenic silver nanoparticles on their toxicity and mechanism of action towards Sclerotinia sclerotiorum. Journal of Nanobiotechnology , 19 , 1–18. Rozhin, A., Batasheva, S., Kruychkova, M., Cherednichenko, Y., Rozhina, E., & Fakhrullin, R. (2021). Biogenic silver nanoparticles: Synthesis and application as antibacterial and antifungal agents. Micromachines , 12 (12), 1480. Zaid Alkilani, A., Hamed, R., Abdo, H., Swellmeen, L., Basheer, H. A., Wahdan, W., et al. (2022). Formulation and evaluation of azithromycin-loaded niosomal gel: optimization, in vitro studies, rheological characterization, and cytotoxicity study. ACS omega , 7 (44), 39782–39793. Hanafy, N. A., Sheashaa, R. F., Moussa, E. A., & Mahfouz, M. E. (2023). Potential of curcumin and niacin-loaded targeted chitosan coated liposomes to activate autophagy in hepatocellular carcinoma cells: An in vitro evaluation in HePG2 cell line. International journal of biological macromolecules , 245 , 125572. Uhrich, K. E., Cannizzaro, S. M., Langer, R. S., & Shakesheff, K. M. (1999). Polymeric systems for controlled drug release. Chemical reviews , 99 (11), 3181–3198. Ways, M., Ng, T. M., Lau, K. W., & Khutoryanskiy, W. M. (2020). Silica nanoparticles in transmucosal drug delivery. Pharmaceutics , 12 (8), 751. Odeniyi, M. A., Omoteso, O. A., Adepoju, A. O., & Jaiyeoba, K. T. (2018). Starch nanoparticles in drug delivery: A review. Polim W Med , 48 , 41–45. Slowing, I. I., Trewyn, B. G., Giri, S., & Lin, V. Y. (2007). Mesoporous silica nanoparticles for drug delivery and biosensing applications. Advanced Functional Materials , 17 (8), 1225–1236. Javaid, S., Ahmad, N. M., Mahmood, A., Nasir, H., Iqbal, M., Ahmad, N., et al. (2021). Cefotaxime loaded polycaprolactone based polymeric nanoparticles with antifouling properties for in-vitro drug release applications. Polymers , 13 (13), 2180. Hazira, R. M. N., & Reddy, M. S. (2023). Niosomes: A nanocarrier drug delivery system. GSC Biological and Pharmaceutical Sciences , 22 (2), 120–127. Rao, N. N., Chowdary, P., Divya, Y., Laksmi, T., Latha, K., & Sirisha, P. (2018). Niosomes: a vesicular drug delivery system. Research Journal of Pharmacy and Technology , 11 (8), 3731–3736. Wang, T-T., Wang, S-K., Huang, G-L., & Sun, G-J. (2012). Luteolin induced-growth inhibition and apoptosis of human esophageal squamous carcinoma cell line Eca109 cells in vitro. Asian Pacific journal of cancer prevention , 13 (11), 5455–5461. Hirsch, G. E., Parisi, M. M., Martins, L. A., Andrade, C. M., Barbé-Tuana, F. M., & Guma, F. T. (2015). γ‐oryzanol reduces caveolin‐1 and PCGEM1 expression, markers of aggressiveness in prostate cancer cell lines. The Prostate , 75 (8), 783–797. Wu, X., Wei, Z., Feng, H., Chen, H., Xie, J., Huang, Y., et al. (2022). Targeting Effect of Betulinic Acid Liposome Modified by Hyaluronic Acid on Hepatoma Cells In Vitro. Journal of Pharmaceutical Sciences , 111 (11), 3047–3053. Villaverde, A. I. S. B., Netherton, J., & Baker, M. A. (2019). From past to present: The link between reactive oxygen species in sperm and male infertility. Antioxidants , 8 (12), 616. Wang, H., Wan, K., & Shi, X. (2019). Recent advances in nanozyme research. Advanced materials , 31 (45), 1805368. Ikeda, Y., Taniguchi, K., Nagase, N., Tsuji, A., Kitagishi, Y., & Matsuda, S. (2021). Reactive oxygen species may influence on the crossroads of stemness, senescence, and carcinogenesis in a cell via the roles of APRO family proteins. Exploration of Medicine , 2 (5), 443–454. Mateen, S., Moin, S., Khan, A. Q., Zafar, A., & Fatima, N. (2016). Increased reactive oxygen species formation and oxidative stress in rheumatoid arthritis. PloS one , 11 (4), e0152925. Zhai, K., Duan, H., Khan, G. J., Xu, H., Han, F., Cao, W., et al. (2018). Salicin from Alangium chinense ameliorates rheumatoid arthritis by modulating the Nrf2-HO-1-ROS pathways. Journal of Agricultural and Food Chemistry , 66 (24), 6073–6082. Bloch, Y., Bouchareychas, L., Merceron, R., Składanowska, K., Van den Bossche, L., Detry, S., et al. (2018). Structural activation of pro-inflammatory human cytokine IL-23 by cognate IL-23 receptor enables recruitment of the shared receptor IL-12Rβ1. Immunity , 48 (1), 45–58. e6. Al Sheikh, M. M., El-shafey, A. M., Gawish, H. H., & ROLE OF INTERLEUKIN-23 AS A MARKER OF DISEASE ACTIVITY IN RHEUMATOID ARTHRITIS PATIENTS. (2018). Zagazig University Medical Journal . ;24(5):404–408. Li, J., Yang, P., Wu, Q., Li, H., Ding, Y., Hsu, H. C., et al. (2013). Death receptor 5–targeted depletion of interleukin-23–producing macrophages, Th17, and Th1/17 associated with defective tyrosine phosphatase in mice and patients with rheumatoid arthritis. Arthritis & Rheumatism , 65 (10), 2594–2605. Elliott, R. L., & Blobe, G. C. (2005). Role of transforming growth factor Beta in human cancer. Journal of clinical oncology , 23 (9), 2078–2093. Stover, D. G., Bierie, B., & Moses, H. L. (2007). A delicate balance: TGF-β and the tumor microenvironment. Journal of cellular biochemistry , 101 (4), 851–861. Pohlers, D., Brenmoehl, J., Löffler, I., Müller, C. K., Leipner, C., Schultze-Mosgau, S. (2009). TGF-β and fibrosis in different organs—molecular pathway imprints. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. ;1792(8):746–756. Bira, Y., Tani, K., Nishioka, Y., Miyata, J., Sato, K., Hayashi, A., et al. (2005). Transforming growth factor β stimulates rheumatoid synovial fibroblasts via the type II receptor. Modern rheumatology , 15 , 108–113. Cheon, H., Yu, S-J., Yoo, D., Chae, I., Song, G., & Sohn, J. (2002). Increased expression of pro-inflammatory cytokines and metalloproteinase-1 by TGF-β 1 in synovial fibroblasts from rheumatoid arthritis and normal individuals. Clinical & Experimental Immunology , 127 (3), 547–552. Chakravarti, R., Gupta, K., Majors, A., Ruple, L., Aronica, M., & Stuehr, D. J. (2015). Novel insights in mammalian catalase heme maturation: effect of NO and thioredoxin-1. Free Radical Biology and Medicine , 82 , 105–113. Kamanlı, A., Nazıroğlu, M., Aydılek, N., & Hacıevlıyagil, C. (2004). Plasma lipid peroxidation and antioxidant levels in patients with rheumatoid arthritis. Cell biochemistry and function , 22 (1), 53–57. Surapneni, K. M., & Chandrasada Gopan, V. (2008). Lipid peroxidation and antioxidant status in patients with rheumatoid arthritis. Indian Journal of Clinical Biochemistry , 23 , 41–44. Asagiri, M., Sato, K., Usami, T., Ochi, S., Nishina, H., Yoshida, H., et al. (2005). Autoamplification of NFATc1 expression determines its essential role in bone homeostasis. The Journal of experimental medicine , 202 (9), 1261–1269. Song, I., Kim, J. H., Kim, K., Jin, H. M., Youn, B. U., & Kim, N. (2009). Regulatory mechanism of NFATc1 in RANKL-induced osteoclast activation. FEBS letters , 583 (14), 2435–2440. Charles, J. F., Coury, F., Sulyanto, R., Sitara, D., Wu, J., Brady, N., et al. (2012). The collection of NFATc1-dependent transcripts in the osteoclast includes numerous genes non-essential to physiologic bone resorption. Bone , 51 (5), 902–912. Pang, M., Rodríguez-Gonzalez, M., Hernandez, M., Recinos, C. C., Seldeen, K. L., & Troen, B. R. (2019). AP‐1 and Mitf interact with NFATc1 to stimulate cathepsin K promoter activity in osteoclast precursors. Journal of cellular biochemistry , 120 (8), 12382–12392. Park-Min, K-H., Lim, E., Lee, M. J., Park, S. H., Giannopoulou, E., Yarilina, A., et al. (2014). Inhibition of osteoclastogenesis and inflammatory bone resorption by targeting BET proteins and epigenetic regulation. Nature communications , 5 (1), 5418. Panagiotidis, I., Christoulas, D., & Terpos, E. (2016). Inhibition of receptor activator of nuclear factor kappa-B ligand pathway for the management of aggressive osteosarcoma. Annals of Translational Medicine . ;4(24). Taubman, M. A., Kawai, T., & Han, X. (2007). The new concept of periodontal disease pathogenesis requires new and novel therapeutic strategies (pp. 367–369). Wiley Online Library. Feng, X., Shi, Y., Xu, L., Peng, Q., Wang, F., Wang, X., et al. (2016). Modulation of IL-6 induced RANKL expression in arthritic synovium by a transcription factor SOX5. Scientific reports , 6 (1), 32001. Ota, Y., Niiro, H., Ota, S., Ueki, N., Tsuzuki, H., Nakayama, T., et al. (2016). Generation mechanism of RANKL + effector memory B cells: relevance to the pathogenesis of rheumatoid arthritis. Arthritis research & therapy , 18 , 1–10. Morita, T., Shima, Y., Fujimoto, K., Tsuboi, H., Saeki, Y., Narazaki, M., et al. (2019). Anti-receptor activator of nuclear factor κB ligand antibody treatment increases osteoclastogenesis-promoting IL-8 in patients with rheumatoid arthritis. International Immunology , 31 (5), 277–285. Cottrell, J., & O’Connor, J. P. (2010). Effect of non-steroidal anti-inflammatory drugs on bone healing. Pharmaceuticals , 3 (5), 1668–1693. Kawai, S. (1998). Cyclooxygenase selectivity and the risk of gastro-intestinal complications of various non-steroidal anti-inflammatory drugs: a clinical consideration. Inflammation Research , 47 , 102–106. Sundy, J. S. (2001). COX-2 inhibitors in rheumatoid arthritis. Current Rheumatology Reports , 3 (1), 86–91. Lazzaroni, M., & Bianchi Porro, G. (2004). Gastrointestinal side-effects of traditional non‐steroidal anti‐inflammatory drugs and new formulations. Alimentary pharmacology & therapeutics , 20 , 48–58. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4767562\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":331208687,\"identity\":\"12dfa858-1d91-4d77-9143-3e94cb3e4168\",\"order_by\":0,\"name\":\"Shatha Jassim Hatem\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Kerbala\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shatha\",\"middleName\":\"Jassim\",\"lastName\":\"Hatem\",\"suffix\":\"\"},{\"id\":331208688,\"identity\":\"79716716-6e6e-4435-b449-1396fee8432d\",\"order_by\":1,\"name\":\"Fadhil Jawad Al-Tu’ma\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLElEQVRIie2PvUrEQBCAJywkzXJpJ5w/r7ASCCmOu1eJBJImhRDwB0UFwdJaH+OarYWA11hLYAsThauu8IoLZyPu5qIgJqkF94Od2WHnY2cANJo/iHUJHgQHQFSBAL7KRiEDHXQo9F4p7FtBeYAw9WL2KcA2xZdiqgCdipXxomBg2bdhmcMZnrOnbH6ySsZbJpDyJW9RaHTE1GCYR64PD4hMRJ7Y5qEczHTd5LcygcTDehcReChHkkrgCYcTqVBz2KJQe7FRdkVcIXwoJa5Sh190K9j8woS8GNdKSTxjybMeZX4oFSR7z4vU379B504k6dDgM2qS9l2oHXJnfTwKdx5n0/ytGtkDEU+X7/x0YltX5WuL0oBhnYKmJLSOne014x+Vse7v1mg0mv/FJ8onVsuYtN7uAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"University of Kerbala\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Fadhil\",\"middleName\":\"Jawad\",\"lastName\":\"Al-Tu’ma\",\"suffix\":\"\"},{\"id\":331208689,\"identity\":\"0a83cbae-2667-4ec5-b486-91773249f47b\",\"order_by\":2,\"name\":\"Maher Abbood Mukheef\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Kerbala\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Maher\",\"middleName\":\"Abbood\",\"lastName\":\"Mukheef\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-07-19 10:42:47\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4767562/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4767562/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":61090601,\"identity\":\"e8a1a9d8-6e6c-44d7-be0f-cd1a802c4254\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:18\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":135832,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eRANKL signaling pathway, which is a complex pathway that leads to the activation of the transcription factors AP-1 and NF-κB, which promote the expression of genes involved in osteoclastogenesis\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/94769a5875d4aecaff0fcfe7.png\"},{\"id\":61090607,\"identity\":\"ac70d9cc-7d2c-4a09-b02b-c473e3efe0b6\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:20\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":89561,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe results of mean diameter, PDI and zeta potential value of fabricated Hyalo-Nio-met NPs by DLS technique.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/4fcbba77e4b29f0cc6cad5a0.png\"},{\"id\":61090602,\"identity\":\"eebb5ba1-d378-44f1-8668-fc18acf453fe\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:18\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":625699,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe SEM and AFM images of fabricated blank niosome and Hyalo-Nio-met NPs. A) SEM image of blank niosome NPs, B) SEM image of Hyalo-Nio-met, C) AFM image of Hyalo-Nio-met. NPs These images revealed the\\u003cstrong\\u003e \\u003c/strong\\u003espherical morphology of the NPs.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/d7cce8492aadc70c0ca5665d.png\"},{\"id\":61090603,\"identity\":\"46030e4e-3642-420c-85b3-23b4ed4c0ddb\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:19\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":138979,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe FTIR spectrum of hyaluronic acid, metformin, fabricated blank niosome, and Hyalo-Nio-met NPs. A) Hyaluronic acid, B) Metformin, C) Blank niosome NPs, D) Hyalo-Nio-met NPs. The FTIR spectrum of Hyalo-Nio-met NPs confirmed the presence of metformin in its composition.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/ea7f7cf764f17e02d00a91a0.png\"},{\"id\":61090604,\"identity\":\"8b386de7-6d5d-4dee-8312-b0f23af18849\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:20\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":85333,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe release pattern of metformin from Nio-met, and Hyalo-Nio-met NPs at 37 °C and pH 7.4 (physiological condition). Metformin showed a biphasic release pattern from these NPs.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/5b959fd752194f31c67b4ece.png\"},{\"id\":61090608,\"identity\":\"055bbffa-7928-4b82-965b-999713dd77dc\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:22\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":70676,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of metformin, Nio-met, and Hyalo-Nio-met NPs on PBMCs proliferation. The encapsulation of metformin results in increases in PBMCs proliferation effects (p-value \\u0026lt; 0.01 **, and p-value \\u0026lt; 0.1 *).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/7e18218f6a98ad5d48bd97ff.png\"},{\"id\":61090594,\"identity\":\"0eb9a615-61ea-4f9e-9d29-a76edc085558\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:18\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":78782,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eROS levels changes in untreated and treated PBMCs of Rheumatoid Arthritis+ T2DM with metformin, Nio-met NPs, and Hyalo-Nio-met NPs. A) Untreated PBMCs, B) Metformin, C) Nio-met NPs, D) Hyalo-Nio-met NPs\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/65a998f2869d3de1a986049c.png\"},{\"id\":61091092,\"identity\":\"e37a97e6-257b-4dc2-ba24-bfb629de79ff\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:08:19\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":98970,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIL-23 and TGF-β levels change in untreated and treated PBMCs of individuals with rheumatoid arthritis and rheumatoid arthritis with T2DM following treatment with metformin, Nio-met NPs, and Hyalo-Nio-met NPs.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/5b2949d75e418aae6523f06b.png\"},{\"id\":61090606,\"identity\":\"14cee87a-8cf7-4b13-b5e5-a04f8e29d376\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:00:20\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":102394,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of the drugs on the NFATc1, RANKL, and COX-2 genes expression in the PBMCs isolated from RA patients (A) and RA patients with T2DM (B). (p value \\u0026lt; 0.001 ***, p value \\u0026lt; 0.01 **, and p value \\u0026lt; 0.1 *)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/7db00ad7435f8e5a44c5bf2e.png\"},{\"id\":61091098,\"identity\":\"54714280-022b-4742-97ec-2037d3644584\",\"added_by\":\"auto\",\"created_at\":\"2024-07-25 13:08:25\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2218407,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767562/v1/62df0301-6e8f-4ddc-95af-beca9269785e.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Potential anti-osteoclastic and anti-inflammatory effects of metformin-encapsulated hyaluronic acid-decorated niosome nanoparticles: possible application for effective treatment of rheumatoid arthritis\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eRheumatoid arthritis often referred to as RA is a term condition known for causing inflammation, in the joints and affecting the whole body (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). This condition can result in damage leading to health challenges (\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). The development of RA involves a combination of factors, asymptomatic autoimmunity and the progression to visible symptoms over time (\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). Managing RA is a faceted process that heavily relies on medication particularly during the early stages of the illness (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e). There has been discussion about using therapies that target signaling pathways like ERK in cells related to RA treatment (\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e). Beyond pain and swelling individuals with arthritis may experience a wide range of symptoms due to extra articular manifestations that impact various organs such as the skin, lungs, heart, eyes and nervous system. For example patients with RA may develop nodules on their skin or experience lung complications like lung disease as part of this conditions effects, beyond the joints (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). Additionally, lung involvement, including interstitial lung disease, is a common extra-articular manifestation of rheumatoid arthritis (\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). Furthermore bone marrow edema has been recognized as a predictor of advancement, in RA on X rays linked to the severity of inflammation, joint damage and clinical indicators (\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). Moreover the presence of fatigue has been observed as a prevalent and taxing symptom in RA patients among those with inflammatory conditions (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). Detecting RA in early stages is essential for treatment results and prognosis. Several studies have explored approaches such as proteomic analysis, mass spectrometry and innovative biomarkers to refine the accuracy of RA diagnosis (\\u003cspan additionalcitationids=\\\"CR12\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). Various genes involve in RA, for instance, RANKL, which stands for Receptor activator of NF-κB ligand, is a crucial molecule involved in various physiological processes. It is known to play a significant role in bone homeostasis and the formation of lymphoid tissues (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e shows the signaling pathways through which RANKL induces osteoclastogenesis by affecting the NF-κB and MAPKs pathways. Research has shown that rheumatoid arthritis is associated with an increased risk of diabetes (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eType 2 Diabetes Mellitus (T2DM) is a metabolic disorder characterized by blood sugar levels due to insulin resistance and inadequate insulin production (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). T2DM stands as a leading cause of mortality and health issues (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). In T2DM, a fasting blood sugar level equal to or greater than 7.0 mmol/l or requiring medication is indicative (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). This progressive epidemic accounts for than 90% of all diabetes instances (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). Individuals with T2DM face an escalated risk of complications, like heart disease and irregular heart rhythms (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e). Furthermore Type 2 diabetes is linked with lipid levels changes, in how the body processes lipids and heart related conditions (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e). actors that increase the risk of developing Type 2 diabetes consist of lack of activity unhealthy eating patterns and socio economic standing (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). Both rheumatoid arthritis (RA) and type 2 diabetes mellitus (T2DM) are long term conditions that can impact the body in ways. There are various treatment options for both RA (like methotrexate (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e), rituximab (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e)) and T2DM (including SGLT2 inhibitors like empagliflozin (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e), natural compounds like curcumin (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e)). These drugs could cause side effects for normal cells or have solubility and absorption limitations One innovative solution to these challenges is the use of nanodrug delivery systems (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e). Different types of these systems including nanoparticles, lipid based systems and polymer nanoparticles have been created to overcome these limitations (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). These delivery systems are valued for being safe, compatible with the body, and reliable in drug delivery applications (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). Nanoparticles (NPs) play a crucial role in improving how drugs move through the body reducing side effects and enhancing drug delivery to specific areas affected by disease (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). They can be administered into the body through methods like injections, skin application, oral ingestion, or through inhalation with promising results in drug delivery effectiveness (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e). Researchers have explored types of nanoparticles like liposomes, niosomes, polymeric particles, micelles, dendrimers, silica particles, magnetic particles, and gold nanoparticles as potential carriers, for delivering drugs effectively (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e). Among them noisomes offer a range of advantages including high stability, ease of preparation, and relatively low cost of surfactants, making them attractive for various applications (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). Niosomes have been found to reduce systemic toxicity by encapsulating treatment agents, leading to slow drug release and minimizing clearance from the body (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e). These vesicles are considered novel carriers that can enhance the solubility and stability of various pharmaceutical compounds (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eTo enhance the effects of niosomes, which are non-ionic surfactant vesicles like liposomes, various strategies can be employed based on existing research. One approach to improve niosome efficacy is through the modification of their composition, size, and type, which can influence drug penetration and delivery (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e). Additionally, the use of smart nanocarriers, such as enzyme-responsive nanomaterials, can further enhance controlled drug delivery by incorporating stimuli-responsive elements into the niosome structure (36). Moreover, targeted drug delivery using nanomaterial-based vehicles has shown promise in chronic disease therapy (\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e). Researchers are looking to enhance the effectiveness of drug delivery by customizing niosomes with ligands that target organs or tissues. One approach involves using glutathione targeted PEGylated liposomes to deliver drugs to organs, like the retina, which could lead to treatment outcomes (\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e). Hyaluronic acid (HA) has gained attention in treating arthritis (RA) because of its biodegradability, compatibility with the body and lack of triggering responses (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e). Studies indicate that HA can target CD44 receptors found in inflamed joints on activated macrophages suggesting its potential as an option for RA (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). Moreover HA has been incorporated into formulations, including HA coated nanoparticles designed for drug delivery and therapy, in RA (\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn this study, we investigated the potential of HA-coated niosomes for targeted delivery of metformin to PBMCs derived from both RA and T2DM patients. Our study aimed to explore whether HA-coated niosomes could serve as an effective carrier system for developing targeted cellular therapies for these chronic inflammatory conditions and T2DM.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eResearch participants\\u003c/h2\\u003e \\u003cp\\u003e The research plan received approval, from the Institutional Ethics Committee at the College of Medicine, University of Karbala / Karbala \\u0026ndash; Iraq, and consent was obtained from all participants. Blood samples were taken from a group consisting of 47 healthy control group, 39 rheumatoid arthritis patients, and 36 rheumatoid arthritis patients with T2DM who attended the Orthopedics Outpatient Department at the Faculty of Medicine, Karbala University of Medical Sciences located in Karbala, Iraq. The diagnosis of arthritis was made based on the European League Against Rheumatism (EULAR) 2010 classification criteria. Detailed clinical and demographic information for participants detailed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The exclusion criteria for participants encompassed individuals who were smokers, alcoholics, or afflicted with chronic diseases, as well as those undergoing treatment with NSAIDs, DMARDs, or steroids.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eDemographical and clinical data of healthy controls and rheumatoid arthritis patients.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHealthy Controls\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eRA Patients\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eRA Patients\\u003c/p\\u003e \\u003cp\\u003eWith T2DM\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSex (M/F)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e22/25\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e17/22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e17/19\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e46.91\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.321\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e46.34\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.341\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e48.24\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.739\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBody mass index (BMI)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e23.245\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.72\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e27.56\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.714\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e24.288\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.417\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eErythrocyte sedimentation rate (ESR, mm/h)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e14.17\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.84\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e51.37\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;13.46\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e52.82\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;12.65\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e28-Joint count disease activity score (DAS28)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5.14\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.24\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e5.53\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.37\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHbA1c ( %)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5.31\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.68\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5.52\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.64\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e11.80\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.81\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFasting glucose\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e96.98\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.80\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e106.92\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e331.30\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;108.84\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIsolation and culture of peripheral blood mononuclear cells\\u003c/h2\\u003e \\u003cp\\u003ePeripheral blood mononuclear cells (PBMCs) were separated using Histopaque 1077 density gradients (Sigma, Germany) by centrifugation (1500rpm, 5 min). The cells were washed three times with phosphate buffered saline (PBS, pH 7.4) centrifuged, and resuspended in RPMI1640 medium containing 10% bovine serum (FBS, Biochrom, UK) 10 U/mL of penicillin (Sigma, Germany) and 10 \\u0026micro;g/ml of streptomycin (Sigma, Germany), at a concentration of 1 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e cells/ml. These cells were incubated at 37\\u0026deg;C with 5% CO₂ until they reached a confluency of 90% following which they were used in experimental procedures.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFabrication of niosomal NPs\\u003c/h2\\u003e \\u003cp\\u003eThe fabrication of niosome NPs was conducted using the thin-film hydration method. Initially, a mixture of cholesterol (6 mg) and Span 60 (36 mg) dissolved in Methanol (6 ml) and Chloroform (3 ml) and subjected to a rotary evaporator at 55\\u0026ndash;60 \\u003csup\\u003e◦\\u003c/sup\\u003eC and 0.46 atm for 1 hour to form a lipid film and remove solvents. Subsequently, the film was hydrated with 10 ml of PBS (pH 7.4) under similar conditions for another hour. Ultrasonication for 30 minutes at 24 \\u003csup\\u003e◦\\u003c/sup\\u003eC was employed to reduce the size of the fabricated niosomal NPs. For the fabrication of metformin-loaded niosomal NPs (Nio-met NPs), metformin (1.65 mg) was added to the initial mixture. To obtain hyaluronic acid-coated niosomal NPs (Hyalo-Nio NPs) and metformin-loaded hyaluronic acid-coated niosomal NPs (Hyalo-Nio-met NPs), a solution containing 0.1% (w/v) hyaluronic acid in normal saline was gradually added to blank niosomal NPs and Nio-met NPs while stirring, followed by an hour of stirring at ambient temperature to facilitate NP reforming and hyaluronic acid coating.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCharacterization of niosomal NPs\\u003c/h2\\u003e \\u003cp\\u003eSpectral analysis of the compounds before and after nanoparticle fabrication was studied using an FT-IR spectrophotometer (Shimadzu 8400 S, Kyoto, Japan) in the spectral region of 4000\\u0026thinsp;\\u0026minus;\\u0026thinsp;400 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e, with a spectra resolution of 4 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e. The size, polydispersity index (PDI), and zeta potential of the fabricated niosomal nanoparticles were analyzed using the Zeta sizer dynamic light scattering system (ZS 90, Malvern Instruments Ltd., Malvern, UK). The surface morphological properties of the fabricated niosomal nanoparticles examined using scanning electron microscopy (SEM, MIRA3, TESCAN, Czech) and atomic force microscopy (AFM, Nanowizard II; JPK instruments; Germany).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRelease Kinetics of metformin from Niosomal NPs\\u003c/h2\\u003e \\u003cp\\u003eTo assess the in-vitro drug release characteristics of Hyalo-Nio-met NPs and Nio-met NPs, the dialysis method was utilized as follows: Initially, 5 mL of nanoparticles were introduced into a dialysis membrane tube (12 kDa) and stirred magnetically at 120 rpm in PBS (pH\\u0026thinsp;=\\u0026thinsp;7.4) while incubating at 37\\u0026deg;C. At predetermined intervals, 2 mL of the immersion solution was exchanged with an equal volume of fresh PBS, and the absorbance of the released metformin was measured at 234 nm (the maximum wavelength of metformin) using ultraviolet spectrophotometry (PerkinElmer, Fremont, CA, USA). The process allowed for the monitoring of metformin release kinetics from the niosomal nanoparticles over time, providing insights into their controlled drug release behavior.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of PBMCs proliferation\\u003c/h2\\u003e \\u003cp\\u003eTo study the effects of metformin, on PBMCs viability an MTT reduction test performed using concentrations of pure metformin (0, 5, 10, 15, 20, and 25 mM) Nio-met NPs (0, 5, 10, 15, 20, and 25 mM), and Hyalo-Nio-met NPs (0, 5, 10, 15, 20, and 25 mM). Initially 1 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e PBMCs were seeded in each well of a 96 well plate and incubated for 24 hours. Subsequently the cells were exposed to treatment substances for 48 hours. After 48 hours' treatment substances were substituted with a MTT solution (Sigma, Germany) and kept in dark conditions at the 37\\u0026deg;C for 4 hours. Following this incubation period, the MTT solution was removed from each well and replaced with DMSO (Merck, Germany). Finally, the optical density of the wells was measured at 570 nm using the EL \\u0026times; 800 Microplate Absorbance Reader (Bio-Tek Instruments), and the proliferation values for pure metformin, Nio-met NPs, and Hyalo-Nio-met NPs were determined using GraphPad Prism software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEvaluation of Reactive Oxygen Species in PBMCs\\u003c/h2\\u003e \\u003cp\\u003eReactive Oxygen Species (ROS) in the isolated PBMCs were determined spectrofluorimetricaly using 2',7'dichlorofluorescein diacetate (DCFH-DA, Sigma, Germany). The treated and untreated PBMCs were washed with PBS and incubated with 30 \\u0026micro;M of DCFH-DA at 37\\u0026deg;C in the dark condition. After 30 min were washed and resuspended in PBS and analyzed using a flow cytometer (ACSCalibur, BD Biosciences, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDetermination of interleukin-23, transforming growth factor beta, and catalase status\\u003c/h2\\u003e \\u003cp\\u003ePBMCs were seeded in a 6-well plate (5 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well) and allowed to adhere for 24 hours at 37\\u0026deg;C with 5% CO₂. After attachment, the PBMCs were exposed to metformin, Nio-met NPs, and Hyalo-Nio-met NPs for 48 hours at 37\\u0026deg;C with 5% CO₂, while a control group of cells remained untreated. The assays were performed according to methods outlined in the manufacturer\\u0026rsquo;s instructions. Subsequently, the levels of interlukin-23 (IL-23) and transforming growth factor beta (TGF-β) in both treated and untreated PBMCs were quantified using an enzyme immunoassay with the human ELISA Kit (Sino Biological Inc., Beijing, China). Catalase (CAT) activity was assessed according to the method of Aebi which is based on the decomposition of H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e by CAT. Enzyme activity was expressed as the first order kinetic constant (K) of the rate of disappearance of H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 15 s as measured by decrease in absorbance at 240 nm. Results were expressed as U/mg (\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eReal-time PCR\\u003c/h2\\u003e \\u003cp\\u003e For the cDNA synthesis, 0.5 \\u0026micro;g of total RNA was utilized in the reverse transcription process, employing the Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Fermentas) as per the manufacturer's guidelines. The mRNA expression levels of cytokines were quantified using the Rotor-Gene TM 6000 (Corbett). Real-time PCR (RT-PCR) assays were conducted in a 25 \\u0026micro;l reaction mixture, comprising 2 \\u0026micro;l of the synthesized cDNA, 12.5 \\u0026micro;l of 2x Rotor-Gene Probe PCR Master Mix (Qiagen, Germany), 500 nM of each primer, and 250 nM of the TaqMan-probe (FAM, TAMRA). The volume was adjusted to 25 \\u0026micro;l with DNase/RNase-free water. The amplification protocol consisted of an initial heating phase (10 min at 94\\u0026deg;C), followed by denaturation (94\\u0026deg;C for 15 s) and annealing/extension (60\\u0026deg;C for 60 s). Cytokine mRNA expressions were standardized to GAPDH (a housekeeping gene), and the relative quantification was determined utilizing the 2-ΔΔCt approach. The sequences of the oligonucleotides for cyclooxygenase 2 (COX-2), NFATc1, RANKL, and GAPDH primers are detailed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe forward and reverse primers sequences used for real-time PCR reactions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGenes\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eNFATc1\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGGCCATCCTCTCCAACACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTTCTTCCTCCCGATGTCCGTCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eRANKL\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTTTTATTACCTGTATGCCAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTGCTTATTATTCAAGGCATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eCOX-2\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTCCTCTATATCATCTCGCTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTCTATTGGCAGAACGACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eGAPDH\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTTCCAGGAGCGAGATCCCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCTGTTGCTGTAGCCAAATTCGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results and discussion\",\"content\":\"\\u003cp\\u003eStudies have revealed that metformin\\u0026rsquo;s antidiabetic role, by suppressing hepatic glucose production (\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e). Metformin is widely prescribed for type 2 diabetes as it effectively controls blood sugar levels and provides cardioprotective protection (\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e). Moreover studies suggest that metformin can help manage metabolism and potentially treat conditions like RA by regulating metabolism (\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e). Enhancing the effects of metformin using NPs for drug delivery shows promise by optimizing controlled release improving drug targeting and reducing effects (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThese carriers enhance drug penetration into tissues, specificity and drug availability making them ideal for targeted delivery (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e). Nanocarriers also allow drug release, boosting treatment effectiveness (\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e). iosomes, a type of ionic surfactant vesicles, have garnered attention in the pharmaceutical industry due to their ability to encapsulate both hydrophilic and hydrophobic agents (\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e). These synthetic vesicles, formed by self-assembly of nonionic surfactants, cholesterol, and some other lipids, offer benefits like breakdown in the body and compatibility with living tissue (\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e). Researchers have utilized these nanoparticles in various applications, including transdermal drug delivery (\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e), gene delivery (\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e), and targeted drug delivery to immune-privileged tissues (\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e). Scientists have investigated methods to enhance nano carriers, for drug delivery purposes. For example, the development of folic acid-modified nano-drug carriers has shown promise in the targeted delivery of specific drugs (\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e). Various characteristics affects the properties of the NPs. The size of nanoparticles plays a crucial role in their uptake and retention by cells and tissues (\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e). For intravenously administered nanoparticles, diameter is a key factor affecting pharmacokinetics and bio-distribution pores in blood vessels (\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e). The size of nanoparticles influences their ability to overcome transport barriers in biological tissues, affecting their tissue penetration efficacy (\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e). Additionally, nanoparticle size impacts their biological activity, with factors like concentration and size playing primary roles (\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e). The DLS analysis showed that the blank niosome NPs had an average diameter of 151\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.2 nm (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). However, encapsulation of metformin inside these NPs causes an increase in their average diameter to 168\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.2 nm. The highest diameter among those fabricated belongs to Hyalo-Nio-met NPs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e) with 179\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.5 nm, due to coating with hyaluronic acid and encapsulation of metformin inside these NPs.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe zeta potential of nanoparticles is a critical parameter for characterizing their surface charge properties. It is determined by the presence of charged ions at the NPs surface and in the surrounding solution (\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e). Zeta potential plays a key role in expressing the stability of nanoparticles in suspension by influencing the electrostatic repulsion between particles, thus preventing aggregation (\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e). Zeta potential values between \\u0026minus;\\u0026thinsp;30 mV and +\\u0026thinsp;30 mV are generally considered ideal for achieving better physical stability of nanoparticles (\\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e). Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e lists the obtained zeta potential values for blank niosomes, Nio-met, and Hyalo-Nio-met nanoparticles.\\u003c/p\\u003e \\u003cp\\u003ePDI is recognized as another key factor in assessing the stability and functionality of NPs for drug delivery applications (\\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e). PDI significantly influences various aspects of nanoparticles, including their stability, drug release kinetics, cellular uptake, and biodistribution (\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e). Maintaining a low PDI (\\u0026lt;\\u0026thinsp;0.4) is crucial to achieve a narrow size distribution, which is essential for effective tissue accumulation and renal clearance (\\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e). The reproducibility and quality of nanoparticles are greatly affected by PDI, as it indicates the width of the particle size distribution and the uniformity of the nanoparticles (\\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e66\\u003c/span\\u003e). Additionally, measuring PDI is vital for evaluating the colloidal properties of nanoparticles, especially in understanding their ability to penetrate biological barriers (\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e). Particularly in pharmaceutical applications, the size uniformity of nanoparticles is crucial to ensure consistent performance and efficacy (\\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e). According to the DLS results listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, the blank niosome, Nio-met, and Hyalo-Nio-met NPs are all within the acceptable range in terms of size, zeta potential, and PDI values.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe evaluated size, zeta potential, and PDI values of blank niosome, Nio-met, and Hyalo-Nio-met NPs using DLS.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGroups\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSize (nm)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003ePolydispersity Index\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eZeta potential (mV)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBlank niosome\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e151\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.2\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.426\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e\\u0026minus;13.47\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.8\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNio-met\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e168\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.2\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.453\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e\\u0026minus;15.21\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.9\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHyalo-Nio-met\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e179\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.5\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.663\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e\\u0026minus;9.76\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.4\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe interaction of nanoparticles with biological systems is controlled by various factors, including size, shape, and surface properties (\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e). The shape of nanoparticles has been shown to have significant effects on their interactions with biological materials such as cells and tissues (\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e). The morphology of NPs can impact their biological activities, such as cell membrane penetration, wetting, and interactions with proteins (\\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e). Furthermore, the morphology of biologically synthesized nanoparticles can influence their toxicity, mechanism of action, and applications as antibacterial and antifungal agents (\\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e demonstrates the SEM images of fabricated blank niosome, Nio-met, and Hyalo-Nio-met NPs. All these nanoparticles show a spherical morphology, with the only difference between them being their size. The AFM images of nanoparticles are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, and these images are consistent with previous DLS results.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFTIR is an effective analytical method used for detecting functional chemical groups and characterizing covalent bonding information. The characteristic peaks in the Span 60 spectrum appeared at 3389, 2916, and 1736 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e, corresponding to OH stretching, carbonyl dimer, and C\\u0026thinsp;=\\u0026thinsp;O stretching, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). For cholesterol, a notable peak at 3435 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e indicated OH stretching. In the blank niosomes' spectrum, the OH stretching peak from Span 60 was seen at 3388 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e, while the carbonyl dimer shifted to 2918 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e and the C\\u0026thinsp;=\\u0026thinsp;O stretching peak shifted to 1737 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e. These shifts in the carbonyl groups' peaks suggest hydrogen bonding between Span and cholesterol, indicative of niosome formation. In the spectrum of drug-loaded niosomes, significant peaks were observed at 3370, 2920, and 1738 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e, likely representing OH stretching, carbonyl dimer, and C\\u0026thinsp;=\\u0026thinsp;O stretching. These shifts are similar to those seen in blank niosomes and point to interactions that facilitate niosomal formation (\\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e). The FTIR spectrum of cholesterol exhibited a broad band at 3432 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e, indicating OH stretching vibration. Symmetric and asymmetric stretching vibrations in CH2 groups of alkyl chains were observed at 2989 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e and 2882 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e, respectively. A strong band at 1716 cm\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e was attributed to the double bond in the second ring of the cholesterol structure (76).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eDrug release patterns play a key role in the effectiveness of drug therapy. V Different controlled release systems have been created to improve the therapeutic performance of drugs (\\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e77\\u003c/span\\u003e). Factors, like particle size, surface properties and the porous structure of nanoparticles all affect how drugs are released from nanoparticles (\\u003cspan additionalcitationids=\\\"CR79\\\" citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e). It's highly desirable for drugs to be released steadily from nanoparticles for medical purposes (\\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e81\\u003c/span\\u003e). Niosomes, which are composed of biodegradable and non-immunogenic components, can carry both amphiphilic and lipophilic drugs, making them appealing for drug delivery (\\u003cspan citationid=\\\"CR82\\\" class=\\\"CitationRef\\\"\\u003e82\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e83\\u003c/span\\u003e). Niosomes are praised for their ability to offer an controlled release of drugs because of their characteristics (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e shows the 120 hours' release pattern of metformin from the Nio-met, and Hyalo-Nio-met NPs at 37\\u0026deg;C and pH 7.4. Both Nio-met, and Hyalo-Nio-met NPs shows biphasic release pattern. The maximum release rates reached 42% and 47% within the first 12 hours of the experiment, followed by a subsequent decrease. This initial high release is attributed to the drug being weakly bound to the surface of the niosomal nanoparticles rather than being encapsulated inside them.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eMTT is a widely used method for assessing cytotoxicity, viability, and proliferation studies in cell biology (\\u003cspan citationid=\\\"CR84\\\" class=\\\"CitationRef\\\"\\u003e84\\u003c/span\\u003e). This is based on the ability of mitochondrial enzymes in viable cells to reduce the MTT yellow tetrazolium salt to purple formazan crystals (\\u003cspan citationid=\\\"CR85\\\" class=\\\"CitationRef\\\"\\u003e85\\u003c/span\\u003e). The effect of metformin, Nio-met, and Hyalo-Nio-met NPs on PBMCs are illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e. The Hyalo-Nio-met composed of Span 60, cholesterol, metformin, and hyaluronic acid. Hyaluronic acid and cholesterol are both natural components find in human body and studies confirmed their safety to normal cells (\\u003cspan citationid=\\\"CR86\\\" class=\\\"CitationRef\\\"\\u003e86\\u003c/span\\u003e). As illustrated in the Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e, metformin, Nio-met, and Hyalo-Nio-met NPs exhibit a negligible and insignificant proliferation effect on PBMCs at concentrations of 5 mM. As previously described, niosomal NPs can enhance treatment effectiveness by increasing the solubility and bioavailability of drugs. Additionally, the decoration of hyaluronic acid on their surface facilitates the localization of drug into the PBMCs, thereby enhancing the likelihood of cellular uptake and therapeutic impact. The highly significant result (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.1 *) is observed in the Hyalo-Nio-met treated group at a 15 mM concentration. Based on these findings, 15 mM of metformin, Nio-met NPs, and Hyalo-Nio-met NPs have been selected for use in the subsequent experiments of this study.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eReactive Oxygen Species (ROS) are highly reactive molecules that can be generated in cells through both enzymatic and non-enzymatic mechanisms (\\u003cspan citationid=\\\"CR87\\\" class=\\\"CitationRef\\\"\\u003e87\\u003c/span\\u003e). These molecules have the ability to interact with active substances, organic compounds, and environmental pollutants, outside the cell (\\u003cspan citationid=\\\"CR88\\\" class=\\\"CitationRef\\\"\\u003e88\\u003c/span\\u003e). Elevated levels of ROS can cause stress, a factor associated with aging and the onset of human illnesses (\\u003cspan citationid=\\\"CR89\\\" class=\\\"CitationRef\\\"\\u003e89\\u003c/span\\u003e). Oxidative stress happens when there is an imbalance, between ROS and antioxidants, leading to tissue damage and the chronicity of diseases (\\u003cspan citationid=\\\"CR90\\\" class=\\\"CitationRef\\\"\\u003e90\\u003c/span\\u003e). Furthermore, ROS has been linked to the progression and severity of RA, affecting joint tissue injury (\\u003cspan citationid=\\\"CR91\\\" class=\\\"CitationRef\\\"\\u003e91\\u003c/span\\u003e). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e illustrates the ROS level of untreated and treated PBMCs. The treatment of PBMCs with metformin in free form could successfully reduce the ROS level in these cells. The Nio-met treated group showed increased reduction compared to the free form of metformin and eventually, the highest reduction belonged to Hyalo-Nio-met treated group. These results can be interpreted by the role of niosomes in increasing drug solubility and bioavailability, as well as the role of hyaluronic acid in placing these nanoparticles in the vicinity of cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eIL 23 is a cytokine plays an essential role in different inflammatory and autoimmune conditions. Research indicates that IL 23 can activate shared receptors structurally to induce inflammatory responses (\\u003cspan citationid=\\\"CR92\\\" class=\\\"CitationRef\\\"\\u003e92\\u003c/span\\u003e). It is also recognized as a factor in the development of RA (\\u003cspan citationid=\\\"CR93\\\" class=\\\"CitationRef\\\"\\u003e93\\u003c/span\\u003e). In RA there is an increased presence of M1 macrophages that produce levels of IL 23 highlighting its involvement in inflammation (\\u003cspan citationid=\\\"CR94\\\" class=\\\"CitationRef\\\"\\u003e94\\u003c/span\\u003e). Studies have shown elevated levels of IL 23 in the blood of RA patients closely linked to disease activity (\\u003cspan citationid=\\\"CR93\\\" class=\\\"CitationRef\\\"\\u003e93\\u003c/span\\u003e). TGF beta serves as a regulator in cellular functions like proliferation, differentiation, migration, cell survival, angiogenesis and immunesurveillance (\\u003cspan citationid=\\\"CR95\\\" class=\\\"CitationRef\\\"\\u003e95\\u003c/span\\u003e). The TGF beta signaling pathway plays a key role in cancer development and progression by influencing interactions, within the tumor microenvironment (\\u003cspan citationid=\\\"CR96\\\" class=\\\"CitationRef\\\"\\u003e96\\u003c/span\\u003e). TGF-β contributes to increased production of extracellular matrix components and mesenchymal cell activities post inflammatory responses (\\u003cspan citationid=\\\"CR97\\\" class=\\\"CitationRef\\\"\\u003e97\\u003c/span\\u003e). It regulates fibroblast function, influences inflammatory responses, and modulates tissue repair processes (\\u003cspan citationid=\\\"CR98\\\" class=\\\"CitationRef\\\"\\u003e98\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR99\\\" class=\\\"CitationRef\\\"\\u003e99\\u003c/span\\u003e). The IL-23 and TGF-β levels in PBMCs are illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e. These results show a decrease in IL-23 level and an increase in TGF-β level in treated cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eCatalase is a tetrameric enzyme that plays a crucial role in protecting aerobic cells from oxidative stress by catalyzing the decomposition of hydrogen peroxide into water and oxygen (\\u003cspan citationid=\\\"CR100\\\" class=\\\"CitationRef\\\"\\u003e100\\u003c/span\\u003e). Various research studies have explored the significance of catalase in RA and its potential as a treatment target. They discovered catalase activity in the blood plasma of RA patients compared to those who're healthy hinting at a possible imbalance in antioxidant defenses (\\u003cspan citationid=\\\"CR101\\\" class=\\\"CitationRef\\\"\\u003e101\\u003c/span\\u003e). likewise there have been observations of reduced catalase activity among individuals with RA indicating a connection, between stress and the development of RA (\\u003cspan citationid=\\\"CR102\\\" class=\\\"CitationRef\\\"\\u003e102\\u003c/span\\u003e). Table\\u0026nbsp;\\u003cspan refid=\\\"Tab4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e listed the catalase level in PBMCs isolated from healthy individuals, RA patients, and RA patients with T2DM. Generally, the treated PBMCs demonstrated higher level of catalase compared to untreated group. The highest increase in catalase level belongs to the Hyalo-Nio-met NPs treated group.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab4\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 4\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eCatalase level in PBMCs isolated from healthy individuals, RA patients, and RA patients with T2DM\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCatalase level (U/mg protein)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eUntreated\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eMetformin\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eNio-met\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eHyalo-Nio-met\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eHealthy\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e75\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e81\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e99\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e87\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eRheumatoid Arthritis\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e43\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e64\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e93\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e109\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eRheumatoid Arthritis\\u0026thinsp;+\\u0026thinsp;T2DM\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e28\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e62\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e85\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\"\\u0026plusmn;\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e117\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe expression of various genes plays a role in RA, so the expression of some of these genes was investigated by real-time PCR. The NFATc1 gene, encoding the nuclear factor of activated T-cells c1, plays a crucial role in various biological processes, particularly in bone homeostasis and cancer. It is essential for osteoclast differentiation (\\u003cspan additionalcitationids=\\\"CR104\\\" citationid=\\\"CR103\\\" class=\\\"CitationRef\\\"\\u003e103\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR105\\\" class=\\\"CitationRef\\\"\\u003e105\\u003c/span\\u003e). NFATc1 also interacts with other transcription factors like AP-1 and Mitf to stimulate gene expression in osteoclast precursors (\\u003cspan citationid=\\\"CR106\\\" class=\\\"CitationRef\\\"\\u003e106\\u003c/span\\u003e). Studies have shown that NFATc1 expression is increased in synovial osteoclast precursors of RA patients, indicating a potential link to the enhanced osteoclast differentiation observed in RA (\\u003cspan citationid=\\\"CR107\\\" class=\\\"CitationRef\\\"\\u003e107\\u003c/span\\u003e). RANKL, which stands for Receptor activator of NF-κB ligand, is a crucial molecule involved in various physiological processes. It is known to play a significant role in bone homeostasis and the formation of lymphoid tissues (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e). It is encoded by a gene located on chromosome 13q14 and is primarily expressed by osteocytes, activated T-cells, and bone marrow stromal cells (\\u003cspan citationid=\\\"CR108\\\" class=\\\"CitationRef\\\"\\u003e108\\u003c/span\\u003e). This molecule exists in two forms: membrane-bound RANKL (mRANKL) and soluble RANKL (sRANKL) (\\u003cspan citationid=\\\"CR109\\\" class=\\\"CitationRef\\\"\\u003e109\\u003c/span\\u003e). It also plays a crucial role in bone erosion in RA by promoting osteoclast formation, function, and survival (\\u003cspan citationid=\\\"CR110\\\" class=\\\"CitationRef\\\"\\u003e110\\u003c/span\\u003e). Studies have shown that RANKL is highly expressed in synovial fluid B cells of RA patients and is a key cytokine involved in bone destruction (\\u003cspan citationid=\\\"CR111\\\" class=\\\"CitationRef\\\"\\u003e111\\u003c/span\\u003e). Anti-RANKL antibody treatment has been proposed as a strategy to protect against joint destruction in RA (\\u003cspan citationid=\\\"CR112\\\" class=\\\"CitationRef\\\"\\u003e112\\u003c/span\\u003e). COX-2 is an inducible enzyme that is involved in pathophysiological processes such as pain, inflammation, and fever (\\u003cspan citationid=\\\"CR113\\\" class=\\\"CitationRef\\\"\\u003e113\\u003c/span\\u003e). COX-2, expressed in synovial cells of RA patients, plays a crucial role in the inflammatory process within the joints (\\u003cspan citationid=\\\"CR114\\\" class=\\\"CitationRef\\\"\\u003e114\\u003c/span\\u003e). Selective COX-2 inhibitors have emerged as important options in RA treatment due to their efficacy and reduced gastrointestinal toxicity compared to traditional non-selective nonsteroidal anti-inflammatory drugs (\\u003cspan citationid=\\\"CR115\\\" class=\\\"CitationRef\\\"\\u003e115\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR116\\\" class=\\\"CitationRef\\\"\\u003e116\\u003c/span\\u003e). Changes in the expression of NFATc1, RANKL, and COX-2 genes in untreated and treated PBMCs with metformin, Nio-met NPs, and Hyalo-Nio-met NPs are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003e for both RA patients and RA patients with T2DM. In both groups there is no statistically significant change in NFATc1 gene expression following treatment with metformin and Nio-met NPs. In RA patients, there is a significant decrease in RANKL gene expression following treatment with Hyalo-Nio-met NPs same results are repeated in RA patients with T2DM. In RA patients, there is a statistically significant decrease in COX-2 gene expression in treatment with metformin and Nio-met NPs. Treatment with Hyalo-Nio-met NPs resulted in a significant decrease in COX-2 gene expression in this group. In RA patients with T2DM, there is a statistically significant decrease in COX-2 gene expression between treatment with Nio-met NPs and Hyalo-Nio-met NPs. The results revealed that when metformin was exposed to PBMCs the NFATc1, RANKL, and COX-2 expressions were reducing.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThis study highlighted the potential of hyaluronic acid-coated niosomal nanoparticles as an effective drug delivery system for metformin, targeting RA and RA patients with T2DM derived PBMCs. The Hyalo-Nio-met NPs exhibited desirable characteristics, including stability and controlled drug release. The decoration of HA on niosomal NPs enhanced the targeting and therapeutic impact of these NPs. The synthesized Hyalo-Nio-met NPs demonstrated a significant reduction in reactive oxygen species (ROS), pro-inflammatory cytokine IL-23, and osteoclastogenesis-related genes (NFATc1, RANKL, and COX-2) in both RA patients and RA patients with T2DM. This indicates a promising reduction in inflammation and an enhancement of anti-inflammatory and antioxidant defenses. Overall, the Hyalo-Nio-met NPs drug delivery system effectively delivered metformin to PBMCs, showing potential as a novel treatment approach for RA with T2DM by reducing systemic toxicity and improving drug delivery to specific cells. Further research and clinical studies are warranted to validate these findings and explore the full therapeutic potential of this nanodrug delivery system.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eCompeting Interests\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNo potential competing interest was reported by the authors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical Approval and Consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research protocol was evaluated and approved on 02.11.2023 by Medical Research Bioethical Committee, College of Medicine, University of Kerbala / Kerbala \\u0026ndash; Iraq.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInformed consent was obtained from all individual participants included in the study.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of supporting data\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe data that support the findings of this study are available from the corresponding author, upon reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable for the research.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contribution\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWriting - original draft preparation and methodology: Shatha Jassim HatemConceptualization, Supervision: Fadhil Jawad Al-Tu\\u0026apos;ma.Reviewing and editing: Maher Abbood Mukheef\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eBullock, J., Rizvi, S. A., Saleh, A. M., Ahmed, S. S., Do, D. P., Ansari, R. A., et al. (2019). Rheumatoid arthritis: a brief overview of the treatment. \\u003cem\\u003eMedical Principles and Practice\\u003c/em\\u003e, \\u003cem\\u003e27\\u003c/em\\u003e(6), 501\\u0026ndash;507.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTanaka, Y. (2016). Current concepts in the management of rheumatoid arthritis. \\u003cem\\u003eThe Korean Journal of Internal Medicine\\u003c/em\\u003e, \\u003cem\\u003e31\\u003c/em\\u003e(2), 210.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeane, K. D., Norris, J. M., \\u0026amp; Holers, V. M. (2010). Preclinical rheumatoid arthritis: identification, evaluation, and future directions for investigation. \\u003cem\\u003eRheumatic Disease Clinics\\u003c/em\\u003e, \\u003cem\\u003e36\\u003c/em\\u003e(2), 213\\u0026ndash;241.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDariushnejad, H., Chodari, L., Sedighi, M., Akbari, S., \\u0026amp; Ghorbanzadeh, V. (2022). Rheumatoid arthritis: current therapeutics compendium. \\u003cem\\u003eEndocrine Regulations\\u003c/em\\u003e, \\u003cem\\u003e56\\u003c/em\\u003e(2), 148\\u0026ndash;162.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOhori, M. (2008). ERK inhibitors as a potential new therapy for rheumatoid arthritis. \\u003cem\\u003eDrug news \\u0026amp; perspectives\\u003c/em\\u003e, \\u003cem\\u003e21\\u003c/em\\u003e(5), 245\\u0026ndash;250.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSayah, A., \\u0026amp; EnglishIII, J. C. (2005). Rheumatoid arthritis: a review of the cutaneous manifestations. \\u003cem\\u003eJournal of the American Academy of Dermatology\\u003c/em\\u003e, \\u003cem\\u003e53\\u003c/em\\u003e(2), 191\\u0026ndash;209.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShaw, M., Collins, B. F., Ho, L. A., \\u0026amp; Raghu, G. (2015). Rheumatoid arthritis-associated lung disease. \\u003cem\\u003eEuropean Respiratory Review\\u003c/em\\u003e, \\u003cem\\u003e24\\u003c/em\\u003e(135), 1\\u0026ndash;16.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEsposito, A. J., Chu, S. G., Madan, R., Doyle, T. J., \\u0026amp; Dellaripa, P. F. (2019). Thoracic manifestations of rheumatoid arthritis. \\u003cem\\u003eClinics in chest medicine\\u003c/em\\u003e, \\u003cem\\u003e40\\u003c/em\\u003e(3), 545\\u0026ndash;560.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSudoł-Szopińska, I., Kontny, E., Maśliński, W., Prochorec-Sobieszek, M., Warczyńska, A., \\u0026amp; Kwiatkowska, B. (2013). Significance of bone marrow edema in pathogenesis of rheumatoid arthritis. \\u003cem\\u003ePolish journal of radiology\\u003c/em\\u003e, \\u003cem\\u003e78\\u003c/em\\u003e(1), 57.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBasu, N., Jones, G. T., Macfarlane, G. J., \\u0026amp; Druce, K. L. (2017). Identification and validation of clinically relevant clusters of severe fatigue in rheumatoid arthritis. \\u003cem\\u003ePsychosomatic medicine\\u003c/em\\u003e, \\u003cem\\u003e79\\u003c/em\\u003e(9), 1051\\u0026ndash;1058.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMun, S., Lee, J., Park, A., Kim, H-J., Lee, Y-J., Son, H., et al. (2019). Proteomics approach for the discovery of rheumatoid arthritis biomarkers using mass spectrometry. \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, \\u003cem\\u003e20\\u003c/em\\u003e(18), 4368.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBalakrishnan, L., Bhattacharjee, M., Ahmad, S., Nirujogi, R. S., Renuse, S., Subbannayya, Y., et al. (2014). Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients. \\u003cem\\u003eClinical proteomics\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e, 1\\u0026ndash;14.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSpasovski, D., Latifi, A., Osmani, B., Krstevska-Balkanov, S., Kafedizska, I., Slaninka-Micevska, M. (2013). Determination of the diagnostic values of asymmetric dimethylarginine as an indicator for evaluation of the endothelial dysfunction in patients with rheumatoid arthritis. Arthritis. ;2013.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMueller, C. G., \\u0026amp; Hess, E. (2012). Emerging functions of RANKL in lymphoid tissues. \\u003cem\\u003eFrontiers in immunology\\u003c/em\\u003e, \\u003cem\\u003e3\\u003c/em\\u003e, 261.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTian, Z., Mclaughlin, J., Verma, A., Chinoy, H., \\u0026amp; Heald, A. H. (2021). The relationship between rheumatoid arthritis and diabetes mellitus: a systematic review and meta-analysis. \\u003cem\\u003eCardiovascular endocrinology \\u0026amp; metabolism\\u003c/em\\u003e, \\u003cem\\u003e10\\u003c/em\\u003e(2), 125\\u0026ndash;131.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin, S., Naseri, T., Linhart, C., Morrell, S., Taylor, R., McGarvey, S., et al. (2017). Trends in diabetes and obesity in Samoa over 35 years, 1978\\u0026ndash;2013. \\u003cem\\u003eDiabetic Medicine\\u003c/em\\u003e, \\u003cem\\u003e34\\u003c/em\\u003e(5), 654\\u0026ndash;661.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBirabwa, C., Bwambale, M. F., Waiswa, P., \\u0026amp; Mayega, R. W. (2019). Quality and barriers of outpatient diabetes care in rural health facilities in Uganda\\u0026ndash;a mixed methods study. \\u003cem\\u003eBMC Health Services Research\\u003c/em\\u003e, \\u003cem\\u003e19\\u003c/em\\u003e, 1\\u0026ndash;10.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAhmed, S. F., Shabayek, M. I., Abdel Ghany, M. E., El-Hefnawy, M. H., \\u0026amp; El-Mesallamy, H. O. (2018). Role of CTRP3, CTRP9 and MCP-1 for the evaluation of T2DM associated coronary artery disease in Egyptian postmenopausal females. \\u003cem\\u003ePLoS One\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(12), e0208038.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFarmaki, P., Damaskos, C., Garmpis, N., Garmpi, A., Savvanis, S., \\u0026amp; Diamantis, E. (2020). Complications of the type 2 diabetes mellitus. \\u003cem\\u003eCurrent cardiology reviews\\u003c/em\\u003e, \\u003cem\\u003e16\\u003c/em\\u003e(4), 249\\u0026ndash;251.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePelin, A. M., Gavat, C. C., Balan, G., Popescu, E., \\u0026amp; Georgescu, C. V. (2017). Particularities of Statin Therapy in Diabetic Patients. \\u003cem\\u003eRevista de Chimie\\u003c/em\\u003e, \\u003cem\\u003e68\\u003c/em\\u003e(4), 720\\u0026ndash;725.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGudjinu, H. Y., \\u0026amp; Sarfo, B. (2017). Risk factors for type 2 diabetes mellitus among out-patients in Ho, the Volta regional capital of Ghana: a case\\u0026ndash;control study. \\u003cem\\u003eBMC research notes\\u003c/em\\u003e, \\u003cem\\u003e10\\u003c/em\\u003e, 1\\u0026ndash;10.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLovell, D. J., Ruperto, N., Goodman, S., Reiff, A., Jung, L., Jarosova, K., et al. (2008). Adalimumab with or without methotrexate in juvenile rheumatoid arthritis. \\u003cem\\u003eNew England Journal of Medicine\\u003c/em\\u003e, \\u003cem\\u003e359\\u003c/em\\u003e(8), 810\\u0026ndash;820.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBagust, A., Boland, A., Hockenhull, J., Fleeman, N., Greenhalgh, J., Dundar, Y., et al. (2009). Rituximab for the treatment of rheumatoid arthritis. \\u003cem\\u003eHealth Technology Assessment\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(Suppl 2), 23\\u0026ndash;29.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLehrke, M., \\u0026amp; Marx, N. (2017). Diabetes mellitus and heart failure. \\u003cem\\u003eThe American journal of cardiology\\u003c/em\\u003e, \\u003cem\\u003e120\\u003c/em\\u003e(1), S37\\u0026ndash;S47.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePivari, F., Mingione, A., Brasacchio, C., \\u0026amp; Soldati, L. (2019). Curcumin and type 2 diabetes mellitus: prevention and treatment. \\u003cem\\u003eNutrients\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(8), 1837.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGong, Z., Peng, S., Cao, J., Tan, H., Zhao, H., \\u0026amp; Bai, J. (2024). Advances in the variations and biomedical applications of stimuli-responsive nanodrug delivery systems. \\u003cem\\u003eNanotechnology\\u003c/em\\u003e, \\u003cem\\u003e35\\u003c/em\\u003e(13), 132001.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuang, Y., Cole, S. P., Cai, T., \\u0026amp; Cai, Y. (2016). Applications of nanoparticle drug delivery systems for the reversal of multidrug resistance in cancer. \\u003cem\\u003eOncology letters\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(1), 11\\u0026ndash;15.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMcMillan, J., Batrakova, E., \\u0026amp; Gendelman, H. E. (2011). Cell delivery of therapeutic nanoparticles. \\u003cem\\u003eProgress in molecular biology and translational science\\u003c/em\\u003e, \\u003cem\\u003e104\\u003c/em\\u003e, 563\\u0026ndash;601.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOnoue, S., Yamada, S., \\u0026amp; Chan, H-K. (2014). Nanodrugs: pharmacokinetics and safety. \\u003cem\\u003eInternational journal of nanomedicine\\u003c/em\\u003e. :1025\\u0026ndash;1037.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCheng, Y., Samia, A. C., Li, J., Kenney, M. E., Resnick, A., \\u0026amp; Burda, C. (2010). Delivery and efficacy of a cancer drug as a function of the bond to the gold nanoparticle surface. \\u003cem\\u003eLangmuir\\u003c/em\\u003e, \\u003cem\\u003e26\\u003c/em\\u003e(4), 2248\\u0026ndash;2255.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJadid, M. F. S., Jafari-Gharabaghlou, D., Bahrami, M. K., Bonabi, E., \\u0026amp; Zarghami, N. (2023). Enhanced anti-cancer effect of curcumin loaded-niosomal nanoparticles in combination with heat-killed Saccharomyces cerevisiae against human colon cancer cells. \\u003cem\\u003eJournal of Drug Delivery Science and Technology\\u003c/em\\u003e, \\u003cem\\u003e80\\u003c/em\\u003e, 104167.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMandal, S., Banerjee, C., Ghosh, S., Kuchlyan, J., \\u0026amp; Sarkar, N. (2013). Modulation of the photophysical properties of curcumin in nonionic surfactant (Tween-20) forming micelles and niosomes: a comparative study of different microenvironments. \\u003cem\\u003eThe Journal of Physical Chemistry B\\u003c/em\\u003e, \\u003cem\\u003e117\\u003c/em\\u003e(23), 6957\\u0026ndash;6968.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLo, C. T., Jahn, A., Locascio, L. E., \\u0026amp; Vreeland, W. N. (2010). Controlled self-assembly of monodisperse niosomes by microfluidic hydrodynamic focusing. \\u003cem\\u003eLangmuir\\u003c/em\\u003e, \\u003cem\\u003e26\\u003c/em\\u003e(11), 8559\\u0026ndash;8566.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGharbavi, M., Amani, J., Kheiri-Manjili, H., Danafar, H., \\u0026amp; Sharafi, A. (2018). Niosome: a promising nanocarrier for natural drug delivery through blood-brain barrier. Advances in pharmacological sciences. ;2018.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChoi, M., \\u0026amp; Maibach, H. (2005). Liposomes and niosomes as topical drug delivery systems. \\u003cem\\u003eSkin pharmacology and physiology\\u003c/em\\u003e, \\u003cem\\u003e18\\u003c/em\\u003e(5), 209\\u0026ndash;219.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu, Q., Katti, P. S., \\u0026amp; Gu, Z. (2014). Enzyme-responsive nanomaterials for controlled drug delivery. \\u003cem\\u003eNanoscale\\u003c/em\\u003e, \\u003cem\\u003e6\\u003c/em\\u003e(21), 12273\\u0026ndash;12286.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSingh, A. P., Biswas, A., Shukla, A., \\u0026amp; Maiti, P. (2019). Targeted therapy in chronic diseases using nanomaterial-based drug delivery vehicles. \\u003cem\\u003eSignal transduction and targeted therapy\\u003c/em\\u003e, \\u003cem\\u003e4\\u003c/em\\u003e(1), 33.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVighi, E., Trifunović, D., Veiga-Crespo, P., Rentsch, A., Hoffmann, D., Sahaboglu, A. (2018). Combination of cGMP analogue and drug delivery system provides functional protection in hereditary retinal degeneration. Proceedings of the National Academy of Sciences. ;115(13):E2997-E3006.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, C., Liu, R., Song, Y., Chen, Y., Zhu, D., Yu, L., et al. (2022). Hyaluronic acid hydrogels hybridized with au-triptolide nanoparticles for intraarticular targeted multi-therapy of rheumatoid arthritis. \\u003cem\\u003eFrontiers in Pharmacology\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e, 849101.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, J., Chen, L., She, Z., Zeng, F., \\u0026amp; Wu, S. (2024). A multifunctional nanoaggregate-based system for detection of rheumatoid arthritis via Optoacoustic/NIR‐II fluorescent imaging and therapy via inhibiting JAK‐STAT/NF‐κB/NLRP3 pathways. \\u003cem\\u003eAggregate\\u003c/em\\u003e, \\u003cem\\u003e5\\u003c/em\\u003e(1), e419.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, Z., Yang, J., Yang, Y., Pu, X., Zhao, J., \\u0026amp; Zhang, N. (2020). Targeted and combined TPCA-1-gold nanocage therapy for in vivo treatment of inflammatory arthritis. \\u003cem\\u003eAn Official Journal Of The American Association Of Pharmaceutical Scientists\\u003c/em\\u003e, \\u003cem\\u003e21\\u003c/em\\u003e, 1\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu, C., Li, X., Hou, Y., Meng, X., Wang, D., Liu, J., et al. (2019). Hyaluronic acid coated acid-sensitive nanoparticles for targeted therapy of adjuvant-induced arthritis in rats. \\u003cem\\u003eMolecules\\u003c/em\\u003e, \\u003cem\\u003e24\\u003c/em\\u003e(1), 146.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, C., Liu, R., Song, Y., Zhu, D., Yu, L., Huang, Q. (2021). Intra-articular Administrated Hydrogels of Hyaluronic Acid Hybridized with Triptolide/Gold Nanoparticles for Targeted Delivery to Rheumatoid Arthritis Combined with Photothermal-chemo Therapy. \\u003cem\\u003eRes Sq\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEl-barbary, A. M., Khalek, M. A. A., Elsalawy, A. M., \\u0026amp; Hazaa, S. M. (2011). Assessment of lipid peroxidation and antioxidant status in rheumatoid arthritis and osteoarthritis patients. \\u003cem\\u003eThe Egyptian Rheumatologist\\u003c/em\\u003e, \\u003cem\\u003e33\\u003c/em\\u003e(4), 179\\u0026ndash;185.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eForetz, M., Guigas, B., \\u0026amp; Viollet, B. (2019). Understanding the glucoregulatory mechanisms of metformin in type 2 diabetes mellitus. \\u003cem\\u003eNature Reviews Endocrinology\\u003c/em\\u003e, \\u003cem\\u003e15\\u003c/em\\u003e(10), 569\\u0026ndash;589.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang, L-L., \\u0026amp; Liu, L. (2020). Effect of metformin on stem cells: Molecular mechanism and clinical prospect. \\u003cem\\u003eWorld journal of stem cells\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(12), 1455.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTran, S., DeGiovanni, P-J., Piel, B., \\u0026amp; Rai, P. (2017). Cancer nanomedicine: a review of recent success in drug delivery. \\u003cem\\u003eClinical and translational medicine\\u003c/em\\u003e, \\u003cem\\u003e6\\u003c/em\\u003e, 1\\u0026ndash;21.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUpadhyay, S., Ganguly, K., \\u0026amp; Palmberg, L. (2015). Wonders of nanotechnology in the treatment for chronic lung diseases. \\u003cem\\u003eJournal of Nanomedicine \\u0026amp; Nanotechnology\\u003c/em\\u003e, \\u003cem\\u003e6\\u003c/em\\u003e(6), 1.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXiao, S., Tong, C., Liu, X., Yu, D., Liu, Q., Xue, C., et al. (2006). Preparation of folate-conjugated starch nanoparticles and its application to tumor-targeted drug delivery vector. \\u003cem\\u003eChinese science bulletin\\u003c/em\\u003e, \\u003cem\\u003e51\\u003c/em\\u003e, 1693\\u0026ndash;1697.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGe, X., Wei, M., He, S., \\u0026amp; Yuan, W-E. (2019). Advances of non-ionic surfactant vesicles (niosomes) and their application in drug delivery. \\u003cem\\u003ePharmaceutics\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(2), 55.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAg Seleci, D., Seleci, M., Walter, J-G., Stahl, F., \\u0026amp; Scheper, T. (2016). Niosomes as nanoparticular drug carriers: fundamentals and recent applications. Journal of nanomaterials. ;2016.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlnaim, A. S., Shah, H., Nair, A. B., Mewada, V., Patel, S., Jacob, S., et al. (2023). Qbd-based approach to optimize niosomal gel of levosulpiride for transdermal drug delivery. \\u003cem\\u003eGels\\u003c/em\\u003e, \\u003cem\\u003e9\\u003c/em\\u003e(3), 213.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl Qtaish, N., Gallego, I., Villate-Beitia, I., Sainz-Ramos, M., L\\u0026oacute;pez-M\\u0026eacute;ndez, T. B., Grijalvo, S., et al. (2020). Niosome-based approach for in situ gene delivery to retina and brain cortex as immune-privileged tissues. \\u003cem\\u003ePharmaceutics\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(3), 198.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHaddadian, A., Robattorki, F. F., Dibah, H., Soheili, A., Ghanbarzadeh, E., Sartipnia, N., et al. (2022). Niosomes-loaded selenium nanoparticles as a new approach for enhanced antibacterial, anti-biofilm, and anticancer activities. \\u003cem\\u003eScientific reports\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(1), 21938.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJing, F., Li, G., Wang, Y., Zhu, S., Liu, R., He, J., et al. (2021). Synthesis and characterization of folic acid-modified carboxymethyl chitosan‐ursolic acid targeted nano‐drug carrier for the delivery of ursolic acid and 10‐hydroxycamptothecin. \\u003cem\\u003ePolymers for Advanced Technologies\\u003c/em\\u003e, \\u003cem\\u003e32\\u003c/em\\u003e(1), 343\\u0026ndash;354.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJain, P. K., Lee, K. S., El-Sayed, I. H., \\u0026amp; El-Sayed, M. A. (2006). Calculated absorption and scattering properties of gold nanoparticles of different size, shape, and composition: applications in biological imaging and biomedicine. \\u003cem\\u003eThe journal of physical chemistry B\\u003c/em\\u003e, \\u003cem\\u003e110\\u003c/em\\u003e(14), 7238\\u0026ndash;7248.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlbanese, A., Tang, P. S., \\u0026amp; Chan, W. C. (2012). The effect of nanoparticle size, shape, and surface chemistry on biological systems. \\u003cem\\u003eAnnual review of biomedical engineering\\u003c/em\\u003e, \\u003cem\\u003e14\\u003c/em\\u003e, 1\\u0026ndash;16.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIslam, M. A., Barua, S., \\u0026amp; Barua, D. (2017). A multiscale modeling study of particle size effects on the tissue penetration efficacy of drug-delivery nanoparticles. \\u003cem\\u003eBMC systems biology\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e, 1\\u0026ndash;13.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChurilov, D., Churilov, G., Polischuk, S., Churilova, V., \\u0026amp; Byshova, D. (Eds.). (2020). Influence of the size of nanostructured metals on changes in the functional state of the cell and biological activity. E3S Web of Conferences; : EDP Sciences.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eInam, W., Bhadane, R., Akpolat, R. N., Taiseer, R. A., Filippov, S. K., Salo-Ahen, O. M., et al. (2022). Interactions between polymeric nanoparticles and different buffers as investigated by zeta potential measurements and molecular dynamics simulations. \\u003cem\\u003eView\\u003c/em\\u003e, \\u003cem\\u003e3\\u003c/em\\u003e(4), 20210009.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee, J-S., Kim, G-H., \\u0026amp; Lee, H. G. (2010). Characteristics and antioxidant activity of Elsholtzia splendens extract-loaded nanoparticles. \\u003cem\\u003eJournal of Agricultural and Food Chemistry\\u003c/em\\u003e, \\u003cem\\u003e58\\u003c/em\\u003e(6), 3316\\u0026ndash;3321.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGu, M., Luan, J., Song, K., Qiu, C., Zhang, X., \\u0026amp; Zhang, M. (2021). Development of paclitaxel loaded pegylated gelatin targeted nanoparticles for improved treatment efficacy in non-small cell lung cancer (NSCLC): an in vitro and in vivo evaluation study. \\u003cem\\u003eActa Biochimica Polonica\\u003c/em\\u003e, \\u003cem\\u003e68\\u003c/em\\u003e(4), 583\\u0026ndash;591.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilhelm Romero, K., Quir\\u0026oacute;s, M. I., Vargas Huertas, F., Vega-Baudrit, J. R., Navarro-Hoyos, M., \\u0026amp; Araya-Sibaja, A. M. (2021). Design of Hybrid Polymeric-Lipid Nanoparticles Using Curcumin as a Model: Preparation, Characterization, and In Vitro Evaluation of Demethoxycurcumin and Bisdemethoxycurcumin-Loaded Nanoparticles. \\u003cem\\u003ePolymers\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(23), 4207.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMato, E., Puras, G., Bell, O., Agirre, M., Hern\\u0026aacute;ndez, R., Igartua, M., et al. (2015). Selective antitumoral effect of sorafenib loaded PLGA nanoparticles conjugated with cetuximab on undifferentiated/anaplastic thyroid carcinoma cells. \\u003cem\\u003eJ Nanomed Nanotechnol\\u003c/em\\u003e, \\u003cem\\u003e6\\u003c/em\\u003e(281), 2.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu, B., Pan, C., Sun, Y., Hou, Z., Ye, H., Hu, B., et al. (2008). Optimization of fabrication parameters to produce chitosan\\u0026thinsp;\\u0026ndash;\\u0026thinsp;tripolyphosphate nanoparticles for delivery of tea catechins. \\u003cem\\u003eJournal of agricultural and food chemistry\\u003c/em\\u003e, \\u003cem\\u003e56\\u003c/em\\u003e(16), 7451\\u0026ndash;7458.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRostamkalaei, S. S., Akbari, J., Saeedi, M., Morteza-Semnani, K., \\u0026amp; Nokhodchi, A. (2019). Topical gel of Metformin solid lipid nanoparticles: A hopeful promise as a dermal delivery system. \\u003cem\\u003eColloids and Surfaces B: Biointerfaces\\u003c/em\\u003e, \\u003cem\\u003e175\\u003c/em\\u003e, 150\\u0026ndash;157.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMd, S., Alhakamy, N. A., Neamatallah, T., Alshehri, S., Mujtaba, M. A., Riadi, Y., et al. (2021). Development, characterization, and evaluation of α-Mangostin-loaded polymeric nanoparticle gel for topical therapy in skin Cancer. \\u003cem\\u003eGels\\u003c/em\\u003e, \\u003cem\\u003e7\\u003c/em\\u003e(4), 230.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKawamura, J., Kitamura, H., Otake, Y., Fuse, S., \\u0026amp; Nakamura, H. (2020). Size-controllable and scalable production of liposomes using a v-shaped mixer micro-flow reactor. \\u003cem\\u003eOrganic Process Research \\u0026amp; Development\\u003c/em\\u003e, \\u003cem\\u003e24\\u003c/em\\u003e(10), 2122\\u0026ndash;2127.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKenry, Yeo, T., Manghnani, P. N., Middha, E., Pan, Y., Chen, H., et al. (2020). Mechanistic understanding of the biological responses to polymeric nanoparticles. \\u003cem\\u003eACS nano\\u003c/em\\u003e, \\u003cem\\u003e14\\u003c/em\\u003e(4), 4509\\u0026ndash;4522.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiebert, T., Kostag, M., Wotschadlo, J., \\u0026amp; Heinze, T. (2011). Stable cellulose nanospheres for cellular uptake. \\u003cem\\u003eMacromolecular bioscience\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(10), 1387\\u0026ndash;1392.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, X., Yu, M., Kim, H., Mameli, M., \\u0026amp; Stellacci, F. (2012). Determination of monolayer-protected gold nanoparticle ligand\\u0026ndash;shell morphology using NMR. \\u003cem\\u003eNature communications\\u003c/em\\u003e, \\u003cem\\u003e3\\u003c/em\\u003e(1), 1182.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGe, C., Tian, J., Zhao, Y., Chen, C., Zhou, R., \\u0026amp; Chai, Z. (2015). Towards understanding of nanoparticle\\u0026ndash;protein corona. \\u003cem\\u003eArchives of toxicology\\u003c/em\\u003e, \\u003cem\\u003e89\\u003c/em\\u003e, 519\\u0026ndash;539.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuilger-Casagrande, M., Germano-Costa, T., Bilesky-Jos\\u0026eacute;, N., Pasquoto-Stigliani, T., Carvalho, L., Fraceto, L. F., et al. (2021). Influence of the capping of biogenic silver nanoparticles on their toxicity and mechanism of action towards Sclerotinia sclerotiorum. \\u003cem\\u003eJournal of Nanobiotechnology\\u003c/em\\u003e, \\u003cem\\u003e19\\u003c/em\\u003e, 1\\u0026ndash;18.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRozhin, A., Batasheva, S., Kruychkova, M., Cherednichenko, Y., Rozhina, E., \\u0026amp; Fakhrullin, R. (2021). Biogenic silver nanoparticles: Synthesis and application as antibacterial and antifungal agents. \\u003cem\\u003eMicromachines\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(12), 1480.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZaid Alkilani, A., Hamed, R., Abdo, H., Swellmeen, L., Basheer, H. A., Wahdan, W., et al. (2022). Formulation and evaluation of azithromycin-loaded niosomal gel: optimization, in vitro studies, rheological characterization, and cytotoxicity study. \\u003cem\\u003eACS omega\\u003c/em\\u003e, \\u003cem\\u003e7\\u003c/em\\u003e(44), 39782\\u0026ndash;39793.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHanafy, N. A., Sheashaa, R. F., Moussa, E. A., \\u0026amp; Mahfouz, M. E. (2023). Potential of curcumin and niacin-loaded targeted chitosan coated liposomes to activate autophagy in hepatocellular carcinoma cells: An in vitro evaluation in HePG2 cell line. \\u003cem\\u003eInternational journal of biological macromolecules\\u003c/em\\u003e, \\u003cem\\u003e245\\u003c/em\\u003e, 125572.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUhrich, K. E., Cannizzaro, S. M., Langer, R. S., \\u0026amp; Shakesheff, K. M. (1999). Polymeric systems for controlled drug release. \\u003cem\\u003eChemical reviews\\u003c/em\\u003e, \\u003cem\\u003e99\\u003c/em\\u003e(11), 3181\\u0026ndash;3198.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWays, M., Ng, T. M., Lau, K. W., \\u0026amp; Khutoryanskiy, W. M. (2020). Silica nanoparticles in transmucosal drug delivery. \\u003cem\\u003ePharmaceutics\\u003c/em\\u003e, \\u003cem\\u003e12\\u003c/em\\u003e(8), 751.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOdeniyi, M. A., Omoteso, O. A., Adepoju, A. O., \\u0026amp; Jaiyeoba, K. T. (2018). Starch nanoparticles in drug delivery: A review. \\u003cem\\u003ePolim W Med\\u003c/em\\u003e, \\u003cem\\u003e48\\u003c/em\\u003e, 41\\u0026ndash;45.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSlowing, I. I., Trewyn, B. G., Giri, S., \\u0026amp; Lin, V. Y. (2007). Mesoporous silica nanoparticles for drug delivery and biosensing applications. \\u003cem\\u003eAdvanced Functional Materials\\u003c/em\\u003e, \\u003cem\\u003e17\\u003c/em\\u003e(8), 1225\\u0026ndash;1236.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJavaid, S., Ahmad, N. M., Mahmood, A., Nasir, H., Iqbal, M., Ahmad, N., et al. (2021). Cefotaxime loaded polycaprolactone based polymeric nanoparticles with antifouling properties for in-vitro drug release applications. \\u003cem\\u003ePolymers\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(13), 2180.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHazira, R. M. N., \\u0026amp; Reddy, M. S. (2023). Niosomes: A nanocarrier drug delivery system. \\u003cem\\u003eGSC Biological and Pharmaceutical Sciences\\u003c/em\\u003e, \\u003cem\\u003e22\\u003c/em\\u003e(2), 120\\u0026ndash;127.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRao, N. N., Chowdary, P., Divya, Y., Laksmi, T., Latha, K., \\u0026amp; Sirisha, P. (2018). Niosomes: a vesicular drug delivery system. \\u003cem\\u003eResearch Journal of Pharmacy and Technology\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(8), 3731\\u0026ndash;3736.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, T-T., Wang, S-K., Huang, G-L., \\u0026amp; Sun, G-J. (2012). Luteolin induced-growth inhibition and apoptosis of human esophageal squamous carcinoma cell line Eca109 cells in vitro. \\u003cem\\u003eAsian Pacific journal of cancer prevention\\u003c/em\\u003e, \\u003cem\\u003e13\\u003c/em\\u003e(11), 5455\\u0026ndash;5461.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHirsch, G. E., Parisi, M. M., Martins, L. A., Andrade, C. M., Barb\\u0026eacute;-Tuana, F. M., \\u0026amp; Guma, F. T. (2015). γ‐oryzanol reduces caveolin‐1 and PCGEM1 expression, markers of aggressiveness in prostate cancer cell lines. \\u003cem\\u003eThe Prostate\\u003c/em\\u003e, \\u003cem\\u003e75\\u003c/em\\u003e(8), 783\\u0026ndash;797.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, X., Wei, Z., Feng, H., Chen, H., Xie, J., Huang, Y., et al. (2022). Targeting Effect of Betulinic Acid Liposome Modified by Hyaluronic Acid on Hepatoma Cells In Vitro. \\u003cem\\u003eJournal of Pharmaceutical Sciences\\u003c/em\\u003e, \\u003cem\\u003e111\\u003c/em\\u003e(11), 3047\\u0026ndash;3053.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVillaverde, A. I. S. B., Netherton, J., \\u0026amp; Baker, M. A. (2019). From past to present: The link between reactive oxygen species in sperm and male infertility. \\u003cem\\u003eAntioxidants\\u003c/em\\u003e, \\u003cem\\u003e8\\u003c/em\\u003e(12), 616.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, H., Wan, K., \\u0026amp; Shi, X. (2019). Recent advances in nanozyme research. \\u003cem\\u003eAdvanced materials\\u003c/em\\u003e, \\u003cem\\u003e31\\u003c/em\\u003e(45), 1805368.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIkeda, Y., Taniguchi, K., Nagase, N., Tsuji, A., Kitagishi, Y., \\u0026amp; Matsuda, S. (2021). Reactive oxygen species may influence on the crossroads of stemness, senescence, and carcinogenesis in a cell via the roles of APRO family proteins. \\u003cem\\u003eExploration of Medicine\\u003c/em\\u003e, \\u003cem\\u003e2\\u003c/em\\u003e(5), 443\\u0026ndash;454.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMateen, S., Moin, S., Khan, A. Q., Zafar, A., \\u0026amp; Fatima, N. (2016). Increased reactive oxygen species formation and oxidative stress in rheumatoid arthritis. \\u003cem\\u003ePloS one\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e(4), e0152925.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhai, K., Duan, H., Khan, G. J., Xu, H., Han, F., Cao, W., et al. (2018). Salicin from Alangium chinense ameliorates rheumatoid arthritis by modulating the Nrf2-HO-1-ROS pathways. \\u003cem\\u003eJournal of Agricultural and Food Chemistry\\u003c/em\\u003e, \\u003cem\\u003e66\\u003c/em\\u003e(24), 6073\\u0026ndash;6082.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBloch, Y., Bouchareychas, L., Merceron, R., Składanowska, K., Van den Bossche, L., Detry, S., et al. (2018). Structural activation of pro-inflammatory human cytokine IL-23 by cognate IL-23 receptor enables recruitment of the shared receptor IL-12Rβ1. \\u003cem\\u003eImmunity\\u003c/em\\u003e, \\u003cem\\u003e48\\u003c/em\\u003e(1), 45\\u0026ndash;58. e6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl Sheikh, M. M., El-shafey, A. M., Gawish, H. H., \\u0026amp; ROLE OF INTERLEUKIN-23 AS A MARKER OF DISEASE ACTIVITY IN RHEUMATOID ARTHRITIS PATIENTS. (2018). \\u003cem\\u003eZagazig University Medical Journal\\u003c/em\\u003e. ;24(5):404\\u0026ndash;408.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, J., Yang, P., Wu, Q., Li, H., Ding, Y., Hsu, H. C., et al. (2013). Death receptor 5\\u0026ndash;targeted depletion of interleukin-23\\u0026ndash;producing macrophages, Th17, and Th1/17 associated with defective tyrosine phosphatase in mice and patients with rheumatoid arthritis. \\u003cem\\u003eArthritis \\u0026amp; Rheumatism\\u003c/em\\u003e, \\u003cem\\u003e65\\u003c/em\\u003e(10), 2594\\u0026ndash;2605.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eElliott, R. L., \\u0026amp; Blobe, G. C. (2005). Role of transforming growth factor Beta in human cancer. \\u003cem\\u003eJournal of clinical oncology\\u003c/em\\u003e, \\u003cem\\u003e23\\u003c/em\\u003e(9), 2078\\u0026ndash;2093.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStover, D. G., Bierie, B., \\u0026amp; Moses, H. L. (2007). A delicate balance: TGF-β and the tumor microenvironment. \\u003cem\\u003eJournal of cellular biochemistry\\u003c/em\\u003e, \\u003cem\\u003e101\\u003c/em\\u003e(4), 851\\u0026ndash;861.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePohlers, D., Brenmoehl, J., L\\u0026ouml;ffler, I., M\\u0026uuml;ller, C. K., Leipner, C., Schultze-Mosgau, S. (2009). TGF-β and fibrosis in different organs\\u0026mdash;molecular pathway imprints. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. ;1792(8):746\\u0026ndash;756.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBira, Y., Tani, K., Nishioka, Y., Miyata, J., Sato, K., Hayashi, A., et al. (2005). Transforming growth factor β stimulates rheumatoid synovial fibroblasts via the type II receptor. \\u003cem\\u003eModern rheumatology\\u003c/em\\u003e, \\u003cem\\u003e15\\u003c/em\\u003e, 108\\u0026ndash;113.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCheon, H., Yu, S-J., Yoo, D., Chae, I., Song, G., \\u0026amp; Sohn, J. (2002). Increased expression of pro-inflammatory cytokines and metalloproteinase-1 by TGF-β 1 in synovial fibroblasts from rheumatoid arthritis and normal individuals. \\u003cem\\u003eClinical \\u0026amp; Experimental Immunology\\u003c/em\\u003e, \\u003cem\\u003e127\\u003c/em\\u003e(3), 547\\u0026ndash;552.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChakravarti, R., Gupta, K., Majors, A., Ruple, L., Aronica, M., \\u0026amp; Stuehr, D. J. (2015). Novel insights in mammalian catalase heme maturation: effect of NO and thioredoxin-1. \\u003cem\\u003eFree Radical Biology and Medicine\\u003c/em\\u003e, \\u003cem\\u003e82\\u003c/em\\u003e, 105\\u0026ndash;113.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKamanlı, A., Nazıroğlu, M., Aydılek, N., \\u0026amp; Hacıevlıyagil, C. (2004). Plasma lipid peroxidation and antioxidant levels in patients with rheumatoid arthritis. \\u003cem\\u003eCell biochemistry and function\\u003c/em\\u003e, \\u003cem\\u003e22\\u003c/em\\u003e(1), 53\\u0026ndash;57.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSurapneni, K. M., \\u0026amp; Chandrasada Gopan, V. (2008). Lipid peroxidation and antioxidant status in patients with rheumatoid arthritis. \\u003cem\\u003eIndian Journal of Clinical Biochemistry\\u003c/em\\u003e, \\u003cem\\u003e23\\u003c/em\\u003e, 41\\u0026ndash;44.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAsagiri, M., Sato, K., Usami, T., Ochi, S., Nishina, H., Yoshida, H., et al. (2005). Autoamplification of NFATc1 expression determines its essential role in bone homeostasis. \\u003cem\\u003eThe Journal of experimental medicine\\u003c/em\\u003e, \\u003cem\\u003e202\\u003c/em\\u003e(9), 1261\\u0026ndash;1269.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSong, I., Kim, J. H., Kim, K., Jin, H. M., Youn, B. U., \\u0026amp; Kim, N. (2009). Regulatory mechanism of NFATc1 in RANKL-induced osteoclast activation. \\u003cem\\u003eFEBS letters\\u003c/em\\u003e, \\u003cem\\u003e583\\u003c/em\\u003e(14), 2435\\u0026ndash;2440.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCharles, J. F., Coury, F., Sulyanto, R., Sitara, D., Wu, J., Brady, N., et al. (2012). The collection of NFATc1-dependent transcripts in the osteoclast includes numerous genes non-essential to physiologic bone resorption. \\u003cem\\u003eBone\\u003c/em\\u003e, \\u003cem\\u003e51\\u003c/em\\u003e(5), 902\\u0026ndash;912.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePang, M., Rodr\\u0026iacute;guez-Gonzalez, M., Hernandez, M., Recinos, C. C., Seldeen, K. L., \\u0026amp; Troen, B. R. (2019). AP‐1 and Mitf interact with NFATc1 to stimulate cathepsin K promoter activity in osteoclast precursors. \\u003cem\\u003eJournal of cellular biochemistry\\u003c/em\\u003e, \\u003cem\\u003e120\\u003c/em\\u003e(8), 12382\\u0026ndash;12392.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePark-Min, K-H., Lim, E., Lee, M. J., Park, S. H., Giannopoulou, E., Yarilina, A., et al. (2014). Inhibition of osteoclastogenesis and inflammatory bone resorption by targeting BET proteins and epigenetic regulation. \\u003cem\\u003eNature communications\\u003c/em\\u003e, \\u003cem\\u003e5\\u003c/em\\u003e(1), 5418.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePanagiotidis, I., Christoulas, D., \\u0026amp; Terpos, E. (2016). Inhibition of receptor activator of nuclear factor kappa-B ligand pathway for the management of aggressive osteosarcoma. \\u003cem\\u003eAnnals of Translational Medicine\\u003c/em\\u003e. ;4(24).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTaubman, M. A., Kawai, T., \\u0026amp; Han, X. (2007). \\u003cem\\u003eThe new concept of periodontal disease pathogenesis requires new and novel therapeutic strategies\\u003c/em\\u003e (pp. 367\\u0026ndash;369). Wiley Online Library.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFeng, X., Shi, Y., Xu, L., Peng, Q., Wang, F., Wang, X., et al. (2016). Modulation of IL-6 induced RANKL expression in arthritic synovium by a transcription factor SOX5. \\u003cem\\u003eScientific reports\\u003c/em\\u003e, \\u003cem\\u003e6\\u003c/em\\u003e(1), 32001.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOta, Y., Niiro, H., Ota, S., Ueki, N., Tsuzuki, H., Nakayama, T., et al. (2016). Generation mechanism of RANKL\\u0026thinsp;+\\u0026thinsp;effector memory B cells: relevance to the pathogenesis of rheumatoid arthritis. \\u003cem\\u003eArthritis research \\u0026amp; therapy\\u003c/em\\u003e, \\u003cem\\u003e18\\u003c/em\\u003e, 1\\u0026ndash;10.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMorita, T., Shima, Y., Fujimoto, K., Tsuboi, H., Saeki, Y., Narazaki, M., et al. (2019). Anti-receptor activator of nuclear factor κB ligand antibody treatment increases osteoclastogenesis-promoting IL-8 in patients with rheumatoid arthritis. \\u003cem\\u003eInternational Immunology\\u003c/em\\u003e, \\u003cem\\u003e31\\u003c/em\\u003e(5), 277\\u0026ndash;285.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCottrell, J., \\u0026amp; O\\u0026rsquo;Connor, J. P. (2010). Effect of non-steroidal anti-inflammatory drugs on bone healing. \\u003cem\\u003ePharmaceuticals\\u003c/em\\u003e, \\u003cem\\u003e3\\u003c/em\\u003e(5), 1668\\u0026ndash;1693.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKawai, S. (1998). Cyclooxygenase selectivity and the risk of gastro-intestinal complications of various non-steroidal anti-inflammatory drugs: a clinical consideration. \\u003cem\\u003eInflammation Research\\u003c/em\\u003e, \\u003cem\\u003e47\\u003c/em\\u003e, 102\\u0026ndash;106.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSundy, J. S. (2001). COX-2 inhibitors in rheumatoid arthritis. \\u003cem\\u003eCurrent Rheumatology Reports\\u003c/em\\u003e, \\u003cem\\u003e3\\u003c/em\\u003e(1), 86\\u0026ndash;91.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLazzaroni, M., \\u0026amp; Bianchi Porro, G. (2004). Gastrointestinal side-effects of traditional non‐steroidal anti‐inflammatory drugs and new formulations. \\u003cem\\u003eAlimentary pharmacology \\u0026amp; therapeutics\\u003c/em\\u003e, \\u003cem\\u003e20\\u003c/em\\u003e, 48\\u0026ndash;58.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Rheumatoid arthritis, Type 2 Diabetes Mellitus, Metformin, Niosomal NPs, Targeted therapy\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4767562/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4767562/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eNanodrug delivery systems offer promising solutions to the limitations of conventional treatments for rheumatoid arthritis (RA) and type 2 Diabetes Mellitus (T2DM). Among nanoparticles, niosomes are particularly effective due to their stability, ease of preparation, and ability to reduce systemic toxicity. They provide controlled drug release and enhance the solubility and stability of pharmaceutical compounds. Incorporating hyaluronic acid (HA) into niosomes can further enhance their efficacy by targeting specific cells, improving drug delivery, and increasing therapeutic impact. In this study, metformin, a common T2DM medication, was effectively delivered using HA-coated niosomes, to demonstrate the potential of this approach in treating RA patients with T2DM.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003ePeripheral blood mononuclear cells (PBMCs) were extracted from blood samples of RA patients, RA patients with T2DM, and healthy individuals. Metformin-loaded niosomal nanoparticles (Nio-met NPs) were synthesized using the thin-film hydration method and modified into Hyalo-Nio-met NPs by adding hyaluronic acid. The drug release pattern of metformin was studied, and these NPs were characterized using Dynamic Light Scattering (DLS), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), and Fourier Transform Infrared Spectroscopy (FT-IR). Factors like reactive oxygen species (ROS), interleukin-23 (IL-23), nuclear factor of activated T-cells cytoplasmic 1 (NFATc1), receptor activator of nuclear factor kappa-Β ligand (RANKL), and cyclooxygenase-2 (COX-2) were assessed in both treated and untreated PBMCs.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eThe synthesized Hyalo-Nio-met NPs exhibited a spherical morphology with sizes of 179\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.5 nm, a polydispersity index (PDI) of 0.663, and a zeta potential of -9.76\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.4 mV. FT-IR analysis confirmed the effective encapsulation of metformin within the Hyalo-Nio-met NPs. Approximately 68% of the loaded metformin was released from the Hyalo-niosomal NPs after 120 hours. Treatment with Hyalo-Nio-met NPs led to a significant reduction in reactive oxygen species (ROS) level and decreased activity of pro-inflammatory cytokine (IL-23) and inflammation-related genes (NFATc1, RANKL, and COX-2).\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eTaken together the Hyalo-Nio-met NPs drug delivery system was acceptable in terms of characteristics and effectively delivery of metformin to the vicinity of PBMCs. The treatment demonstrated a notable reduction in inflammatory markers and an enhancement of anti-inflammatory and antioxidant defenses in the PBMCs from both RA patients and RA patients with T2DM.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Potential anti-osteoclastic and anti-inflammatory effects of metformin-encapsulated hyaluronic acid-decorated niosome nanoparticles: possible application for effective treatment of rheumatoid arthritis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-07-25 13:00:12\",\"doi\":\"10.21203/rs.3.rs-4767562/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"811c05fd-9cc2-4138-bbbe-e52d6aa3335a\",\"owner\":[],\"postedDate\":\"July 25th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-08-28T10:21:16+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-07-25 13:00:12\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4767562\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4767562\",\"identity\":\"rs-4767562\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}