{"paper_id":"4bd8ef49-03ec-4e48-b200-ebfface9a03d","body_text":"Maternal exposure to PM2.5 impairs behaviors and hippocampal plasticity in association with reduced cysteine levels in adult offspring | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Maternal exposure to PM 2.5 impairs behaviors and hippocampal plasticity in association with reduced cysteine levels in adult offspring Yunxiao Zhong, Ahadullah, Tong Cheng, Julia Macedo Rosa, Yang Yang, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6813049/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Autism spectrum disorder (ASD) is characterized by early-onset challenges in social communication and repetitive behaviors, influenced by both genetic and environmental factors. The global increase in ASD diagnoses has drawn attention to air pollution as a significant environmental risk factor, although the underlying mechanisms remain unclear. This study investigates the impact of maternal exposure to the air pollutant PM 2.5 on ASD risk in offspring. In this study, female C57BL/6J mice were exposed to PM 2.5 via intratracheal instillation every three days for two weeks prior to mating, with exposure continuing until birth. Both male and female offspring exhibited reduced social novelty and increased repetitive behaviors, only male offspring showed significant impairment in working memory. PM 2.5 exposure led to an increased number of proliferating progenitor cells and immature neurons in the hippocampus of male offspring, a change not observed in females. However, PM 2.5 exposure resulted in reduced dendritic length exclusively in female offspring, while both sexes experienced decreased long-term potentiation and synaptic GluN2B protein expression. These structural changes were associated with significantly lower cysteine levels in the hippocampi of offspring of both sexes, but not with changes in relative abundance of gut microbiota and neuroinflammatory response in the hippocampus. These findings suggest that maternal PM 2.5 exposure may induce autism-like behaviors in offspring, potentially linked to reduced hippocampal cysteine levels and hippocampal dysfunction. Animal Science Cognitive Neuroscience PM2.5 maternal exposure ASD-like behavior hippocampus offspring synaptic plasticity metabolites Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Autism spectrum disorder (ASD) is the most common neurodevelopmental disorder. It is characterized by core symptoms that include social behavioral deficits, communication impairments, and repetitive behavior. The prevalence of ASD has increased to approximately 1% of the world population, with a prevalence rate of 1 in 59 for children aged 8 years old in the United States[ 1 ] and a comparable prevalence in China [ 2 ]. The causes of the dramatic increase in the incident rate of ASD are still largely unknown. However, emerging evidence indicates that environmental factors (particularly in utero or during early life), or the interaction between genes and environment can significantly contribute to ASD [ 3 ]. Recent epidemiological studies indicate that chronic pre- and/or postnatal exposure to particulate matter that has a diameter of less than 2.5 µm (PM 2.5 ) may impair neurodevelopment and be linked to ASD development in children [ 4 ]. Systematic reviews have highlighted the role of atmospheric PM exposure in neurodevelopmental disorders, including cognitive decline, attention-deficit/hyperactivity disorder, and ASD [ 5 , 6 ]. A recent meta-analysis and systemic review supports the notion that exposure to PM 2.5 during pregnancy increases risk of ASD in newborns [ 7 ]. Both prenatal and postnatal exposures to PM 2.5 are significantly associated with an increased risk of ASD [ 8 , 9 ], suggesting that PM 2.5 may enhance susceptibility to the disorder. This risk is likely due to the neurotoxic components of PM 2.5 [ 10 ], such as polycyclic aromatic hydrocarbons, metals, organic matter, and elemental carbon, which can alter gene expression, trigger neuroinflammation, and disrupt brain development [ 11 ]. However, mechanisms by which chronic PM 2.5 exposure increases ASD risk is still largely unknown. Chronic exposure to PM 2.5 during pregnancy significantly decreases the number and size of cortical neurons in offspring mice [ 12 ], causing neuronal atrophy in various brain regions, including the hippocampus [ 13 ] which is crucial for learning, memory, and emotional regulation [ 14 , 15 ]. Direct PM 2.5 exposure reduces apical dendritic length in the CA1 region and decreases synaptic vesicle numbers in the hippocampus, thereby impairing synaptic plasticity [ 16 ]. Our previous study has indicated that synaptic impairment in the hippocampus could be linked to cognitive deficits observed in fragile x mice, a commonly studied ASD model caused by single gene mutation [ 17 ]. Hippocampal abnormalities in children [ 18 , 19 ] and adolescents [ 20 , 21 ] with ASD have been widely reported. Changes in gut microbiota could contribute to gastrointestinal disturbances, social impairment, and repetitive behavior in individuals with ASD [ 22 , 23 ]. Epidemiological studies have shown that exposure to PM 2.5 reduces gut microbiota diversity [ 24 ], which could be linked to gastrointestinal diseases [ 25 ]. Notably, PM 2.5 intratracheal instillation during gestation changes the gut microbiota profile in the dams [ 25 ]. Emerging data suggest a connection between ASD and changes in gut microbiota, as well as altered levels of certain microbiota-derived metabolites in blood and urine [ 26 ]. Accumulated data suggest that altered gut microbiota contributes to ASD by influencing the production of neuroactive metabolites. Additionally, maternal gut microbiota has been shown to promote thalamocortical axon formation in the fetus, likely through the modulation of neuronal signaling in the developing brain [ 27 ]. In this study, we investigated whether maternal exposure to PM 2.5 induces autism-like behaviors male and female offspring, and examined its relationship to hippocampal impairments, neuroinflammation, metabolites and changes in gut microbiota. 2. Materials and methods Animals and experimental design All experimental procedures were approved by the Animal Subjects Ethics Sub-Committee of The Hong Kong Polytechnic University and adhered to their guidelines. C57BL/6J mice were provided with standard chow and water ad libitum and maintained in a 12-hour light-dark cycle (lights on at 9 a.m.) in the animal holding facility. To mitigate stress from social isolation, which can impact adult neurogenesis, animals were group-housed as previously described [ 28 ]. After a 2-day acclimation period, two female mice were paired with one male. Pregnancy was confirmed by the presence of seminal plugs. PM 2.5 was dissolved in artificial lung fluid (ALF) to achieve a concentration of 2.5 µg/µl, creating an ALF/PM 2.5 solution. Beginning at 5 weeks of age, female mice received PM 2.5 exposure via intratracheal instillation every 3 days for two weeks, after which they were housed with males for mating. Maternal PM 2.5 exposure continued until parturition. Offspring were weaned at 3 weeks of age and separated by sex into different cages on postnatal day 28 (PND 28). At 5 weeks of age, offspring underwent a series of behavioral tests under dim light conditions during the light cycle to evaluate social abilities, social novelty preference, spatial learning and memory, working memory, locomotor activity, anxiety-like behaviors, and depression-like behaviors. Behavioral assessments were conducted over 7 days, with each test performed on a separate day in the following order: open field test, novel object recognition test, Y-maze test, three-chamber social interaction test, and forced swim test. To evaluate repetitive behavior, a marble burying test was conducted in a new cohort of animals after modeling. From each litter, 1–3 male and female offspring were selected for behavioral testing, 1 male and female offspring in each litter were taken for molecular assays. Behavioral tests A separate cohort of animals was designated for behavioral testing. All mice underwent a 7-day pre-handling period, followed by a two-day habituation phase in which they were exposed to the empty testing apparatus for 15 minutes each day. This pre-handling and habituation protocol is crucial for minimizing stress associated with handling and exposure to novel environments. To further reduce stress, mice were acclimated to the behavioral testing room for 2 hours prior to the commencement of tests each day. Each mouse participated in a series of behavioral assessments, with only one test administered per day to prevent confounding effects from multiple tests [ 29 ]. Three-chambered social interaction test The three-chamber test was utilized to evaluate sociability and social novelty in mice [ 30 ]. The test consisted of three phases: habituation, sociability test, and social novelty test, and was conducted as previously described[ 31 ]. An apparatus box that was separated into three chambers was used (60 × 30 × 30 cm³). During a 5-min habituation period, a test mouse was placed in the middle chamber of the box, and an empty wire enclosure was placed in both the first and third chambers. The test mice were allowed to freely access and explore the three chambers through the doorways. There was a 5-min interval before the next phase started. In the 10-min sociability test, a stimulus mouse was placed in the wire cage in one chamber, while the wire enclosure in the other chamber remained empty. The test mouse was then returned to the middle chamber and allowed to roam around the three chambers freely. Sociability was determined by the preference of the testing mouse for the stimulus mouse or the empty enclosure. Any direct contact or sniffing of the cage was assessed as evidence of direct exploration or touch of an enclosure or social interest in the stimulus mouse. The exploration ratio was calculated as T A /(T A +T B ) for the mouse and T B /(T A +T B ) for the empty enclosure. The exploration ration index was calculated as (T A – T B )/(T A +T B ), where T A = time spent exploring the mouse and T B = time spent exploring the empty enclosure. A 5-min interval was given before the final phase. In the 10-min social novelty test, a new stimulus mouse (novel mouse) was placed in the empty wire enclosure, and the test mouse was allowed to explore the chambers for 10 min. Social novelty recognition memory was assessed by the preference for approaching the novel or the familiar mouse. The exploration ratios for the familiar and novel mouses were calculated as T F /(T F +T N ) and T N /(T F +T N ), respectively. The exploration index was calculated as (T N - T F )/(T N +T F ), where T F = time spent exploring the familiar mouse and T N = time spent exploring the novel mouse. The test was videotaped and analyzed by a well-trained researcher manually in a sample-blinded manner. Novel object recognition test A transparent plastic arena (60 × 40 × 22 cm) was used for the test. A camera was positioned directly above the box to capture the mice's movements throughout the experiment. In the adaptation period, mice were allowed to move freely within the arena for 5 minutes to acclimate to the experimental setup. After After a 5 minutes test interval in the home cage, mice were re-introduced to the arena with two identical objects (object set 1) for 10 minutes. After a 2-hour interval, one of the original objects was replaced with a novel object of similar size but different shape. Mice were then allowed to explore for 5 minutes. The time spent sniffing each object was recorded [ 32 ].The familiar exploration ratio was calculated with the formula: (T F /(T F +T N ) ). The novel exploration ratio was calculated with the formula (T N /(T F +T N )). The exploration index was calculated with the formula: (T N - T F )/(T N +T F ), where T F = time spent exploring the familiar mouse and T N = time spent exploring the novel mouse. Y maze The Y-maze test, designed to assess spatial memory, was conducted in an arena consisting of three symmetrical arms made of gray plastic, each arm having the dimensions of 30 cm x 15 cm X 6 cm. These arms were arranged at 120° angles, with external spatial cues provided in the surrounding room. The test was divided into 2 phases. In phase 1, the mice were allowed to explore for 10 mins with one arm was blocked (Novel arm). Phase 2 was conducted after an interval of 2 hours. In phase 2, the blocked arm was open and the mice were allowed to explore freely for 10 mins. The familiar exploration ratio was calculated with the formula: (T F /(T F +T N ) ). The novel exploration ratio was calculated with the formula (T N /(T F +T N )). The exploration index was calculated with the formula: (T N - T F )/(T N +T F ), where T F = time spent exploring the familiar mouse and T N = time spent exploring the novel mouse[ 33 ]. Open field test (OFT) Each mouse was placed in the center of a square open field arena (50 × 50 × 30 cm), for 5 minutes. The total distance traveled (in meters) and the time spent in the center (in seconds) were recorded and analyzed using the EthoVision XT 10 system (Noldus) [ 31 ]. Forced swim test (FST) A mouse was placed in a cylindrical container (30 cm in height and 15 cm in diameter) filled with water maintained at room temperature (24–25°C) and recorded on video for 6 minutes following established protocols [ 28 ]. An observer, blinded to the treatment conditions, assessed the time the mouse spent immobile during the final 4 minutes of the test. Immobility was defined as the absence of movement except for the minimal actions required to keep the head above water [ 34 ]. This measure was used as an indicator of depression-like behavior. Marble burying test Animals were housed in a standard type II cage (40 cm x 28 cm x 18 cm) with a 5 cm layer of bedding. Twenty identical black marbles were evenly distributed across the bedding. The animals were observed for a duration of one hour. A marble was classified as buried if at least two-thirds of its surface was covered by bedding [ 35 ]. Tissue preparation and immunohistochemistry Offspring mice were deeply anesthetized using a cocktail of ketamine (10 mg/kg) and xylazine (4 mg/kg) and then perfused transcardially with normal saline, followed by 4% paraformaldehyde. The brains were post-fixed overnight at 4°C and subsequently immersed in 30% sucrose until they sank. Coronal sections with 30 µm thickness (1-in-6 series) were cut through the hippocampus, spanning from bregma 23.30 mm to 24.52 mm [ 36 ]. These brain sections were stored in a cryoprotectant solution consisting of 30% glycerol and 30% ethylene glycol in 1x PBS until immunostaining was performed. After washing with 0.01 M PBS, sections were incubated overnight with rabbit anti-Ki67 antibody (1:1000, Abcam), followed by biotinylated goat anti-mouse antibody (1:200, Vector Laboratories). Ki67 staining was visualized using the peroxidase method (ABC system, Vector Laboratories) and diaminobenzidine (DAB) kits (1:200, Vector Laboratories)[ 36 ]. For DCX or NeuroD staining, sections were incubated with rabbit anti-DCX (1:200, Vector Laboratories) or mouse anti-NeuroD (1:200, Vector Laboratories) antibodies, respectively, followed by the same visualization method as described above [ 37 ]. Data quantification of cell proliferation and neurogenesis Cell proliferation, immature neurons, and neuronal differentiation were quantified by counting Ki67, DCX, and NeuroD immunopositive cells, respectively. Total number of Ki67+, DCX+, and NeuroD + cells present in the SGZ of either the dorsal DG (from Bregma 1.34 to 2.54), or the ventral DG (Bregma 2.54 to 3.80) sub-regions were quantified as previously performed [ 38 ].The counts were performed using a Nikon H600L microscope (Nikon, Japan). Sholl analysis Immature neurons were selected based on the following criteria: (1) the neuron must be at least a tertiary immature neuron, possessing three or more dendritic branches; (2) the neuron must extend towards the molecular layer of the DG with intact dendritic branching; (3) the cell body should be located in the subgranular zone of the DG; and (4) neurons can be selected from either the superior or inferior blade of the dentate gyrus. For each brain region, five immature neurons were traced, encompassing three dorsal and three ventral regions, resulting in a total of 30 neurons analyzed [ 39 ]. Neurons were selected under 400x magnification to measure total dendritic length and perform Sholl analysis using Neurolucida software (MicroBrightField Bioscience, VT, United States). Golgi-Cox staining and dendritic spine counting Golgi-Cox staining and dendritic spine counting conducted as previously performed [ 36 , 40 ]. Mouse hippocampal tissues were immersed in Golgi-Cox staining solution and stored in the dark for two weeks, following the manufacturer's instructions (FD Neurotechnologies Inc., Columbia, MD). After rinsing with distilled water, the tissues were placed in 80% glacial acetic acid overnight. The tissues were then sectioned into 150 µm slices using vibratome (Leica VT2000S). Five neurons per section were analyzed using Neurolucida software (MicroBrightField, USA), selected based on established criteria [ 41 ]. Only neurons located in the DG region of the dorsal hippocampus were chosen for analysis. To ensure accuracy, selected neurons were relatively isolated from neighboring stained neurons to prevent analytical interference. The cell bodies were positioned in the middle of the section thickness to minimize truncation of dendritic branches. Additionally, neurons were required to be consistently and thoroughly impregnated along the entire length of all dendrites. Spine density was estimated by randomly selecting high-magnification tracings of 0.10 mm-long terminal segments of basal and apical dendritic branches. Three to five tertiary apical and basal dendrites, each with at least one branch point, were selected for counting. Visible spines along these segments were counted under microscope (X600 magnification) (Axioplan, Zeiss, Oberkochen, Germany). Data were expressed as the number of spines per 10 mm [ 36 ]. Immunostaining and quantification analysis Antigen retrieval was performed using a citric acid heat method (pH 6.0) at 95°C for 10 minutes. Following three washes with 1x PBS for 10 minutes each, brain slices were incubated overnight with the primary antibody, rabbit anti-Iba-1 (1:1000, Abcam). Subsequently, the slices were incubated with the secondary antibody, goat anti-rabbit (1:200, Vector Laboratories). Positive cells were visualized using the VECTASTAIN ABC kit (HRP) (1:200, Vector Laboratories) and the DAB peroxidase substrate kit (1:200, Vector Laboratories). Iba-1 immunopositive cells were quantified from eight sections spanning the Bregma positions − 1.34 to -3.80 mm[ 42 ]. Sections were imaged at 200x magnification using a Nikon H600L microscope (Nikon, Japan). Quantification of inflammatory cells was carried out by counting Iba-1 immunopositive cells were counted from 8 sections across − 1.34 to -3.80 mm bregma position. The sections were scanned at 200x magnification (United States). The hippocampus was divided into the dentate gyrus (DG), cornu ammonis 1 (CA1) and cornu ammonis 3 (CA3) region respectively using ImageJ (NIH, University of Wisconsin, United States) and Iba-1 cells in the regions were counted. Western blot assays Protein samples were resolved on 8% or 12% polyacrylamide gels and subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% non-fat dry milk in TBST (Tris-buffered saline with 0.1% Tween 20) for 2 hours at room temperature. Following blocking, the membranes were washed three times with PBS at room temperature. They were then incubated overnight at 4°C with specific primary antibodies: Tubulin (1:2000, Abcam), PSD95 (1:1000, Abcam), Synaptophysin (1:1000, Abcam), Synapsin-1 (1:1000, CST), BDNF (1:1000, Abcam), β-Actin (1:2000, Abcam), GluN2B (1:1000, Cell Signaling Technology), GluN2A (1:1000, Cell Signaling Technology), pGluN2A (1:1000, Cell Signaling Technology), pGluN2B (1:1000, Cell Signaling Technology), and GAPDH (1:10000, Bioworld, China). After three washes with TBST, the membranes were incubated for 2 hours at room temperature with horseradish peroxidase-conjugated secondary antibodies (1:10000, Proteintech). Protein bands were visualized using the ChemiDoc XRS + Imaging System (Bio-Rad). Band intensities were quantified using Image Lab 3.0 software (Bio-Rad). Enzyme-linked immunosorbent assay (ELISA) Following the collection of fresh tissue samples, the hippocampal region was homogenized and centrifuged at 13,000 rpm. The resulting supernatant was collected for analysis using enzyme-linked immunosorbent assay (ELISA)[ 36 ]. ELISA procedures were conducted according to the protocols provided in the commercial kits. Three commercial kits were utilized: High Mobility Group Box 1 protein (HMGB1), tumor necrosis factor-alpha (TNF-α), and Matrix Metallopeptidase 9 (MMP-9), all from CUSABIO (Houston). The supernatant was added to the ELISA plate and incubated for 2 hours. This was followed by sequential incubations with a biotin-conjugated antibody for 1 hour and an avidin-conjugated antibody for another hour. Subsequently, the 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate was added and allowed to react for 15 minutes. Finally, a stop solution was added, and the absorbance was immediately measured at 450 nm and 570 nm. Quantification of amino acids in the hippocampus The hippocampus was homogenized in a 0.9% NaCl solution at a ratio of 1:3 (w/v). The resulting homogenate was extracted with two volumes of pre-chilled acetonitrile and then centrifuged at 17,000 g for 10 minutes. The supernatant was derivatized using the Kairos Amino Acid Kit (Waters, Milford, MA, USA) and quantified via ultra-high-performance liquid chromatography coupled with triple quadrupole mass spectrometry (UHPLC-QqQ-MS/MS). Amino acid analysis was conducted on an Agilent 1290 Infinity II UHPLC system paired with an Agilent 6460 Triple Quadrupole Mass Spectrometer equipped with an electrospray ionization (ESI) source (Agilent Technologies Inc., Santa Clara, CA, USA), following a modified version of the method by Lo et al[ 43 ]. Chromatographic separation was achieved using a Waters CORTECS UPLC C18 column (2.1 x 150 mm, 1.6 µm) with a Waters CORTECS C18 VanGuard Pre-column (2.1 x 150 mm, 1.6 µm). The binary mobile phase consisted of (A) water with 0.1% formic acid and (B) acetonitrile with 0.1% formic acid. Gradient elution was performed at a flow rate of 0.3 mL/min, starting at 2% B from 0 to 1.5 minutes, increasing to 9% at 4 minutes, 11% at 5 minutes, 13% at 18 minutes, and 95% from 18.5 to 20.5 minutes, before returning to initial conditions in 0.1 minutes and equilibrating for 4.4 minutes prior to the next injection. The column temperature was maintained at 55°C, and the autosampler was kept at room temperature. The injection volume was 2 µL. Electrophysiological field recording Acute hippocampal slice preparation Following deep anesthesia with isoflurane, the mice were promptly decapitated. The brains were immediately immersed for one minute in ice-cold normal artificial cerebrospinal fluid (nACSF), composed of 125 mM NaCl, 2.5 mM KCl, 1.25 mM NaHPO4, 25 mM NaHCO3, 2 mM CaCl2, and 1.3 mM MgCl2, with a pH of 7.3. This solution was oxygenated with a 95% O2/5% CO2 mixture, as described in our previous protocol [ 44 ]. Transverse brain slices, 300 µm thick, were prepared using a fully automated vibratome (VT1200 S, Leica Biosystems Inc., IL, USA). These slices were then transferred to separate compartments of an incubation chamber filled with normal ACSF, continuously supplied with carbogen, and allowed to recover at 35°C for at least one hour prior to recording Field recording The hippocampal slice was placed on a MED Probe equipped with 64 microelectrodes (P515A, Alpha MED Scientific Inc., Osaka, Japan). The electrodes were precisely positioned within the middle molecular layer of the suprapyramidal blade to stimulate granule neurons, following a previously established protocol [ 45 ] and guided by a light microscope. The slices were continuously perfused with nACSF at 28°C at a flow rate of 2 ml/min. Field excitatory postsynaptic potentials (fEPSPs) were recorded using amplifiers (MED-A64MD1 and MED-A64HE1S, Alpha MED Scientific Inc., Osaka, Japan) and Mobius software interfaced with a computer. The stimulus intensity was set between 25–35 µA for each slice to achieve 40–50% of the maximum response slope, while avoiding population spikes. After a 20-minute stabilization period with single-pulse stimulations at 15-second intervals, high-frequency stimulation (HFS) was applied. This involved four trains of 50 pulses at 100 Hz with a 30-second intertrain interval, in the presence of picrotoxin (100 µM), a GABAA receptor antagonist, to induce LTP. Input-output (I/O) experiments were conducted to measure responses with increasing stimulation intensity, using 9 trains with a 10-second intertrain interval and increasing intensity of 10 µA. Additionally, presynaptic release probability was assessed using a paired pulse (PP) protocol in nACSF, consisting of 5 sets of two pulses with a 20 ms interval and a 20-second interval between paired stimuli. Gut microbiota analysis DNA extraction DNA was extracted from 36 fecal samples using the TIANamp Stool DNA Kit (DP328-02, China) according to the manufacturer's instructions. The extracted DNA samples were stored at − 80°C until sequencing. For the polymerase chain reaction (PCR), 30 ng of qualified DNA template was combined with 16S rRNA fusion primers. PCR products were purified using Agencourt AMPure XP beads, dissolved in Elution Buffer, and labeled to complete library construction. The size and concentration of the libraries were assessed using an Agilent 2100 Bioanalyzer. Qualified libraries were then sequenced on the HiSeq platform based on their insert size. PCR amplification The library was prepared using the 2× Phanta Max Master Mix (VAZYME, China) polymerase. The V3V4 variable region of bacterial 16S rDNA was amplified using forward and reverse degenerate primers, 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). PCR enrichment was conducted in a 50 µL reaction volume containing 30 ng of template DNA and fusion PCR primers. The PCR cycling conditions were as follows: an initial denaturation at 95°C for 3 minutes, followed by 30 cycles of 95°C for 15 seconds, 56°C for 15 seconds, and 72°C for 45 seconds, with a final extension at 72°C for 5 minutes. PCR products were purified using DNA magnetic beads (BGI, LB00V60). Subsequently, the final double-stranded library products were denatured to produce single-stranded library products. A circularization reaction was then performed to obtain single-stranded circular DNA products, with any remaining single-stranded linear DNA being digested and removed. The final single-stranded circular library was amplified using phi29 and rolling circle amplification (RCA) to generate DNA nanoballs (DNBs), which contain multiple copies of the initial single-stranded library molecule. The DNBs were loaded onto a patterned nanoarray, and sequencing reads of 300 base pairs in length were generated using the DNBSEQ-G400 platform (BGI, China). Processing of reads and data analysis Intestinal sample raw reads were processed using the DADA2 plugin within the QIIME2 platform (version 2024.5) to perform denoising and generate amplicon sequence variants (ASVs). Taxonomic assignment of ASVs was conducted using the SILVA 138 reference database, with a similarity threshold of 99%. On average, each sample yielded 44,698 ± 2,061 high-quality reads. Rarefaction was conducted at a depth of 40,800 sequences, corresponding to the sample with the fewest sequences, utilizing the q2-diversity plugin in QIIME2. Alpha diversity, based on this rarefaction depth, was evaluated using the Shannon index, calculated via the q2-diversity plugin. Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarity was performed using the \"vegan\" package (version 2.6-4) in R. Compositional differences were assessed through permutational multivariate analysis of variance (PERMANOVA) and analysis of similarities (ANOSIM), both implemented in the \"vegan\" package. Statistical differences between two groups were determined using the nonparametric Mann-Whitney U test, while differences among more than two groups were evaluated using the Kruskal-Wallis test. Both tests were conducted using the \"stats\" package (version 4.2.2) in R. A p-value of less than 0.05 was considered statistically significant. Statistical analysis All statistical analyses were conducted using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). Two-way analysis of variance (ANOVA) was conducted, with PM 2.5 exposure and gender as between-subject factors. Post hoc analyses were performed using Tukey's or Fisher's tests, as appropriate. For comparisons between two groups, a two-tailed Student's t-test was employed when appropriate. Raw amino acid data were processed using MassHunter Quantitative Analysis software (Agilent Technologies, Santa Clara, CA, USA). For the diversity and composition of intestinal microbiota, statistical differences between two groups were determined using the nonparametric Mann-Whitney U test, while differences among more than two groups were assessed using the Kruskal-Wallis test. A p-value of less than 0.05 was considered statistically significant. Data are presented as means ± standard error of the mean (SEM). 3. Results Maternal exposure to PM 2.5 impaired behaviors in adult offspring In the sociability test, all offspring mice spent significantly more time sniffing the unfamiliar stimulus mouse compared to the empty chamber (Fig. 2A1, Students’ T-test: males-control: t 5 = 11.57, P < 0.0001; females-control: t 4 = 12.29, P = 0.0003; males-PM 2.5 : t 5 = 59.63, P < 0.0001; females-PM 2.5 : t 5 = 19.84, P < 0.0001), indicating a strong preference for the chamber containing the mouse. A two-way ANOVA of the social preference index revealed a significant effect of treatment (Fig. 2A2: F (1, 19) = 47.23, P < 0.0001) but no significant effect of sex (F (1, 19) = 0.01152, P = 0.9157) and interaction (F (1, 19) = 2.869, P = 0.1067). Post-hoc test revealed that maternal PM 2.5 increased exploration index in both male and female offspring (males-control vs males-PM 2.5 : P < 0.01, females-control vs females-PM 2.5 ༚P < 0.0001), suggesting maternal PM 2.5 affected sociability in both male and female offspring. In the social novelty test, control male and female offspring spent significantly more time sniffing the novel stimulus mouse (S2) compared to the familiar stimulus mouse (S1) (Fig. 2B1, Students’ T-test: males-control: t 5 = 3.786, P < 0.05; females-control: t 4 = 3.639, P < 0.05), suggesting intact social novelty recognition memory. Male offspring (Fig. 2B1, males-PM 2.5 : t 5 = 5.215, P < 0.001) but not female offspring (females-PM 2.5 : t 5 = 0.6012, P = 0.5739) from dams with maternal PM 2.5 exposure showed significantly higher exploration ratio to the stimulus mouse. A two-way ANOVA of the social novelty index revealed a significant effect of treatment (Fig. 2A2: F (1, 19) = 5.654, P = 0.0281) but no significant effect of sex (F (1, 19) = 2.896, P = 0.1051) and interaction (F (1, 19) = 0.01797, P = 0.8948). Post- hoc analysis showed no significant difference in exploration index among groups but a decreased trend, suggesting maternal PM 2.5 had a tendency to affect social novelty in both male and female offspring (males-control vs males-PM 2.5 : P = 0.3886; females-control vs females-PM 2.5 : P = 0.3339). To assess repetitive behavior using the marble burying test, there was a significant effect of treatment (Fig. 2C: F (1, 22) = 13.71, P = 0.0012) but no significant effect of sex (F (1, 22) = 0.3608, P = 0.5542) and interaction (F (1, 22) = 1.661e-005, P = 0.9968). Post-hoc analysis revealed no statistically significant differences in the number of buried marbles between groups (males-control vs males-PM 2.5 : P = 0.0697; females-control vs females-PM 2.5 : P = 0.0689). However, the data indicate a strong trend toward an increase in buried marbles in the PM2.5-exposed groups, suggesting increased repetitive behavior in offspring. Maternal exposure to PM 2.5 impaired working memory in male offspring All control offspring demonstrated a significantly greater preference for the novel object compared to the familiar object (Fig. 3A1, Students’ T-test: males-control: t 5 = 11.06, P < 0.001; females-control: t 4 = 4.063, P < 0.05), whereas male and female offspring with PM 2.5 -exposed dams showed no difference in exploration ratio ( males-PM 2.5 : t 5 = 1.014, P = 0.357; females-PM 2.5 : t 5 = 0.3964, P = 0.7082). In the exploration index, a two-way ANOVA revealed a main effect of PM 2.5 (Fig. 3A2, F (1, 19) = 15.17, P = 0.0010) and effect of sex (F (1, 19) = 6.412, P = 0.0203), though no significant interaction (F (1, 19) = 1.504, P = 0.235). Notably, maternal PM 2.5 significantly reduced exploration index in male offspring, indicating impaired working memory compared to control male offspring (Fig. 3A2, Tukey post hoc test: P = 0.0074 males: control vs. PM 2.5 ). In contrast, PM 2.5 exposure did not significantly affect working memory in female offspring compared to controls (Fig. 3A2, P = 0.2849 females: control vs. PM 2.5 ). Spatial memory were evaluated using the Y-maze test. Control male and female offspring showed significantly more exploration of the novel arm (Fig. 3B1, Students’ T-test: males-control: t 4 = 6.862, P < 0.01; females-control: t 4 = 3.492, P < 0.05). PM 2.5 -exposed male offspring showed significant difference in exploration between novel and familiar arms but maternal PM 2.5 -exposed female offspring did not exhibit significant differences in exploration (males-control: t 6 = 2.749, P < 0.05; females-control: t 6 = 1.223, P = 0.2673). Two-way ANOVA of the exploration index showed significant gender (Fig. 3B2, F (1, 22) = 5.5, P = 0.0291) and treatment effects (F (1, 22) = 10, P = 0.0043), but not interaction effect (F (1, 22) = 0.52, P = 0.4771). There were no significant differences in exploration index (Fig. 3B2, Tukey post hoc test: males: control vs. males: PM 2.5 : P = 0.328) and female offspring (females: control vs. females: PM 2.5 : P = 0.0515). The open field test assessed locomotor activity (Fig. 3C1) and anxiety-like behavior (Fig. 3C2). Two-way ANOVA showed no interaction effects for distance traveled (interaction: F(1, 19) = 0.2172, P = 0.6465; gender factor: F (1, 19) = 0.09725, P = 0.7586; PM 2.5 factor: F (1, 19) = 0.005082, P = 0.9439), and time spent in the center (interaction: F (1, 19) = 0.5773, P = 0.4567; gender factor F (1, 19) = 0.05048, P = 0.8246; PM 2.5 Factor F (1, 19) = 2.431, P = 0.1355). Tukey post hoc test showed that no significant changes were observed in distance traveled (males: control vs. males: PM 2.5 : P = 0.9794, females: control vs. females: PM 2.5 : P = 0.9927) or time spent in the center (males: control vs. males: PM 2.5 : P = 0.9371, females: control vs. females: PM 2.5 : P = 0.401) between control and PM 2.5 -exposed groups. Two-way ANOVA showed no interaction effects for immobility in the forced swimming test (interaction factor F (1, 19) = 2.070, P = 0.1665; gender factor F (1, 19) = 0.02094, P = 0.8865; PM 2.5 factor F (1, 19) = 0.01981, P = 0.8896), indicating no significant difference in depression-like behavior in offspring. Maternal exposure to PM 2.5 enhanced hippocampal cell proliferation and neuronal differentiation in male offspring We investigated the effects of maternal exposure to PM 2.5 on hippocampal neurogenesis in offspring, focusing on cell proliferation and neuronal differentiation. We assessed neurogenesis by measuring cell proliferation (Ki67+), the number of immature neurons (DCX+), and neuronal differentiation (NeuroD+). Our findings indicate that maternal exposure to PM 2.5 significantly increased the number of Ki67 + cells in the dorsal and ventral DG of male offspring, as demonstrated by a main effect of PM 2.5 treatment (F (1, 19) = 14.72, P = 0.0011), though no significant interaction (F (1, 19) = 2.377, P = 0.1396) and sex effect (F (1, 19) = 0.4581, P = 0.5067). Similarly, the analysis of the ventral DG revealed a significant main effect of PM 2.5 (F (1, 19) = 9.003, P = 0.0074) and a significant interaction effect (F (1, 19) = 4.394, P = 0.0497), although no main effect of sex (F (1, 19) = 0.7991, P = 0.3825). Post hoc tests confirmed that maternal PM 2.5 exposure increased Ki67 + cell proliferation in both dorsal and ventral DG of male offspring compared to control group (P < 0.01), while no significant differences were observed in females (dorsal: P = 0.4098; ventral: P = 0.9228). Furthermore, the number of NeuroD + cells significantly increased in the dorsal DG following maternal PM 2.5 exposure, indicating a significant treatment effect (F (1, 19) = 99, P < 0.0001), without a significant sex effect (F (1, 19) = 0.0049, P = 0.9447) or interaction (F (1, 19) = 0.94, P = 0.3444). However, the number of NeuroD + cells did not increase in the ventral DG following maternal PM 2.5 exposure, with no treatment effect (F (1, 19) = 3.723, P = 0.0688), sex effect (F (1, 19) = 0.5598, P = 0.4635) or interaction (F (1, 19) = 0.4415, P = 0.5144). Post hoc tests confirmed that maternal PM 2.5 exposure highly increased NeuroD + cells in both male and female offspring compared to control group in dorsal DG (P < 0.0001), while no significant effects were observed in the ventral DG for either sex (males: P = 0.7964; females: P = 0.3075 compared to control counterpart). The two-way ANOVA analysis showed that maternal exposure to PM 2.5 did not significantly affect the number of DCX + cells in the dorsal DG for either sex (main effect of treatment: F (1, 18) = 0.7912, P = 0.3855; main effect of sex: F (1, 18) = 0.2672, P = 0.6115; interaction: F (1, 18) = 0.1956, P = 0.6636). Post hoc tests revealed no significant increase in DCX + cells in the dorsal DG of male offspring (P = 0.7831 PM 2.5 vs. control) and female offspring (P = 0.9887 PM 2.5 vs. control). Similarly, no significant effects of PM 2.5 exposure were observed in the ventral DG (treatment: (F (1, 19) = 9.003, P = 0.0074); sex effect (F (1, 19) = 0.7991 P = 0.3825; interaction effect (F (1, 19) = 0.94, P = 0.3444). Post-hoc analyses showed no significant differences in the number of DCX + cells in the ventral DG between the PM 2.5 -exposed and control groups for male offspring (P = 0.9812) and female offspring (P > 0.9999). In conclusion, our study highlights sex-specific effects of maternal PM 2.5 exposure on hippocampal neurogenesis, with significant increases in cell proliferation and neuronal differentiation observed in male offspring. Maternal exposure to PM 2.5 reduced dendritic branch length of hippocampal immature neurons in female offspring We next examined whether maternal PM 2.5 exposure impaired dendritic development of immature neurons undergoing dendritic maturation. Morphological analysis of immature neurons (DCX + cell) in offspring mice (Fig. 5A) was performed using Sholl analysis. A two-way ANOVA revealed a main treatment-specific effect (Fig. 5B: F (1, 95) = 10.29, P = 0.0018) and highly sex-specific effect (F (1, 95) = 5.105, P = 0.0261) on total dendritic length, but no interaction effect (F (1, 95) = 0.7734, P = 0.3814) was observed. Post-hoc analysis indicated a significant reduction in total dendritic length in female offspring exposed to PM 2.5 compared to controls (P < 0.05), whereas no significant difference was found in male offspring (P = 0.3623 vs. control male offspring). There was no significant difference in dendritic length in offspring (Fig. 5C: main effect of treatment: F (1, 20) = 2.480, P = 0.1310; main effect of sex: F (1, 20) = 1.834, P = 0.1908; interaction: F (1, 20) = 0.6017, P = 0.4470). Golgi-Cox staining (Fig. 5D) demonstrated that maternal exposure to PM 2.5 did not affect the density of dendritic spines in the hippocampal DG region in either male or female offspring (Fig. 5E: main effect of treatment: F (1, 22) = 0.42, P = 0.5241; main effect of sex: F(1, 22) = 1.4, P = 0.2457; interaction: F(1, 22) = 0.47, P = 0.4999). Maternal exposure to PM 2.5 impaired hippocampal synaptic plasticity in both male and female offspring Field recording revealed that maternal exposure to PM 2.5 resulted in a significant reduction in LTP in both male and female pups (Fig. 6A: main effect of treatment: F (1, 316) = 91.37, P < 0.0001; main effect of sex: F (1, 316) = 5.459, P = 0.0201; interaction: F (1, 316) = 3.382, P = 0.0669). Tukey post hoc test confirmed that a significant reduction in LTP of male offspring (P < 0.0001 PM 2.5 vs. control) and female offspring (P < 0.0001 PM 2.5 vs. control). This reduction was evidenced by a significant decrease in the average fEPSP slope change compared to control mice (Fig. 6B: main effect of treatment: F (1, 44) = 44.58, P < 0.0001; main effect of sex: F (1, 44) = 0.01991, P = 0.8884; interaction: F (1, 44) = 0.4213, P = 0.5197). Post hoc tests revealed a significant decrease in the average fESP slope change of male offspring (P < 0.0001 PM 2.5 vs. control) and in female offspring (P = 0.0006 female vs. control). We also assessed synaptic transmission efficiency through I/O responses. The analysis revealed no significant difference in the I/O response in offspring (Fig. 6C; main effect of treatment: F (6, 312) = 20.61, P < 0.0001; main effect of sex: F (18, 312) = 0.1169, P > 0.9999; interaction: F (3, 312) = 0.4959, P = 0.6854), suggesting that basal synaptic transmission remains intact. To evaluate short-term plasticity using a paired-pulse conditioning stimulation protocol, there was no significant difference (Fig. 6D; main effect of treatment: F (1, 44) = 1.871, P = 0.1783; main effect of sex: F (1, 44) = 0.1751, P = 0.6777; interaction: F (1, 44) = 0.1280, P = 0.7222).Collectively, these results suggest that chronic maternal exposure to PM 2.5 reduced hippocampal LTP formation in offspring, impairing synaptic plasticity in the DG region of the hippocampus. Maternal exposure to PM 2.5 reduced synaptic proteins in offspring We next examined changes of synaptic proteins in the hippocampal tissues (Fig. 7A). Figure 7A- Two-way ANOVA revealed a main sex-specific effect (F (1, 20) = 8.423, P = 0.0088) and interaction effect (F (1, 20) = 8.423, P = 0.0088), but not a treatment-specific effect (F (1, 20) = 0.6247, P = 0.4386), on hippocampal brain-derived neurotrophic factor (BDNF) levels (Fig. 7B). Post-hoc analysis indicated that maternal PM 2.5 exposure did not significantly affect BDNF levels in either sex compared to controls (males: P = 0.4598; females: P = 0.9379). PM 2.5 exposure did not significantly alter the levels of synaptophysin (SYN) (Fig. 7C: interaction: F (1, 20) = 0.5700, P = 0.4591; gender: F (1, 20) = 0.5700, P = 0.4591; PM 2.5 : F (1, 20) = 0.003697, P = 0.9521) and PSD-95 proteins (Fig. 7D: PSD-95, interaction: F (1, 20) = 0.5700, P = 0.4591; gender: F (1, 20) = 0.5700, P = 0.4591; PM 2.5 : F (1, 20) = 0.003697, P = 0.9521) in the hippocampi of offspring mice. PM 2.5 treatment did not affect GluN2A protein levels (Fig. 7E gender effect ( F (1, 20) = 1.054, P = 0.3169) and interaction effect ( F (1, 20) = 1.054, P = 0.3169). However, there was a main treatment effect (Fig. 7F. (F (1, 20) = 24.40, P < 0.0001), but not sex-specific effect (F (1, 20) = 0.01762, P = 0.8957) and interaction effect (F (1, 20) = 0.01762, P = 0.8957) on hippocampal GluN2B levels. Post-hoc tests revealed that maternal PM 2.5 exposure reduced GluN2B protein expression in the hippocampi of both male and female offspring (males: P < 0.01 PM 2.5 vs. control; females: P < 0.01 PM 2.5 vs. control), suggesting impaired LTP formation could be linked to reduction in GluN2B subunit of the NMDA receptors. Metabolomic analysis of amino acid levels in the hippocampus of offspring Amino acids play crucial roles in neurodevelopmental disorders associated with ASD [ 46 , 47 ]. To investigate the effect of maternal exposure to PM 2.5 on hippocampal amino acid levels in both mothers and offspring mice, we measured the concentrations of twenty standard amino acids in the hippocampus (Fig. 8A). Targeted metabolomics revealed a significant decrease in the concentration of glutamic acid in the PM 2.5 -exposed mothers (PMO group: 386 ± 11 µM) than in the control mothers (CMO group: 422 ± 7 µM) (Fig. 8B: p < 0.05). A two-way ANOVA revealed no significant differences in glutamic acid levels in the offspring mice (Fig. 8B: interaction: F (1, 17) = 0.3579, P = 0.5575; gender: F (1, 17) = 0.01324, P = 0.9097; PM 2.5 : F (1, 17) = 0.3050, P = 0.5880). Offspring mice displayed significant decrease in cysteine levels. A two-way ANOVA indicated a significant treatment-specific effect on hippocampal cysteine levels, but no sex-specific effect was found (main effect of treatment: F (1, 19) = 52.75, P < 0.0001; main effect of sex: F (1, 19) = 2.329, P = 0.1434; interaction: F (1, 19) = 2.040, P = 0.1694). Specifically, both female and male offspring with dams exposed to PM 2.5 exhibited significantly lower cysteine concentrations compared to those in the control groups with Tukey's post-hoc test (Fig. 8C: males: P < 0.01, females: P < 0.001). Maternal exposure to PM 2.5 did not induce neuroinflammation in the hippocampus of offspring Our study aims to investigate whether maternal exposure to PM 2.5 induces autism-like behaviors in offspring and whether these behaviors are associated with a neuroinflammatory response. We assessed neuroinflammation by examining the number of ionized calcium-binding adapter molecule 1 (IBA-1) positive microglial cells in the hippocampus. Two-way ANOVA revealed no significant inflammatory response in the hippocampal subregions in the DG (Fig. 9B: interaction: F(1, 20) = 0.8710, P = 0.3618; gender: F (1, 20) = 0.1625, P = 0.6911; PM 2.5 : F (1, 20) = 0.9950, P = 0.3304) and CA3 region (Fig. 9D: interaction: (F(1, 20) = 0.5972, P = 0.4487; gender: F (1, 20) = 0.06823, P = 0.7966; PM 2.5 : F (1, 20) = 1.184, P = 0.2896). A two-way ANOVA showed a main treatment-specific effect (F (1, 20) = 6.203, P = 0.0217), but not sex-specific effect (F (1, 20) = 1.672, P = 0.2107) and interaction effect (F (1, 20) = 0.3840, P = 0.5424) on inflammatory response in the hippocampal subregions in the CA1 region. Post hoc analysis confirmed no significant changes in the number of IBA-1 positive cells in the DG (males: P > 0.9999, females: P = 0.5344), CA1 (males: P = 0.5597, females: P = 0.1576), and CA3 (males: P = 0.996, females: P = 0.564). Additionally, there were no significant changes in the levels of HMGB1, TNF-α, and MMP-9 proteins (Fig. 9E-G). The ANOVA results showed no significant effects for HMGB1 (Fig. 9E: interaction: (F (1, 20) = 1.802, P = 0.1945; gender: F (1, 20) = 0.4713, P = 0.5003; PM 2.5 : F (1, 20) = 0.5959, P = 0.4492) and MMP-9 levels (Fig. 9G: interaction: (F (1, 20) = 0.3252, P = 0.5749; gender: F (1, 20) = 0.04604, P = 0.8323; PM 2.5 : F (1, 20) = 1.137, P = 0.2989). A two-way ANOVA showed a main sex-specific effect (F (1, 16) = 4.483, P = 0.0503), but not treatment-specific effect (F (1, 20) = 1.672, P = 0.2107) and interaction effect (F (1, 16) = 0.02486, P = 0.8767) on TNF-α level. Furthermore, post hoc tests indicated no significant differences in hippocampal levels of HMGB1 (males: P > 0.9999, females: P = 0.5344), TNF-α (males: P = 0.4017, females: P = 0.5256), and MMP-9 (males: P = 0.6595, females: P = 0.9847) across all groups. These findings suggest that maternal PM 2.5 exposure does not induce a detectable neuroinflammatory response in the hippocampus of offspring. Intestinal microbiota in male offspring with decreased relative abundance of Bacteroidaceae family In the analysis of alpha-diversity, the Shannon index revealed that PM 2.5 -exposed groups had significantly lower diversity compared to healthy groups (P = 0.020, Fig. 10A). However, no significant differences were observed in the Shannon index for male offspring (P = 0.240 vs. control male offspring) and female offspring (P = 0.589 vs. control female offspring) when exposed to PM 2.5 . A marginally significant difference was noted in female mother groups between PM 2.5 -exposed and healthy groups (P = 0.065, Fig. 10A). Regarding beta-diversity, a main treatment-specific effect was identified, but no gender-specific effect was observed (Fig. 10B, PERMANOVA: Interaction: R² = 0.170, P = 0.269; PM 2.5 : R² = 0.031, P = 0.290; Gender: R² = 0.102, P = 0.006). The ANOSIM test indicated a significant difference in the intestinal bacterial communities of female mothers between PM 2.5 -exposed and healthy groups (R = 0.233, P = 0.024). The top 10 most abundant bacterial genera across all samples were analyzed to identify functionally important taxa affected by PM 2.5 exposure (Fig. 10C). The dominant genus was Muribaculaceae , with no significant differences observed in these genera upon PM 2.5 exposure. Further comparisons of the most abundant bacterial classes (Fig. 10D) and families (Fig. 10E) revealed a significantly lower relative abundance of the classes Campylobacteria (P = 0.026 vs. control female mother) and Saccharimonadia (P = 0.026 vs. control female mother) in female mothers exposed to PM 2.5 compared to healthy groups (Fig. 10D). Additionally, a significantly lower relative abundance of the family Bacteroidaceae (P = 0.015 vs. control male offspring) was found in PM 2.5 -treated male offspring compared to healthy groups (Fig. 10E). 4. Discussion We found that offspring from mother exposure to PM 2.5 displayed behavioral abnormalities and hippocampal dysfunction with a gender effect. Both male and female offspring showed some behavioral abnormalities in association with male offspring exhibiting more proliferating progenitor cells and immature neurons in the hippocampus, while females showing reduced dendritic length of immature neurons. Both sexes experienced decreased LTP formation and synaptic GluN2B protein expression and a significant decrease in cysteine levels in the hippocampus. These changes are independent of neuroinflammatory responses and changes in gut microbiota profile. Our findings suggest that maternal PM 2.5 exposure may contribute to autism-like behaviors in offspring, with hippocampal dysfunction and reduced cysteine levels. Previous epidemiological studies have shown that prenatal and/or postnatal exposure to PM 2.5 increases the likelihood of offspring developing ASD [ 48 – 50 ], with some studies suggesting that this exposure could potentially double the risk of ASD development [ 51 ]. In rodent models, direct exposure to PM 2.5 in young rats has been associated with autistic-like behaviors [ 52 ]. Our results provided evidence showing the link between maternal PM 2.5 exposure and behavioral deficits in adult offspring that assemble some autistic-like behaviors. Defects in neuronal maturation have been observed in multiple regions associated with ASD, suggesting dysregulation in adult neurogenesis, neuronal migration, and/or maturation [ 53 ]. Our findings indicate increased proliferating cells and mature neurons in the hippocampus, with no change in the number of immature neurons or spine density following exposure, but a reduction in the total dendritic length of immature neurons in female offspring. In contrast, Wang et al. reported that maternal exposure to PM 2.5 decreases neurogenesis rates[ 54 ]. This could be due to the fact that exposure to PM 2.5 at different developmental stages may yield different effect on neuronal development and function[ 55 ]. In our study, mice were 42 days old, primarily reflecting adult neurogenesis, whereas Wang's study involved mice at 14 days old, a period of active developmental stages. Similarly, Juliandi et al. found that prenatal exposure to valproic acid in an autism model of mice led to cognitive impairments postnatally, potentially due to premature enhancement of embryonic neurogenesis [ 56 ]. This premature enhancement may deplete the neural progenitor cell (NPC) pool, subsequently inhibiting adult hippocampal neurogenesis. In ferret pups, exposure to VPA resulted in disrupted social behaviors and promoted the proliferation of neural progenitor cells in the DG, introducing additional NPCs into the DG granule cell layer [ 57 ]. This observation aligns with our research findings. In the cellular culture analysis of reprogrammed fibroblasts, induced pluripotent stem cells, neural progenitor cells, and neurons derived from individuals with autism exhibited increased cell proliferation [ 58 ]. Similarly, three-dimensional neural cultures from induced pluripotent stem cells of individuals with autism demonstrated upregulation of genes associated with cell proliferation and neuronal differentiation [ 59 ]. Watanabe et al. found that developmental exposure to risk factors in autistic rats primarily affects interneurons, which later impacts the proliferation of neural progenitor cells in the subgranular zone, leading to an increased number of granule cell layer neurons in the rat hippocampus [ 60 ]. Other studies, through the analysis of neuronal ultrastructure, have found that exposure to PM 2.5 during pregnancy leads to an increase in synaptic clefts, thinning of postsynaptic density, shortening of synaptic active zones, as well as swelling of mitochondrial matrix, partial blurring of mitochondrial cristae, and mitochondrial vacuolation in the hippocampal neurons of mouse offspring [ 61 , 62 ]. These findings align with our results, which demonstrate an increase in neuronal differentiation. However, further investigation is needed to identify the specific types of neurons involved. Although the number of immature neurons remained relatively unchanged, we observed a notable reduction in total dendritic length in female offspring. Collectively, these studies, along with our data, suggest that dysregulation of neural progenitor cell proliferation and delayed neuronal maturation occurred in the hippocampus with a gender specific effect. Changes of hippocampal structural plasticity may partly contribute to core behavioral deficits associated with ASD. Our research provides unique insights into the significant structural changes in hippocampal neurons resulting from maternal exposure to PM 2.5 . Synaptic plasticity is regulated by various mechanisms, including changes in receptor numbers, neurotransmitter release, and synaptic site localization. Maternal PM 2.5 exposure may alter dendritic branching, dendritic spine density, and morphology, potentially disrupting these processes and impairing synaptic transmission in the offspring's brain. PM 2.5 exposure reduced cell viability, increased apoptosis, and synaptic damage in primary cultured hippocampal neurons [ 11 , 63 ]. N-Methyl-D-Aspartate receptor (NMDAR)-dependent synaptic plasticity is a key mediator of hippocampus-dependent learning and memory processes [ 64 , 65 ]. Alterations in signaling of NMDARs containing the GluN2B subunit can inhibit dendritic spine density and impair learning capabilities [ 66 ]. In this study, we observed a reduction in LTP in the offspring, suggesting that maternal PM 2.5 exposure diminishes hippocampal long-term synaptic plasticity. Western blotting revealed a significant decrease in GluN2B expression in the hippocampus of PM 2.5 -exposed offspring compared to controls. Previous studies have shown that the absence of GluN2B in the hippocampus impairs dendritic spine density and hippocampal-mediated learning and memory [ 67 , 68 ], underscoring the critical role of GluN2B in modulating synaptic plasticity. Further investigation into the potential mechanisms linking GluN2B and hippocampal synaptic plasticity in offspring exposed to PM 2.5 is warranted. Numerous studies have identified a link between maternal inflammation during early pregnancy and an increased risk of ASD [ 69 ]. Our results showed no significant changes in the levels of HMGB1, TNF-α, MMP-9 proteins, or in the number of Iba-1 positive microglial cells in the hippocampus. These findings are consistent with postmortem studies of the hippocampal region by Vargas et al., which also reported no significant inflammation[ 70 ]. Another study found no pronounced inflammation in the hippocampus but observed abnormally small and densely distributed hippocampal neurons with reduced complexity and dendritic arbor length [ 71 ]. These observations suggest that hippocampal inflammation may not be the necessary mechanism underlying PM 2.5 -induced ASD during pregnancy. Instead, alterations in neuronal maturation and differentiation might contribute to behavioral deficits. Some studies have reported increased inflammation only in high-dose PM 2.5 groups [ 72 ]. In contrast, our study used lower doses, which may explain the differences in findings. Further research is needed to determine the specific PM 2.5 dose and duration of exposure required to trigger neuroinflammation. The maternal microbiome plays a critical role in offspring’s neurodevelopment [ 73 ], possibly because maternal gut microbiota affects the availability of essential metabolites required for fetal development [ 27 ]. Clinical studies have demonstrated that changes of gut microbiota found in children with ASD are also presented in their mothers [ 74 ], and gut microbiota shared in children and their mothers is related to developmental disability and social behavioral deficits [ 75 ]. Findings from animal research provide further support for the link between microbiota and ASD in clinical studies. Previous studies have shown that alterations in the gut microbiota can lead to long-term enhancements in adult neurogenesis [ 76 ] and synaptic transmission [ 77 ]. Gut microbiota can influence brain function and behavior by producing various metabolites, such as short-chain fatty acids and neurotransmitter precursors [ 78 ]. Our findings revealed that PM 2.5 exposure significantly decreased abundance of the Bacteroidaceae family only in male offspring. These findings suggest that maternal gut microbiota potentially influenced by environmental exposures such as PM2.5 may contribute to offspring neurodevelopmental outcomes in a sex-specific manner, possibly through alterations in microbiota composition and associated metabolite production. Synaptic plasticity and memory function in the brain are primarily driven by NMDAR, which require the binding of glutamate and the co-agonist D-serine at the glycine site. Cysteine also plays a crucial role in hippocampal synaptic plasticity, influencing synaptic transmission [ 79 , 80 ], neuronal connectivity [ 81 ], and the regulation of the intracellular environment [ 82 ], thereby affecting learning and memory. In this study, metabolomic analysis revealed that maternal exposure to PM 2.5 results in decreased glutamate levels in the maternal body and reduced cysteine levels in the offspring's hippocampal tissue. Research indicates that melatonin treatment significantly increased cysteine-rich protein 1 levels, contributing to dendritic branching in mouse hippocampal neurons [ 83 ]. Neuronal uptake of cysteine via excitatory amino acid carriers can mitigate ischemia-induced neuronal death by promoting glutathione synthesis in the hippocampus of ischemic animal models [ 83 ]. Furthermore, administration of L-cysteine (L-Cys) has been shown to improve behavioral, biochemical, neurochemical, and redox status in the central nervous system [ 84 ]. Prenatal supplementation with the antioxidant N-acetyl cysteine (NAC) offers protective benefits for fetal neurodevelopment against the adverse effects of prenatal restraint stress and maternal high-fat diet [ 85 ]. Early supplementation with antioxidants such as NAC or L-Cys may represent a promising therapeutic strategy for addressing neurodevelopmental disorders. Our results discovered deficiency of cysteine in the hippocampus of offspring displaying hippocampal atrophy and behavioral deficit, suggesting the critical role of cysteine in the impact of PM 2.5 on hippocampal function. 5. Conclusion Our study provides evidence that maternal exposure to PM 2.5 significantly impacts hippocampal function of offspring with a gender effect, resulting in autism-like behaviors. These effects are intricately linked to structural and functional alterations in the hippocampus, including disrupted synaptic plasticity and neuronal dendric development. Specifically, PM 2.5 exposure leads to notable reductions in cysteine levels in the hippocampus, which may contribute to impaired long-term potentiation formation and behavioral deficits. These findings emphasize the connection between maternal PM 2.5 exposure, reduction of cysteine levels and alterations in hippocampal plasticity, providing evidence showing the possible impacts of PM 2.5 on inducing behavioral abnormalities in offspring’s brain development. Declarations Declaration of interests ☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐ The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: References Baio J, Wiggins L, Christensen DL, Maenner MJ, Daniels J, Warren Z, Kurzius-Spencer M, Zahorodny W, Robinson Rosenberg C, White T et al : Prevalence of Autism Spectrum Disorder Among Children Aged 8 Years - Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2014 . MMWR Surveill Summ 2018, 67 (6). Sun X, Allison C, Wei L, Matthews FE, Auyeung B, Wu YY, Griffiths S, Zhang J, Baron-Cohen S, Brayne C: Autism prevalence in China is comparable to Western prevalence . Molecular autism 2019, 10 :7. Hallmayer J, Cleveland S, Torres A, Phillips J, Cohen B, Torigoe T, Miller J, Fedele A, Collins J, Smith K et al : Genetic heritability and shared environmental factors among twin pairs with autism . Archives of general psychiatry 2011, 68 (11):1095-1102. Suades-Gonzalez E, Gascon M, Guxens M, Sunyer J: Air Pollution and Neuropsychological Development: A Review of the Latest Evidence . Endocrinology 2015, 156 (10):3473-3482. Ruiz-Sobremazas D, Rodulfo-Cárdenas R, Ruiz-Coca M, Morales-Navas M, Teresa Colomina M, López-Granero C, Sánchez-Santed F, Perez-Fernandez C: Uncovering the link between air pollution and neurodevelopmental alterations during pregnancy and early life exposure: A systematic review . Neurosci Biobehav Rev 2023, 152 :105314. Lyall K, Schmidt RJ, Hertz-Picciotto I: Maternal lifestyle and environmental risk factors for autism spectrum disorders . Int J Epidemiol 2014, 43 (2):443-464. Dutheil F, Comptour A, Morlon R, Mermillod M, Pereira B, Baker JS, Charkhabi M, Clinchamps M, Bourdel N: Autism spectrum disorder and air pollution: A systematic review and meta-analysis . Environ Pollut 2021, 278 :116856. Lin H-H, Jung C-R, Lin C-Y, Chang Y-C, Hsieh C-Y, Hsu P-C, Chuang B-R, Hwang B-F: Prenatal and postnatal exposure to heavy metals in PM2.5 and autism spectrum disorder . Environ Res 2023, 237 (Pt 1):116874. Rahman MM, Shu Y-H, Chow T, Lurmann FW, Yu X, Martinez MP, Carter SA, Eckel SP, Chen J-C, Chen Z et al : Prenatal Exposure to Air Pollution and Autism Spectrum Disorder: Sensitive Windows of Exposure and Sex Differences . Environ Health Perspect 2022, 130 (1):17008. Kumar RK, Shadie AM, Bucknall MP, Rutlidge H, Garthwaite L, Herbert C, Halliburton B, Parsons KS, Wark PAB: Differential injurious effects of ambient and traffic-derived particulate matter on airway epithelial cells . Respirology 2015, 20 (1):73-79. Ahadullah, Yau S-Y, Lu H-X, Lee TMC, Guo H, Chan CCH: PM2.5 as a potential risk factor for autism spectrum disorder: Its possible link to neuroinflammation, oxidative stress and changes in gene expression . Neurosci Biobehav Rev 2021, 128 :534-548. Zheng X, Wang X, Wang T, Zhang H, Wu H, Zhang C, Yu L, Guan Y: Gestational Exposure to Particulate Matter 2.5 (PM2.5) Leads to Spatial Memory Dysfunction and Neurodevelopmental Impairment in Hippocampus of Mice Offspring . Front Neurosci 2018, 12 :1000. Power MC, Lamichhane AP, Liao D, Xu X, Jack CR, Gottesman RF, Mosley T, Stewart JD, Yanosky JD, Whitsel EA: The Association of Long-Term Exposure to Particulate Matter Air Pollution with Brain MRI Findings: The ARIC Study . Environ Health Perspect 2018, 126 (2):027009. Rossi CC, Van de Water J, Rogers SJ, Amaral DG: Detection of plasma autoantibodies to brain tissue in young children with and without autism spectrum disorders . Brain Behav Immun 2011, 25 (6):1123-1135. Raymond GV, Bauman ML, Kemper TL: Hippocampus in autism: a Golgi analysis . Acta Neuropathol 1996, 91 (1):117-119. Greco CM, Navarro CS, Hunsaker MR, Maezawa I, Shuler JF, Tassone F, Delany M, Au JW, Berman RF, Jin L-W et al : Neuropathologic features in the hippocampus and cerebellum of three older men with fragile X syndrome . Mol Autism 2011, 2 (1):2. Yau S-Y, Bettio L, Chiu J, Chiu C, Christie BR: Fragile-X Syndrome Is Associated With NMDA Receptor Hypofunction and Reduced Dendritic Complexity in Mature Dentate Granule Cells . Frontiers In Molecular Neuroscience 2018, 11 :495. Barnea-Goraly N, Frazier TW, Piacenza L, Minshew NJ, Keshavan MS, Reiss AL, Hardan AY: A preliminary longitudinal volumetric MRI study of amygdala and hippocampal volumes in autism . Progress In Neuro-psychopharmacology & Biological Psychiatry 2014, 48 :124-128. Schumann CM, Hamstra J, Goodlin-Jones BL, Lotspeich LJ, Kwon H, Buonocore MH, Lammers CR, Reiss AL, Amaral DG: The amygdala is enlarged in children but not adolescents with autism; the hippocampus is enlarged at all ages . J Neurosci 2004, 24 (28):6392-6401. Groen W, Teluij M, Buitelaar J, Tendolkar I: Amygdala and hippocampus enlargement during adolescence in autism . J Am Acad Child Adolesc Psychiatry 2010, 49 (6):552-560. Aylward EH, Minshew NJ, Goldstein G, Honeycutt NA, Augustine AM, Yates KO, Barta PE, Pearlson GD: MRI volumes of amygdala and hippocampus in non-mentally retarded autistic adolescents and adults . Neurology 1999, 53 (9):2145-2150. Roussin L, Prince N, Perez-Pardo P, Kraneveld AD, Rabot S, Naudon L: Role of the Gut Microbiota in the Pathophysiology of Autism Spectrum Disorder: Clinical and Preclinical Evidence . Microorganisms 2020, 8 (9). Oh D, Cheon KA: Alteration of Gut Microbiota in Autism Spectrum Disorder: An Overview . Soa Chongsonyon Chongsin Uihak 2020, 31 (3):131-145. Ran Z, An Y, Zhou J, Yang J, Zhang Y, Yang J, Wang L, Li X, Lu D, Zhong J et al : Subchronic exposure to concentrated ambient PM2.5 perturbs gut and lung microbiota as well as metabolic profiles in mice . Environ Pollut 2021, 272 :115987. Liu W, Zhou Y, Yong L, Qin Y, Yu L, Li R, Chen Y, Xu Y: Effects of PM2.5 exposure during gestation on maternal gut microbiota and pregnancy outcomes . Chemosphere 2020, 247 :125879. Yap IKS, Angley M, Veselkov KA, Holmes E, Lindon JC, Nicholson JK: Urinary metabolic phenotyping differentiates children with autism from their unaffected siblings and age-matched controls . Journal of Proteome Research 2010, 9 (6):2996-3004. Vuong HE, Pronovost GN, Williams DW, Coley EJL, Siegler EL, Qiu A, Kazantsev M, Wilson CJ, Rendon T, Hsiao EY: The maternal microbiome modulates fetal neurodevelopment in mice . Nature 2020, 586 (7828):281-286. Yau SY, Li A, Hoo RLC, Ching YP, Christie BR, Lee TMC, Xu A, So K-F: Physical exercise-induced hippocampal neurogenesis and antidepressant effects are mediated by the adipocyte hormone adiponectin . Proc Natl Acad Sci U S A 2014, 111 (44):15810-15815. Yau SY, Bostrom CA, Chiu J, Fontaine CJ, Sawchuk S, Meconi A, Wortman RC, Truesdell E, Truesdell A, Chiu C et al : Impaired bidirectional NMDA receptor dependent synaptic plasticity in the dentate gyrus of adult female Fmr1 heterozygous knockout mice . Neurobiol Dis 2016, 96 :261-270. Yau SY, Chiu C, Vetrici M, Christie BR: Chronic minocycline treatment improves social recognition memory in adult male Fmr1 knockout mice . Behavioural Brain Research 2016, 312 :77-83. Yau S-Y, Yip YSL, Formolo DA, He S, Lee THY, Wen C, Hryciw DH: Chronic consumption of a high linoleic acid diet during pregnancy, lactation and post-weaning period increases depression-like behavior in male, but not female offspring . Behavioural Brain Research 2022, 416 :113538. Block ML, Calderón-Garcidueñas L: Air pollution: mechanisms of neuroinflammation and CNS disease . Trends Neurosci 2009, 32 (9):506-516. Alexander JF, Seua AV, Arroyo LD, Ray PR, Wangzhou A, Heiβ-Lückemann L, Schedlowski M, Price TJ, Kavelaars A, Heijnen CJ: Nasal administration of mitochondria reverses chemotherapy-induced cognitive deficits . Theranostics 2021, 11 (7):3109-3130. Yau S-Y, Lee TH-Y, Formolo DA, Lee W-L, Li LC-K, Siu PM, Chan CCH: Effects of Maternal Voluntary Wheel Running During Pregnancy on Adult Hippocampal Neurogenesis, Temporal Order Memory, and Depression-Like Behavior in Adult Female and Male Offspring . Front Neurosci 2019, 13 :470. Wiebe S, Nagpal A, Truong VT, Park J, Skalecka A, He AJ, Gamache K, Khoutorsky A, Gantois I, Sonenberg N: Inhibitory interneurons mediate autism-associated behaviors via 4E-BP2 . Proc Natl Acad Sci U S A 2019, 116 (36):18060-18067. Yau S-Y, Lau BW-M, Tong J-B, Wong R, Ching Y-P, Qiu G, Tang S-W, Lee TMC, So K-F: Hippocampal neurogenesis and dendritic plasticity support running-improved spatial learning and depression-like behaviour in stressed rats . PloS One 2011, 6 (9):e24263. Lau BW-M, Yau S-Y, Lee TMC, Ching Y-P, Tang S-W, So K-F: Effect of corticosterone and paroxetine on masculine mating behavior: possible involvement of neurogenesis . J Sex Med 2011, 8 (5):1390-1403. Yau S-Y, Lee TH-Y, Li A, Xu A, So K-F: Adiponectin Mediates Running-Restored Hippocampal Neurogenesis in Streptozotocin-Induced Type 1 Diabetes in Mice . Front Neurosci 2018, 12 :679. Ramirez-Rodriguez G, Ortíz-López L, Domínguez-Alonso A, Benítez-King GA, Kempermann G: Chronic treatment with melatonin stimulates dendrite maturation and complexity in adult hippocampal neurogenesis of mice . J Pineal Res 2011, 50 (1):29-37. Lee TH, Ahadullah, Christie BR, Lin K, Siu PM-F, Zhang L, Yuan T-F, Komal P, Xu A, So K-F et al : Chronic AdipoRon Treatment Mimics the Effects of Physical Exercise on Restoring Hippocampal Neuroplasticity in Diabetic Mice . Mol Neurobiol 2021, 58 (9):4666-4681. Woolley CS, Gould E, McEwen BS: Exposure to excess glucocorticoids alters dendritic morphology of adult hippocampal pyramidal neurons . Brain Res 1990, 531 (1-2):225-231. Chao M-W, Yang C-H, Lin P-T, Yang Y-H, Chuang Y-C, Chung M-C, Tseng C-Y: Exposure to PM2.5 causes genetic changes in fetal rat cerebral cortex and hippocampus . Environ Toxicol 2017, 32 (4):1412-1425. Lo EKK, Wang X, Lee P-K, Wong H-C, Lee JC-Y, Gómez-Gallego C, Zhao D, El-Nezami H, Li J: Mechanistic insights into zearalenone-accelerated colorectal cancer in mice using integrative multi-omics approaches . Comput Struct Biotechnol J 2023, 21 :1785-1796. Yau SY, Bostrom C, Chiu J, Fontaine C, Sawchuk S, Meconi A, Wortman R, Truesdell E, Truesdell A, Chiu C: Impaired bidirectional NMDA receptor dependent synaptic plasticity in the dentate gyrus of adult female Fmr1 heterozygous knockout mice . Neurobiology of disease 2016, 96 :261-270. Lee TH, Ahadullah, Christie BR, Lin K, Siu PM-f, Zhang L, Yuan T-f, Komal P, Xu A, So K-f: Chronic AdipoRon treatment mimics the effects of physical exercise on restoring hippocampal neuroplasticity in diabetic mice . Molecular neurobiology 2021, 58 (9):4666-4681. Fung LK, Flores RE, Gu M, Sun KL, James D, Schuck RK, Jo B, Park JH, Lee BC, Jung JH et al : Thalamic and prefrontal GABA concentrations but not GABAA receptor densities are altered in high-functioning adults with autism spectrum disorder . Mol Psychiatry 2021, 26 (5):1634-1646. Drenthen GS, Barendse EM, Aldenkamp AP, van Veenendaal TM, Puts NAJ, Edden RAE, Zinger S, Thoonen G, Hendriks MPH, Kessels RPC et al : Altered neurotransmitter metabolism in adolescents with high-functioning autism . Psychiatry Res Neuroimaging 2016, 256 :44-49. Becerra TA, Wilhelm M, Olsen J, Cockburn M, Ritz B: Ambient air pollution and autism in Los Angeles county, California . Environ Health Perspect 2013, 121 (3):380-386. Raz R, Roberts AL, Lyall K, Hart JE, Just AC, Laden F, Weisskopf MG: Autism spectrum disorder and particulate matter air pollution before, during, and after pregnancy: a nested case-control analysis within the Nurses' Health Study II Cohort . Environ Health Perspect 2015, 123 (3):264-270. Talbott EO, Arena VC, Rager JR, Clougherty JE, Michanowicz DR, Sharma RK, Stacy SL: Fine particulate matter and the risk of autism spectrum disorder . Environ Res 2015, 140 :414-420. Volk HE, Lurmann F, Penfold B, Hertz-Picciotto I, McConnell R: Traffic-related air pollution, particulate matter, and autism . JAMA Psychiatry 2013, 70 (1):71-77. Zhang M, Liu W, Zhou Y, Li Y, Qin Y, Xu Y: Neurodevelopmental toxicity induced by maternal PM2.5 exposure and protective effects of quercetin and Vitamin C . Chemosphere 2018, 213 :182-196. Wegiel J, Kuchna I, Nowicki K, Imaki H, Wegiel J, Marchi E, Ma SY, Chauhan A, Chauhan V, Bobrowicz TW et al : The neuropathology of autism: defects of neurogenesis and neuronal migration, and dysplastic changes . Acta Neuropathol 2010, 119 (6):755-770. Wang T, Zhang T, Sun L, Li W, Zhang C, Yu L, Guan Y: Gestational B-vitamin supplementation alleviates PM2.5-induced autism-like behavior and hippocampal neurodevelopmental impairment in mice offspring . Ecotoxicol Environ Saf 2019, 185 :109686. Xia Y-Y, de Seymour JV, Yang X-J, Zhou L-W, Liu Y, Yang Y, Beck KL, Conlon CA, Mansell T, Novakovic B et al : Hair and cord blood element levels and their relationship with air pollution, dietary intake, gestational diabetes mellitus, and infant neurodevelopment . Clin Nutr 2023, 42 (10):1875-1888. Juliandi B, Tanemura K, Igarashi K, Tominaga T, Furukawa Y, Otsuka M, Moriyama N, Ikegami D, Abematsu M, Sanosaka T et al : Reduced Adult Hippocampal Neurogenesis and Cognitive Impairments following Prenatal Treatment of the Antiepileptic Drug Valproic Acid . Stem Cell Reports 2015, 5 (6). Sawada K, Kamiya S, Aoki I: The Proliferation of Dentate Gyrus Progenitors in the Ferret Hippocampus by Neonatal Exposure to Valproic Acid . Front Neurosci 2021, 15 :736313. Gormanns P, Mueller NS, Ditzen C, Wolf S, Holsboer F, Turck CW: Phenome-transcriptome correlation unravels anxiety and depression related pathways . Journal of Psychiatric Research 2011, 45 (7):973-979. Goyer RA: Results of lead research: prenatal exposure and neurological consequences . Environ Health Perspect 1996, 104 (10):1050-1054. Watanabe Y, Murakami T, Kawashima M, Hasegawa-Baba Y, Mizukami S, Imatanaka N, Akahori Y, Yoshida T, Shibutani M: Maternal Exposure to Valproic Acid Primarily Targets Interneurons Followed by Late Effects on Neurogenesis in the Hippocampal Dentate Gyrus in Rat Offspring . Neurotoxicity Research 2017, 31 (1):46-62. Fortoul TI: Health Effects of Metals in Particulate Matter . In . , edn.: IntechOpen; 2015. Guo Y-P, Commons KG: Serotonin neuron abnormalities in the BTBR mouse model of autism . Autism Res 2017, 10 (1):66-77. Costa LG, Chang Y-C, Cole TB: Developmental Neurotoxicity of Traffic-Related Air Pollution: Focus on Autism . Curr Environ Health Rep 2017, 4 (2):156-165. Gray JA, Shi Y, Usui H, During MJ, Sakimura K, Nicoll RA: Distinct modes of AMPA receptor suppression at developing synapses by GluN2A and GluN2B: single-cell NMDA receptor subunit deletion in vivo . Neuron 2011, 71 (6):1085-1101. Murphy JA, Stein IS, Lau CG, Peixoto RT, Aman TK, Kaneko N, Aromolaran K, Saulnier JL, Popescu GK, Sabatini BL et al : Phosphorylation of Ser1166 on GluN2B by PKA is critical to synaptic NMDA receptor function and Ca2+ signaling in spines . J Neurosci 2014, 34 (3):869-879. Raybuck JD, Hargus NJ, Thayer SA: A GluN2B-Selective NMDAR Antagonist Reverses Synapse Loss and Cognitive Impairment Produced by the HIV-1 Protein Tat . J Neurosci 2017, 37 (33):7837-7847. Brigman JL, Wright T, Talani G, Prasad-Mulcare S, Jinde S, Seabold GK, Mathur P, Davis MI, Bock R, Gustin RM et al : Loss of GluN2B-containing NMDA receptors in CA1 hippocampus and cortex impairs long-term depression, reduces dendritic spine density, and disrupts learning . J Neurosci 2010, 30 (13):4590-4600. Wang X, Xie J, Tan L, Lu Y, Shen N, Li J, Hu H, Li H, Li X, Cheng L: N6-methyladenosine-modified circRIMS2 mediates synaptic and memory impairments by activating GluN2B ubiquitination in Alzheimer's disease . Translational Neurodegeneration 2023, 12 (1):53. Hogan MK, Kovalycsik T, Sun Q, Rajagopalan S, Nelson RJ: Combined effects of exposure to dim light at night and fine particulate matter on C3H/HeNHsd mice . Behavioural Brain Research 2015, 294 :81-88. Vargas DL, Nascimbene C, Krishnan C, Zimmerman AW, Pardo CA: Neuroglial activation and neuroinflammation in the brain of patients with autism . Ann Neurol 2005, 57 (1):67-81. Kemper TL, Bauman M: Neuropathology of infantile autism . Journal of Neuropathology and Experimental Neurology 1998, 57 (7):645-652. Zhang T, Zheng X, Wang X, Zhao H, Wang T, Zhang H, Li W, Shen H, Yu L: Maternal Exposure to PM2.5 during Pregnancy Induces Impaired Development of Cerebral Cortex in Mice Offspring . Int J Mol Sci 2018, 19 (1). Jasarevic E, Bale TL: Prenatal and postnatal contributions of the maternal microbiome on offspring programming . Front Neuroendocrinol 2019, 55 :100797. Li N, Yang J, Zhang J, Liang C, Wang Y, Chen B, Zhao C, Wang J, Zhang G, Zhao D et al : Correlation of Gut Microbiome Between ASD Children and Mothers and Potential Biomarkers for Risk Assessment . Genomics Proteomics Bioinformatics 2019, 17 (1):26-38. Chen Y, Fang H, Li C, Wu G, Xu T, Yang X, Zhao L, Ke X, Zhang C: Gut Bacteria Shared by Children and Their Mothers Associate with Developmental Level and Social Deficits in Autism Spectrum Disorder . mSphere 2020, 5 (6). Ogbonnaya ES, Clarke G, Shanahan F, Dinan TG, Cryan JF, O'Leary OF: Adult Hippocampal Neurogenesis Is Regulated by the Microbiome . Biological Psychiatry 2015, 78 (4):e7-e9. Darch HT, Collins MK, O'Riordan KJ, Cryan JF: Microbial memories: Sex-dependent impact of the gut microbiome on hippocampal plasticity . The European Journal of Neuroscience 2021, 54 (4):5235-5244. Foster JA, McVey Neufeld K-A: Gut-brain axis: how the microbiome influences anxiety and depression . Trends Neurosci 2013, 36 (5):305-312. Pu L, Kopec AM, Boyle HD, Carew TJ: A novel cysteine-rich neurotrophic factor in Aplysia facilitates growth, MAPK activation, and long-term synaptic facilitation . Learn Mem 2014, 21 (4):215-222. Zareba-Koziol M, Bartkowiak-Kaczmarek A, Figiel I, Krzystyniak A, Wojtowicz T, Bijata M, Wlodarczyk J: Stress-induced Changes in the S-palmitoylation and S-nitrosylation of Synaptic Proteins . Mol Cell Proteomics 2019, 18 (10):1916-1938. Park M, Baek I-J, Kim H, Woo DK, Park Y-J, Shim S: CCN3 overexpression inhibits growth of callosal projections via upregulation of RAB25 . Biochem Biophys Res Commun 2015, 461 (3):456-462. Mannan A, Germon ZP, Chamberlain J, Sillar JR, Nixon B, Dun MD: Reactive Oxygen Species in Acute Lymphoblastic Leukaemia: Reducing Radicals to Refine Responses . Antioxidants (Basel) 2021, 10 (10). Ang MJ, Kang S, Moon C: Melatonin alters neuronal architecture and increases cysteine-rich protein 1 signaling in the male mouse hippocampus . Journal of Neuroscience Research 2020, 98 (11):2333-2348. Samad N, Rafeeque M, Imran I: Free-L-Cysteine improves corticosterone-induced behavioral deficits, oxidative stress and neurotransmission in rats . Metabolic Brain Disease 2023, 38 (3):983-997. Garcia-Serrano AM, Vieira JPP, Fleischhart V, Duarte JMN: Taurine and N-acetylcysteine treatments prevent memory impairment and metabolite profile alterations in the hippocampus of high-fat diet-fed female mice . Nutr Neurosci 2023, 26 (11):1090-1102. Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6813049\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":465998462,\"identity\":\"7fa2a211-a30d-42da-87e7-99fb657ba20c\",\"order_by\":0,\"name\":\"Yunxiao Zhong\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yunxiao\",\"middleName\":\"\",\"lastName\":\"Zhong\",\"suffix\":\"\"},{\"id\":466012179,\"identity\":\"662b81f3-34d5-4b6a-84e7-ea3ef6fcb1a9\",\"order_by\":1,\"name\":\"Ahadullah\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"\",\"middleName\":\"\",\"lastName\":\"Ahadullah\",\"suffix\":\"\"},{\"id\":466012180,\"identity\":\"e7989504-9639-4d59-a02e-9e2ebd21ef3d\",\"order_by\":2,\"name\":\"Tong Cheng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tong\",\"middleName\":\"\",\"lastName\":\"Cheng\",\"suffix\":\"\"},{\"id\":466012181,\"identity\":\"5628b571-a175-4e3f-9db3-ae6abe680cf8\",\"order_by\":3,\"name\":\"Julia Macedo Rosa\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Julia\",\"middleName\":\"Macedo\",\"lastName\":\"Rosa\",\"suffix\":\"\"},{\"id\":466012182,\"identity\":\"7507e35c-3f9b-4fe9-a4cc-4ed4e7ac2a0d\",\"order_by\":4,\"name\":\"Yang Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yang\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":466012183,\"identity\":\"b9598ecd-c14c-4deb-895e-5050541c0533\",\"order_by\":5,\"name\":\"Danyue Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Danyue\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":466012184,\"identity\":\"440ccd24-4a45-432c-bd67-85de653472e6\",\"order_by\":6,\"name\":\"Shicong Du\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"School of Energy and Environment, City University of Hong Kong\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shicong\",\"middleName\":\"\",\"lastName\":\"Du\",\"suffix\":\"\"},{\"id\":466012185,\"identity\":\"82c99e0a-275a-415d-916e-e7c049fc54d1\",\"order_by\":7,\"name\":\"Patrick K H Lee\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"City University of Hong Kong\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Patrick\",\"middleName\":\"K H\",\"lastName\":\"Lee\",\"suffix\":\"\"},{\"id\":466012186,\"identity\":\"5245a621-263d-4d01-8985-00e0b557182f\",\"order_by\":8,\"name\":\"Hussain Akhlaq\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hussain\",\"middleName\":\"\",\"lastName\":\"Akhlaq\",\"suffix\":\"\"},{\"id\":466012187,\"identity\":\"d5e08a87-cb08-4316-88a8-cc9e376f3c63\",\"order_by\":9,\"name\":\"Jiasui Yu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiasui\",\"middleName\":\"\",\"lastName\":\"Yu\",\"suffix\":\"\"},{\"id\":466012188,\"identity\":\"b8f98cb0-273b-4100-922d-61c5cd8943f8\",\"order_by\":10,\"name\":\"Douglas Affonso Formolo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Douglas\",\"middleName\":\"Affonso\",\"lastName\":\"Formolo\",\"suffix\":\"\"},{\"id\":466012189,\"identity\":\"c5984960-8ea4-4802-a719-66d4d9c55d93\",\"order_by\":11,\"name\":\"Yvonne YM Han\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA90lEQVRIiWNgGAWjYBCDBAYG5gMMDAVgjgEDY0MCMVrYEkCKSdLCY0CcFoMbycceF1Qw5PHP7vn24IPB4cQG9uZtEow70vBoSUs3nnGGoVjiztnthjNAWniOlUkwnsnBreXMGTNp3jaGxIYbudukeUBaJHLMJBjbKgho+ceQOP9GzjOIFvk3BLQc7wFqaWBI3HAjhw1qCw9IC26HSR5vS5PmOSaRuPFGmjnQL+nGbTxpxRaJbbi9z3eY+Zg0T41N4rwbyc8efKiwlu1nP7zxxse2ZJxaFA6AKQkQwQbEzWASFE04gXwDgg1SXIdH7SgYBaNgFIxUAAAm1lSyeo2AYAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yvonne\",\"middleName\":\"YM\",\"lastName\":\"Han\",\"suffix\":\"\"},{\"id\":466012190,\"identity\":\"67bb89ff-bea9-40ec-86a2-688d547e5957\",\"order_by\":12,\"name\":\"Chetwyn C H Chan\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtUlEQVRIiWNgGAWjYFACHgZmICnHwJDAxtjAcMCAaC3GpGtJbCBaC3/72YOfC2rupPez55g9nMFwx5igFokzecnSM449y53Z88bccAPDMzOCWgwkeMyYedgO5264kWMm+YDhsA2RWv4dTrcnTQtv2+EEAwmglg0Mhwk7TOJMjrE0b99hwxlnnpVJzjA4TNj7/O1nDD/zfDssz9+evE2yp+KwYQNBPWjuJFH9KBgFo2AUjALsAADo+Dqh58rgWAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"The Education University of Hong Kong\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Chetwyn\",\"middleName\":\"C H\",\"lastName\":\"Chan\",\"suffix\":\"\"},{\"id\":466012191,\"identity\":\"4669b8c6-37ff-4c65-8463-fa89c8e3bb06\",\"order_by\":13,\"name\":\"Hai Guo\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIie3RMQrCMBSA4VcqdInOFaleIZKhFIpnaRDayVUcI0Km4i54iG7ilpLBza5duzvoILhpmzqHjIL5lySQDxIegM32g2FwWLdOAVy1aY/INSIEvhsT0keZMQk9yZwnj7OTt+UTBHFQiKHEOhLllLkBT1fnvOxISgoxWibah4mWjLlcFTXtiKSFQERoSdUokuGevA1ITZnz4DL5EqGI/mF1wyRc03n7l110xEtykIhov4+rrGle63gWeruyvm0Wwf6SE19HuiQCNaCBr8akn0qf8+qJeze4bLPZbH/YB+HYTcLZW878AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hai\",\"middleName\":\"\",\"lastName\":\"Guo\",\"suffix\":\"\"},{\"id\":466012192,\"identity\":\"1e89802f-3df3-48b7-b3c5-f5f64c2622f3\",\"order_by\":14,\"name\":\"Suk-Yu Yau\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Hong Kong Polytechnic University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Suk-Yu\",\"middleName\":\"\",\"lastName\":\"Yau\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-06-03 15:51:22\",\"currentVersionCode\":1,\"declarations\":{\"humanSubjects\":false,\"vertebrateSubjects\":true,\"conflictsOfInterestStatement\":false,\"humanSubjectEthicalGuidelines\":false,\"humanSubjectConsent\":false,\"humanSubjectClinicalTrial\":false,\"humanSubjectCaseReport\":false,\"vertebrateSubjectEthicalGuidelines\":true},\"doi\":\"10.21203/rs.3.rs-6813049/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6813049/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":83906635,\"identity\":\"8c4b8f0c-9c1b-4131-9415-3b745d1dd90b\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:07\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":64784,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eTreatment Timeline.\\u003c/strong\\u003e Female mice, aged 5 weeks, were exposed to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e via intratracheal instillation every three days for two weeks. Following this exposure period, the females were housed with male mice for mating. Maternal exposure to PM2.5 continued until parturition. Offspring were weaned at 3 weeks of age and separated by sex on postnatal day 28 (PND 28). At 5 weeks of age, the offspring underwent a series of behavioral tests. OFT: open field test; NOR: novel object recognition test; Y maze; 3CST: three-chamber social interaction test; FST: forced swim test; Marble burying test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/7c2b1971c55187ddedf453f4.png\"},{\"id\":83906639,\"identity\":\"a446ab97-13b3-4bcd-9f12-8aeb4429c58a\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:07\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":193652,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003e exposure increased sociability and repetitive behavior in adult offspring mice.\\u003c/strong\\u003e (A-B) The three-chamber social interaction test was used to assess sociability and preference for social novelty. (A1) the exploration ratio indicates sociability (paired t-test: **P \\u0026lt; 0.001; #P \\u0026lt; 0.0001vs empty enclosure). (B1) the exploration ratio for preference for social novelty (paired t-test: *P \\u0026lt; 0.05; **P \\u0026lt; 0.01 vs familiar mouse). (A2 and B2) the exploration index (males: **P \\u0026lt; 0.01; females: #P \\u0026lt; 0.0001), two-way ANOVA with Tukey's post-hoc test for multiple comparisons. \\u0026nbsp;(C) the marble burying test, which measures repetitive behavior, two-way ANOVA with Tukey's post-hoc test. n = 5–7 mice per group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/3ea9b5951727d31cc6416d0b.png\"},{\"id\":83906642,\"identity\":\"d696e742-792a-44d6-95c1-4a573d3faeb3\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:07\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":203056,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003e in impaired working memory in adult male offspring.\\u003c/strong\\u003e (A) Spatial memory performance was evaluated using the Y-maze task, (A1) exploration ratio: paired t-test: *P \\u0026lt; 0.05; ***P \\u0026lt; 0.001 vs familiar object), and (B) working memory was assessed with the novel object recognition (NOR) task (B1) paired t-test: *P \\u0026lt; 0.05; **P \\u0026lt; 0.01 vs familiar object). (A2 and B2) the exploration index (males: **P \\u0026lt; 0.01), two-way ANOVA with Tukey's post-hoc test for multiple comparisons. \\u0026nbsp;(C1) Anxiety-like behavior and (C2) locomotor activity were measured in the open field test. (D) Depression-like behavior was evaluated using the forced swim test. Statistical comparisons for panels C and D were performed using a two-way ANOVA followed by Tukey's post-hoc test for multiple comparisons. n = 5–7 mice per group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/acd742ccfe20e3caaa601069.png\"},{\"id\":83906644,\"identity\":\"b8531438-18d6-4430-a5b0-39ab3fb621ad\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:07\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":517832,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003e enhanced hippocampal cell proliferation and neuronal differentiation in male offspring.\\u003c/strong\\u003e (A) Representative images of Ki67+, NeuroD+, and DCX+ cells in the hippocampal dentate gyrus. (B-C) The density of Ki67+ cells in the dorsal and ventral hippocampi. (D-E) The density of NeuroD+ cells in the dorsal and ventral hippocampi. (F-G) The density of DCX+ cells in the dorsal and ventral hippocampus. **P \\u0026lt; 0.01 and #P \\u0026lt; 0.0001, two-way ANOVA with Tukey's post-hoc test for multiple comparisons. n = 5–8 mice per group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/78bf78a2f2e9251a8a7e9381.png\"},{\"id\":83906636,\"identity\":\"e0a99e1c-3832-4f3f-9fda-153f60cc2c62\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:07\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":647345,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5 \\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003ereduced total dendritic length of immature adult-born neurons in the hippocampus of female offspring.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Representative images of doublecortin-positive immature neurons in the hippocampus. Scale bar: 50 μm. (B) The total dendritic length of doublecortin-labeled immature neurons. (C) Sholl analysis of dendritic length. (D) Representative images of dendritic spines in the hippocampal dentate gyrus using Golgi-Cox staining. Scale bar: 10 μm. (E) The density of dendritic spines *P \\u0026lt; 0.05, two-way ANOVA with Tukey's post-hoc test for multiple comparisons. n = 5–8 mice per group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/faa33bf29a793e68cccab1c2.png\"},{\"id\":83906885,\"identity\":\"76a6cf2c-c05e-423d-9b0f-5aef98e4ba10\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:36:07\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":171867,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5 \\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003esignificantly reduced synaptic plasticity in the hippocampal dentate gyrus in field electrophysiological recording. \\u003c/strong\\u003e(A) Significant reduction in long-term potentiation (LTP) formation. (B) The average slope changes, normalized to baseline, recorded during the last 5 minutes following high-frequency stimulation (HFS; four trains of 0.5 s duration at 100 Hz). (C) The input/output (I/O) curve of the field excitatory postsynaptic potential (fEPSP) slope in response to increasing stimulus intensity. (D) No significant difference in paired-pulse stimulation. Two-way ANOVA with Tukey's post-hoc test for multiple comparisons. ***p \\u0026lt; 0.001 and # p \\u0026lt; 0.0001. n = 12 slices from 4 mice.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/d7533bf44d4a4131b86445fa.png\"},{\"id\":83906882,\"identity\":\"f3d95152-e87f-4d1c-9056-89535d41752c\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:36:07\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":201032,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5 \\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003esignificantly reduced NMDA receptor subunit expression. \\u003c/strong\\u003e(A) Representative images of Western blotting. Quantitative analysis showed no difference in protein expression levels of (B) BDNF, (C) synaptophysin, (D) PSD95, (E) GluN2A, but significant reduction of (F) GluN2B expression levels in hippocampal synaptoneurosome fractions. **p \\u0026lt; 0.01, two-way ANOVA with Tukey post-hoc test for multiple comparisons. n = 6 mice per group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/dadb2cb19ec4d760d5f1943b.png\"},{\"id\":83906649,\"identity\":\"5ec87135-ea09-449c-b47c-b703ae287395\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:10\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":189938,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMetabolomic analysis of amino acid levels in the hippocampal tissues of offspring mice. \\u003c/strong\\u003e(A) Standard amino acid levels in the hippocampus of maternal and offspring mice. CMO (Control Mother), PMO (PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-treated Mother), CM (Male Offspring with Control Mother), PM (Male Offspring with PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-treated Mother), CF (Female Offspring with Control Mother), and PF (Female Offspring with PM2.5-treated Mother). (B) Glutamic acid concentration in the hippocampi. (C) Cysteine concentration in the hippocampi of offspring mice. Student’s T test for two groups and two-way ANOVA with Tukey's post-hoc test for multiple comparisons. n = 4–6 per group. *p \\u0026lt; 0.05, **p \\u0026lt; 0.01, and #p \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/e7570fec912576ede6323ff8.png\"},{\"id\":83906884,\"identity\":\"4d50948a-4be2-4395-8750-cbb70fc85df6\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:36:07\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":409094,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003e did not induce neuroinflammation in the hippocampal of offspring.\\u003c/strong\\u003e (A) Representative images of Iba-1 positive cells in the hippocampal dentate gyrus. (B-D) Quantification of Iba-1 positive microglial cells in the (B) dentate gyrus (DG), (C) cornu ammonis 1 (CA1), and (D) CA3 regions. (E-G) Levels of inflammatory cytokines in the hippocampi of offspring, including (E) High Mobility Group Box 1 protein (HMGB1), (F) tumor necrosis factor-alpha (TNF-α), and (G) Matrix Metallopeptidase 9 (MMP-9).\\u0026nbsp; Two-way ANOVA with Tukey's post-hoc test for multiple comparisons. n = -6 mice per group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/5601a216c4803b3086100b09.png\"},{\"id\":83906650,\"identity\":\"3d05e0c7-4ceb-42a8-9228-5d381bb2e9a5\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:28:10\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":310552,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe diversity and composition of fecal microbiota of offspring mice.\\u003c/strong\\u003e (A) Alpha-diversity of the fecal microbiota among male offspring, female offspring, and mothers exposed to PM\\u003csub\\u003e2.5 \\u003c/sub\\u003e(PMO). (B) Principal coordinate analysis (PCoA) of the Bray–Curtis dissimilarity matrix in intestinal microbiota composition. (C) The relative abundance of the top 10 genera in the intestinal microbiota. (D) The relative abundance of the top 10 classes among male offspring, female offspring, and PMO. (E) The relative abundance of the top 10 families among male offspring, female offspring, and PMO. Statistical differences between two groups were determined using the nonparametric Mann-Whitney U test, while differences among more than two groups were assessed using the Kruskal-Wallis test. Both tests were performed in the R package “stats” (v.4.2.2). n = 6 per group. *p \\u0026lt; 0.05 and **p \\u0026lt; 0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/92d458a3ad916daf2920932b.png\"},{\"id\":83907673,\"identity\":\"8f56a2e3-f6fb-4867-a77b-84c59ce87465\",\"added_by\":\"auto\",\"created_at\":\"2025-06-04 10:52:11\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":8184846,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6813049/v1/ec7760d9-c838-448c-a0c3-939511ccdd10.pdf\"}],\"financialInterests\":\"The authors declare no competing interests.\",\"formattedTitle\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal exposure to PM\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2.5 \\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003eimpairs behaviors and hippocampal plasticity in association with reduced cysteine levels in adult offspring\\u003c/strong\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eAutism spectrum disorder (ASD) is the most common neurodevelopmental disorder. It is characterized by core symptoms that include social behavioral deficits, communication impairments, and repetitive behavior. The prevalence of ASD has increased to approximately 1% of the world population, with a prevalence rate of 1 in 59 for children aged 8 years old in the United States[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e] and a comparable prevalence in China [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The causes of the dramatic increase in the incident rate of ASD are still largely unknown. However, emerging evidence indicates that environmental factors (particularly \\u003cem\\u003ein utero\\u003c/em\\u003e or during early life), or the interaction between genes and environment can significantly contribute to ASD [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eRecent epidemiological studies indicate that chronic pre- and/or postnatal exposure to particulate matter that has a diameter of less than 2.5 \\u0026micro;m (PM\\u003csub\\u003e2.5\\u003c/sub\\u003e) may impair neurodevelopment and be linked to ASD development in children [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Systematic reviews have highlighted the role of atmospheric PM exposure in neurodevelopmental disorders, including cognitive decline, attention-deficit/hyperactivity disorder, and ASD [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. A recent meta-analysis and systemic review supports the notion that exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e during pregnancy increases risk of ASD in newborns [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Both prenatal and postnatal exposures to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e are significantly associated with an increased risk of ASD [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e], suggesting that PM\\u003csub\\u003e2.5\\u003c/sub\\u003e may enhance susceptibility to the disorder. This risk is likely due to the neurotoxic components of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e], such as polycyclic aromatic hydrocarbons, metals, organic matter, and elemental carbon, which can alter gene expression, trigger neuroinflammation, and disrupt brain development [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. However, mechanisms by which chronic PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure increases ASD risk is still largely unknown.\\u003c/p\\u003e \\u003cp\\u003eChronic exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e during pregnancy significantly decreases the number and size of cortical neurons in offspring mice [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], causing neuronal atrophy in various brain regions, including the hippocampus [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e] which is crucial for learning, memory, and emotional regulation [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Direct PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure reduces apical dendritic length in the CA1 region and decreases synaptic vesicle numbers in the hippocampus, thereby impairing synaptic plasticity [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Our previous study has indicated that synaptic impairment in the hippocampus could be linked to cognitive deficits observed in fragile x mice, a commonly studied ASD model caused by single gene mutation [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Hippocampal abnormalities in children [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e] and adolescents [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e] with ASD have been widely reported.\\u003c/p\\u003e \\u003cp\\u003eChanges in gut microbiota could contribute to gastrointestinal disturbances, social impairment, and repetitive behavior in individuals with ASD [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Epidemiological studies have shown that exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e reduces gut microbiota diversity [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e], which could be linked to gastrointestinal diseases [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Notably, PM\\u003csub\\u003e2.5\\u003c/sub\\u003e intratracheal instillation during gestation changes the gut microbiota profile in the dams [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Emerging data suggest a connection between ASD and changes in gut microbiota, as well as altered levels of certain microbiota-derived metabolites in blood and urine [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Accumulated data suggest that altered gut microbiota contributes to ASD by influencing the production of neuroactive metabolites. Additionally, maternal gut microbiota has been shown to promote thalamocortical axon formation in the fetus, likely through the modulation of neuronal signaling in the developing brain [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIn this study, we investigated whether maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e induces autism-like behaviors male and female offspring, and examined its relationship to hippocampal impairments, neuroinflammation, metabolites and changes in gut microbiota.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eAnimals and experimental design\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e All experimental procedures were approved by the Animal Subjects Ethics Sub-Committee of The Hong Kong Polytechnic University and adhered to their guidelines. C57BL/6J mice were provided with standard chow and water ad libitum and maintained in a 12-hour light-dark cycle (lights on at 9 a.m.) in the animal holding facility. To mitigate stress from social isolation, which can impact adult neurogenesis, animals were group-housed as previously described [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. After a 2-day acclimation period, two female mice were paired with one male. Pregnancy was confirmed by the presence of seminal plugs. PM\\u003csub\\u003e2.5\\u003c/sub\\u003e was dissolved in artificial lung fluid (ALF) to achieve a concentration of 2.5 \\u0026micro;g/\\u0026micro;l, creating an ALF/PM\\u003csub\\u003e2.5\\u003c/sub\\u003e solution. Beginning at 5 weeks of age, female mice received PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure via intratracheal instillation every 3 days for two weeks, after which they were housed with males for mating. Maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure continued until parturition. Offspring were weaned at 3 weeks of age and separated by sex into different cages on postnatal day 28 (PND 28). At 5 weeks of age, offspring underwent a series of behavioral tests under dim light conditions during the light cycle to evaluate social abilities, social novelty preference, spatial learning and memory, working memory, locomotor activity, anxiety-like behaviors, and depression-like behaviors. Behavioral assessments were conducted over 7 days, with each test performed on a separate day in the following order: open field test, novel object recognition test, Y-maze test, three-chamber social interaction test, and forced swim test. To evaluate repetitive behavior, a marble burying test was conducted in a new cohort of animals after modeling. From each litter, 1\\u0026ndash;3 male and female offspring were selected for behavioral testing, 1 male and female offspring in each litter were taken for molecular assays.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eBehavioral tests\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eA separate cohort of animals was designated for behavioral testing. All mice underwent a 7-day pre-handling period, followed by a two-day habituation phase in which they were exposed to the empty testing apparatus for 15 minutes each day. This pre-handling and habituation protocol is crucial for minimizing stress associated with handling and exposure to novel environments. To further reduce stress, mice were acclimated to the behavioral testing room for 2 hours prior to the commencement of tests each day. Each mouse participated in a series of behavioral assessments, with only one test administered per day to prevent confounding effects from multiple tests [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eThree-chambered social interaction test\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe three-chamber test was utilized to evaluate sociability and social novelty in mice [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. The test consisted of three phases: habituation, sociability test, and social novelty test, and was conducted as previously described[\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. An apparatus box that was separated into three chambers was used (60 \\u0026times; 30 \\u0026times; 30 cm\\u0026sup3;). During a 5-min habituation period, a test mouse was placed in the middle chamber of the box, and an empty wire enclosure was placed in both the first and third chambers. The test mice were allowed to freely access and explore the three chambers through the doorways. There was a 5-min interval before the next phase started. In the 10-min sociability test, a stimulus mouse was placed in the wire cage in one chamber, while the wire enclosure in the other chamber remained empty. The test mouse was then returned to the middle chamber and allowed to roam around the three chambers freely. Sociability was determined by the preference of the testing mouse for the stimulus mouse or the empty enclosure. Any direct contact or sniffing of the cage was assessed as evidence of direct exploration or touch of an enclosure or social interest in the stimulus mouse. The exploration ratio was calculated as T\\u003csub\\u003eA\\u003c/sub\\u003e/(T\\u003csub\\u003eA\\u003c/sub\\u003e +T\\u003csub\\u003eB\\u003c/sub\\u003e) for the mouse and T\\u003csub\\u003eB\\u003c/sub\\u003e/(T\\u003csub\\u003eA\\u003c/sub\\u003e +T\\u003csub\\u003eB\\u003c/sub\\u003e) for the empty enclosure. The exploration ration index was calculated as (T\\u003csub\\u003eA\\u003c/sub\\u003e \\u0026ndash; T\\u003csub\\u003eB\\u003c/sub\\u003e)/(T\\u003csub\\u003eA\\u003c/sub\\u003e +T\\u003csub\\u003eB\\u003c/sub\\u003e), where T\\u003csub\\u003eA\\u003c/sub\\u003e = time spent exploring the mouse and T\\u003csub\\u003eB\\u003c/sub\\u003e = time spent exploring the empty enclosure. A 5-min interval was given before the final phase. In the 10-min social novelty test, a new stimulus mouse (novel mouse) was placed in the empty wire enclosure, and the test mouse was allowed to explore the chambers for 10 min. Social novelty recognition memory was assessed by the preference for approaching the novel or the familiar mouse. The exploration ratios for the familiar and novel mouses were calculated as T\\u003csub\\u003eF\\u003c/sub\\u003e/(T\\u003csub\\u003eF\\u003c/sub\\u003e +T\\u003csub\\u003eN\\u003c/sub\\u003e) and T\\u003csub\\u003eN\\u003c/sub\\u003e/(T\\u003csub\\u003eF\\u003c/sub\\u003e +T\\u003csub\\u003eN\\u003c/sub\\u003e), respectively. The exploration index was calculated as (T\\u003csub\\u003eN\\u003c/sub\\u003e - T\\u003csub\\u003eF\\u003c/sub\\u003e)/(T\\u003csub\\u003eN\\u003c/sub\\u003e +T\\u003csub\\u003eF\\u003c/sub\\u003e), where T\\u003csub\\u003eF\\u003c/sub\\u003e = time spent exploring the familiar mouse and T\\u003csub\\u003eN\\u003c/sub\\u003e = time spent exploring the novel mouse. The test was videotaped and analyzed by a well-trained researcher manually in a sample-blinded manner.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eNovel object recognition test\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eA transparent plastic arena (60 \\u0026times; 40 \\u0026times; 22 cm) was used for the test. A camera was positioned directly above the box to capture the mice's movements throughout the experiment. In the adaptation period, mice were allowed to move freely within the arena for 5 minutes to acclimate to the experimental setup. After After a 5 minutes test interval in the home cage, mice were re-introduced to the arena with two identical objects (object set 1) for 10 minutes. After a 2-hour interval, one of the original objects was replaced with a novel object of similar size but different shape. Mice were then allowed to explore for 5 minutes. The time spent sniffing each object was recorded [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e].The familiar exploration ratio was calculated with the formula: (T\\u003csub\\u003eF\\u003c/sub\\u003e/(T\\u003csub\\u003eF\\u003c/sub\\u003e +T\\u003csub\\u003eN\\u003c/sub\\u003e) ). The novel exploration ratio was calculated with the formula (T\\u003csub\\u003eN\\u003c/sub\\u003e/(T\\u003csub\\u003eF\\u003c/sub\\u003e +T\\u003csub\\u003eN\\u003c/sub\\u003e)). The exploration index was calculated with the formula: (T\\u003csub\\u003eN\\u003c/sub\\u003e - T\\u003csub\\u003eF\\u003c/sub\\u003e)/(T\\u003csub\\u003eN\\u003c/sub\\u003e +T\\u003csub\\u003eF\\u003c/sub\\u003e), where T\\u003csub\\u003eF\\u003c/sub\\u003e = time spent exploring the familiar mouse and T\\u003csub\\u003eN\\u003c/sub\\u003e = time spent exploring the novel mouse.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eY maze\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe Y-maze test, designed to assess spatial memory, was conducted in an arena consisting of three symmetrical arms made of gray plastic, each arm having the dimensions of 30 cm x 15 cm X 6 cm. These arms were arranged at 120\\u0026deg; angles, with external spatial cues provided in the surrounding room. The test was divided into 2 phases. In phase 1, the mice were allowed to explore for 10 mins with one arm was blocked (Novel arm). Phase 2 was conducted after an interval of 2 hours. In phase 2, the blocked arm was open and the mice were allowed to explore freely for 10 mins. The familiar exploration ratio was calculated with the formula: (T\\u003csub\\u003eF\\u003c/sub\\u003e/(T\\u003csub\\u003eF\\u003c/sub\\u003e +T\\u003csub\\u003eN\\u003c/sub\\u003e) ). The novel exploration ratio was calculated with the formula (T\\u003csub\\u003eN\\u003c/sub\\u003e/(T\\u003csub\\u003eF\\u003c/sub\\u003e +T\\u003csub\\u003eN\\u003c/sub\\u003e)). The exploration index was calculated with the formula: (T\\u003csub\\u003eN\\u003c/sub\\u003e - T\\u003csub\\u003eF\\u003c/sub\\u003e)/(T\\u003csub\\u003eN\\u003c/sub\\u003e +T\\u003csub\\u003eF\\u003c/sub\\u003e), where T\\u003csub\\u003eF\\u003c/sub\\u003e = time spent exploring the familiar mouse and T\\u003csub\\u003eN\\u003c/sub\\u003e = time spent exploring the novel mouse[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eOpen field test (OFT)\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eEach mouse was placed in the center of a square open field arena (50 \\u0026times; 50 \\u0026times; 30 cm), for 5 minutes. The total distance traveled (in meters) and the time spent in the center (in seconds) were recorded and analyzed using the EthoVision XT 10 system (Noldus) [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eForced swim test (FST)\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eA mouse was placed in a cylindrical container (30 cm in height and 15 cm in diameter) filled with water maintained at room temperature (24\\u0026ndash;25\\u0026deg;C) and recorded on video for 6 minutes following established protocols [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. An observer, blinded to the treatment conditions, assessed the time the mouse spent immobile during the final 4 minutes of the test. Immobility was defined as the absence of movement except for the minimal actions required to keep the head above water [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. This measure was used as an indicator of depression-like behavior.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eMarble burying test\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eAnimals were housed in a standard type II cage (40 cm x 28 cm x 18 cm) with a 5 cm layer of bedding. Twenty identical black marbles were evenly distributed across the bedding. The animals were observed for a duration of one hour. A marble was classified as buried if at least two-thirds of its surface was covered by bedding [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTissue preparation and immunohistochemistry\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eOffspring mice were deeply anesthetized using a cocktail of ketamine (10 mg/kg) and xylazine (4 mg/kg) and then perfused transcardially with normal saline, followed by 4% paraformaldehyde. The brains were post-fixed overnight at 4\\u0026deg;C and subsequently immersed in 30% sucrose until they sank. Coronal sections with 30 \\u0026micro;m thickness (1-in-6 series) were cut through the hippocampus, spanning from bregma 23.30 mm to 24.52 mm [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. These brain sections were stored in a cryoprotectant solution consisting of 30% glycerol and 30% ethylene glycol in 1x PBS until immunostaining was performed. After washing with 0.01 M PBS, sections were incubated overnight with rabbit anti-Ki67 antibody (1:1000, Abcam), followed by biotinylated goat anti-mouse antibody (1:200, Vector Laboratories). Ki67 staining was visualized using the peroxidase method (ABC system, Vector Laboratories) and diaminobenzidine (DAB) kits (1:200, Vector Laboratories)[\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. For DCX or NeuroD staining, sections were incubated with rabbit anti-DCX (1:200, Vector Laboratories) or mouse anti-NeuroD (1:200, Vector Laboratories) antibodies, respectively, followed by the same visualization method as described above [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eData quantification of cell proliferation and neurogenesis\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eCell proliferation, immature neurons, and neuronal differentiation were quantified by counting Ki67, DCX, and NeuroD immunopositive cells, respectively. Total number of Ki67+, DCX+, and NeuroD\\u0026thinsp;+\\u0026thinsp;cells present in the SGZ of either the dorsal DG (from Bregma 1.34 to 2.54), or the ventral DG (Bregma 2.54 to 3.80) sub-regions were quantified as previously performed [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e].The counts were performed using a Nikon H600L microscope (Nikon, Japan).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eSholl analysis\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eImmature neurons were selected based on the following criteria: (1) the neuron must be at least a tertiary immature neuron, possessing three or more dendritic branches; (2) the neuron must extend towards the molecular layer of the DG with intact dendritic branching; (3) the cell body should be located in the subgranular zone of the DG; and (4) neurons can be selected from either the superior or inferior blade of the dentate gyrus. For each brain region, five immature neurons were traced, encompassing three dorsal and three ventral regions, resulting in a total of 30 neurons analyzed [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. Neurons were selected under 400x magnification to measure total dendritic length and perform Sholl analysis using Neurolucida software (MicroBrightField Bioscience, VT, United States).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eGolgi-Cox staining and dendritic spine counting\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eGolgi-Cox staining and dendritic spine counting conducted as previously performed [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Mouse hippocampal tissues were immersed in Golgi-Cox staining solution and stored in the dark for two weeks, following the manufacturer's instructions (FD Neurotechnologies Inc., Columbia, MD). After rinsing with distilled water, the tissues were placed in 80% glacial acetic acid overnight. The tissues were then sectioned into 150 \\u0026micro;m slices using vibratome (Leica VT2000S). Five neurons per section were analyzed using Neurolucida software (MicroBrightField, USA), selected based on established criteria [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Only neurons located in the DG region of the dorsal hippocampus were chosen for analysis. To ensure accuracy, selected neurons were relatively isolated from neighboring stained neurons to prevent analytical interference. The cell bodies were positioned in the middle of the section thickness to minimize truncation of dendritic branches. Additionally, neurons were required to be consistently and thoroughly impregnated along the entire length of all dendrites. Spine density was estimated by randomly selecting high-magnification tracings of 0.10 mm-long terminal segments of basal and apical dendritic branches. Three to five tertiary apical and basal dendrites, each with at least one branch point, were selected for counting. Visible spines along these segments were counted under microscope (X600 magnification) (Axioplan, Zeiss, Oberkochen, Germany). Data were expressed as the number of spines per 10 mm [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eImmunostaining and quantification analysis\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAntigen retrieval was performed using a citric acid heat method (pH 6.0) at 95\\u0026deg;C for 10 minutes. Following three washes with 1x PBS for 10 minutes each, brain slices were incubated overnight with the primary antibody, rabbit anti-Iba-1 (1:1000, Abcam). Subsequently, the slices were incubated with the secondary antibody, goat anti-rabbit (1:200, Vector Laboratories). Positive cells were visualized using the VECTASTAIN ABC kit (HRP) (1:200, Vector Laboratories) and the DAB peroxidase substrate kit (1:200, Vector Laboratories). Iba-1 immunopositive cells were quantified from eight sections spanning the Bregma positions \\u0026minus;\\u0026thinsp;1.34 to -3.80 mm[\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Sections were imaged at 200x magnification using a Nikon H600L microscope (Nikon, Japan). Quantification of inflammatory cells was carried out by counting Iba-1 immunopositive cells were counted from 8 sections across \\u0026minus;\\u0026thinsp;1.34 to -3.80 mm bregma position. The sections were scanned at 200x magnification (United States). The hippocampus was divided into the dentate gyrus (DG), cornu ammonis 1 (CA1) and cornu ammonis 3 (CA3) region respectively using ImageJ (NIH, University of Wisconsin, United States) and Iba-1 cells in the regions were counted.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eWestern blot assays\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eProtein samples were resolved on 8% or 12% polyacrylamide gels and subsequently transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% non-fat dry milk in TBST (Tris-buffered saline with 0.1% Tween 20) for 2 hours at room temperature. Following blocking, the membranes were washed three times with PBS at room temperature. They were then incubated overnight at 4\\u0026deg;C with specific primary antibodies: Tubulin (1:2000, Abcam), PSD95 (1:1000, Abcam), Synaptophysin (1:1000, Abcam), Synapsin-1 (1:1000, CST), BDNF (1:1000, Abcam), β-Actin (1:2000, Abcam), GluN2B (1:1000, Cell Signaling Technology), GluN2A (1:1000, Cell Signaling Technology), pGluN2A (1:1000, Cell Signaling Technology), pGluN2B (1:1000, Cell Signaling Technology), and GAPDH (1:10000, Bioworld, China). After three washes with TBST, the membranes were incubated for 2 hours at room temperature with horseradish peroxidase-conjugated secondary antibodies (1:10000, Proteintech). Protein bands were visualized using the ChemiDoc XRS\\u0026thinsp;+\\u0026thinsp;Imaging System (Bio-Rad). Band intensities were quantified using Image Lab 3.0 software (Bio-Rad).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eEnzyme-linked immunosorbent assay (ELISA)\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eFollowing the collection of fresh tissue samples, the hippocampal region was homogenized and centrifuged at 13,000 rpm. The resulting supernatant was collected for analysis using enzyme-linked immunosorbent assay (ELISA)[\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. ELISA procedures were conducted according to the protocols provided in the commercial kits. Three commercial kits were utilized: High Mobility Group Box 1 protein (HMGB1), tumor necrosis factor-alpha (TNF-α), and Matrix Metallopeptidase 9 (MMP-9), all from CUSABIO (Houston). The supernatant was added to the ELISA plate and incubated for 2 hours. This was followed by sequential incubations with a biotin-conjugated antibody for 1 hour and an avidin-conjugated antibody for another hour. Subsequently, the 3,3\\u0026prime;,5,5\\u0026prime;-Tetramethylbenzidine (TMB) substrate was added and allowed to react for 15 minutes. Finally, a stop solution was added, and the absorbance was immediately measured at 450 nm and 570 nm.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eQuantification of amino acids in the hippocampus\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe hippocampus was homogenized in a 0.9% NaCl solution at a ratio of 1:3 (w/v). The resulting homogenate was extracted with two volumes of pre-chilled acetonitrile and then centrifuged at 17,000 g for 10 minutes. The supernatant was derivatized using the Kairos Amino Acid Kit (Waters, Milford, MA, USA) and quantified via ultra-high-performance liquid chromatography coupled with triple quadrupole mass spectrometry (UHPLC-QqQ-MS/MS). Amino acid analysis was conducted on an Agilent 1290 Infinity II UHPLC system paired with an Agilent 6460 Triple Quadrupole Mass Spectrometer equipped with an electrospray ionization (ESI) source (Agilent Technologies Inc., Santa Clara, CA, USA), following a modified version of the method by Lo et al[\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Chromatographic separation was achieved using a Waters CORTECS UPLC C18 column (2.1 x 150 mm, 1.6 \\u0026micro;m) with a Waters CORTECS C18 VanGuard Pre-column (2.1 x 150 mm, 1.6 \\u0026micro;m). The binary mobile phase consisted of (A) water with 0.1% formic acid and (B) acetonitrile with 0.1% formic acid. Gradient elution was performed at a flow rate of 0.3 mL/min, starting at 2% B from 0 to 1.5 minutes, increasing to 9% at 4 minutes, 11% at 5 minutes, 13% at 18 minutes, and 95% from 18.5 to 20.5 minutes, before returning to initial conditions in 0.1 minutes and equilibrating for 4.4 minutes prior to the next injection. The column temperature was maintained at 55\\u0026deg;C, and the autosampler was kept at room temperature. The injection volume was 2 \\u0026micro;L.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eElectrophysiological field recording\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eAcute hippocampal slice preparation\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eFollowing deep anesthesia with isoflurane, the mice were promptly decapitated. The brains were immediately immersed for one minute in ice-cold normal artificial cerebrospinal fluid (nACSF), composed of 125 mM NaCl, 2.5 mM KCl, 1.25 mM NaHPO4, 25 mM NaHCO3, 2 mM CaCl2, and 1.3 mM MgCl2, with a pH of 7.3. This solution was oxygenated with a 95% O2/5% CO2 mixture, as described in our previous protocol [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. Transverse brain slices, 300 \\u0026micro;m thick, were prepared using a fully automated vibratome (VT1200 S, Leica Biosystems Inc., IL, USA). These slices were then transferred to separate compartments of an incubation chamber filled with normal ACSF, continuously supplied with carbogen, and allowed to recover at 35\\u0026deg;C for at least one hour prior to recording\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eField recording\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe hippocampal slice was placed on a MED Probe equipped with 64 microelectrodes (P515A, Alpha MED Scientific Inc., Osaka, Japan). The electrodes were precisely positioned within the middle molecular layer of the suprapyramidal blade to stimulate granule neurons, following a previously established protocol [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e] and guided by a light microscope. The slices were continuously perfused with nACSF at 28\\u0026deg;C at a flow rate of 2 ml/min. Field excitatory postsynaptic potentials (fEPSPs) were recorded using amplifiers (MED-A64MD1 and MED-A64HE1S, Alpha MED Scientific Inc., Osaka, Japan) and Mobius software interfaced with a computer. The stimulus intensity was set between 25\\u0026ndash;35 \\u0026micro;A for each slice to achieve 40\\u0026ndash;50% of the maximum response slope, while avoiding population spikes. After a 20-minute stabilization period with single-pulse stimulations at 15-second intervals, high-frequency stimulation (HFS) was applied. This involved four trains of 50 pulses at 100 Hz with a 30-second intertrain interval, in the presence of picrotoxin (100 \\u0026micro;M), a GABAA receptor antagonist, to induce LTP. Input-output (I/O) experiments were conducted to measure responses with increasing stimulation intensity, using 9 trains with a 10-second intertrain interval and increasing intensity of 10 \\u0026micro;A. Additionally, presynaptic release probability was assessed using a paired pulse (PP) protocol in nACSF, consisting of 5 sets of two pulses with a 20 ms interval and a 20-second interval between paired stimuli.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eGut microbiota analysis\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eDNA extraction\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eDNA was extracted from 36 fecal samples using the TIANamp Stool DNA Kit (DP328-02, China) according to the manufacturer's instructions. The extracted DNA samples were stored at \\u0026minus;\\u0026thinsp;80\\u0026deg;C until sequencing. For the polymerase chain reaction (PCR), 30 ng of qualified DNA template was combined with 16S rRNA fusion primers. PCR products were purified using Agencourt AMPure XP beads, dissolved in Elution Buffer, and labeled to complete library construction. The size and concentration of the libraries were assessed using an Agilent 2100 Bioanalyzer. Qualified libraries were then sequenced on the HiSeq platform based on their insert size.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003ePCR amplification\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe library was prepared using the 2\\u0026times; Phanta Max Master Mix (VAZYME, China) polymerase. The V3V4 variable region of bacterial 16S rDNA was amplified using forward and reverse degenerate primers, 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). PCR enrichment was conducted in a 50 \\u0026micro;L reaction volume containing 30 ng of template DNA and fusion PCR primers. The PCR cycling conditions were as follows: an initial denaturation at 95\\u0026deg;C for 3 minutes, followed by 30 cycles of 95\\u0026deg;C for 15 seconds, 56\\u0026deg;C for 15 seconds, and 72\\u0026deg;C for 45 seconds, with a final extension at 72\\u0026deg;C for 5 minutes. PCR products were purified using DNA magnetic beads (BGI, LB00V60). Subsequently, the final double-stranded library products were denatured to produce single-stranded library products. A circularization reaction was then performed to obtain single-stranded circular DNA products, with any remaining single-stranded linear DNA being digested and removed. The final single-stranded circular library was amplified using phi29 and rolling circle amplification (RCA) to generate DNA nanoballs (DNBs), which contain multiple copies of the initial single-stranded library molecule. The DNBs were loaded onto a patterned nanoarray, and sequencing reads of 300 base pairs in length were generated using the DNBSEQ-G400 platform (BGI, China).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eProcessing of reads and data analysis\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eIntestinal sample raw reads were processed using the DADA2 plugin within the QIIME2 platform (version 2024.5) to perform denoising and generate amplicon sequence variants (ASVs). Taxonomic assignment of ASVs was conducted using the SILVA 138 reference database, with a similarity threshold of 99%. On average, each sample yielded 44,698\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2,061 high-quality reads. Rarefaction was conducted at a depth of 40,800 sequences, corresponding to the sample with the fewest sequences, utilizing the q2-diversity plugin in QIIME2. Alpha diversity, based on this rarefaction depth, was evaluated using the Shannon index, calculated via the q2-diversity plugin. Principal coordinate analysis (PCoA) based on Bray-Curtis dissimilarity was performed using the \\\"vegan\\\" package (version 2.6-4) in R. Compositional differences were assessed through permutational multivariate analysis of variance (PERMANOVA) and analysis of similarities (ANOSIM), both implemented in the \\\"vegan\\\" package. Statistical differences between two groups were determined using the nonparametric Mann-Whitney U test, while differences among more than two groups were evaluated using the Kruskal-Wallis test. Both tests were conducted using the \\\"stats\\\" package (version 4.2.2) in R. A p-value of less than 0.05 was considered statistically significant.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eStatistical analysis\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAll statistical analyses were conducted using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). Two-way analysis of variance (ANOVA) was conducted, with PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure and gender as between-subject factors. Post hoc analyses were performed using Tukey's or Fisher's tests, as appropriate. For comparisons between two groups, a two-tailed Student's t-test was employed when appropriate. Raw amino acid data were processed using MassHunter Quantitative Analysis software (Agilent Technologies, Santa Clara, CA, USA). For the diversity and composition of intestinal microbiota, statistical differences between two groups were determined using the nonparametric Mann-Whitney U test, while differences among more than two groups were assessed using the Kruskal-Wallis test. A p-value of less than 0.05 was considered statistically significant. Data are presented as means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard error of the mean (SEM).\\u003c/p\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003eimpaired behaviors in adult offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eIn the sociability test, all offspring mice spent significantly more time sniffing the unfamiliar stimulus mouse compared to the empty chamber (Fig.\\u0026nbsp;2A1, Students’ T-test: males-control: t\\u003csub\\u003e5\\u003c/sub\\u003e = 11.57, P \\u0026lt; 0.0001; females-control: t\\u003csub\\u003e4\\u003c/sub\\u003e = 12.29, P = 0.0003; males-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: t\\u003csub\\u003e5\\u003c/sub\\u003e = 59.63, P \\u0026lt; 0.0001; females-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: t\\u003csub\\u003e5\\u003c/sub\\u003e = 19.84, P \\u0026lt; 0.0001), indicating a strong preference for the chamber containing the mouse. A two-way ANOVA of the social preference index revealed a significant effect of treatment (Fig.\\u0026nbsp;2A2: F (1, 19) = 47.23, P \\u0026lt; 0.0001) but no significant effect of sex (F (1, 19) = 0.01152, P = 0.9157) and interaction (F (1, 19) = 2.869, P = 0.1067). Post-hoc test revealed that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e increased exploration index in both male and female offspring (males-control vs males-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P \\u0026lt; 0.01, females-control vs females-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e༚P \\u0026lt; 0.0001), suggesting maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e affected sociability in both male and female offspring.\\u003c/p\\u003e \\u003cp\\u003eIn the social novelty test, control male and female offspring spent significantly more time sniffing the novel stimulus mouse (S2) compared to the familiar stimulus mouse (S1) (Fig.\\u0026nbsp;2B1, Students’ T-test: males-control: t\\u003csub\\u003e5\\u003c/sub\\u003e = 3.786, P \\u0026lt; 0.05; females-control: t\\u003csub\\u003e4\\u003c/sub\\u003e = 3.639, P \\u0026lt; 0.05), suggesting intact social novelty recognition memory. Male offspring (Fig.\\u0026nbsp;2B1, males-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: t\\u003csub\\u003e5\\u003c/sub\\u003e = 5.215, P \\u0026lt; 0.001) but not female offspring (females-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: t\\u003csub\\u003e5\\u003c/sub\\u003e = 0.6012, P = 0.5739) from dams with maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure showed significantly higher exploration ratio to the stimulus mouse. A two-way ANOVA of the social novelty index revealed a significant effect of treatment (Fig.\\u0026nbsp;2A2: F (1, 19) = 5.654, P = 0.0281) but no significant effect of sex (F (1, 19) = 2.896, P = 0.1051) and interaction (F (1, 19) = 0.01797, P = 0.8948). Post- hoc analysis showed no significant difference in exploration index among groups but a decreased trend, suggesting maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e had a tendency to affect social novelty in both male and female offspring (males-control vs males-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.3886; females-control vs females-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.3339).\\u003c/p\\u003e \\u003cp\\u003eTo assess repetitive behavior using the marble burying test, there was a significant effect of treatment (Fig.\\u0026nbsp;2C: F (1, 22) = 13.71, P = 0.0012) but no significant effect of sex (F (1, 22) = 0.3608, P = 0.5542) and interaction (F (1, 22) = 1.661e-005, P = 0.9968). Post-hoc analysis revealed no statistically significant differences in the number of buried marbles between groups (males-control vs males-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.0697; females-control vs females-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.0689). However, the data indicate a strong trend toward an increase in buried marbles in the PM2.5-exposed groups, suggesting increased repetitive behavior in offspring.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003eimpaired working memory in male offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eAll control offspring demonstrated a significantly greater preference for the novel object compared to the familiar object (Fig.\\u0026nbsp;3A1, Students’ T-test: males-control: t\\u003csub\\u003e5\\u003c/sub\\u003e = 11.06, P \\u0026lt; 0.001; females-control: t\\u003csub\\u003e4\\u003c/sub\\u003e = 4.063, P \\u0026lt; 0.05), whereas male and female offspring with PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed dams showed no difference in exploration ratio ( males-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: t\\u003csub\\u003e5\\u003c/sub\\u003e = 1.014, P = 0.357; females-PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: t\\u003csub\\u003e5\\u003c/sub\\u003e = 0.3964, P = 0.7082). In the exploration index, a two-way ANOVA revealed a main effect of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e (Fig.\\u0026nbsp;3A2, F (1, 19) = 15.17, P = 0.0010) and effect of sex (F (1, 19) = 6.412, P = 0.0203), though no significant interaction (F (1, 19) = 1.504, P = 0.235). Notably, maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e significantly reduced exploration index in male offspring, indicating impaired working memory compared to control male offspring (Fig.\\u0026nbsp;3A2, Tukey post hoc test: P = 0.0074 males: control vs. PM\\u003csub\\u003e2.5\\u003c/sub\\u003e). In contrast, PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure did not significantly affect working memory in female offspring compared to controls (Fig.\\u0026nbsp;3A2, P = 0.2849 females: control vs. PM\\u003csub\\u003e2.5\\u003c/sub\\u003e).\\u003c/p\\u003e \\u003cp\\u003eSpatial memory were evaluated using the Y-maze test. Control male and female offspring showed significantly more exploration of the novel arm (Fig.\\u0026nbsp;3B1, Students’ T-test: males-control: t\\u003csub\\u003e4\\u003c/sub\\u003e = 6.862, P \\u0026lt; 0.01; females-control: t\\u003csub\\u003e4\\u003c/sub\\u003e = 3.492, P \\u0026lt; 0.05). PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed male offspring showed significant difference in exploration between novel and familiar arms but maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed female offspring did not exhibit significant differences in exploration (males-control: t\\u003csub\\u003e6\\u003c/sub\\u003e = 2.749, P \\u0026lt; 0.05; females-control: t\\u003csub\\u003e6\\u003c/sub\\u003e = 1.223, P = 0.2673). Two-way ANOVA of the exploration index showed significant gender (Fig.\\u0026nbsp;3B2, F (1, 22) = 5.5, P = 0.0291) and treatment effects (F (1, 22) = 10, P = 0.0043), but not interaction effect (F (1, 22) = 0.52, P = 0.4771). There were no significant differences in exploration index (Fig.\\u0026nbsp;3B2, Tukey post hoc test: males: control vs. males: PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.328) and female offspring (females: control vs. females: PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.0515).\\u003c/p\\u003e \\u003cp\\u003eThe open field test assessed locomotor activity (Fig.\\u0026nbsp;3C1) and anxiety-like behavior (Fig.\\u0026nbsp;3C2). Two-way ANOVA showed no interaction effects for distance traveled (interaction: F(1, 19) = 0.2172, P = 0.6465; gender factor: F (1, 19) = 0.09725, P = 0.7586; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e factor: F (1, 19) = 0.005082, P = 0.9439), and time spent in the center (interaction: F (1, 19) = 0.5773, P = 0.4567; gender factor F (1, 19) = 0.05048, P = 0.8246; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e Factor F (1, 19) = 2.431, P = 0.1355). Tukey post hoc test showed that no significant changes were observed in distance traveled (males: control vs. males: PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.9794, females: control vs. females: PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.9927) or time spent in the center (males: control vs. males: PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.9371, females: control vs. females: PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: P = 0.401) between control and PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed groups. Two-way ANOVA showed no interaction effects for immobility in the forced swimming test (interaction factor F (1, 19) = 2.070, P = 0.1665; gender factor F (1, 19) = 0.02094, P = 0.8865; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e factor F (1, 19) = 0.01981, P = 0.8896), indicating no significant difference in depression-like behavior in offspring.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003eenhanced hippocampal cell proliferation and neuronal differentiation in male offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eWe investigated the effects of maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e on hippocampal neurogenesis in offspring, focusing on cell proliferation and neuronal differentiation. We assessed neurogenesis by measuring cell proliferation (Ki67+), the number of immature neurons (DCX+), and neuronal differentiation (NeuroD+).\\u003c/p\\u003e \\u003cp\\u003eOur findings indicate that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e significantly increased the number of Ki67 + cells in the dorsal and ventral DG of male offspring, as demonstrated by a main effect of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e treatment (F (1, 19) = 14.72, P = 0.0011), though no significant interaction (F (1, 19) = 2.377, P = 0.1396) and sex effect (F (1, 19) = 0.4581, P = 0.5067). Similarly, the analysis of the ventral DG revealed a significant main effect of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e (F (1, 19) = 9.003, P = 0.0074) and a significant interaction effect (F (1, 19) = 4.394, P = 0.0497), although no main effect of sex (F (1, 19) = 0.7991, P = 0.3825). Post hoc tests confirmed that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure increased Ki67 + cell proliferation in both dorsal and ventral DG of male offspring compared to control group (P \\u0026lt; 0.01), while no significant differences were observed in females (dorsal: P = 0.4098; ventral: P = 0.9228). Furthermore, the number of NeuroD + cells significantly increased in the dorsal DG following maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure, indicating a significant treatment effect (F (1, 19) = 99, P \\u0026lt; 0.0001), without a significant sex effect (F (1, 19) = 0.0049, P = 0.9447) or interaction (F (1, 19) = 0.94, P = 0.3444). However, the number of NeuroD + cells did not increase in the ventral DG following maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure, with no treatment effect (F (1, 19) = 3.723, P = 0.0688), sex effect (F (1, 19) = 0.5598, P = 0.4635) or interaction (F (1, 19) = 0.4415, P = 0.5144). Post hoc tests confirmed that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure highly increased NeuroD + cells in both male and female offspring compared to control group in dorsal DG (P \\u0026lt; 0.0001), while no significant effects were observed in the ventral DG for either sex (males: P = 0.7964; females: P = 0.3075 compared to control counterpart).\\u003c/p\\u003e \\u003cp\\u003eThe two-way ANOVA analysis showed that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e did not significantly affect the number of DCX + cells in the dorsal DG for either sex (main effect of treatment: F (1, 18) = 0.7912, P = 0.3855; main effect of sex: F (1, 18) = 0.2672, P = 0.6115; interaction: F (1, 18) = 0.1956, P = 0.6636). Post hoc tests revealed no significant increase in DCX + cells in the dorsal DG of male offspring (P = 0.7831 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control) and female offspring (P = 0.9887 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control). Similarly, no significant effects of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure were observed in the ventral DG (treatment: (F (1, 19) = 9.003, P = 0.0074); sex effect (F (1, 19) = 0.7991 P = 0.3825; interaction effect (F (1, 19) = 0.94, P = 0.3444). Post-hoc analyses showed no significant differences in the number of DCX + cells in the ventral DG between the PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed and control groups for male offspring (P = 0.9812) and female offspring (P \\u0026gt; 0.9999).\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, our study highlights sex-specific effects of maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure on hippocampal neurogenesis, with significant increases in cell proliferation and neuronal differentiation observed in male offspring.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003ereduced dendritic branch length of hippocampal immature neurons in female offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eWe next examined whether maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure impaired dendritic development of immature neurons undergoing dendritic maturation. Morphological analysis of immature neurons (DCX + cell) in offspring mice (Fig.\\u0026nbsp;5A) was performed using Sholl analysis. A two-way ANOVA revealed a main treatment-specific effect (Fig.\\u0026nbsp;5B: F (1, 95) = 10.29, P = 0.0018) and highly sex-specific effect (F (1, 95) = 5.105, P = 0.0261) on total dendritic length, but no interaction effect (F (1, 95) = 0.7734, P = 0.3814) was observed. Post-hoc analysis indicated a significant reduction in total dendritic length in female offspring exposed to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e compared to controls (P \\u0026lt; 0.05), whereas no significant difference was found in male offspring (P = 0.3623 vs. control male offspring). There was no significant difference in dendritic length in offspring (Fig.\\u0026nbsp;5C: main effect of treatment: F (1, 20) = 2.480, P = 0.1310; main effect of sex: F (1, 20) = 1.834, P = 0.1908; interaction: F (1, 20) = 0.6017, P = 0.4470).\\u003c/p\\u003e \\u003cp\\u003eGolgi-Cox staining (Fig.\\u0026nbsp;5D) demonstrated that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e did not affect the density of dendritic spines in the hippocampal DG region in either male or female offspring (Fig.\\u0026nbsp;5E: main effect of treatment: F (1, 22) = 0.42, P = 0.5241; main effect of sex: F(1, 22) = 1.4, P = 0.2457; interaction: F(1, 22) = 0.47, P = 0.4999).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003eimpaired hippocampal synaptic plasticity in both male and female offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eField recording revealed that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e resulted in a significant reduction in LTP in both male and female pups (Fig.\\u0026nbsp;6A: main effect of treatment: F (1, 316) = 91.37, P \\u0026lt; 0.0001; main effect of sex: F (1, 316) = 5.459, P = 0.0201; interaction: F (1, 316) = 3.382, P = 0.0669). Tukey post hoc test confirmed that a significant reduction in LTP of male offspring (P \\u0026lt; 0.0001 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control) and female offspring (P \\u0026lt; 0.0001 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control). This reduction was evidenced by a significant decrease in the average fEPSP slope change compared to control mice (Fig.\\u0026nbsp;6B: main effect of treatment: F (1, 44) = 44.58, P \\u0026lt; 0.0001; main effect of sex: F (1, 44) = 0.01991, P = 0.8884; interaction: F (1, 44) = 0.4213, P = 0.5197). Post hoc tests revealed a significant decrease in the average fESP slope change of male offspring (P \\u0026lt; 0.0001 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control) and in female offspring (P = 0.0006 female vs. control). We also assessed synaptic transmission efficiency through I/O responses. The analysis revealed no significant difference in the I/O response in offspring (Fig.\\u0026nbsp;6C; main effect of treatment: F (6, 312) = 20.61, P \\u0026lt; 0.0001; main effect of sex: F (18, 312) = 0.1169, P \\u0026gt; 0.9999; interaction: F (3, 312) = 0.4959, P = 0.6854), suggesting that basal synaptic transmission remains intact.\\u003c/p\\u003e \\u003cp\\u003eTo evaluate short-term plasticity using a paired-pulse conditioning stimulation protocol, there was no significant difference (Fig.\\u0026nbsp;6D; main effect of treatment: F (1, 44) = 1.871, P = 0.1783; main effect of sex: F (1, 44) = 0.1751, P = 0.6777; interaction: F (1, 44) = 0.1280, P = 0.7222).Collectively, these results suggest that chronic maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e reduced hippocampal LTP formation in offspring, impairing synaptic plasticity in the DG region of the hippocampus.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003ereduced synaptic proteins in offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eWe next examined changes of synaptic proteins in the hippocampal tissues (Fig.\\u0026nbsp;7A). Figure\\u0026nbsp;7A- Two-way ANOVA revealed a main sex-specific effect (F (1, 20) = 8.423, P = 0.0088) and interaction effect (F (1, 20) = 8.423, P = 0.0088), but not a treatment-specific effect (F (1, 20) = 0.6247, P = 0.4386), on hippocampal brain-derived neurotrophic factor (BDNF) levels (Fig.\\u0026nbsp;7B). Post-hoc analysis indicated that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure did not significantly affect BDNF levels in either sex compared to controls (males: P = 0.4598; females: P = 0.9379). PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure did not significantly alter the levels of synaptophysin (SYN) (Fig.\\u0026nbsp;7C: interaction: F (1, 20) = 0.5700, P = 0.4591; gender: F (1, 20) = 0.5700, P = 0.4591; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 20) = 0.003697, P = 0.9521) and PSD-95 proteins (Fig.\\u0026nbsp;7D: PSD-95, interaction: F (1, 20) = 0.5700, P = 0.4591; gender: F (1, 20) = 0.5700, P = 0.4591; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 20) = 0.003697, P = 0.9521) in the hippocampi of offspring mice. PM\\u003csub\\u003e2.5\\u003c/sub\\u003e treatment did not affect GluN2A protein levels (Fig.\\u0026nbsp;7E gender effect ( F (1, 20) = 1.054, P = 0.3169) and interaction effect ( F (1, 20) = 1.054, P = 0.3169). However, there was a main treatment effect (Fig.\\u0026nbsp;7F. (F (1, 20) = 24.40, P \\u0026lt; 0.0001), but not sex-specific effect (F (1, 20) = 0.01762, P = 0.8957) and interaction effect (F (1, 20) = 0.01762, P = 0.8957) on hippocampal GluN2B levels. Post-hoc tests revealed that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure reduced GluN2B protein expression in the hippocampi of both male and female offspring (males: P \\u0026lt; 0.01 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control; females: P \\u0026lt; 0.01 PM\\u003csub\\u003e2.5\\u003c/sub\\u003e vs. control), suggesting impaired LTP formation could be linked to reduction in GluN2B subunit of the NMDA receptors.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMetabolomic analysis of amino acid levels in the hippocampus of offspring\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAmino acids play crucial roles in neurodevelopmental disorders associated with ASD [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. To investigate the effect of maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e on hippocampal amino acid levels in both mothers and offspring mice, we measured the concentrations of twenty standard amino acids in the hippocampus (Fig.\\u0026nbsp;8A). Targeted metabolomics revealed a significant decrease in the concentration of glutamic acid in the PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed mothers (PMO group: 386 ± 11 µM) than in the control mothers (CMO group: 422 ± 7 µM) (Fig.\\u0026nbsp;8B: p \\u0026lt; 0.05). A two-way ANOVA revealed no significant differences in glutamic acid levels in the offspring mice (Fig.\\u0026nbsp;8B: interaction: F (1, 17) = 0.3579, P = 0.5575; gender: F (1, 17) = 0.01324, P = 0.9097; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 17) = 0.3050, P = 0.5880). Offspring mice displayed significant decrease in cysteine levels. A two-way ANOVA indicated a significant treatment-specific effect on hippocampal cysteine levels, but no sex-specific effect was found (main effect of treatment: F (1, 19) = 52.75, P \\u0026lt; 0.0001; main effect of sex: F (1, 19) = 2.329, P = 0.1434; interaction: F (1, 19) = 2.040, P = 0.1694). Specifically, both female and male offspring with dams exposed to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exhibited significantly lower cysteine concentrations compared to those in the control groups with Tukey's post-hoc test (Fig.\\u0026nbsp;8C: males: P \\u0026lt; 0.01, females: P \\u0026lt; 0.001).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal exposure to PM\\u003c/b\\u003e \\u003csub\\u003e \\u003cb\\u003e2.5\\u003c/b\\u003e \\u003c/sub\\u003e \\u003cb\\u003edid not induce neuroinflammation in the hippocampus of offspring\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eOur study aims to investigate whether maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e induces autism-like behaviors in offspring and whether these behaviors are associated with a neuroinflammatory response. We assessed neuroinflammation by examining the number of ionized calcium-binding adapter molecule 1 (IBA-1) positive microglial cells in the hippocampus. Two-way ANOVA revealed no significant inflammatory response in the hippocampal subregions in the DG (Fig.\\u0026nbsp;9B: interaction: F(1, 20) = 0.8710, P = 0.3618; gender: F (1, 20) = 0.1625, P = 0.6911; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 20) = 0.9950, P = 0.3304) and CA3 region (Fig.\\u0026nbsp;9D: interaction: (F(1, 20) = 0.5972, P = 0.4487; gender: F (1, 20) = 0.06823, P = 0.7966; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 20) = 1.184, P = 0.2896). A two-way ANOVA showed a main treatment-specific effect (F (1, 20) = 6.203, P = 0.0217), but not sex-specific effect (F (1, 20) = 1.672, P = 0.2107) and interaction effect (F (1, 20) = 0.3840, P = 0.5424) on inflammatory response in the hippocampal subregions in the CA1 region. Post hoc analysis confirmed no significant changes in the number of IBA-1 positive cells in the DG (males: P \\u0026gt; 0.9999, females: P = 0.5344), CA1 (males: P = 0.5597, females: P = 0.1576), and CA3 (males: P = 0.996, females: P = 0.564).\\u003c/p\\u003e \\u003cp\\u003eAdditionally, there were no significant changes in the levels of HMGB1, TNF-α, and MMP-9 proteins (Fig.\\u0026nbsp;9E-G). The ANOVA results showed no significant effects for HMGB1 (Fig.\\u0026nbsp;9E: interaction: (F (1, 20) = 1.802, P = 0.1945; gender: F (1, 20) = 0.4713, P = 0.5003; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 20) = 0.5959, P = 0.4492) and MMP-9 levels (Fig.\\u0026nbsp;9G: interaction: (F (1, 20) = 0.3252, P = 0.5749; gender: F (1, 20) = 0.04604, P = 0.8323; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: F (1, 20) = 1.137, P = 0.2989). A two-way ANOVA showed a main sex-specific effect (F (1, 16) = 4.483, P = 0.0503), but not treatment-specific effect (F (1, 20) = 1.672, P = 0.2107) and interaction effect (F (1, 16) = 0.02486, P = 0.8767) on TNF-α level.\\u003c/p\\u003e \\u003cp\\u003eFurthermore, post hoc tests indicated no significant differences in hippocampal levels of HMGB1 (males: P \\u0026gt; 0.9999, females: P = 0.5344), TNF-α (males: P = 0.4017, females: P = 0.5256), and MMP-9 (males: P = 0.6595, females: P = 0.9847) across all groups. These findings suggest that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure does not induce a detectable neuroinflammatory response in the hippocampus of offspring.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eIntestinal microbiota in male offspring with decreased relative abundance of\\u003c/b\\u003e \\u003cb\\u003eBacteroidaceae\\u003c/b\\u003e \\u003cb\\u003efamily\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eIn the analysis of alpha-diversity, the Shannon index revealed that PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed groups had significantly lower diversity compared to healthy groups (P = 0.020, Fig.\\u0026nbsp;10A). However, no significant differences were observed in the Shannon index for male offspring (P = 0.240 vs. control male offspring) and female offspring (P = 0.589 vs. control female offspring) when exposed to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e. A marginally significant difference was noted in female mother groups between PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed and healthy groups (P = 0.065, Fig.\\u0026nbsp;10A). Regarding beta-diversity, a main treatment-specific effect was identified, but no gender-specific effect was observed (Fig.\\u0026nbsp;10B, PERMANOVA: Interaction: R² = 0.170, P = 0.269; PM\\u003csub\\u003e2.5\\u003c/sub\\u003e: R² = 0.031, P = 0.290; Gender: R² = 0.102, P = 0.006). The ANOSIM test indicated a significant difference in the intestinal bacterial communities of female mothers between PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed and healthy groups (R = 0.233, P = 0.024). The top 10 most abundant bacterial genera across all samples were analyzed to identify functionally important taxa affected by PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure (Fig.\\u0026nbsp;10C). The dominant genus was \\u003cem\\u003eMuribaculaceae\\u003c/em\\u003e, with no significant differences observed in these genera upon PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure. Further comparisons of the most abundant bacterial classes (Fig.\\u0026nbsp;10D) and families (Fig.\\u0026nbsp;10E) revealed a significantly lower relative abundance of the classes \\u003cem\\u003eCampylobacteria\\u003c/em\\u003e (P = 0.026 vs. control female mother) and \\u003cem\\u003eSaccharimonadia\\u003c/em\\u003e (P = 0.026 vs. control female mother) in female mothers exposed to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e compared to healthy groups (Fig.\\u0026nbsp;10D). Additionally, a significantly lower relative abundance of the family \\u003cem\\u003eBacteroidaceae\\u003c/em\\u003e (P = 0.015 vs. control male offspring) was found in PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-treated male offspring compared to healthy groups (Fig.\\u0026nbsp;10E).\\u003c/p\\u003e \"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eWe found that offspring from mother exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e displayed behavioral abnormalities and hippocampal dysfunction with a gender effect. Both male and female offspring showed some behavioral abnormalities in association with male offspring exhibiting more proliferating progenitor cells and immature neurons in the hippocampus, while females showing reduced dendritic length of immature neurons. Both sexes experienced decreased LTP formation and synaptic GluN2B protein expression and a significant decrease in cysteine levels in the hippocampus. These changes are independent of neuroinflammatory responses and changes in gut microbiota profile. Our findings suggest that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure may contribute to autism-like behaviors in offspring, with hippocampal dysfunction and reduced cysteine levels.\\u003c/p\\u003e\\u003cp\\u003ePrevious epidemiological studies have shown that prenatal and/or postnatal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e increases the likelihood of offspring developing ASD [\\u003cspan additionalcitationids=\\\"CR49\\\" citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e–\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e], with some studies suggesting that this exposure could potentially double the risk of ASD development [\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. In rodent models, direct exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e in young rats has been associated with autistic-like behaviors [\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e]. Our results provided evidence showing the link between maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure and behavioral deficits in adult offspring that assemble some autistic-like behaviors.\\u003c/p\\u003e\\u003cp\\u003eDefects in neuronal maturation have been observed in multiple regions associated with ASD, suggesting dysregulation in adult neurogenesis, neuronal migration, and/or maturation [\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e]. Our findings indicate increased proliferating cells and mature neurons in the hippocampus, with no change in the number of immature neurons or spine density following exposure, but a reduction in the total dendritic length of immature neurons in female offspring. In contrast, Wang et al. reported that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e decreases neurogenesis rates[\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e]. This could be due to the fact that exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e at different developmental stages may yield different effect on neuronal development and function[\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e]. In our study, mice were 42 days old, primarily reflecting adult neurogenesis, whereas Wang's study involved mice at 14 days old, a period of active developmental stages. Similarly, Juliandi et al. found that prenatal exposure to valproic acid in an autism model of mice led to cognitive impairments postnatally, potentially due to premature enhancement of embryonic neurogenesis [\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e]. This premature enhancement may deplete the neural progenitor cell (NPC) pool, subsequently inhibiting adult hippocampal neurogenesis. In ferret pups, exposure to VPA resulted in disrupted social behaviors and promoted the proliferation of neural progenitor cells in the DG, introducing additional NPCs into the DG granule cell layer [\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e]. This observation aligns with our research findings.\\u003c/p\\u003e\\u003cp\\u003eIn the cellular culture analysis of reprogrammed fibroblasts, induced pluripotent stem cells, neural progenitor cells, and neurons derived from individuals with autism exhibited increased cell proliferation [\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e]. Similarly, three-dimensional neural cultures from induced pluripotent stem cells of individuals with autism demonstrated upregulation of genes associated with cell proliferation and neuronal differentiation [\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e]. Watanabe et al. found that developmental exposure to risk factors in autistic rats primarily affects interneurons, which later impacts the proliferation of neural progenitor cells in the subgranular zone, leading to an increased number of granule cell layer neurons in the rat hippocampus [\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e]. Other studies, through the analysis of neuronal ultrastructure, have found that exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e during pregnancy leads to an increase in synaptic clefts, thinning of postsynaptic density, shortening of synaptic active zones, as well as swelling of mitochondrial matrix, partial blurring of mitochondrial cristae, and mitochondrial vacuolation in the hippocampal neurons of mouse offspring [\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e]. These findings align with our results, which demonstrate an increase in neuronal differentiation. However, further investigation is needed to identify the specific types of neurons involved. Although the number of immature neurons remained relatively unchanged, we observed a notable reduction in total dendritic length in female offspring. Collectively, these studies, along with our data, suggest that dysregulation of neural progenitor cell proliferation and delayed neuronal maturation occurred in the hippocampus with a gender specific effect. Changes of hippocampal structural plasticity may partly contribute to core behavioral deficits associated with ASD. Our research provides unique insights into the significant structural changes in hippocampal neurons resulting from maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e.\\u003c/p\\u003e\\u003cp\\u003eSynaptic plasticity is regulated by various mechanisms, including changes in receptor numbers, neurotransmitter release, and synaptic site localization. Maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure may alter dendritic branching, dendritic spine density, and morphology, potentially disrupting these processes and impairing synaptic transmission in the offspring's brain. PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure reduced cell viability, increased apoptosis, and synaptic damage in primary cultured hippocampal neurons [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e]. N-Methyl-D-Aspartate receptor (NMDAR)-dependent synaptic plasticity is a key mediator of hippocampus-dependent learning and memory processes [\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e]. Alterations in signaling of NMDARs containing the GluN2B subunit can inhibit dendritic spine density and impair learning capabilities [\\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e66\\u003c/span\\u003e]. In this study, we observed a reduction in LTP in the offspring, suggesting that maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure diminishes hippocampal long-term synaptic plasticity. Western blotting revealed a significant decrease in GluN2B expression in the hippocampus of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-exposed offspring compared to controls. Previous studies have shown that the absence of GluN2B in the hippocampus impairs dendritic spine density and hippocampal-mediated learning and memory [\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e], underscoring the critical role of GluN2B in modulating synaptic plasticity. Further investigation into the potential mechanisms linking GluN2B and hippocampal synaptic plasticity in offspring exposed to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e is warranted.\\u003c/p\\u003e\\u003cp\\u003eNumerous studies have identified a link between maternal inflammation during early pregnancy and an increased risk of ASD [\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e]. Our results showed no significant changes in the levels of HMGB1, TNF-α, MMP-9 proteins, or in the number of Iba-1 positive microglial cells in the hippocampus. These findings are consistent with postmortem studies of the hippocampal region by Vargas et al., which also reported no significant inflammation[\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e]. Another study found no pronounced inflammation in the hippocampus but observed abnormally small and densely distributed hippocampal neurons with reduced complexity and dendritic arbor length [\\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e]. These observations suggest that hippocampal inflammation may not be the necessary mechanism underlying PM\\u003csub\\u003e2.5\\u003c/sub\\u003e-induced ASD during pregnancy. Instead, alterations in neuronal maturation and differentiation might contribute to behavioral deficits. Some studies have reported increased inflammation only in high-dose PM\\u003csub\\u003e2.5\\u003c/sub\\u003e groups [\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e]. In contrast, our study used lower doses, which may explain the differences in findings. Further research is needed to determine the specific PM\\u003csub\\u003e2.5\\u003c/sub\\u003e dose and duration of exposure required to trigger neuroinflammation.\\u003c/p\\u003e\\u003cp\\u003eThe maternal microbiome plays a critical role in offspring’s neurodevelopment [\\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e], possibly because maternal gut microbiota affects the availability of essential metabolites required for fetal development [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Clinical studies have demonstrated that changes of gut microbiota found in children with ASD are also presented in their mothers [\\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e], and gut microbiota shared in children and their mothers is related to developmental disability and social behavioral deficits [\\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e]. Findings from animal research provide further support for the link between microbiota and ASD in clinical studies. Previous studies have shown that alterations in the gut microbiota can lead to long-term enhancements in adult neurogenesis [\\u003cspan citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e76\\u003c/span\\u003e] and synaptic transmission [\\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e77\\u003c/span\\u003e]. Gut microbiota can influence brain function and behavior by producing various metabolites, such as short-chain fatty acids and neurotransmitter precursors [\\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e]. Our findings revealed that PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure significantly decreased abundance of the \\u003cem\\u003eBacteroidaceae\\u003c/em\\u003e family only in male offspring. These findings suggest that maternal gut microbiota potentially influenced by environmental exposures such as PM2.5 may contribute to offspring neurodevelopmental outcomes in a sex-specific manner, possibly through alterations in microbiota composition and associated metabolite production.\\u003c/p\\u003e\\u003cp\\u003eSynaptic plasticity and memory function in the brain are primarily driven by NMDAR, which require the binding of glutamate and the co-agonist D-serine at the glycine site. Cysteine also plays a crucial role in hippocampal synaptic plasticity, influencing synaptic transmission [\\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e79\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e], neuronal connectivity [\\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e81\\u003c/span\\u003e], and the regulation of the intracellular environment [\\u003cspan citationid=\\\"CR82\\\" class=\\\"CitationRef\\\"\\u003e82\\u003c/span\\u003e], thereby affecting learning and memory. In this study, metabolomic analysis revealed that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e results in decreased glutamate levels in the maternal body and reduced cysteine levels in the offspring's hippocampal tissue. Research indicates that melatonin treatment significantly increased cysteine-rich protein 1 levels, contributing to dendritic branching in mouse hippocampal neurons [\\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e83\\u003c/span\\u003e]. Neuronal uptake of cysteine via excitatory amino acid carriers can mitigate ischemia-induced neuronal death by promoting glutathione synthesis in the hippocampus of ischemic animal models [\\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e83\\u003c/span\\u003e]. Furthermore, administration of L-cysteine (L-Cys) has been shown to improve behavioral, biochemical, neurochemical, and redox status in the central nervous system [\\u003cspan citationid=\\\"CR84\\\" class=\\\"CitationRef\\\"\\u003e84\\u003c/span\\u003e]. Prenatal supplementation with the antioxidant N-acetyl cysteine (NAC) offers protective benefits for fetal neurodevelopment against the adverse effects of prenatal restraint stress and maternal high-fat diet [\\u003cspan citationid=\\\"CR85\\\" class=\\\"CitationRef\\\"\\u003e85\\u003c/span\\u003e]. Early supplementation with antioxidants such as NAC or L-Cys may represent a promising therapeutic strategy for addressing neurodevelopmental disorders. Our results discovered deficiency of cysteine in the hippocampus of offspring displaying hippocampal atrophy and behavioral deficit, suggesting the critical role of cysteine in the impact of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e on hippocampal function.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusion\",\"content\":\"\\u003cp\\u003eOur study provides evidence that maternal exposure to PM\\u003csub\\u003e2.5\\u003c/sub\\u003e significantly impacts hippocampal function of offspring with a gender effect, resulting in autism-like behaviors. These effects are intricately linked to structural and functional alterations in the hippocampus, including disrupted synaptic plasticity and neuronal dendric development. Specifically, PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure leads to notable reductions in cysteine levels in the hippocampus, which may contribute to impaired long-term potentiation formation and behavioral deficits. These findings emphasize the connection between maternal PM\\u003csub\\u003e2.5\\u003c/sub\\u003e exposure, reduction of cysteine levels and alterations in hippocampal plasticity, providing evidence showing the possible impacts of PM\\u003csub\\u003e2.5\\u003c/sub\\u003e on inducing behavioral abnormalities in offspring\\u0026rsquo;s brain development.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of interests\\u003c/strong\\u003e\\u003cbr\\u003e\\u0026nbsp;\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp;☒\\u0026nbsp;The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\\u003cbr\\u003e\\u0026nbsp;\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp;☐\\u0026nbsp;The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:\\u003cbr\\u003e\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBaio J, Wiggins L, Christensen DL, Maenner MJ, Daniels J, Warren Z, Kurzius-Spencer M, Zahorodny W, Robinson Rosenberg C, White T\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003ePrevalence of Autism Spectrum Disorder Among Children Aged 8 Years - Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2014\\u003c/strong\\u003e. \\u003cem\\u003eMMWR Surveill Summ \\u003c/em\\u003e2018, \\u003cstrong\\u003e67\\u003c/strong\\u003e(6).\\u003c/li\\u003e\\n\\u003cli\\u003eSun X, Allison C, Wei L, Matthews FE, Auyeung B, Wu YY, Griffiths S, Zhang J, Baron-Cohen S, Brayne C: \\u003cstrong\\u003eAutism prevalence in China is comparable to Western prevalence\\u003c/strong\\u003e. \\u003cem\\u003eMolecular autism \\u003c/em\\u003e2019, \\u003cstrong\\u003e10\\u003c/strong\\u003e:7.\\u003c/li\\u003e\\n\\u003cli\\u003eHallmayer J, Cleveland S, Torres A, Phillips J, Cohen B, Torigoe T, Miller J, Fedele A, Collins J, Smith K\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eGenetic heritability and shared environmental factors among twin pairs with autism\\u003c/strong\\u003e. \\u003cem\\u003eArchives of general psychiatry \\u003c/em\\u003e2011, \\u003cstrong\\u003e68\\u003c/strong\\u003e(11):1095-1102.\\u003c/li\\u003e\\n\\u003cli\\u003eSuades-Gonzalez E, Gascon M, Guxens M, Sunyer J: \\u003cstrong\\u003eAir Pollution and Neuropsychological Development: A Review of the Latest Evidence\\u003c/strong\\u003e. \\u003cem\\u003eEndocrinology \\u003c/em\\u003e2015, \\u003cstrong\\u003e156\\u003c/strong\\u003e(10):3473-3482.\\u003c/li\\u003e\\n\\u003cli\\u003eRuiz-Sobremazas D, Rodulfo-C\\u0026aacute;rdenas R, Ruiz-Coca M, Morales-Navas M, Teresa Colomina M, L\\u0026oacute;pez-Granero C, S\\u0026aacute;nchez-Santed F, Perez-Fernandez C: \\u003cstrong\\u003eUncovering the link between air pollution and neurodevelopmental alterations during pregnancy and early life exposure: A systematic review\\u003c/strong\\u003e. \\u003cem\\u003eNeurosci Biobehav Rev \\u003c/em\\u003e2023, \\u003cstrong\\u003e152\\u003c/strong\\u003e:105314.\\u003c/li\\u003e\\n\\u003cli\\u003eLyall K, Schmidt RJ, Hertz-Picciotto I: \\u003cstrong\\u003eMaternal lifestyle and environmental risk factors for autism spectrum disorders\\u003c/strong\\u003e. \\u003cem\\u003eInt J Epidemiol \\u003c/em\\u003e2014, \\u003cstrong\\u003e43\\u003c/strong\\u003e(2):443-464.\\u003c/li\\u003e\\n\\u003cli\\u003eDutheil F, Comptour A, Morlon R, Mermillod M, Pereira B, Baker JS, Charkhabi M, Clinchamps M, Bourdel N: \\u003cstrong\\u003eAutism spectrum disorder and air pollution: A systematic review and meta-analysis\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Pollut \\u003c/em\\u003e2021, \\u003cstrong\\u003e278\\u003c/strong\\u003e:116856.\\u003c/li\\u003e\\n\\u003cli\\u003eLin H-H, Jung C-R, Lin C-Y, Chang Y-C, Hsieh C-Y, Hsu P-C, Chuang B-R, Hwang B-F: \\u003cstrong\\u003ePrenatal and postnatal exposure to heavy metals in PM2.5 and autism spectrum disorder\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Res \\u003c/em\\u003e2023, \\u003cstrong\\u003e237\\u003c/strong\\u003e(Pt 1):116874.\\u003c/li\\u003e\\n\\u003cli\\u003eRahman MM, Shu Y-H, Chow T, Lurmann FW, Yu X, Martinez MP, Carter SA, Eckel SP, Chen J-C, Chen Z\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003ePrenatal Exposure to Air Pollution and Autism Spectrum Disorder: Sensitive Windows of Exposure and Sex Differences\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Health Perspect \\u003c/em\\u003e2022, \\u003cstrong\\u003e130\\u003c/strong\\u003e(1):17008.\\u003c/li\\u003e\\n\\u003cli\\u003eKumar RK, Shadie AM, Bucknall MP, Rutlidge H, Garthwaite L, Herbert C, Halliburton B, Parsons KS, Wark PAB: \\u003cstrong\\u003eDifferential injurious effects of ambient and traffic-derived particulate matter on airway epithelial cells\\u003c/strong\\u003e. \\u003cem\\u003eRespirology \\u003c/em\\u003e2015, \\u003cstrong\\u003e20\\u003c/strong\\u003e(1):73-79.\\u003c/li\\u003e\\n\\u003cli\\u003eAhadullah, Yau S-Y, Lu H-X, Lee TMC, Guo H, Chan CCH: \\u003cstrong\\u003ePM2.5 as a potential risk factor for autism spectrum disorder: Its possible link to neuroinflammation, oxidative stress and changes in gene expression\\u003c/strong\\u003e. \\u003cem\\u003eNeurosci Biobehav Rev \\u003c/em\\u003e2021, \\u003cstrong\\u003e128\\u003c/strong\\u003e:534-548.\\u003c/li\\u003e\\n\\u003cli\\u003eZheng X, Wang X, Wang T, Zhang H, Wu H, Zhang C, Yu L, Guan Y: \\u003cstrong\\u003eGestational Exposure to Particulate Matter 2.5 (PM2.5) Leads to Spatial Memory Dysfunction and Neurodevelopmental Impairment in Hippocampus of Mice Offspring\\u003c/strong\\u003e. \\u003cem\\u003eFront Neurosci \\u003c/em\\u003e2018, \\u003cstrong\\u003e12\\u003c/strong\\u003e:1000.\\u003c/li\\u003e\\n\\u003cli\\u003ePower MC, Lamichhane AP, Liao D, Xu X, Jack CR, Gottesman RF, Mosley T, Stewart JD, Yanosky JD, Whitsel EA: \\u003cstrong\\u003eThe Association of Long-Term Exposure to Particulate Matter Air Pollution with Brain MRI Findings: The ARIC Study\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Health Perspect \\u003c/em\\u003e2018, \\u003cstrong\\u003e126\\u003c/strong\\u003e(2):027009.\\u003c/li\\u003e\\n\\u003cli\\u003eRossi CC, Van de Water J, Rogers SJ, Amaral DG: \\u003cstrong\\u003eDetection of plasma autoantibodies to brain tissue in young children with and without autism spectrum disorders\\u003c/strong\\u003e. \\u003cem\\u003eBrain Behav Immun \\u003c/em\\u003e2011, \\u003cstrong\\u003e25\\u003c/strong\\u003e(6):1123-1135.\\u003c/li\\u003e\\n\\u003cli\\u003eRaymond GV, Bauman ML, Kemper TL: \\u003cstrong\\u003eHippocampus in autism: a Golgi analysis\\u003c/strong\\u003e. \\u003cem\\u003eActa Neuropathol \\u003c/em\\u003e1996, \\u003cstrong\\u003e91\\u003c/strong\\u003e(1):117-119.\\u003c/li\\u003e\\n\\u003cli\\u003eGreco CM, Navarro CS, Hunsaker MR, Maezawa I, Shuler JF, Tassone F, Delany M, Au JW, Berman RF, Jin L-W\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eNeuropathologic features in the hippocampus and cerebellum of three older men with fragile X syndrome\\u003c/strong\\u003e. \\u003cem\\u003eMol Autism \\u003c/em\\u003e2011, \\u003cstrong\\u003e2\\u003c/strong\\u003e(1):2.\\u003c/li\\u003e\\n\\u003cli\\u003eYau S-Y, Bettio L, Chiu J, Chiu C, Christie BR: \\u003cstrong\\u003eFragile-X Syndrome Is Associated With NMDA Receptor Hypofunction and Reduced Dendritic Complexity in Mature Dentate Granule Cells\\u003c/strong\\u003e. \\u003cem\\u003eFrontiers In Molecular Neuroscience \\u003c/em\\u003e2018, \\u003cstrong\\u003e11\\u003c/strong\\u003e:495.\\u003c/li\\u003e\\n\\u003cli\\u003eBarnea-Goraly N, Frazier TW, Piacenza L, Minshew NJ, Keshavan MS, Reiss AL, Hardan AY: \\u003cstrong\\u003eA preliminary longitudinal volumetric MRI study of amygdala and hippocampal volumes in autism\\u003c/strong\\u003e. \\u003cem\\u003eProgress In Neuro-psychopharmacology \\u0026amp; Biological Psychiatry \\u003c/em\\u003e2014, \\u003cstrong\\u003e48\\u003c/strong\\u003e:124-128.\\u003c/li\\u003e\\n\\u003cli\\u003eSchumann CM, Hamstra J, Goodlin-Jones BL, Lotspeich LJ, Kwon H, Buonocore MH, Lammers CR, Reiss AL, Amaral DG: \\u003cstrong\\u003eThe amygdala is enlarged in children but not adolescents with autism; the hippocampus is enlarged at all ages\\u003c/strong\\u003e. \\u003cem\\u003eJ Neurosci \\u003c/em\\u003e2004, \\u003cstrong\\u003e24\\u003c/strong\\u003e(28):6392-6401.\\u003c/li\\u003e\\n\\u003cli\\u003eGroen W, Teluij M, Buitelaar J, Tendolkar I: \\u003cstrong\\u003eAmygdala and hippocampus enlargement during adolescence in autism\\u003c/strong\\u003e. \\u003cem\\u003eJ Am Acad Child Adolesc Psychiatry \\u003c/em\\u003e2010, \\u003cstrong\\u003e49\\u003c/strong\\u003e(6):552-560.\\u003c/li\\u003e\\n\\u003cli\\u003eAylward EH, Minshew NJ, Goldstein G, Honeycutt NA, Augustine AM, Yates KO, Barta PE, Pearlson GD: \\u003cstrong\\u003eMRI volumes of amygdala and hippocampus in non-mentally retarded autistic adolescents and adults\\u003c/strong\\u003e. \\u003cem\\u003eNeurology \\u003c/em\\u003e1999, \\u003cstrong\\u003e53\\u003c/strong\\u003e(9):2145-2150.\\u003c/li\\u003e\\n\\u003cli\\u003eRoussin L, Prince N, Perez-Pardo P, Kraneveld AD, Rabot S, Naudon L: \\u003cstrong\\u003eRole of the Gut Microbiota in the Pathophysiology of Autism Spectrum Disorder: Clinical and Preclinical Evidence\\u003c/strong\\u003e. \\u003cem\\u003eMicroorganisms \\u003c/em\\u003e2020, \\u003cstrong\\u003e8\\u003c/strong\\u003e(9).\\u003c/li\\u003e\\n\\u003cli\\u003eOh D, Cheon KA: \\u003cstrong\\u003eAlteration of Gut Microbiota in Autism Spectrum Disorder: An Overview\\u003c/strong\\u003e. \\u003cem\\u003eSoa Chongsonyon Chongsin Uihak \\u003c/em\\u003e2020, \\u003cstrong\\u003e31\\u003c/strong\\u003e(3):131-145.\\u003c/li\\u003e\\n\\u003cli\\u003eRan Z, An Y, Zhou J, Yang J, Zhang Y, Yang J, Wang L, Li X, Lu D, Zhong J\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eSubchronic exposure to concentrated ambient PM2.5 perturbs gut and lung microbiota as well as metabolic profiles in mice\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Pollut \\u003c/em\\u003e2021, \\u003cstrong\\u003e272\\u003c/strong\\u003e:115987.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu W, Zhou Y, Yong L, Qin Y, Yu L, Li R, Chen Y, Xu Y: \\u003cstrong\\u003eEffects of PM2.5 exposure during gestation on maternal gut microbiota and pregnancy outcomes\\u003c/strong\\u003e. \\u003cem\\u003eChemosphere \\u003c/em\\u003e2020, \\u003cstrong\\u003e247\\u003c/strong\\u003e:125879.\\u003c/li\\u003e\\n\\u003cli\\u003eYap IKS, Angley M, Veselkov KA, Holmes E, Lindon JC, Nicholson JK: \\u003cstrong\\u003eUrinary metabolic phenotyping differentiates children with autism from their unaffected siblings and age-matched controls\\u003c/strong\\u003e. \\u003cem\\u003eJournal of Proteome Research \\u003c/em\\u003e2010, \\u003cstrong\\u003e9\\u003c/strong\\u003e(6):2996-3004.\\u003c/li\\u003e\\n\\u003cli\\u003eVuong HE, Pronovost GN, Williams DW, Coley EJL, Siegler EL, Qiu A, Kazantsev M, Wilson CJ, Rendon T, Hsiao EY: \\u003cstrong\\u003eThe maternal microbiome modulates fetal neurodevelopment in mice\\u003c/strong\\u003e. \\u003cem\\u003eNature \\u003c/em\\u003e2020, \\u003cstrong\\u003e586\\u003c/strong\\u003e(7828):281-286.\\u003c/li\\u003e\\n\\u003cli\\u003eYau SY, Li A, Hoo RLC, Ching YP, Christie BR, Lee TMC, Xu A, So K-F: \\u003cstrong\\u003ePhysical exercise-induced hippocampal neurogenesis and antidepressant effects are mediated by the adipocyte hormone adiponectin\\u003c/strong\\u003e. \\u003cem\\u003eProc Natl Acad Sci U S A \\u003c/em\\u003e2014, \\u003cstrong\\u003e111\\u003c/strong\\u003e(44):15810-15815.\\u003c/li\\u003e\\n\\u003cli\\u003eYau SY, Bostrom CA, Chiu J, Fontaine CJ, Sawchuk S, Meconi A, Wortman RC, Truesdell E, Truesdell A, Chiu C\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eImpaired bidirectional NMDA receptor dependent synaptic plasticity in the dentate gyrus of adult female Fmr1 heterozygous knockout mice\\u003c/strong\\u003e. \\u003cem\\u003eNeurobiol Dis \\u003c/em\\u003e2016, \\u003cstrong\\u003e96\\u003c/strong\\u003e:261-270.\\u003c/li\\u003e\\n\\u003cli\\u003eYau SY, Chiu C, Vetrici M, Christie BR: \\u003cstrong\\u003eChronic minocycline treatment improves social recognition memory in adult male Fmr1 knockout mice\\u003c/strong\\u003e. \\u003cem\\u003eBehavioural Brain Research \\u003c/em\\u003e2016, \\u003cstrong\\u003e312\\u003c/strong\\u003e:77-83.\\u003c/li\\u003e\\n\\u003cli\\u003eYau S-Y, Yip YSL, Formolo DA, He S, Lee THY, Wen C, Hryciw DH: \\u003cstrong\\u003eChronic consumption of a high linoleic acid diet during pregnancy, lactation and post-weaning period increases depression-like behavior in male, but not female offspring\\u003c/strong\\u003e. \\u003cem\\u003eBehavioural Brain Research \\u003c/em\\u003e2022, \\u003cstrong\\u003e416\\u003c/strong\\u003e:113538.\\u003c/li\\u003e\\n\\u003cli\\u003eBlock ML, Calder\\u0026oacute;n-Garcidue\\u0026ntilde;as L: \\u003cstrong\\u003eAir pollution: mechanisms of neuroinflammation and CNS disease\\u003c/strong\\u003e. \\u003cem\\u003eTrends Neurosci \\u003c/em\\u003e2009, \\u003cstrong\\u003e32\\u003c/strong\\u003e(9):506-516.\\u003c/li\\u003e\\n\\u003cli\\u003eAlexander JF, Seua AV, Arroyo LD, Ray PR, Wangzhou A, Hei\\u0026beta;-L\\u0026uuml;ckemann L, Schedlowski M, Price TJ, Kavelaars A, Heijnen CJ: \\u003cstrong\\u003eNasal administration of mitochondria reverses chemotherapy-induced cognitive deficits\\u003c/strong\\u003e. \\u003cem\\u003eTheranostics \\u003c/em\\u003e2021, \\u003cstrong\\u003e11\\u003c/strong\\u003e(7):3109-3130.\\u003c/li\\u003e\\n\\u003cli\\u003eYau S-Y, Lee TH-Y, Formolo DA, Lee W-L, Li LC-K, Siu PM, Chan CCH: \\u003cstrong\\u003eEffects of Maternal Voluntary Wheel Running During Pregnancy on Adult Hippocampal Neurogenesis, Temporal Order Memory, and Depression-Like Behavior in Adult Female and Male Offspring\\u003c/strong\\u003e. \\u003cem\\u003eFront Neurosci \\u003c/em\\u003e2019, \\u003cstrong\\u003e13\\u003c/strong\\u003e:470.\\u003c/li\\u003e\\n\\u003cli\\u003eWiebe S, Nagpal A, Truong VT, Park J, Skalecka A, He AJ, Gamache K, Khoutorsky A, Gantois I, Sonenberg N: \\u003cstrong\\u003eInhibitory interneurons mediate autism-associated behaviors via 4E-BP2\\u003c/strong\\u003e. \\u003cem\\u003eProc Natl Acad Sci U S A \\u003c/em\\u003e2019, \\u003cstrong\\u003e116\\u003c/strong\\u003e(36):18060-18067.\\u003c/li\\u003e\\n\\u003cli\\u003eYau S-Y, Lau BW-M, Tong J-B, Wong R, Ching Y-P, Qiu G, Tang S-W, Lee TMC, So K-F: \\u003cstrong\\u003eHippocampal neurogenesis and dendritic plasticity support running-improved spatial learning and depression-like behaviour in stressed rats\\u003c/strong\\u003e. \\u003cem\\u003ePloS One \\u003c/em\\u003e2011, \\u003cstrong\\u003e6\\u003c/strong\\u003e(9):e24263.\\u003c/li\\u003e\\n\\u003cli\\u003eLau BW-M, Yau S-Y, Lee TMC, Ching Y-P, Tang S-W, So K-F: \\u003cstrong\\u003eEffect of corticosterone and paroxetine on masculine mating behavior: possible involvement of neurogenesis\\u003c/strong\\u003e. \\u003cem\\u003eJ Sex Med \\u003c/em\\u003e2011, \\u003cstrong\\u003e8\\u003c/strong\\u003e(5):1390-1403.\\u003c/li\\u003e\\n\\u003cli\\u003eYau S-Y, Lee TH-Y, Li A, Xu A, So K-F: \\u003cstrong\\u003eAdiponectin Mediates Running-Restored Hippocampal Neurogenesis in Streptozotocin-Induced Type 1 Diabetes in Mice\\u003c/strong\\u003e. \\u003cem\\u003eFront Neurosci \\u003c/em\\u003e2018, \\u003cstrong\\u003e12\\u003c/strong\\u003e:679.\\u003c/li\\u003e\\n\\u003cli\\u003eRamirez-Rodriguez G, Ort\\u0026iacute;z-L\\u0026oacute;pez L, Dom\\u0026iacute;nguez-Alonso A, Ben\\u0026iacute;tez-King GA, Kempermann G: \\u003cstrong\\u003eChronic treatment with melatonin stimulates dendrite maturation and complexity in adult hippocampal neurogenesis of mice\\u003c/strong\\u003e. \\u003cem\\u003eJ Pineal Res \\u003c/em\\u003e2011, \\u003cstrong\\u003e50\\u003c/strong\\u003e(1):29-37.\\u003c/li\\u003e\\n\\u003cli\\u003eLee TH, Ahadullah, Christie BR, Lin K, Siu PM-F, Zhang L, Yuan T-F, Komal P, Xu A, So K-F\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eChronic AdipoRon Treatment Mimics the Effects of Physical Exercise on Restoring Hippocampal Neuroplasticity in Diabetic Mice\\u003c/strong\\u003e. \\u003cem\\u003eMol Neurobiol \\u003c/em\\u003e2021, \\u003cstrong\\u003e58\\u003c/strong\\u003e(9):4666-4681.\\u003c/li\\u003e\\n\\u003cli\\u003eWoolley CS, Gould E, McEwen BS: \\u003cstrong\\u003eExposure to excess glucocorticoids alters dendritic morphology of adult hippocampal pyramidal neurons\\u003c/strong\\u003e. \\u003cem\\u003eBrain Res \\u003c/em\\u003e1990, \\u003cstrong\\u003e531\\u003c/strong\\u003e(1-2):225-231.\\u003c/li\\u003e\\n\\u003cli\\u003eChao M-W, Yang C-H, Lin P-T, Yang Y-H, Chuang Y-C, Chung M-C, Tseng C-Y: \\u003cstrong\\u003eExposure to PM2.5 causes genetic changes in fetal rat cerebral cortex and hippocampus\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Toxicol \\u003c/em\\u003e2017, \\u003cstrong\\u003e32\\u003c/strong\\u003e(4):1412-1425.\\u003c/li\\u003e\\n\\u003cli\\u003eLo EKK, Wang X, Lee P-K, Wong H-C, Lee JC-Y, G\\u0026oacute;mez-Gallego C, Zhao D, El-Nezami H, Li J: \\u003cstrong\\u003eMechanistic insights into zearalenone-accelerated colorectal cancer in mice using integrative multi-omics approaches\\u003c/strong\\u003e. \\u003cem\\u003eComput Struct Biotechnol J \\u003c/em\\u003e2023, \\u003cstrong\\u003e21\\u003c/strong\\u003e:1785-1796.\\u003c/li\\u003e\\n\\u003cli\\u003eYau SY, Bostrom C, Chiu J, Fontaine C, Sawchuk S, Meconi A, Wortman R, Truesdell E, Truesdell A, Chiu C: \\u003cstrong\\u003eImpaired bidirectional NMDA receptor dependent synaptic plasticity in the dentate gyrus of adult female Fmr1 heterozygous knockout mice\\u003c/strong\\u003e. \\u003cem\\u003eNeurobiology of disease \\u003c/em\\u003e2016, \\u003cstrong\\u003e96\\u003c/strong\\u003e:261-270.\\u003c/li\\u003e\\n\\u003cli\\u003eLee TH, Ahadullah, Christie BR, Lin K, Siu PM-f, Zhang L, Yuan T-f, Komal P, Xu A, So K-f: \\u003cstrong\\u003eChronic AdipoRon treatment mimics the effects of physical exercise on restoring hippocampal neuroplasticity in diabetic mice\\u003c/strong\\u003e. \\u003cem\\u003eMolecular neurobiology \\u003c/em\\u003e2021, \\u003cstrong\\u003e58\\u003c/strong\\u003e(9):4666-4681.\\u003c/li\\u003e\\n\\u003cli\\u003eFung LK, Flores RE, Gu M, Sun KL, James D, Schuck RK, Jo B, Park JH, Lee BC, Jung JH\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eThalamic and prefrontal GABA concentrations but not GABAA receptor densities are altered in high-functioning adults with autism spectrum disorder\\u003c/strong\\u003e. \\u003cem\\u003eMol Psychiatry \\u003c/em\\u003e2021, \\u003cstrong\\u003e26\\u003c/strong\\u003e(5):1634-1646.\\u003c/li\\u003e\\n\\u003cli\\u003eDrenthen GS, Barendse EM, Aldenkamp AP, van Veenendaal TM, Puts NAJ, Edden RAE, Zinger S, Thoonen G, Hendriks MPH, Kessels RPC\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eAltered neurotransmitter metabolism in adolescents with high-functioning autism\\u003c/strong\\u003e. \\u003cem\\u003ePsychiatry Res Neuroimaging \\u003c/em\\u003e2016, \\u003cstrong\\u003e256\\u003c/strong\\u003e:44-49.\\u003c/li\\u003e\\n\\u003cli\\u003eBecerra TA, Wilhelm M, Olsen J, Cockburn M, Ritz B: \\u003cstrong\\u003eAmbient air pollution and autism in Los Angeles county, California\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Health Perspect \\u003c/em\\u003e2013, \\u003cstrong\\u003e121\\u003c/strong\\u003e(3):380-386.\\u003c/li\\u003e\\n\\u003cli\\u003eRaz R, Roberts AL, Lyall K, Hart JE, Just AC, Laden F, Weisskopf MG: \\u003cstrong\\u003eAutism spectrum disorder and particulate matter air pollution before, during, and after pregnancy: a nested case-control analysis within the Nurses\\u0026apos; Health Study II Cohort\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Health Perspect \\u003c/em\\u003e2015, \\u003cstrong\\u003e123\\u003c/strong\\u003e(3):264-270.\\u003c/li\\u003e\\n\\u003cli\\u003eTalbott EO, Arena VC, Rager JR, Clougherty JE, Michanowicz DR, Sharma RK, Stacy SL: \\u003cstrong\\u003eFine particulate matter and the risk of autism spectrum disorder\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Res \\u003c/em\\u003e2015, \\u003cstrong\\u003e140\\u003c/strong\\u003e:414-420.\\u003c/li\\u003e\\n\\u003cli\\u003eVolk HE, Lurmann F, Penfold B, Hertz-Picciotto I, McConnell R: \\u003cstrong\\u003eTraffic-related air pollution, particulate matter, and autism\\u003c/strong\\u003e. \\u003cem\\u003eJAMA Psychiatry \\u003c/em\\u003e2013, \\u003cstrong\\u003e70\\u003c/strong\\u003e(1):71-77.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang M, Liu W, Zhou Y, Li Y, Qin Y, Xu Y: \\u003cstrong\\u003eNeurodevelopmental toxicity induced by maternal PM2.5 exposure and protective effects of quercetin and Vitamin C\\u003c/strong\\u003e. \\u003cem\\u003eChemosphere \\u003c/em\\u003e2018, \\u003cstrong\\u003e213\\u003c/strong\\u003e:182-196.\\u003c/li\\u003e\\n\\u003cli\\u003eWegiel J, Kuchna I, Nowicki K, Imaki H, Wegiel J, Marchi E, Ma SY, Chauhan A, Chauhan V, Bobrowicz TW\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eThe neuropathology of autism: defects of neurogenesis and neuronal migration, and dysplastic changes\\u003c/strong\\u003e. \\u003cem\\u003eActa Neuropathol \\u003c/em\\u003e2010, \\u003cstrong\\u003e119\\u003c/strong\\u003e(6):755-770.\\u003c/li\\u003e\\n\\u003cli\\u003eWang T, Zhang T, Sun L, Li W, Zhang C, Yu L, Guan Y: \\u003cstrong\\u003eGestational B-vitamin supplementation alleviates PM2.5-induced autism-like behavior and hippocampal neurodevelopmental impairment in mice offspring\\u003c/strong\\u003e. \\u003cem\\u003eEcotoxicol Environ Saf \\u003c/em\\u003e2019, \\u003cstrong\\u003e185\\u003c/strong\\u003e:109686.\\u003c/li\\u003e\\n\\u003cli\\u003eXia Y-Y, de Seymour JV, Yang X-J, Zhou L-W, Liu Y, Yang Y, Beck KL, Conlon CA, Mansell T, Novakovic B\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eHair and cord blood element levels and their relationship with air pollution, dietary intake, gestational diabetes mellitus, and infant neurodevelopment\\u003c/strong\\u003e. \\u003cem\\u003eClin Nutr \\u003c/em\\u003e2023, \\u003cstrong\\u003e42\\u003c/strong\\u003e(10):1875-1888.\\u003c/li\\u003e\\n\\u003cli\\u003eJuliandi B, Tanemura K, Igarashi K, Tominaga T, Furukawa Y, Otsuka M, Moriyama N, Ikegami D, Abematsu M, Sanosaka T\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eReduced Adult Hippocampal Neurogenesis and Cognitive Impairments following Prenatal Treatment of the Antiepileptic Drug Valproic Acid\\u003c/strong\\u003e. \\u003cem\\u003eStem Cell Reports \\u003c/em\\u003e2015, \\u003cstrong\\u003e5\\u003c/strong\\u003e(6).\\u003c/li\\u003e\\n\\u003cli\\u003eSawada K, Kamiya S, Aoki I: \\u003cstrong\\u003eThe Proliferation of Dentate Gyrus Progenitors in the Ferret Hippocampus by Neonatal Exposure to Valproic Acid\\u003c/strong\\u003e. \\u003cem\\u003eFront Neurosci \\u003c/em\\u003e2021, \\u003cstrong\\u003e15\\u003c/strong\\u003e:736313.\\u003c/li\\u003e\\n\\u003cli\\u003eGormanns P, Mueller NS, Ditzen C, Wolf S, Holsboer F, Turck CW: \\u003cstrong\\u003ePhenome-transcriptome correlation unravels anxiety and depression related pathways\\u003c/strong\\u003e. \\u003cem\\u003eJournal of Psychiatric Research \\u003c/em\\u003e2011, \\u003cstrong\\u003e45\\u003c/strong\\u003e(7):973-979.\\u003c/li\\u003e\\n\\u003cli\\u003eGoyer RA: \\u003cstrong\\u003eResults of lead research: prenatal exposure and neurological consequences\\u003c/strong\\u003e. \\u003cem\\u003eEnviron Health Perspect \\u003c/em\\u003e1996, \\u003cstrong\\u003e104\\u003c/strong\\u003e(10):1050-1054.\\u003c/li\\u003e\\n\\u003cli\\u003eWatanabe Y, Murakami T, Kawashima M, Hasegawa-Baba Y, Mizukami S, Imatanaka N, Akahori Y, Yoshida T, Shibutani M: \\u003cstrong\\u003eMaternal Exposure to Valproic Acid Primarily Targets Interneurons Followed by Late Effects on Neurogenesis in the Hippocampal Dentate Gyrus in Rat Offspring\\u003c/strong\\u003e. \\u003cem\\u003eNeurotoxicity Research \\u003c/em\\u003e2017, \\u003cstrong\\u003e31\\u003c/strong\\u003e(1):46-62.\\u003c/li\\u003e\\n\\u003cli\\u003eFortoul TI: \\u003cstrong\\u003eHealth Effects of Metals in Particulate Matter\\u003c/strong\\u003e. In\\u003cem\\u003e.\\u003c/em\\u003e, edn.: IntechOpen; 2015.\\u003c/li\\u003e\\n\\u003cli\\u003eGuo Y-P, Commons KG: \\u003cstrong\\u003eSerotonin neuron abnormalities in the BTBR mouse model of autism\\u003c/strong\\u003e. \\u003cem\\u003eAutism Res \\u003c/em\\u003e2017, \\u003cstrong\\u003e10\\u003c/strong\\u003e(1):66-77.\\u003c/li\\u003e\\n\\u003cli\\u003eCosta LG, Chang Y-C, Cole TB: \\u003cstrong\\u003eDevelopmental Neurotoxicity of Traffic-Related Air Pollution: Focus on Autism\\u003c/strong\\u003e. \\u003cem\\u003eCurr Environ Health Rep \\u003c/em\\u003e2017, \\u003cstrong\\u003e4\\u003c/strong\\u003e(2):156-165.\\u003c/li\\u003e\\n\\u003cli\\u003eGray JA, Shi Y, Usui H, During MJ, Sakimura K, Nicoll RA: \\u003cstrong\\u003eDistinct modes of AMPA receptor suppression at developing synapses by GluN2A and GluN2B: single-cell NMDA receptor subunit deletion in vivo\\u003c/strong\\u003e. \\u003cem\\u003eNeuron \\u003c/em\\u003e2011, \\u003cstrong\\u003e71\\u003c/strong\\u003e(6):1085-1101.\\u003c/li\\u003e\\n\\u003cli\\u003eMurphy JA, Stein IS, Lau CG, Peixoto RT, Aman TK, Kaneko N, Aromolaran K, Saulnier JL, Popescu GK, Sabatini BL\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003ePhosphorylation of Ser1166 on GluN2B by PKA is critical to synaptic NMDA receptor function and Ca2+ signaling in spines\\u003c/strong\\u003e. \\u003cem\\u003eJ Neurosci \\u003c/em\\u003e2014, \\u003cstrong\\u003e34\\u003c/strong\\u003e(3):869-879.\\u003c/li\\u003e\\n\\u003cli\\u003eRaybuck JD, Hargus NJ, Thayer SA: \\u003cstrong\\u003eA GluN2B-Selective NMDAR Antagonist Reverses Synapse Loss and Cognitive Impairment Produced by the HIV-1 Protein Tat\\u003c/strong\\u003e. \\u003cem\\u003eJ Neurosci \\u003c/em\\u003e2017, \\u003cstrong\\u003e37\\u003c/strong\\u003e(33):7837-7847.\\u003c/li\\u003e\\n\\u003cli\\u003eBrigman JL, Wright T, Talani G, Prasad-Mulcare S, Jinde S, Seabold GK, Mathur P, Davis MI, Bock R, Gustin RM\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eLoss of GluN2B-containing NMDA receptors in CA1 hippocampus and cortex impairs long-term depression, reduces dendritic spine density, and disrupts learning\\u003c/strong\\u003e. \\u003cem\\u003eJ Neurosci \\u003c/em\\u003e2010, \\u003cstrong\\u003e30\\u003c/strong\\u003e(13):4590-4600.\\u003c/li\\u003e\\n\\u003cli\\u003eWang X, Xie J, Tan L, Lu Y, Shen N, Li J, Hu H, Li H, Li X, Cheng L: \\u003cstrong\\u003eN6-methyladenosine-modified circRIMS2 mediates synaptic and memory impairments by activating GluN2B ubiquitination in Alzheimer\\u0026apos;s disease\\u003c/strong\\u003e. \\u003cem\\u003eTranslational Neurodegeneration \\u003c/em\\u003e2023, \\u003cstrong\\u003e12\\u003c/strong\\u003e(1):53.\\u003c/li\\u003e\\n\\u003cli\\u003eHogan MK, Kovalycsik T, Sun Q, Rajagopalan S, Nelson RJ: \\u003cstrong\\u003eCombined effects of exposure to dim light at night and fine particulate matter on C3H/HeNHsd mice\\u003c/strong\\u003e. \\u003cem\\u003eBehavioural Brain Research \\u003c/em\\u003e2015, \\u003cstrong\\u003e294\\u003c/strong\\u003e:81-88.\\u003c/li\\u003e\\n\\u003cli\\u003eVargas DL, Nascimbene C, Krishnan C, Zimmerman AW, Pardo CA: \\u003cstrong\\u003eNeuroglial activation and neuroinflammation in the brain of patients with autism\\u003c/strong\\u003e. \\u003cem\\u003eAnn Neurol \\u003c/em\\u003e2005, \\u003cstrong\\u003e57\\u003c/strong\\u003e(1):67-81.\\u003c/li\\u003e\\n\\u003cli\\u003eKemper TL, Bauman M: \\u003cstrong\\u003eNeuropathology of infantile autism\\u003c/strong\\u003e. \\u003cem\\u003eJournal of Neuropathology and Experimental Neurology \\u003c/em\\u003e1998, \\u003cstrong\\u003e57\\u003c/strong\\u003e(7):645-652.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang T, Zheng X, Wang X, Zhao H, Wang T, Zhang H, Li W, Shen H, Yu L: \\u003cstrong\\u003eMaternal Exposure to PM2.5 during Pregnancy Induces Impaired Development of Cerebral Cortex in Mice Offspring\\u003c/strong\\u003e. \\u003cem\\u003eInt J Mol Sci \\u003c/em\\u003e2018, \\u003cstrong\\u003e19\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003eJasarevic E, Bale TL: \\u003cstrong\\u003ePrenatal and postnatal contributions of the maternal microbiome on offspring programming\\u003c/strong\\u003e. \\u003cem\\u003eFront Neuroendocrinol \\u003c/em\\u003e2019, \\u003cstrong\\u003e55\\u003c/strong\\u003e:100797.\\u003c/li\\u003e\\n\\u003cli\\u003eLi N, Yang J, Zhang J, Liang C, Wang Y, Chen B, Zhao C, Wang J, Zhang G, Zhao D\\u003cem\\u003e et al\\u003c/em\\u003e: \\u003cstrong\\u003eCorrelation of Gut Microbiome Between ASD Children and Mothers and Potential Biomarkers for Risk Assessment\\u003c/strong\\u003e. \\u003cem\\u003eGenomics Proteomics Bioinformatics \\u003c/em\\u003e2019, \\u003cstrong\\u003e17\\u003c/strong\\u003e(1):26-38.\\u003c/li\\u003e\\n\\u003cli\\u003eChen Y, Fang H, Li C, Wu G, Xu T, Yang X, Zhao L, Ke X, Zhang C: \\u003cstrong\\u003eGut Bacteria Shared by Children and Their Mothers Associate with Developmental Level and Social Deficits in Autism Spectrum Disorder\\u003c/strong\\u003e. \\u003cem\\u003emSphere \\u003c/em\\u003e2020, \\u003cstrong\\u003e5\\u003c/strong\\u003e(6).\\u003c/li\\u003e\\n\\u003cli\\u003eOgbonnaya ES, Clarke G, Shanahan F, Dinan TG, Cryan JF, O\\u0026apos;Leary OF: \\u003cstrong\\u003eAdult Hippocampal Neurogenesis Is Regulated by the Microbiome\\u003c/strong\\u003e. \\u003cem\\u003eBiological Psychiatry \\u003c/em\\u003e2015, \\u003cstrong\\u003e78\\u003c/strong\\u003e(4):e7-e9.\\u003c/li\\u003e\\n\\u003cli\\u003eDarch HT, Collins MK, O\\u0026apos;Riordan KJ, Cryan JF: \\u003cstrong\\u003eMicrobial memories: Sex-dependent impact of the gut microbiome on hippocampal plasticity\\u003c/strong\\u003e. \\u003cem\\u003eThe European Journal of Neuroscience \\u003c/em\\u003e2021, \\u003cstrong\\u003e54\\u003c/strong\\u003e(4):5235-5244.\\u003c/li\\u003e\\n\\u003cli\\u003eFoster JA, McVey Neufeld K-A: \\u003cstrong\\u003eGut-brain axis: how the microbiome influences anxiety and depression\\u003c/strong\\u003e. \\u003cem\\u003eTrends Neurosci \\u003c/em\\u003e2013, \\u003cstrong\\u003e36\\u003c/strong\\u003e(5):305-312.\\u003c/li\\u003e\\n\\u003cli\\u003ePu L, Kopec AM, Boyle HD, Carew TJ: \\u003cstrong\\u003eA novel cysteine-rich neurotrophic factor in Aplysia facilitates growth, MAPK activation, and long-term synaptic facilitation\\u003c/strong\\u003e. \\u003cem\\u003eLearn Mem \\u003c/em\\u003e2014, \\u003cstrong\\u003e21\\u003c/strong\\u003e(4):215-222.\\u003c/li\\u003e\\n\\u003cli\\u003eZareba-Koziol M, Bartkowiak-Kaczmarek A, Figiel I, Krzystyniak A, Wojtowicz T, Bijata M, Wlodarczyk J: \\u003cstrong\\u003eStress-induced Changes in the S-palmitoylation and S-nitrosylation of Synaptic Proteins\\u003c/strong\\u003e. \\u003cem\\u003eMol Cell Proteomics \\u003c/em\\u003e2019, \\u003cstrong\\u003e18\\u003c/strong\\u003e(10):1916-1938.\\u003c/li\\u003e\\n\\u003cli\\u003ePark M, Baek I-J, Kim H, Woo DK, Park Y-J, Shim S: \\u003cstrong\\u003eCCN3 overexpression inhibits growth of callosal projections via upregulation of RAB25\\u003c/strong\\u003e. \\u003cem\\u003eBiochem Biophys Res Commun \\u003c/em\\u003e2015, \\u003cstrong\\u003e461\\u003c/strong\\u003e(3):456-462.\\u003c/li\\u003e\\n\\u003cli\\u003eMannan A, Germon ZP, Chamberlain J, Sillar JR, Nixon B, Dun MD: \\u003cstrong\\u003eReactive Oxygen Species in Acute Lymphoblastic Leukaemia: Reducing Radicals to Refine Responses\\u003c/strong\\u003e. \\u003cem\\u003eAntioxidants (Basel) \\u003c/em\\u003e2021, \\u003cstrong\\u003e10\\u003c/strong\\u003e(10).\\u003c/li\\u003e\\n\\u003cli\\u003eAng MJ, Kang S, Moon C: \\u003cstrong\\u003eMelatonin alters neuronal architecture and increases cysteine-rich protein 1 signaling in the male mouse hippocampus\\u003c/strong\\u003e. \\u003cem\\u003eJournal of Neuroscience Research \\u003c/em\\u003e2020, \\u003cstrong\\u003e98\\u003c/strong\\u003e(11):2333-2348.\\u003c/li\\u003e\\n\\u003cli\\u003eSamad N, Rafeeque M, Imran I: \\u003cstrong\\u003eFree-L-Cysteine improves corticosterone-induced behavioral deficits, oxidative stress and neurotransmission in rats\\u003c/strong\\u003e. \\u003cem\\u003eMetabolic Brain Disease \\u003c/em\\u003e2023, \\u003cstrong\\u003e38\\u003c/strong\\u003e(3):983-997.\\u003c/li\\u003e\\n\\u003cli\\u003eGarcia-Serrano AM, Vieira JPP, Fleischhart V, Duarte JMN: \\u003cstrong\\u003eTaurine and N-acetylcysteine treatments prevent memory impairment and metabolite profile alterations in the hippocampus of high-fat diet-fed female mice\\u003c/strong\\u003e. \\u003cem\\u003eNutr Neurosci \\u003c/em\\u003e2023, \\u003cstrong\\u003e26\\u003c/strong\\u003e(11):1090-1102.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"Hong Kong Polytechnic University\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"PM2.5, maternal exposure, ASD-like behavior, hippocampus, offspring, synaptic plasticity, metabolites\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6813049/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6813049/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eAutism spectrum disorder (ASD) is characterized by early-onset challenges in social communication and repetitive behaviors, influenced by both genetic and environmental factors. The global increase in ASD diagnoses has drawn attention to air pollution as a significant environmental risk factor, although the underlying mechanisms remain unclear. This study investigates the impact of maternal exposure to the air pollutant PM\\u003csub\\u003e2.5 \\u003c/sub\\u003eon ASD risk in offspring. In this study, female C57BL/6J mice were exposed to PM\\u003csub\\u003e2.5 \\u003c/sub\\u003evia intratracheal instillation every three days for two weeks prior to mating, with exposure continuing until birth. Both male and female offspring exhibited reduced social novelty and increased repetitive behaviors, only male offspring showed significant impairment in working memory. PM\\u003csub\\u003e2.5 \\u003c/sub\\u003eexposure led to an increased number of proliferating progenitor cells and immature neurons in the hippocampus of male offspring, a change not observed in females. However, PM\\u003csub\\u003e2.5 \\u003c/sub\\u003eexposure resulted in reduced dendritic length exclusively in female offspring, while both sexes experienced decreased long-term potentiation and synaptic GluN2B protein expression. These structural changes were associated with significantly lower cysteine levels in the hippocampi of offspring of both sexes, but not with changes in relative abundance of gut microbiota and neuroinflammatory response in the hippocampus. These findings suggest that maternal PM\\u003csub\\u003e2.5 \\u003c/sub\\u003eexposure may induce autism-like behaviors in offspring, potentially linked to reduced hippocampal cysteine levels and hippocampal dysfunction.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Maternal exposure to PM2.5 impairs behaviors and hippocampal plasticity in association with reduced cysteine levels in adult offspring\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-06-04 10:28:02\",\"doi\":\"10.21203/rs.3.rs-6813049/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"6c6e8878-883d-4fe4-ad22-b664676fdce2\",\"owner\":[],\"postedDate\":\"June 4th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":49512446,\"name\":\"Animal Science\"},{\"id\":49512447,\"name\":\"Cognitive Neuroscience\"}],\"tags\":[],\"updatedAt\":\"2025-06-04T10:28:03+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-06-04 10:28:02\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6813049\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6813049\",\"identity\":\"rs-6813049\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}