{"paper_id":"4ba13196-e731-489e-a126-4ca7df709e87","body_text":"NT5E Promotes Colorectal Cancer Progression and Correlates with PD-L1 Expression: Evidence from Multi-Omics Analysis, Clinical Samples, and Cellular Functional Assays | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article NT5E Promotes Colorectal Cancer Progression and Correlates with PD-L1 Expression: Evidence from Multi-Omics Analysis, Clinical Samples, and Cellular Functional Assays Weixing Wu, Cheng Cheng, Tao Yang, Weishan Meng, Yimin Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9339416/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 13 You are reading this latest preprint version Abstract Background Extracellular 5'-nucleotidase (NT5E/CD73) plays a pivotal role in the tumor immune microenvironment by catalysing the production of adenosine. This study aims to evaluate the expression and function of NT5E in colorectal cancer progression, and to explore its potential as a novel biomarker and for associated immunotherapy. Methods Genomic alterations, prognostic significance, and immune landscape of NT5E were analyzed using cBioPortal, Kaplan‑Meier Plotter, the cancer genome atlas(TCGA)and the Human Protein Atlas. Following siRNA‑mediated knockdown in HCT116 cells, proliferation, migration, and invasion were assessed. NT5E and PD‑L1 expression were examined in 40 paired colorectal cancer specimens by qRT‑PCR. The regulatory relationship between PD‑L1 and NT5E was further validated in vitro. Results NT5E alterations were identified in 5.17% of CRC patients, primarily manifested as high mRNA expression and amplification. Elevated NT5E expression was significantly correlated with poorer overall survival and relapse‑free survival, particularly in patients with advanced stage, CMS1 (Consensus Molecular Subtypes 1), CMS4, and high microsatellite instability (MSI-H) subtypes. Gene set enrichment analysis revealed enrichment of purine metabolism, sphingolipid signaling, focal adhesion, and T cell receptor signaling pathways in NT5E‑high tumors. NT5E expression was positively correlated with helper T cells, macrophages, and mast cells, while negatively correlated with NK CD56dim cells. A significant positive correlation was observed between NT5E and PD‑L1, HAVCR2, and TIGIT. In clinical specimens, NT5E was upregulated in 65% of colorectal cancer tissues and positively associated with lymph node metastasis and PD‑L1 expression. In vitro experiments demonstrated that NT5E knockdown suppressed the proliferation, migration, and invasion of colorectal cancer cells, and confirmed that PD‑L1 regulates NT5E expression in colon cancer cells. Conclusion NT5E accelerates disease progression by promoting malignant biological behaviors in colorectal cancer and synergistically shaping an immunosuppressive microenvironment with PD-L1. Its overexpression constitutes an independent adverse prognostic factor. This discovery offers novel insights for anti-PD-1/PD-L1 combination immunotherapy. Colon Cancer NT5E PD-L1 Tumor Microenvironment Prognosis Immunotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Colorectal cancer currently ranks as the second most common cancer globally, irrespective of gender. It is estimated that in 2022, over 1.9 million new cases of colorectal cancer were diagnosed worldwide, with 904,000 deaths occurring – accounting for nearly one in ten of all cancer cases and deaths respectively. It ranks third in global cancer incidence and second in cancer-related mortality. In China, among the 4.8 million new cancer cases recorded in 2022 alone, colorectal cancer incidence ranked second. However, numerous recent reports indicate a rising incidence of colorectal cancer among young adults (diagnosed under 50 years of age), increasing by 1%–4% annually[1] . In recent years, research into comprehensive treatments for colorectal cancer has continued to increase. Despite ongoing developments in drug regimens, breakthroughs in the treatment of metastatic colorectal cancer (mCRC) remain elusive, with prognosis remaining poor and median overall survival standing at merely 25–30 months[2]. Due to the adverse effects of chemotherapy drugs and the biological characteristics of tumor cells, traditional treatment strategies have struggled to achieve breakthroughs. Targeted drug combination therapy represents the primary treatment approach for patients with mCRC [3]. Immune checkpoint blockade therapy has achieved significant progress in the treatment of advanced malignancies. The first anti-PD-1/PD-L1 drug, pembrolizumab, was approved in 2017 for second-line treatment of mCRC, providing durable benefits for some patients and markedly improving disease prognosis[4]. Regrettably, immunotherapy proves effective only in a minority of patients. Immunotherapy is advancing rapidly. As research into immune checkpoint inhibitors deepens, novel predictive biomarkers continue to emerge[5, 6] . Ecto-5'-nucleotidase (NT5E, CD73) is a 63 kDa glycosylated protein anchored to the outer surface of the plasma membrane via a glycosylphosphatidylinositol anchor. It is overexpressed in various tumors, including colorectal cancer. The primary function of NT5E is to catalyse the conversion of extracellular 5'-AMP into adenosine (ADO) via adenosine receptors (A1, A2A, A2B, and A3 AR), thereby regulating diverse physiological responses and cancer development. Upregulation of NT5E correlates with highly invasive cancer phenotypes, drug resistance, and pro-tumorigenic functions. Research indicates that NT5E expressed by tumor cells is associated with the proliferation and metastasis of colorectal cancer; however, its precise mechanisms and potential role within the microenvironment remain unclear.[7, 8]. In this study, we performed a multi-omics analysis to characterize NT5E expression, its clinical significance, its associations with the immune microenvironment, and the underlying pathways. We also conducted in vitro experiments to validate its functional role. This study aims to investigate the role of NT5E in colorectal cancer tumor cells and its potential mechanisms of action within the tumor microenvironment, seeking to identify NT5E as a key target for therapeutic intervention. It endeavours to provide novel insights into immunotherapy for colorectal cancer and its mechanisms of resistance. Our objective is to offer new strategies for identifying novel tumor markers and developing combination drug therapies, thereby enabling early diagnosis and personalised treatment for patients. 2. Materials and Methods 2.1 Genomic Analysis of NT5E The Cancer Genome Bioinformatics (CBio) portal ( https://www.cbioportal.org ) is an open resource for interactive exploration of numerous multidimensional cancer genomic datasets, comprising over 5,000 tumor samples from 147 ongoing cancer studies[9]. This study primarily evaluates the somatic gene mutation/variant and copy number variation (CNV) profiles of the colorectal cancer mutant NT5E within the cBioPortal database. 2.2 Survival Analysis of NT5E The online Kaplan-Meier plotter ( https://kmplot.com/analysis , accessed 25 January 2026) is a meta-analysis database evaluating survival data for approximately 54,000 genes (genes, miRNAs, proteins) across 21 cancers including colorectal, gastric, ovarian, and lung cancers[10]. Our study assessed the prognostic significance of NT5E expression in colorectal cancer. The cohort was stratified into NT5E high-expression and NT5E low-expression groups based on median NT5E expression levels. Overall survival (OS) and recurrence-free survival (RFS) constituted the primary endpoints of our analysis. Hazard ratios (HR) with 95% confidence intervals (CI) were calculated for survival analysis, with p-values determined using the log-rank test. 2.3 Bioinformatics Analysis and Immunological Infiltration Analysis The TCGA database ( https://portal.gdc.cancer.gov ) stands as one of the most comprehensive cancer databases available today, offering the most detailed characterisation of cancer features. Quality control was performed on the raw sequencing data to remove low-quality reads and adapter sequences. Subsequent analyses included gene expression quantification, Gene Set Enrichment Analysis (GSEA), differential gene expression analysis, as well as Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. RNA-seq data from the TCGA-Colon Cancer project's STAR workflow were downloaded from the TCGA database, organised, and processed to extract Transcripts Per Million (TPM) format data alongside clinical information. Data were log-transformed using the log2(value + 1) method, with results visualised using ggplot2. Correlation analysis was performed using the ggplot2 package [3.3.6] within R software (version 4.2.1), employing Spearman's statistical method. 2.4 Expression of NT5E in Colon Cancer The Human Proteome Atlas (HPA) ( www.Proteatlas.org ) encompasses virtually all human protein-coding genes in cells, tissues, and organs [11]. This study utilised the HPA database to evaluate the proteomic profile of NT5E in colorectal cancer tumors and normal tissue. Representative immunohistochemical (IHC) images demonstrating varying expression levels of NT5E are shown. 2.5 Cell Culture and Transfection Human colon cancer HCT116 and SW480 cells were purchased from Zhongqiao Xinzhou Biotechnology Co., Ltd. (Shanghai). HT-29, LoVo, and SW620 cells were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan). Cells were cultured in high-glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and maintained in a humidified incubator at 37°C with 5% CO₂. For siRNA transient transfection, siRNA and negative control (NC) were designed and purchased from Shanghai GenePharma Co., Ltd. The most effective targeting sequence was: siNT5E: 5'-GGA AUC GUU GGA UAC ACU UTT-3', siPD-L1: 5'-CUGAGAAUCAACACAACAATT-3'. Cells were seeded in 6-well plates, and when they reached 50–60% confluency, siRNA transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Cells were collected 48 hours post-transfection. 2.6 Cell Proliferation Assay For cell proliferation assays, cells were stored overnight in 96-well plates at a density of 4 × 10³ cells per well. Using the Cell Counting Kit-8 (MedChemExpress, USA) according to the manufacturer's instructions, optical density (OD) values were determined by measuring absorbance at 450 nm. Cell proliferation was measured at 24, 48, 72, and 96 hours. 2.7 Wound Healing Assay Cells treated with siRNA were seeded into 6-well plates. After 24 hours of incubation, two vertical lines were drawn within the cells using a 200µL pipette tip. Photographs of the scratch area were taken at 0 and 24 hours post-scratch using a microscope (DFC295, Leica, Buffalo Grove, USA). The scratch healing rate (%) was calculated as: [(0h scratch area − 24h scratch area) / 0h scratch area] × 100%. 2.8 Transwell Assay For the invasion assay, Matrigel (BD Biosciences, USA) was evenly spread in the incubator and incubated overnight at 37°C. Transwell chambers (BD Biosciences, USA) were employed for the invasion assay; Matrigel was not required for the migration assay. Cells were seeded at a density of 4 × 10⁴ cells per chamber in the upper chamber for 24–48 hours. Following crystal violet staining, three random fields of view were observed under an inverted phase-contrast microscope (DFC295, Leica, Buffalo Grove, USA), photographed, and counted. Image J software (version 1.53, National Institutes of Health, USA) was employed to statistically analyse and graphically represent the invasion and migration data. 2.9 Patient Samples This study included 40 patients with colorectal cancer who underwent primary surgery in the Department of General Surgery at Qinhuangdao First Hospital between September 2025 to February 2026. Following surgery, all patients received standard adjuvant chemotherapy. This cohort possessed complete clinical-pathological data and follow-up records. The study was conducted in accordance with the Declaration of Helsinki (2013 revision). It received approval from the Ethics Committee of Qinhuangdao First Hospital (Approval No.: 2025K-255-01). Informed consent was obtained from all participants. 2.10 RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Analysis Total RNA was extracted from cells using TRIzol reagent (Invitrogen, USA). cDNA was synthesised using the TUREscript RT Master Mix reverse transcription kit (Beijing Edle Bio-Technology Co., Ltd.). PCR amplification of cDNA was performed with GO Taq qPCR Master Mix (Promega, USA). Primers were procured from Shanghai Sangon Biotech Co., Ltd. The qRT-PCR primer sequences are as follows: NT5E (F: 5'-CCC ATT CTT CTA AAC AGC AGC ATT C-3'; R: 5'-TGA TTG AGA GGA GCC ATC CAG ATA G-3'), PD-L1 (F: 5'- GACCACCACCACCAATTCCAAG − 3'; R: 5'- TTAGTTGTTGTGTTGATTCTCAGTGTG − 3'), GAPDH (F: 5'-GTG GAC CTG ACC TGC CGT CTA G-3'; R: 5'-GAG TGG GTG TCG CTG TTG AAG TC-3'). Cycling conditions: 95°C for 10 minutes, 95°C for 15 seconds and 58°C for 30 seconds, 72°C for 30 seconds, 40 cycles, followed by 72°C for 10 minutes. GAPDH was used as the internal control. The relative expression levels of the target genes were calculated using the 2^ (-ΔΔCT) method. 2.11 Western Blotting Analysis Cells were lysed using RIPA lysis buffer (Solarbio, R0010, Beijing, China), and incubated on ice for 30 minutes. Following centrifugation, the supernatants were collected. Protein concentrations were determined using a BCA Protein Assay Kit (Boster, BCA-001). Equal amounts of protein were resolved by 10% SDS-PAGE (Epizyme Biotech, PG212, Shanghai, China) and then electrotransferred onto polyvinylidene fluoride (PVDF) membranes (MilliporeSigma, IPVH00010, Darmstadt, Germany). The membranes were blocked with blocking buffer (Report, RW0501, Tianjin, China) for 1 hour at room temperature and subsequently incubated overnight at 4°C with primary antibodies against PD-L1 (1:1000; Proteintech, 28076-1-AP), NT5E (1:1000; Boster, A02120-3), and GAPDH (1:10000; Proteintech, 60004-1-Ig). After washing three times with Tris-buffered saline containing Tween-20 (Epizyme Biotech, TF103), each for 10 minutes, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, including anti-mouse (1:1000; Bioworld, BA1050) and anti-rabbit (1:1000; Bioworld, BA1054), for 2 hours at room temperature. Following additional washes as described above, immunoreactive bands were visualized using an enhanced chemiluminescence (ECL) detection kit (Thermo Scientific, WP20005, USA). Band intensities were quantified using Image J software. 2.12 Statistical Analysis This study employed SPSS 26.0 and Image J software for statistical analysis. Results are presented as mean ± standard deviation. Unpaired two-tailed Student's t-tests were used to compare data between groups. Chi-square and rank-sum tests analysed the relationship between NT5E expression levels and clinical characteristics. Survival curves were plotted using the Kaplan-Meier method, with Cox proportional hazards models estimating potential prognostic effects. Pearson's correlation coefficient was applied for correlation analysis. * P < 0.05, ** P < 0.01, or *** P < 0.001 indicated statistically significant differences. 3. Results 3.1 Genomic Variation Patterns of NT5E in Colorectal Cancer Overall analysis indicated that the mutation rate of the NT5E gene in colorectal cancer tissues was relatively low across pan-cancer data in the cBioPortal database (Fig. 1 A). We selected a study project with mRNA data (Sidra-LUMC AC-ICAM, Nat Med 2023) for analysis. The results showed that NT5E gene alterations included missense mutations, splice site mutations, amplification (AMP), deep deletion, mRNA high expression, and mRNA low expression (Fig. 1 B). Subsequently, we analyzed the relationship between NT5E gene expression and its genomic status to further validate the regulatory mechanisms of NT5E expression. The results showed that AMP led to relatively higher NT5E expression, while deep deletion was associated with lower NT5E mRNA expression (Fig. 1 C). Notably, in this study, the alteration frequency of NT5E was 5.17% (18/348 cases), with an AMP rate of 0.57% (2/348) and an mRNA high expression rate of 2.3% (8/348), which together constituted the majority of NT5E gene alterations. However, CNV of NT5E showed no significant difference in the prognosis of colon cancer patients (HR: 1.087, 95% CI: 0.541–2.186, Log-rank P-Value: 0.804; Fig. 1 D). 3.2 Prognostic Significance of NT5E in Colon Cancer Using the Kaplan-Meier Plotter database, we validated the association between NT5E expression and prognosis in colorectal cancer patients. Results demonstrated a significant correlation between NT5E expression and OS in colorectal cancer patients (HR = 1.49, 95% CI: 0.17–1.9, P = 0.0011; Fig. 2 A). Concurrently, NT5E expression was also significantly correlated with RFS in colorectal cancer patients (HR = 1.62, 95% CI: 1.25–2.11, P = 0.00026; Fig. 2 B). Subsequent analysis by disease stage revealed that in advanced-stage (III-IV) colorectal cancer patients, low NT5E expression was associated with improved OS (HR = 1.5, 95% CI: 1.19–1.9, P = 0.00062; Fig. 2 D). In contrast, in relatively early-stage (I-II) colorectal cancer patients, NT5E expression showed no correlation with OS (Fig. 2 C). We further conducted survival analyses based on CMS (Consensus Molecular Subtypes). Results indicate that: in CMS1-type colorectal cancer patients, low NT5E expression was associated with improved OS (HR = 2.18, 95% CI: 1.24–3.82, P = 0.0053; Fig. 2 E); Similarly, in CMS4, low NT5E expression correlated with favorable OS (HR = 2.05, 95% CI: 1.34–3.15, P = 0.00078; Fig. 6 H). However, NT5E expression showed no significant association with OS in CMS2 or CMS3 patients (Figs. 2 F and 2 G). Re-evaluation of NT5E expression's prognostic significance across three microsatellite instability states revealed that high NT5E expression correlated with poor prognosis in both low microsatellite instability (HR = 2.95, 95% CI: 1.9–4.58, P < 0.0001, Fig. 2 J) and high microsatellite instability (HR = 0.21, 95% CI: 0.05–0.96, P = 0.026, Fig. 2 K), whereas NT5E expression in microsatellite-stable tumors showed no prognostic value (Fig. 2 I). 3.3 Pathway Enrichment and Immune Microenvironment Correlation Analysis of NT5E Expression We performed pathway enrichment analysis on the aforementioned RNA-seq data using the KEGG and conducted GSEA analysis. The results of the KEGG pathway enrichment analysis indicated that this process was implicated in pathways related to cytoskeletal stability, DNA replication, cellular metabolism, cell adhesion, and T cell receptor signaling (Fig. 3 A). To further validate these findings, we plotted GSEA enrichment plots, which revealed four significantly enriched pathways in the NT5E high-expression group: purine metabolism (NES = 1.308, P = 0.026, Fig. 3 B), focal adhesion(NES = 1.517, p.adjust = 3.86e-04, Fig. 3 C), sphingolipid signalling pathway(NES = 1.686, p.adjust = 6.66e-05, Fig. 3 D), regulation of the actin cytoskeleton(NES = 1.489, p.adjust = 3.86e-04, Fig. 3 E), and immune-related T cell receptor signalling (NES = 1.585, p.adjust = 9.63e-04, Fig. 3 G). Subsequently, we employed the TCGA database to analyse the correlation between NT5E expression and immune infiltrating cells within the colorectal cancer tumor microenvironment (Fig. 3 F). We then utilised Spearman's correlation method to sequentially examine the relationship between NT5E and various immune cell types within the TCGA database. Results demonstrated that NT5E expression in colorectal cancer exhibited a significant positive correlation with helper T cells within the tumor microenvironment (R = 0.180, P < 0.001). It also showed a significant positive correlation with helper Macrophages (R = 0.174, P < 0.001). It exhibited a significant positive correlation with helper mast cells in the tumor microenvironment (R = 0.166, P < 0.001). It showed a significant positive correlation with Th1 cells in the tumor microenvironment (R = 0.131, P < 0.01). Significantly positively correlated with T cells in the tumor microenvironment (R = 0.101, P < 0.05). Significantly negatively correlated with helper NK CD56dim cells in the tumor microenvironment (R = − 0.131, P < 0.001). Further correlation analyses were conducted between common immune checkpoints and NT5E using the online TCGA database. The results showed that, in colorectal cancer, there was a significant positive correlation between NT5E and PD-L1 expression (R = 0.201, P < 0.001, Fig. 3 H); there was a significant positive correlation between NT5E and HAVCR2 expression (R = 0.13, P = 0.006, Fig. 3 I); and there was a significant positive correlation between NT5E and TIGIT expression (R = 0.018, P = 0.022, Fig. 3 J). 3.4 Detection of NT5E Expression in Colorectal Cancer by Immunohistochemistry To analyse and validate NT5E protein expression in the colon, we assessed the expression pattern of NT5E protein via immunohistochemical staining using a specific mouse antibody (HPA017357, Sigma-Aldrich, Germany) within the HPA database. Results demonstrated that NT5E exhibits subcellular localisation within the cytoplasm or cell membrane of both normal lymph node tissue (Fig. 4 A) and colon cancer tissue (Figs. 4 B, 4 C). Figure 4 B and Fig. 4 C display representative IHC images of NT5E with high and moderate expression, respectively. 3.5 Biological Functions of NT5E in Colon Cancer Cell Lines We employed real-time quantitative PCR to validate NT5E expression in five common colorectal cancer cell lines, including HCT116, SW480, HT-29, LoVo, and SW620. Results indicated that NT5E mRNA expression was highest in the HCT116 cell line (Fig. 5 A). Subsequently, we silenced the NT5E gene in the HCT116 colon cancer cell line—which exhibited the highest NT5E expression—using siRNA knockdown (si-NT5E). Compared to the si-NC control group, NT5E mRNA expression was significantly downregulated in the si-NT5E group (0.20 ± 0.05 vs. 1.00 ± 0.02; P < 0.001; Fig. 5 B). We therefore employed small RNA interference technology to knock down NT5E in the HCT116 cell line to further validate its biological function. CCK8 assay results demonstrated significantly reduced cell proliferation at days 3 and 4 post-knockdown compared to the si-NC group ( P < 0.001, Fig. 5 C).Wound healing assays demonstrated that NT5E knockdown impaired cell migration capacity (percentage: 20.70% ± 3.34% vs. 48.80% ± 10.82%; P < 0.05; Fig. 5 D- 5 E).Furthermore, validation via Transwell chamber assays demonstrated that NT5E knockdown significantly reduced cell migration capacity compared to the si-NC group (transmembrane cell count: 495.7 ± 12.5 vs. 1315 ± 107.2; P < 0.001, Fig. 5 F- 5 G) and invasion capacity (number of cells crossing the membrane: 139.33 ± 18.00 vs. 423.7 ± 41.24; P < 0.001, Fig. 5 F、5H). 3.6 Correlation Between NT5E and PD-L1 Expression in Tissues and Colorectal Cancer Cells To further validate the expression of NT5E in colorectal cancer within the real-world setting and its clinical significance, we extracted total RNA from 40 colorectal cancer tissues and their adjacent normal tissues within our clinical sample repository. We subsequently analysed the correlation between NT5E expression and clinical pathological characteristics (Table 1 , Fig. 6 A). Results indicated that in our cohort, the rate of NT5E under-expression (NT5E levels in colon cancer tissue lower than in adjacent normal tissue) was 35% (14/40), while the rate of NT5E over-expression (NT5E levels in colon cancer tissue higher than in adjacent normal tissue) was 65% (26/40). Furthermore, regarding clinical information, NT5E expression showed a significant association with lymph node metastasis in colorectal cancer patients (χ²: 4.945, P = 0.0262) (Table 1 ) (Fig. 6 B). In the real-world setting, further validation using the aforementioned clinical pathological data revealed a consistent correlation between NT5E and PD-L1 expression in 40 pairs of colorectal cancer specimens (χ²: 4.183, P = 0.0408, Table 2 & Fig. 6 C). To further validate the relationship between PD-L1 and NT5E, we conducted gene knockdown experiments using small RNA interference technology on the HCT1116 cell line. Firstly, at the genetic level, no significant changes in PD-L1(Figure 6 D, as shown in Fig. 5 B) were observed in cells with NT5E knockdown(Fig. 6 E, 1.00 ± 0.00 vs. 1.00 ± 0.00; P = 0.51). Next, we confirmed the successful knockdown of PD-L1 at both mRNA and protein levels (mRNA level: 0.21 ± 0.02 vs. 1.00 ± 0.00; P < 0.001 Fig. 6 F; protein level: 0.39 ± 0.11 vs. 1.02 ± 0.05; P < 0.001; Fig. 6 G- 6 H). Quantitative RT-PCR and Western blotting analyses revealed that NT5E expression was significantly downregulated in si-PD-L1 cells compared to the si-NC control group (mRNA level: 0.37 ± 0.06 vs. 1.00 ± 0.00; P < 0.001, Fig. 6 I; protein level: 0.66 ± 0.13 vs. 1.03 ± 0.10; P < 0.05, Fig. 6 H- 6 J). Table 1 Relationship between NT5E expression and clinicopathological characteristics of colon cancer patients. Characteristics expression of NT5E P Value Low expression of NT5E High expression of NT5E n 14 26 Gender 0.666 Male 8 13 Female 6 13 Location 0.8416 Left 8 14 Right 6 12 Tumor Size 0.8163 ≤ 2 cm 7 12 > 2 cm 7 14 Lymph Node Metastasis 0.0262 No 10 9 Yes 4 17 Distant Metastasis 0.6971 No 10 17 Yes 4 9 Stage 0.1867 I-II 11 15 III-IV 3 11 Table 2 Correlation between NT5E and PD-L1 expression in colorectal cancer tissues. Characteristics expression of NT5E P Value Low High n 14 26 PD-L1,n(%) 0.0408 Low 9(64.29%) 8(30.77%) High 5(35.71%) 18(69.23%) 4. Discussion The initiation, progression and metastasis of tumors constitute complex malignant processes within the body, involving a series of events including the uncontrolled proliferation of mutated cells, suppression of programmed cell death, abundant angiogenesis, evasion of immune surveillance, invasion, and colonisation of distant organs. Multiple signalling pathways have been demonstrated to participate in cancer development. In recent years, the purinergic signalling pathway, utilising extracellular ATP (adenosine triphosphate), ADP (adenosine diphosphate), and adenosine as primary signalling molecules, has emerged as a significant contributor to cancer progression. NT5E, a glycosylphosphatidylinositol-linked cell surface enzyme found in normal tissues, catalyses the conversion of extracellular 5'-AMP to ADO via adenosine receptors (A1, A2A, A2B, and A3 AR). NT5E plays a pivotal role in activating adenosine signalling pathways. The overexpression of NT5E is driven by the tumor hypoxic microenvironment and certain soluble inflammatory mediators. Recent studies have demonstrated that NT5E is overexpressed in multiple solid malignancies, including breast cancer, colorectal cancer, prostate cancer, and ovarian cancer[12–14]. This is consistent with our research, which also found that gene overexpression constitutes the majority proportion of somatic mutations in NT5E in colorectal cancer. Subsequent survival analysis further revealed that NT5E expression is associated with both OS and RFS. Studies have also reported that high NT5E expression in colorectal cancer patients is associated with poor prognosis[15, 16]. We conducted survival analyses for early-stage and advanced-stage colorectal cancer based on patient staging, demonstrating that NT5E holds greater prognostic significance for patients with advanced colorectal cancer. The CMS classification was developed through collaborative efforts by Guinney et al. in 2015. It aims to integrate recent analyses of molecular characteristics in colorectal cancer conducted by multiple research groups, thereby delineating four distinct colorectal cancer subtypes: CMS1 (microsatellite instability-immunoreactive), CMS2 (original), CMS3 (metabolic), and CMS4 (stromal). Patients with CMS1 or CMS4 tumors exhibit poorer prognosis[17].We conducted survival analyses for each subtype based on the Consensus Molecular Subtypes classification, revealing that NT5E expression holds greater prognostic significance for CMS1 and CMS4 subtypes. Subsequently, we performed survival analyses for different MSI states, which similarly demonstrated that NT5E expression, regardless of high or low MSI status, significantly impacts patient prognosis compared to stable MSI. This suggests that NT5E exhibits both enzymatic and non-enzymatic functions within the tumor microenvironment. Regarding its non-enzymatic role, NT5E reduces intercellular adhesion by modulating cadherin-1 and vimentin, thereby inducing epithelial-mesenchymal transition (EMT) and conferring an ‘invasive phenotype’ upon tumor cells[18, 19]. Furthermore, NT5E plays a pivotal part in tumor cell proliferation, angiogenesis, and apoptosis by modulating signalling pathways such as the EGFR/Akt and VEGF/Akt pathways. The other function of NT5E—its enzymatic activity—refers to the catalysed conversion of AMP into ADO released into the extracellular environment, which plays a role in numerous physiological and pathophysiological conditions. Research indicates that adenosine is a potent immunosuppressive molecule[20]. Through A2A receptor-mediated signalling, adenosine suppresses T-cell and NK-cell function, promotes the differentiation of regulatory T cells (Tregs), and facilitates tumor immune evasion[21]. Extracellular ADO can influence the tumor immune microenvironment through multiple pathways and plays a significant role in tumor immune tolerance, whilst impairing anti-tumor immunity. To further validate this view, we performed pathway enrichment analysis on the RNA‑seq data, which revealed not only the enrichment of the purine metabolism pathway—a key process directly linked to the enzymatic function of NT5E—but also of the focal adhesion pathway. Focal adhesions are integrin‑mediated cell‑extracellular matrix connections that function both as physical anchoring points and as signaling hubs, responding to biochemical cues and mechanical forces. Activation of the focal adhesion pathway is initiated by integrin engagement, which subsequently triggers a cascade of downstream components. Integrin‑centered focal adhesion signaling is involved in virtually all aspects of cancer cell behavior[22]. Furthermore, we have identified the sphingolipid signalling pathway. Sphingolipids are structural molecules of the cell membrane that play a crucial role in maintaining barrier function and fluidity. They also regulate various biological processes—including growth, proliferation, migration, invasion and/or metastasis—by modulating signalling within the signalling networks of cancer cells. For example, chemotherapy, radiotherapy and/or oxidative stress induce the production of ceramides and sphingolins, which can mediate cell death, senescence and/or cell cycle arrest.[23]. GSEA also identified the regulation of the actin cytoskeleton as being enriched. The polymerisation of actin filaments at the cell membrane provides the driving force for a variety of cellular processes, such as cell migration, morphogenesis, endocytosis, phagocytosis and organelle dynamics. Consequently, abnormalities in the dynamics of the actin cytoskeleton are associated with a range of diseases, including cancer[24]. Research has shown that the actin cytoskeleton plays a role in the migration and metastasis of various tumor cells[25, 26]. In addition to these cellular functions, such as proliferation and migration, we also identified the T cell receptor signalling pathway, suggesting that NT5E is also involved in immune regulation within the tumor microenvironment. Here, we conducted an analysis of the correlation between NT5E expression in tumor cells and immune cell infiltration within the colon cancer immune microenvironment. The results indicate that NT5E expression levels are associated with the infiltration of various types of immune cells. Studies have shown that the overexpression of NT5E on tumor cells promotes T-cell apoptosis in vitro and suppresses their antitumor effects in vivo. Tumor-cell-expressed NT5E can limit natural killer (NK) cell-mediated tumor lysis, influence macrophage tumor immune responses, and inhibit dendritic cell (DC) secretion of the antitumor cytokine IL-12[12, 27]. Our results also indicate that NT5E is associated with impaired tumor cell killing and the promotion of tumor immune evasion. Subsequently, we analyzed the correlation between NT5E expression in tumor tissues and common immune checkpoints, and found that NT5E exhibited the most significant correlation with PD-L1 expression. Further validation through in vitro cellular experiments confirmed that NT5E promotes both invasion and proliferation in colorectal cancer cells. Our study also indicates that NT5E expression levels are elevated in patients with colorectal cancer and are positively correlated with lymph node metastasis. Meanwhile, a correlation was also observed between NT5E expression and PD-L1 expression in pathological tissues from colorectal cancer patients, consistent with findings reported by Noh, J. Y[28]. To further investigate the upstream regulatory relationship between NT5E and PD-L1, we performed validation at the genetic level. The results showed that silencing PD-L1 significantly downregulated NT5E expression, whereas silencing NT5E did not alter PD-L1 expression levels, indicating that PD-L1 acts as an upstream regulator positively controlling NT5E expression in a unidirectional manner, with no feedback regulation of NT5E on PD-L1 observed. At the protein level, we first confirmed the subcellular localization of NT5E in colorectal cancer tissues as cytoplasmic or membranous using the HPA database [29]. Subsequent experiments demonstrated that PD-L1 silencing also markedly reduced NT5E protein expression.In summary, tumor cell expression of NT5E drives malignant biological behavior, thereby accelerating colorectal cancer progression. Moreover, NT5E appears to be a potential biomarker for poorer prognosis in colorectal cancer. Therefore, our research indicates that NT5E plays a role in promoting cancer progression within both tumor cells and the tumor immune microenvironment. It also demonstrates predictive value for survival outcomes in colorectal cancer, suggesting potential as a future therapeutic target for colorectal cancer treatment, though further investigation is warranted. Whilst this study enhances our understanding of NT5E in colorectal cancer, certain limitations exist. Firstly, database results can only present partial information regarding NT5E at the gene level, and the database data does not fully represent the situation of colorectal cancer in China. Although further clinical pathological tissue analysis may help overcome this issue, we still require a larger sample size for further validation. Secondly, the key signalling pathways involved in this process warrant more in-depth experimental research to further elucidate their molecular mechanisms. Thirdly, the in vitro proliferation, invasion, and migration functions observed at the cellular level require validation through in vivo animal experimental models. In summary, we conducted a comprehensive analysis of the clinical significance, immunoprofile and potential mechanisms of NT5E in colorectal cancer. The results indicate that NT5E is frequently overexpressed in colorectal cancer, and that high NT5E expression is associated with lymph node metastasis, poor prognosis and an immunosuppressive tumor microenvironment. Current evidence suggests that NT5E exhibits malignant biological behavior in colorectal cancer; furthermore, NT5E is co-expressed with various immune checkpoint molecules. This may provide new insights into the prognostic assessment and immunotherapy of colorectal cancer, whilst offering potential targets for combination therapy. This study is expected to point the way towards new directions in the clinical diagnosis and treatment of colorectal cancer. Abbreviations Full form Abbreviation Metastatic colorectal cancer mCRC Ecto-5'-nucleotidase NT5E Adenosine ADO Copy number variation CNV Overall survival OS Recurrence-free survival RFS Hazard ratios HR Confidence intervals CI Gene Set Enrichment Analysis GSEA Kyoto Encyclopedia of Genes and Genomes KEGG Transcripts Per Million TPM Human Proteome Atlas HPA Immunohistochemical IHC Fetal bovine serum FBS Negative control NC Optical density OD Consensus Molecular Subtypes CMS Epithelial-mesenchymal transition EMT Declarations Ethics Approval: The study was conducted in accordance with the Declaration of Helsinki (2013 revision) and was approved by the Ethics Committee of Qinhuangdao First Hospital (Approval No.: 2025K-255-01). Informed consent was obtained from all patients. Availability of Data and Materials : The datasets generated in the current study are available from the corresponding author on reasonable request. Conflicts of Interest : The authors declare that they have no conflict of interest. Funding Statement: This research received support from various funding sources, including the Research Project of Hebei Provincial Administration of Traditional Chinese Medicine (Grant No. 2026136), Qinhuangdao City Science and Technology Program Project (Grant No. 202501A026), The Natural Science Foundation of Hebei Province (Grant No. C2025107013), The Hebei Province Medical-Research-Enterprise Joint Innovation Special Program（Grant No. LH20250022）. Author Contributions : All authors contributed to this study. Weixing Wu completed most of the experiments, analyzed the data, and edited the manuscript. Cheng Cheng and Weishan Meng participated in research design, literature search, graph drawing, and data processing.Tao Yang and Yimin Wang provided technical support as well as all reagents and chemical reagents. All authors have read and approved the final version of the manuscript. Acknowledgement: The authors thank MS Jiaqi Gu and MS Wanlu Zhang for excellent technical assistance, and all the investigators for participating in this study. References Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-63. Van Cutsem E, Cervantes A, Adam R, Sobrero A, Van Krieken JH, Aderka D, et al. ESMO consensus guidelines for the management of patients with metastatic colorectal cancer. Annals of oncology : official journal of the European Society for Medical Oncology. 2016;27(8):1386-422. Benson AB, Venook AP, Adam M, Chang G, Chen YJ, Ciombor KK, et al. Colon Cancer, Version 3.2024, NCCN Clinical Practice Guidelines in Oncology. Journal of the National Comprehensive Cancer Network : JNCCN. 2024;22(2 d). Le DT, Durham JN, Smith KN, Wang H, Bartlett BR, Aulakh LK, et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade. Science (New York, NY). 2017;357(6349):409-13. Weng J, Li S, Zhu Z, Liu Q, Zhang R, Yang Y, et al. Exploring immunotherapy in colorectal cancer. Journal of hematology & oncology. 2022;15(1):95. Sun Y, Li L, Cai L, Yang J, Qian J, Wang F, et al. Prognostic value and clinical significance of tumoral PD-L1 and stromal α-SMA expression in diffuse pleural mesothelioma. Neoplasma. 2026. Xie M, Qin H, Luo Q, Huang Q, He X, Yang Z, et al. MicroRNA-30a regulates cell proliferation and tumor growth of colorectal cancer by targeting CD73. BMC cancer. 2017;17(1):305. Antonioli L, Haskó G, Fornai M, Colucci R, Blandizzi C. Adenosine pathway and cancer: where do we go from here? Expert opinion on therapeutic targets. 2014;18(9):973-7. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer discovery. 2012;2(5):401-4. Győrffy B. Integrated analysis of public datasets for the discovery and validation of survival-associated genes in solid tumors. Innovation (Cambridge (Mass)). 2024;5(3):100625. Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, et al. Proteomics. Tissue-based map of the human proteome. Science (New York, NY). 2015;347(6220):1260419. Gao ZW, Dong K, Zhang HZ. The roles of CD73 in cancer. BioMed research international. 2014;2014:460654. Yang J, Liao X, Yu J, Zhou P. Role of CD73 in Disease: Promising Prognostic Indicator and Therapeutic Target. Curr Med Chem. 2018;25(19):2260-71. Cheng C, Shi C, Wu S, Wu W, Li J, Gao S, et al. Tumor-expressing PD-L1 regulates NT5E expression through MAPK/ERK pathway in triple-negative breast cancer. Oncology research. 2025;33(7):1633-48. Wu XR, He XS, Chen YF, Yuan RX, Zeng Y, Lian L, et al. High expression of CD73 as a poor prognostic biomarker in human colorectal cancer. Journal of surgical oncology. 2012;106(2):130-7. Liu N, Fang XD, Vadis Q. CD73 as a novel prognostic biomarker for human colorectal cancer. Journal of surgical oncology. 2012;106(7):918-9; author reply 20. Chowdhury S, Xiu J, Ribeiro JR, Nicolaides T, Zhang J, Korn WM, et al. Consensus molecular subtyping of metastatic colorectal cancer expands biomarker-directed therapeutic benefit for patients with CMS1 and CMS2 tumors. British journal of cancer. 2024;131(8):1328-39. Gao ZW, Wang HP, Lin F, Wang X, Long M, Zhang HZ, et al. CD73 promotes proliferation and migration of human cervical cancer cells independent of its enzyme activity. BMC cancer. 2017;17(1):135. Wang L, Fan J, Thompson LF, Zhang Y, Shin T, Curiel TJ, et al. CD73 has distinct roles in nonhematopoietic and hematopoietic cells to promote tumor growth in mice. J Clin Invest. 2011;121(6):2371-82. Allard B, Longhi MS, Robson SC, Stagg J. The ectonucleotidases CD39 and CD73: Novel checkpoint inhibitor targets. Immunological reviews. 2017;276(1):121-44. Ohta A, Gorelik E, Prasad SJ, Ronchese F, Lukashev D, Wong MK, et al. A2A adenosine receptor protects tumors from antitumor T cells. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(35):13132-7. Lin X, Zhuang S, Chen X, Du J, Zhong L, Ding J, et al. lncRNA ITGB8-AS1 functions as a ceRNA to promote colorectal cancer growth and migration through integrin-mediated focal adhesion signaling. Molecular therapy : the journal of the American Society of Gene Therapy. 2022;30(2):688-702. Ogretmen B. Sphingolipid metabolism in cancer signalling and therapy. Nature reviews Cancer. 2018;18(1):33-50. Lappalainen P, Kotila T, Jégou A, Romet-Lemonne G. Biochemical and mechanical regulation of actin dynamics. Nature reviews Molecular cell biology. 2022;23(12):836-52. Najm P, El-Sibai M. Palladin regulation of the actin structures needed for cancer invasion. Cell adhesion & migration. 2014;8(1):29-35. Dong Y, Jin Q, Sun M, Qi D, Qu H, Wang X, et al. CLDN6 inhibits breast cancer metastasis through WIP-dependent actin cytoskeleton-mediated autophagy. Journal of experimental & clinical cancer research : CR. 2023;42(1):68. Lian W, Jiang D, Lin W, Jiang M, Zhang Y, Wang H, et al. Dual role of CD73 as a signaling molecule and adenosine-generating enzyme in colorectal cancer progression and immune evasion. International journal of biological sciences. 2024;20(1):137-51. Noh JY, Lee IP, Han NR, Kim M, Min YK, Lee SY, et al. Additive Effect of CD73 Inhibitor in Colorectal Cancer Treatment With CDK4/6 Inhibitor Through Regulation of PD-L1. Cellular and molecular gastroenterology and hepatology. 2022;14(4):769-88. Aria H, Bakherad H, Mehdipour AR, Azizi M, Rezaei M. Design, engineering, and functional evaluation of nanobody-based anti-CD73 for immunogenic cell death induction in chemoresistant colorectal Cancer cell line. International immunopharmacology. 2026;172:116174. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFulllengthrawblotsforFigure6H420.pdf Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 11 May, 2026 Reviews received at journal 07 May, 2026 Reviewers agreed at journal 05 May, 2026 Reviewers agreed at journal 05 May, 2026 Reviewers agreed at journal 30 Apr, 2026 Reviews received at journal 26 Apr, 2026 Reviewers agreed at journal 23 Apr, 2026 Reviewers agreed at journal 23 Apr, 2026 Reviewers invited by journal 23 Apr, 2026 Editor assigned by journal 23 Apr, 2026 Editor invited by journal 20 Apr, 2026 Submission checks completed at journal 20 Apr, 2026 First submitted to journal 20 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9339416\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":633521646,\"identity\":\"5f0a2656-9056-408e-9c9b-569f94007183\",\"order_by\":0,\"name\":\"Weixing Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Qinhuangdao\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Weixing\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":633521647,\"identity\":\"a9a362e1-e7f4-45e1-a166-6a76b176d39f\",\"order_by\":1,\"name\":\"Cheng Cheng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Qinhuangdao\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Cheng\",\"middleName\":\"\",\"lastName\":\"Cheng\",\"suffix\":\"\"},{\"id\":633521648,\"identity\":\"5b3a0b6d-1848-47e9-9a3a-90d575c9aec7\",\"order_by\":2,\"name\":\"Tao Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Qinhuangdao\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tao\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":633521649,\"identity\":\"1d7a4b87-6f92-4527-812d-519a6f0a4218\",\"order_by\":3,\"name\":\"Weishan Meng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Hospital of Qinhuangdao\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Weishan\",\"middleName\":\"\",\"lastName\":\"Meng\",\"suffix\":\"\"},{\"id\":633521650,\"identity\":\"76c9b0a4-40cd-4b3f-b5a7-7272cc984d05\",\"order_by\":4,\"name\":\"Yimin Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYDCCAxCKh4GZgfExjCtBrBZmY5K0gACbNFFa+G6fMfxc8OuwjG4777Hqgoo70QYHmA/e5mGwy8OlRfJcjrH0zL7DPGaH+dJuzzjzLHfDAbZkax6G5GJcWgzO8G6Q5u0BaeExu83bdhiohcdMmofhQGIDbi2bf8O0FPP+A2nh/0ZIyzZpnh8QLcy8DWBb2PBqkTzD/82atyEdpMVYmufYs9yZh9mMLecYJOPUwneGLfk2zx9re7PzwKDjqbmT23e8+eGNNxV2OLWAAWNbMxKPGexgfOpB4E8dIRWjYBSMglEwkgEAAIlaqkewxAUAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"The First Hospital of Qinhuangdao\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yimin\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-04-07 04:38:25\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9339416/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9339416/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":108725848,\"identity\":\"19564248-ce8d-4f53-a080-c8a6dc1c59ee\",\"added_by\":\"auto\",\"created_at\":\"2026-05-07 16:59:34\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":129632,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNT5E genomic alterations analysis in colorectal cancer. A: Landscape of NT5E genetic alterations in pan-cancer. B: The overall genomic alterations of NT5E expression in colorectal cancer. C: NT5E expression in different alternation groups. D: The prognosis of NT5E based on its alternation condition.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/4564559faed273543dc3badf.png\"},{\"id\":108805929,\"identity\":\"c2b67be4-125b-4a9f-81b4-5e50e0a3cc1b\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:27:13\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":186607,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA: NT5E expression correlates with overall survival in colon cancer patients. B: NT5E expression correlates with recurrence-free survival in colorectal cancer patients. C: NT5E expression in stage I-II colon cancer patients shows no correlation with OS. D: NT5E expression correlates with OS in patients with stage III-IV colorectal cancer. E: NT5E expression correlates with OS in patients with CMS1 colorectal cancer. F: NT5E expression in CMS2 colorectal cancer patients is not correlated with OS. G: NT5E expression in CMS3 colorectal cancer patients is not correlated with OS. H: NT5E expression in CMS4 colorectal cancer patients correlates with OS. I: NT5E expression in microsatellite stable colorectal cancer patients is not correlated with RFS. J: NT5E expression in low microsatellite stability colorectal cancer patients correlates with RFS. K: NT5E expression in high microsatellite stability colorectal cancer patients correlates with RFS.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/a21801ead49a4c8669d7ebbc.png\"},{\"id\":108805810,\"identity\":\"ca9d811b-af39-4071-bb1c-155004961644\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:26:56\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":200619,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNT5E‑associated pathways and immune microenvironment in colon cancer..A: KEGG pathways in NT5E‑high versus NT5E‑low colon cancer samples. B: GSEA enrichment plot of purine metabolisms. C: GSEA enrichment plot of focal adhesion. D: GSEA enrichment plot of sphingolipid signalling pathway. E: GSEA enrichment plot of regulation of the actin cytoskeleton. F: Correlation analysis between NT5E expression in colorectal cancer and immune infiltration. G: GSEA enrichment plot of immune-related T cell receptor signalling. H: Correlation analysis of PD-L1 and NT5E in colorectal cancer. I: Correlation analysis of HAVCR2 and NT5E in colorectal cancer. J: Correlation analysis of PD-L1 and TIGIT in colorectal cancer.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/a79fda3c0aef4890aa89c0ad.png\"},{\"id\":108805813,\"identity\":\"98a03e21-90a6-4c2d-9f71-b237b73a1b01\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:26:56\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":495432,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eRepresentative immunohistochemical staining images of NT5E. A: Representative IHC image of NT5E in normal lymph node tissue. B: Representative IHC image of NT5E with high expression in colorectal cancer tissue. C: Representative IHC image of NT5E with moderate expression in colorectal cancer tissue.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/f32c84144c809202c3bccac6.png\"},{\"id\":108805946,\"identity\":\"b3df0963-1726-467e-a5bf-b86ae1c9fd3a\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:27:16\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":339121,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA: NT5E mRNA expression levels in colorectal cancer cell lines. B: Reduced expression of NT5E mRNA in colon cancer cells after NT5E gene silencing by Si-RNA method. C: Proliferation capacity of HCT116 cells transfected with si-NT5E assessed via the CCK-8 assay. D-E: Migration capacity of HCT116 cells transfected with si-NT5E evaluated through scratch assays. F-H: Migration (G) and invasion capacity (H) of HCT116 cells transfected with si-NT5E determined via Transwell migration and matrix gel invasion assays.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/5c47e221748f4adb3b59ca66.png\"},{\"id\":108725852,\"identity\":\"bdda05ba-b06f-4bde-8f31-a9d470111083\",\"added_by\":\"auto\",\"created_at\":\"2026-05-07 16:59:34\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":107224,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePD-L1 functions as an upstream regulator of NT5E expression. A: Expression of NT5E in clinical colorectal cancer tissue specimens. B: NT5E expression correlates with lymph node metastasis. C: NT5E expression in clinical colon cancer tissue positively correlates with PD-L1. D: Reduced expression of NT5E mRNA in colon cancer cells after NT5E gene silencing by Si-RNA method. E: No significant change of PD-L1 mRNA in colon cancer cells after NT5E gene silencing by Si-RNA method. F-H: Reduced expression of PD-L1 mRNA (F) and protein (G-H) in colon cancer cells after PD-L1 gene silencing by Si-RNA method. H-J: qRT-PCR(I) and Western blotting(H-J) were used to validate the decrease in NT5E expression following PD-L1 gene knockout.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/349a80bd26699406199f893d.png\"},{\"id\":108809978,\"identity\":\"2fc2306c-7ef1-49db-8a5b-ce29a07e541b\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:56:25\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1635738,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/31f3d239-1718-4f98-a383-83a784bd6534.pdf\"},{\"id\":108725846,\"identity\":\"8ebbb652-1f97-4e6a-971b-06563098ac93\",\"added_by\":\"auto\",\"created_at\":\"2026-05-07 16:59:34\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":575823,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryFulllengthrawblotsforFigure6H420.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9339416/v1/56f3ee9a89c195f7b744dfda.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"NT5E Promotes Colorectal Cancer Progression and Correlates with PD-L1 Expression: Evidence from Multi-Omics Analysis, Clinical Samples, and Cellular Functional Assays\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eColorectal cancer currently ranks as the second most common cancer globally, irrespective of gender. It is estimated that in 2022, over 1.9\\u0026nbsp;million new cases of colorectal cancer were diagnosed worldwide, with 904,000 deaths occurring \\u0026ndash; accounting for nearly one in ten of all cancer cases and deaths respectively. It ranks third in global cancer incidence and second in cancer-related mortality. In China, among the 4.8\\u0026nbsp;million new cancer cases recorded in 2022 alone, colorectal cancer incidence ranked second. However, numerous recent reports indicate a rising incidence of colorectal cancer among young adults (diagnosed under 50 years of age), increasing by 1%\\u0026ndash;4% annually[1] .\\u003c/p\\u003e \\u003cp\\u003eIn recent years, research into comprehensive treatments for colorectal cancer has continued to increase. Despite ongoing developments in drug regimens, breakthroughs in the treatment of metastatic colorectal cancer (mCRC) remain elusive, with prognosis remaining poor and median overall survival standing at merely 25\\u0026ndash;30 months[2]. Due to the adverse effects of chemotherapy drugs and the biological characteristics of tumor cells, traditional treatment strategies have struggled to achieve breakthroughs. Targeted drug combination therapy represents the primary treatment approach for patients with mCRC [3]. Immune checkpoint blockade therapy has achieved significant progress in the treatment of advanced malignancies. The first anti-PD-1/PD-L1 drug, pembrolizumab, was approved in 2017 for second-line treatment of mCRC, providing durable benefits for some patients and markedly improving disease prognosis[4]. Regrettably, immunotherapy proves effective only in a minority of patients. Immunotherapy is advancing rapidly. As research into immune checkpoint inhibitors deepens, novel predictive biomarkers continue to emerge[5, 6] .\\u003c/p\\u003e \\u003cp\\u003eEcto-5'-nucleotidase (NT5E, CD73) is a 63 kDa glycosylated protein anchored to the outer surface of the plasma membrane via a glycosylphosphatidylinositol anchor. It is overexpressed in various tumors, including colorectal cancer. The primary function of NT5E is to catalyse the conversion of extracellular 5'-AMP into adenosine (ADO) via adenosine receptors (A1, A2A, A2B, and A3 AR), thereby regulating diverse physiological responses and cancer development. Upregulation of NT5E correlates with highly invasive cancer phenotypes, drug resistance, and pro-tumorigenic functions. Research indicates that NT5E expressed by tumor cells is associated with the proliferation and metastasis of colorectal cancer; however, its precise mechanisms and potential role within the microenvironment remain unclear.[7, 8].\\u003c/p\\u003e \\u003cp\\u003eIn this study, we performed a multi-omics analysis to characterize NT5E expression, its clinical significance, its associations with the immune microenvironment, and the underlying pathways. We also conducted in vitro experiments to validate its functional role. This study aims to investigate the role of NT5E in colorectal cancer tumor cells and its potential mechanisms of action within the tumor microenvironment, seeking to identify NT5E as a key target for therapeutic intervention. It endeavours to provide novel insights into immunotherapy for colorectal cancer and its mechanisms of resistance. Our objective is to offer new strategies for identifying novel tumor markers and developing combination drug therapies, thereby enabling early diagnosis and personalised treatment for patients.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.1 Genomic Analysis of NT5E\\u003c/h2\\u003e\\n \\u003cp\\u003eThe Cancer Genome Bioinformatics (CBio) portal (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.cbioportal.org\\u003c/span\\u003e\\u003c/span\\u003e) is an open resource for interactive exploration of numerous multidimensional cancer genomic datasets, comprising over 5,000 tumor samples from 147 ongoing cancer studies[9]. This study primarily evaluates the somatic gene mutation/variant and copy number variation (CNV) profiles of the colorectal cancer mutant NT5E within the cBioPortal database.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.2 Survival Analysis of NT5E\\u003c/h2\\u003e\\n \\u003cp\\u003eThe online Kaplan-Meier plotter (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://kmplot.com/analysis\\u003c/span\\u003e\\u003c/span\\u003e, accessed 25 January 2026) is a meta-analysis database evaluating survival data for approximately 54,000 genes (genes, miRNAs, proteins) across 21 cancers including colorectal, gastric, ovarian, and lung cancers[10]. Our study assessed the prognostic significance of NT5E expression in colorectal cancer. The cohort was stratified into NT5E high-expression and NT5E low-expression groups based on median NT5E expression levels. Overall survival (OS) and recurrence-free survival (RFS) constituted the primary endpoints of our analysis. Hazard ratios (HR) with 95% confidence intervals (CI) were calculated for survival analysis, with p-values determined using the log-rank test.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.3 Bioinformatics Analysis and Immunological Infiltration Analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eThe TCGA database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://portal.gdc.cancer.gov\\u003c/span\\u003e\\u003c/span\\u003e) stands as one of the most comprehensive cancer databases available today, offering the most detailed characterisation of cancer features. Quality control was performed on the raw sequencing data to remove low-quality reads and adapter sequences. Subsequent analyses included gene expression quantification, Gene Set Enrichment Analysis (GSEA), differential gene expression analysis, as well as Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.\\u003c/p\\u003e\\n \\u003cp\\u003eRNA-seq data from the TCGA-Colon Cancer project\\u0026apos;s STAR workflow were downloaded from the TCGA database, organised, and processed to extract Transcripts Per Million (TPM) format data alongside clinical information. Data were log-transformed using the log2(value\\u0026thinsp;+\\u0026thinsp;1) method, with results visualised using ggplot2. Correlation analysis was performed using the ggplot2 package [3.3.6] within R software (version 4.2.1), employing Spearman\\u0026apos;s statistical method.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.4 Expression of NT5E in Colon Cancer\\u003c/h2\\u003e\\n \\u003cp\\u003eThe Human Proteome Atlas (HPA) (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.Proteatlas.org\\u003c/span\\u003e\\u003c/span\\u003e) encompasses virtually all human protein-coding genes in cells, tissues, and organs [11]. This study utilised the HPA database to evaluate the proteomic profile of NT5E in colorectal cancer tumors and normal tissue. Representative immunohistochemical (IHC) images demonstrating varying expression levels of NT5E are shown.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.5 Cell Culture and Transfection\\u003c/h2\\u003e\\n \\u003cp\\u003eHuman colon cancer HCT116 and SW480 cells were purchased from Zhongqiao Xinzhou Biotechnology Co., Ltd. (Shanghai). HT-29, LoVo, and SW620 cells were purchased from Procell Life Science \\u0026amp; Technology Co., Ltd. (Wuhan). Cells were cultured in high-glucose Dulbecco\\u0026apos;s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and maintained in a humidified incubator at 37\\u0026deg;C with 5% CO₂. For siRNA transient transfection, siRNA and negative control (NC) were designed and purchased from Shanghai GenePharma Co., Ltd. The most effective targeting sequence was: siNT5E: 5\\u0026apos;-GGA AUC GUU GGA UAC ACU UTT-3\\u0026apos;, siPD-L1: 5\\u0026apos;-CUGAGAAUCAACACAACAATT-3\\u0026apos;. Cells were seeded in 6-well plates, and when they reached 50\\u0026ndash;60% confluency, siRNA transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer\\u0026apos;s protocol. Cells were collected 48 hours post-transfection.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.6 Cell Proliferation Assay\\u003c/h2\\u003e\\n \\u003cp\\u003eFor cell proliferation assays, cells were stored overnight in 96-well plates at a density of 4 \\u0026times; 10\\u0026sup3; cells per well. Using the Cell Counting Kit-8 (MedChemExpress, USA) according to the manufacturer\\u0026apos;s instructions, optical density (OD) values were determined by measuring absorbance at 450 nm. Cell proliferation was measured at 24, 48, 72, and 96 hours.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.7 Wound Healing Assay\\u003c/h2\\u003e\\n \\u003cp\\u003eCells treated with siRNA were seeded into 6-well plates. After 24 hours of incubation, two vertical lines were drawn within the cells using a 200\\u0026micro;L pipette tip. Photographs of the scratch area were taken at 0 and 24 hours post-scratch using a microscope (DFC295, Leica, Buffalo Grove, USA). The scratch healing rate (%) was calculated as: [(0h scratch area \\u0026minus;\\u0026thinsp;24h scratch area) / 0h scratch area] \\u0026times; 100%.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.8 Transwell Assay\\u003c/h2\\u003e\\n \\u003cp\\u003eFor the invasion assay, Matrigel (BD Biosciences, USA) was evenly spread in the incubator and incubated overnight at 37\\u0026deg;C. Transwell chambers (BD Biosciences, USA) were employed for the invasion assay; Matrigel was not required for the migration assay. Cells were seeded at a density of 4 \\u0026times; 10⁴ cells per chamber in the upper chamber for 24\\u0026ndash;48 hours. Following crystal violet staining, three random fields of view were observed under an inverted phase-contrast microscope (DFC295, Leica, Buffalo Grove, USA), photographed, and counted. Image J software (version 1.53, National Institutes of Health, USA) was employed to statistically analyse and graphically represent the invasion and migration data.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.9 Patient Samples\\u003c/h2\\u003e\\n \\u003cp\\u003eThis study included 40 patients with colorectal cancer who underwent primary surgery in the Department of General Surgery at Qinhuangdao First Hospital between September 2025 to February 2026. Following surgery, all patients received standard adjuvant chemotherapy. This cohort possessed complete clinical-pathological data and follow-up records. The study was conducted in accordance with the Declaration of Helsinki (2013 revision). It received approval from the Ethics Committee of Qinhuangdao First Hospital (Approval No.: 2025K-255-01). Informed consent was obtained from all participants.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.10 RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eTotal RNA was extracted from cells using TRIzol reagent (Invitrogen, USA). cDNA was synthesised using the TUREscript RT Master Mix reverse transcription kit (Beijing Edle Bio-Technology Co., Ltd.). PCR amplification of cDNA was performed with GO Taq qPCR Master Mix (Promega, USA). Primers were procured from Shanghai Sangon Biotech Co., Ltd. The qRT-PCR primer sequences are as follows: NT5E (F: 5\\u0026apos;-CCC ATT CTT CTA AAC AGC AGC ATT C-3\\u0026apos;; R: 5\\u0026apos;-TGA TTG AGA GGA GCC ATC CAG ATA G-3\\u0026apos;), PD-L1 (F: 5\\u0026apos;- GACCACCACCACCAATTCCAAG\\u0026thinsp;\\u0026minus;\\u0026thinsp;3\\u0026apos;; R: 5\\u0026apos;- TTAGTTGTTGTGTTGATTCTCAGTGTG\\u0026thinsp;\\u0026minus;\\u0026thinsp;3\\u0026apos;), GAPDH (F: 5\\u0026apos;-GTG GAC CTG ACC TGC CGT CTA G-3\\u0026apos;; R: 5\\u0026apos;-GAG TGG GTG TCG CTG TTG AAG TC-3\\u0026apos;). Cycling conditions: 95\\u0026deg;C for 10 minutes, 95\\u0026deg;C for 15 seconds and 58\\u0026deg;C for 30 seconds, 72\\u0026deg;C for 30 seconds, 40 cycles, followed by 72\\u0026deg;C for 10 minutes. GAPDH was used as the internal control. The relative expression levels of the target genes were calculated using the 2^\\u003csup\\u003e(-\\u0026Delta;\\u0026Delta;CT)\\u003c/sup\\u003e method.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.11 Western Blotting Analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eCells were lysed using RIPA lysis buffer (Solarbio, R0010, Beijing, China), and incubated on ice for 30 minutes. Following centrifugation, the supernatants were collected. Protein concentrations were determined using a BCA Protein Assay Kit (Boster, BCA-001). Equal amounts of protein were resolved by 10% SDS-PAGE (Epizyme Biotech, PG212, Shanghai, China) and then electrotransferred onto polyvinylidene fluoride (PVDF) membranes (MilliporeSigma, IPVH00010, Darmstadt, Germany). The membranes were blocked with blocking buffer (Report, RW0501, Tianjin, China) for 1 hour at room temperature and subsequently incubated overnight at 4\\u0026deg;C with primary antibodies against PD-L1 (1:1000; Proteintech, 28076-1-AP), NT5E (1:1000; Boster, A02120-3), and GAPDH (1:10000; Proteintech, 60004-1-Ig). After washing three times with Tris-buffered saline containing Tween-20 (Epizyme Biotech, TF103), each for 10 minutes, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, including anti-mouse (1:1000; Bioworld, BA1050) and anti-rabbit (1:1000; Bioworld, BA1054), for 2 hours at room temperature. Following additional washes as described above, immunoreactive bands were visualized using an enhanced chemiluminescence (ECL) detection kit (Thermo Scientific, WP20005, USA). Band intensities were quantified using Image J software.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e2.12 Statistical Analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eThis study employed SPSS 26.0 and Image J software for statistical analysis. Results are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. Unpaired two-tailed Student\\u0026apos;s t-tests were used to compare data between groups. Chi-square and rank-sum tests analysed the relationship between NT5E expression levels and clinical characteristics. Survival curves were plotted using the Kaplan-Meier method, with Cox proportional hazards models estimating potential prognostic effects. Pearson\\u0026apos;s correlation coefficient was applied for correlation analysis. *\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, or ***\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001 indicated statistically significant differences.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Genomic Variation Patterns of NT5E in Colorectal Cancer\\u003c/h2\\u003e \\u003cp\\u003eOverall analysis indicated that the mutation rate of the NT5E gene in colorectal cancer tissues was relatively low across pan-cancer data in the cBioPortal database (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). We selected a study project with mRNA data (Sidra-LUMC AC-ICAM, Nat Med 2023) for analysis. The results showed that NT5E gene alterations included missense mutations, splice site mutations, amplification (AMP), deep deletion, mRNA high expression, and mRNA low expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). Subsequently, we analyzed the relationship between NT5E gene expression and its genomic status to further validate the regulatory mechanisms of NT5E expression. The results showed that AMP led to relatively higher NT5E expression, while deep deletion was associated with lower NT5E mRNA expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Notably, in this study, the alteration frequency of NT5E was 5.17% (18/348 cases), with an AMP rate of 0.57% (2/348) and an mRNA high expression rate of 2.3% (8/348), which together constituted the majority of NT5E gene alterations. However, CNV of NT5E showed no significant difference in the prognosis of colon cancer patients (HR: 1.087, 95% CI: 0.541\\u0026ndash;2.186, Log-rank P-Value: 0.804; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Prognostic Significance of NT5E in Colon Cancer\\u003c/h2\\u003e \\u003cp\\u003eUsing the Kaplan-Meier Plotter database, we validated the association between NT5E expression and prognosis in colorectal cancer patients. Results demonstrated a significant correlation between NT5E expression and OS in colorectal cancer patients (HR\\u0026thinsp;=\\u0026thinsp;1.49, 95% CI: 0.17\\u0026ndash;1.9, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0011; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). Concurrently, NT5E expression was also significantly correlated with RFS in colorectal cancer patients (HR\\u0026thinsp;=\\u0026thinsp;1.62, 95% CI: 1.25\\u0026ndash;2.11, \\u003cem\\u003eP\\u0026thinsp;=\\u003c/em\\u003e\\u0026thinsp;0.00026; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Subsequent analysis by disease stage revealed that in advanced-stage (III-IV) colorectal cancer patients, low NT5E expression was associated with improved OS (HR\\u0026thinsp;=\\u0026thinsp;1.5, 95% CI: 1.19\\u0026ndash;1.9, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.00062; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). In contrast, in relatively early-stage (I-II) colorectal cancer patients, NT5E expression showed no correlation with OS (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003eWe further conducted survival analyses based on CMS (Consensus Molecular Subtypes). Results indicate that: in CMS1-type colorectal cancer patients, low NT5E expression was associated with improved OS (HR\\u0026thinsp;=\\u0026thinsp;2.18, 95% CI: 1.24\\u0026ndash;3.82, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0053; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE); Similarly, in CMS4, low NT5E expression correlated with favorable OS (HR\\u0026thinsp;=\\u0026thinsp;2.05, 95% CI: 1.34\\u0026ndash;3.15, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.00078; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eH). However, NT5E expression showed no significant association with OS in CMS2 or CMS3 patients (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG). Re-evaluation of NT5E expression's prognostic significance across three microsatellite instability states revealed that high NT5E expression correlated with poor prognosis in both low microsatellite instability (HR\\u0026thinsp;=\\u0026thinsp;2.95, 95% CI: 1.9\\u0026ndash;4.58, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eJ) and high microsatellite instability (HR\\u0026thinsp;=\\u0026thinsp;0.21, 95% CI: 0.05\\u0026ndash;0.96, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.026, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eK), whereas NT5E expression in microsatellite-stable tumors showed no prognostic value (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eI).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Pathway Enrichment and Immune Microenvironment Correlation Analysis of NT5E Expression\\u003c/h2\\u003e \\u003cp\\u003eWe performed pathway enrichment analysis on the aforementioned RNA-seq data using the KEGG and conducted GSEA analysis. The results of the KEGG pathway enrichment analysis indicated that this process was implicated in pathways related to cytoskeletal stability, DNA replication, cellular metabolism, cell adhesion, and T cell receptor signaling (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). To further validate these findings, we plotted GSEA enrichment plots, which revealed four significantly enriched pathways in the NT5E high-expression group: purine metabolism (NES\\u0026thinsp;=\\u0026thinsp;1.308, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.026, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB), focal adhesion(NES\\u0026thinsp;=\\u0026thinsp;1.517, p.adjust\\u0026thinsp;=\\u0026thinsp;3.86e-04, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC), sphingolipid signalling pathway(NES\\u0026thinsp;=\\u0026thinsp;1.686, p.adjust\\u0026thinsp;=\\u0026thinsp;6.66e-05, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD), regulation of the actin cytoskeleton(NES\\u0026thinsp;=\\u0026thinsp;1.489, p.adjust\\u0026thinsp;=\\u0026thinsp;3.86e-04, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE), and immune-related T cell receptor signalling (NES\\u0026thinsp;=\\u0026thinsp;1.585, p.adjust\\u0026thinsp;=\\u0026thinsp;9.63e-04, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG).\\u003c/p\\u003e \\u003cp\\u003eSubsequently, we employed the TCGA database to analyse the correlation between NT5E expression and immune infiltrating cells within the colorectal cancer tumor microenvironment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). We then utilised Spearman's correlation method to sequentially examine the relationship between NT5E and various immune cell types within the TCGA database. Results demonstrated that NT5E expression in colorectal cancer exhibited a significant positive correlation with helper T cells within the tumor microenvironment (R\\u0026thinsp;=\\u0026thinsp;0.180, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). It also showed a significant positive correlation with helper Macrophages (R\\u0026thinsp;=\\u0026thinsp;0.174, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). It exhibited a significant positive correlation with helper mast cells in the tumor microenvironment (R\\u0026thinsp;=\\u0026thinsp;0.166, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). It showed a significant positive correlation with Th1 cells in the tumor microenvironment (R\\u0026thinsp;=\\u0026thinsp;0.131, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). Significantly positively correlated with T cells in the tumor microenvironment (R\\u0026thinsp;=\\u0026thinsp;0.101, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). Significantly negatively correlated with helper NK CD56dim cells in the tumor microenvironment (R\\u0026thinsp;=\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.131, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001).\\u003c/p\\u003e \\u003cp\\u003eFurther correlation analyses were conducted between common immune checkpoints and NT5E using the online TCGA database. The results showed that, in colorectal cancer, there was a significant positive correlation between NT5E and PD-L1 expression (R\\u0026thinsp;=\\u0026thinsp;0.201, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eH); there was a significant positive correlation between NT5E and HAVCR2 expression (R\\u0026thinsp;=\\u0026thinsp;0.13, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.006, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eI); and there was a significant positive correlation between NT5E and TIGIT expression (R\\u0026thinsp;=\\u0026thinsp;0.018, P\\u0026thinsp;=\\u0026thinsp;0.022, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eJ).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 Detection of NT5E Expression in Colorectal Cancer by Immunohistochemistry\\u003c/h2\\u003e \\u003cp\\u003eTo analyse and validate NT5E protein expression in the colon, we assessed the expression pattern of NT5E protein via immunohistochemical staining using a specific mouse antibody (HPA017357, Sigma-Aldrich, Germany) within the HPA database. Results demonstrated that NT5E exhibits subcellular localisation within the cytoplasm or cell membrane of both normal lymph node tissue (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA) and colon cancer tissue (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB, \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB and Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC display representative IHC images of NT5E with high and moderate expression, respectively.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 Biological Functions of NT5E in Colon Cancer Cell Lines\\u003c/h2\\u003e \\u003cp\\u003eWe employed real-time quantitative PCR to validate NT5E expression in five common colorectal cancer cell lines, including HCT116, SW480, HT-29, LoVo, and SW620. Results indicated that NT5E mRNA expression was highest in the HCT116 cell line (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). Subsequently, we silenced the NT5E gene in the HCT116 colon cancer cell line\\u0026mdash;which exhibited the highest NT5E expression\\u0026mdash;using siRNA knockdown (si-NT5E). Compared to the si-NC control group, NT5E mRNA expression was significantly downregulated in the si-NT5E group (0.20\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.05 vs. 1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.02; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). We therefore employed small RNA interference technology to knock down NT5E in the HCT116 cell line to further validate its biological function. CCK8 assay results demonstrated significantly reduced cell proliferation at days 3 and 4 post-knockdown compared to the si-NC group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC).Wound healing assays demonstrated that NT5E knockdown impaired cell migration capacity (percentage: 20.70% \\u0026plusmn; 3.34% vs. 48.80% \\u0026plusmn; 10.82%; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD-\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE).Furthermore, validation via Transwell chamber assays demonstrated that NT5E knockdown significantly reduced cell migration capacity compared to the si-NC group (transmembrane cell count: 495.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;12.5 vs. 1315\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;107.2; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF-\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eG) and invasion capacity (number of cells crossing the membrane: 139.33\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;18.00 vs. 423.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;41.24; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF、5H).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6 Correlation Between NT5E and PD-L1 Expression in Tissues and Colorectal Cancer Cells\\u003c/h2\\u003e \\u003cp\\u003eTo further validate the expression of NT5E in colorectal cancer within the real-world setting and its clinical significance, we extracted total RNA from 40 colorectal cancer tissues and their adjacent normal tissues within our clinical sample repository. We subsequently analysed the correlation between NT5E expression and clinical pathological characteristics (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Results indicated that in our cohort, the rate of NT5E under-expression (NT5E levels in colon cancer tissue lower than in adjacent normal tissue) was 35% (14/40), while the rate of NT5E over-expression (NT5E levels in colon cancer tissue higher than in adjacent normal tissue) was 65% (26/40). Furthermore, regarding clinical information, NT5E expression showed a significant association with lymph node metastasis in colorectal cancer patients (χ\\u0026sup2;: 4.945, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0262) (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). In the real-world setting, further validation using the aforementioned clinical pathological data revealed a consistent correlation between NT5E and PD-L1 expression in 40 pairs of colorectal cancer specimens (χ\\u0026sup2;: 4.183, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0408, Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e \\u0026amp; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003eTo further validate the relationship between PD-L1 and NT5E, we conducted gene knockdown experiments using small RNA interference technology on the HCT1116 cell line. Firstly, at the genetic level, no significant changes in PD-L1(Figure \\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB) were observed in cells with NT5E knockdown(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE, 1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.00 vs. 1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.00; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.51). Next, we confirmed the successful knockdown of PD-L1 at both mRNA and protein levels (mRNA level: 0.21\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.02 vs. 1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.00; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001 Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eF; protein level: 0.39\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.11 vs. 1.02\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.05; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eG-\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eH). Quantitative RT-PCR and Western blotting analyses revealed that NT5E expression was significantly downregulated in si-PD-L1 cells compared to the si-NC control group (mRNA level: 0.37\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.06 vs. 1.00\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.00; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eI; protein level: 0.66\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.13 vs. 1.03\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.10; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eH-\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eJ).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eRelationship between NT5E expression and clinicopathological characteristics of colon cancer patients.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eCharacteristics\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c3\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003eexpression of NT5E\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e Value\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eLow expression of NT5E\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eHigh expression of NT5E\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003en\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eGender\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.666\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMale\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFemale\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eLocation\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.8416\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLeft\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRight\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eTumor Size\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.8163\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u0026le;\\u0026thinsp;2 cm\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u0026gt;\\u0026thinsp;2 cm\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eLymph Node Metastasis\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.0262\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNo\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eYes\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eDistant Metastasis\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.6971\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNo\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eYes\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eStage\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.1867\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eI-II\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIII-IV\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eCorrelation between NT5E and PD-L1 expression in colorectal cancer tissues.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eCharacteristics\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c3\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003eexpression of NT5E\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eP Value\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eLow\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eHigh\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003en\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePD-L1,n(%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.0408\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLow\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e9(64.29%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e8(30.77%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHigh\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5(35.71%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e18(69.23%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eThe initiation, progression and metastasis of tumors constitute complex malignant processes within the body, involving a series of events including the uncontrolled proliferation of mutated cells, suppression of programmed cell death, abundant angiogenesis, evasion of immune surveillance, invasion, and colonisation of distant organs. Multiple signalling pathways have been demonstrated to participate in cancer development. In recent years, the purinergic signalling pathway, utilising extracellular ATP (adenosine triphosphate), ADP (adenosine diphosphate), and adenosine as primary signalling molecules, has emerged as a significant contributor to cancer progression. NT5E, a glycosylphosphatidylinositol-linked cell surface enzyme found in normal tissues, catalyses the conversion of extracellular 5'-AMP to ADO via adenosine receptors (A1, A2A, A2B, and A3 AR). NT5E plays a pivotal role in activating adenosine signalling pathways.\\u003c/p\\u003e \\u003cp\\u003eThe overexpression of NT5E is driven by the tumor hypoxic microenvironment and certain soluble inflammatory mediators. Recent studies have demonstrated that NT5E is overexpressed in multiple solid malignancies, including breast cancer, colorectal cancer, prostate cancer, and ovarian cancer[12\\u0026ndash;14]. This is consistent with our research, which also found that gene overexpression constitutes the majority proportion of somatic mutations in NT5E in colorectal cancer.\\u003c/p\\u003e \\u003cp\\u003eSubsequent survival analysis further revealed that NT5E expression is associated with both OS and RFS. Studies have also reported that high NT5E expression in colorectal cancer patients is associated with poor prognosis[15, 16]. We conducted survival analyses for early-stage and advanced-stage colorectal cancer based on patient staging, demonstrating that NT5E holds greater prognostic significance for patients with advanced colorectal cancer. The CMS classification was developed through collaborative efforts by Guinney et al. in 2015. It aims to integrate recent analyses of molecular characteristics in colorectal cancer conducted by multiple research groups, thereby delineating four distinct colorectal cancer subtypes: CMS1 (microsatellite instability-immunoreactive), CMS2 (original), CMS3 (metabolic), and CMS4 (stromal). Patients with CMS1 or CMS4 tumors exhibit poorer prognosis[17].We conducted survival analyses for each subtype based on the Consensus Molecular Subtypes classification, revealing that NT5E expression holds greater prognostic significance for CMS1 and CMS4 subtypes. Subsequently, we performed survival analyses for different MSI states, which similarly demonstrated that NT5E expression, regardless of high or low MSI status, significantly impacts patient prognosis compared to stable MSI. This suggests that NT5E exhibits both enzymatic and non-enzymatic functions within the tumor microenvironment.\\u003c/p\\u003e \\u003cp\\u003eRegarding its non-enzymatic role, NT5E reduces intercellular adhesion by modulating cadherin-1 and vimentin, thereby inducing epithelial-mesenchymal transition (EMT) and conferring an \\u0026lsquo;invasive phenotype\\u0026rsquo; upon tumor cells[18, 19]. Furthermore, NT5E plays a pivotal part in tumor cell proliferation, angiogenesis, and apoptosis by modulating signalling pathways such as the EGFR/Akt and VEGF/Akt pathways. The other function of NT5E\\u0026mdash;its enzymatic activity\\u0026mdash;refers to the catalysed conversion of AMP into ADO released into the extracellular environment, which plays a role in numerous physiological and pathophysiological conditions. Research indicates that adenosine is a potent immunosuppressive molecule[20]. Through A2A receptor-mediated signalling, adenosine suppresses T-cell and NK-cell function, promotes the differentiation of regulatory T cells (Tregs), and facilitates tumor immune evasion[21]. Extracellular ADO can influence the tumor immune microenvironment through multiple pathways and plays a significant role in tumor immune tolerance, whilst impairing anti-tumor immunity.\\u003c/p\\u003e \\u003cp\\u003eTo further validate this view, we performed pathway enrichment analysis on the RNA‑seq data, which revealed not only the enrichment of the purine metabolism pathway\\u0026mdash;a key process directly linked to the enzymatic function of NT5E\\u0026mdash;but also of the focal adhesion pathway. Focal adhesions are integrin‑mediated cell‑extracellular matrix connections that function both as physical anchoring points and as signaling hubs, responding to biochemical cues and mechanical forces. Activation of the focal adhesion pathway is initiated by integrin engagement, which subsequently triggers a cascade of downstream components. Integrin‑centered focal adhesion signaling is involved in virtually all aspects of cancer cell behavior[22]. Furthermore, we have identified the sphingolipid signalling pathway. Sphingolipids are structural molecules of the cell membrane that play a crucial role in maintaining barrier function and fluidity. They also regulate various biological processes\\u0026mdash;including growth, proliferation, migration, invasion and/or metastasis\\u0026mdash;by modulating signalling within the signalling networks of cancer cells. For example, chemotherapy, radiotherapy and/or oxidative stress induce the production of ceramides and sphingolins, which can mediate cell death, senescence and/or cell cycle arrest.[23]. GSEA also identified the regulation of the actin cytoskeleton as being enriched. The polymerisation of actin filaments at the cell membrane provides the driving force for a variety of cellular processes, such as cell migration, morphogenesis, endocytosis, phagocytosis and organelle dynamics. Consequently, abnormalities in the dynamics of the actin cytoskeleton are associated with a range of diseases, including cancer[24]. Research has shown that the actin cytoskeleton plays a role in the migration and metastasis of various tumor cells[25, 26]. In addition to these cellular functions, such as proliferation and migration, we also identified the T cell receptor signalling pathway, suggesting that NT5E is also involved in immune regulation within the tumor microenvironment. Here, we conducted an analysis of the correlation between NT5E expression in tumor cells and immune cell infiltration within the colon cancer immune microenvironment. The results indicate that NT5E expression levels are associated with the infiltration of various types of immune cells. Studies have shown that the overexpression of NT5E on tumor cells promotes T-cell apoptosis in vitro and suppresses their antitumor effects in vivo. Tumor-cell-expressed NT5E can limit natural killer (NK) cell-mediated tumor lysis, influence macrophage tumor immune responses, and inhibit dendritic cell (DC) secretion of the antitumor cytokine IL-12[12, 27]. Our results also indicate that NT5E is associated with impaired tumor cell killing and the promotion of tumor immune evasion. Subsequently, we analyzed the correlation between NT5E expression in tumor tissues and common immune checkpoints, and found that NT5E exhibited the most significant correlation with PD-L1 expression.\\u003c/p\\u003e \\u003cp\\u003eFurther validation through in vitro cellular experiments confirmed that NT5E promotes both invasion and proliferation in colorectal cancer cells. Our study also indicates that NT5E expression levels are elevated in patients with colorectal cancer and are positively correlated with lymph node metastasis. Meanwhile, a correlation was also observed between NT5E expression and PD-L1 expression in pathological tissues from colorectal cancer patients, consistent with findings reported by Noh, J. Y[28]. To further investigate the upstream regulatory relationship between NT5E and PD-L1, we performed validation at the genetic level. The results showed that silencing PD-L1 significantly downregulated NT5E expression, whereas silencing NT5E did not alter PD-L1 expression levels, indicating that PD-L1 acts as an upstream regulator positively controlling NT5E expression in a unidirectional manner, with no feedback regulation of NT5E on PD-L1 observed. At the protein level, we first confirmed the subcellular localization of NT5E in colorectal cancer tissues as cytoplasmic or membranous using the HPA database [29]. Subsequent experiments demonstrated that PD-L1 silencing also markedly reduced NT5E protein expression.In summary, tumor cell expression of NT5E drives malignant biological behavior, thereby accelerating colorectal cancer progression. Moreover, NT5E appears to be a potential biomarker for poorer prognosis in colorectal cancer.\\u003c/p\\u003e \\u003cp\\u003eTherefore, our research indicates that NT5E plays a role in promoting cancer progression within both tumor cells and the tumor immune microenvironment. It also demonstrates predictive value for survival outcomes in colorectal cancer, suggesting potential as a future therapeutic target for colorectal cancer treatment, though further investigation is warranted. Whilst this study enhances our understanding of NT5E in colorectal cancer, certain limitations exist. Firstly, database results can only present partial information regarding NT5E at the gene level, and the database data does not fully represent the situation of colorectal cancer in China. Although further clinical pathological tissue analysis may help overcome this issue, we still require a larger sample size for further validation. Secondly, the key signalling pathways involved in this process warrant more in-depth experimental research to further elucidate their molecular mechanisms. Thirdly, the in vitro proliferation, invasion, and migration functions observed at the cellular level require validation through in vivo animal experimental models.\\u003c/p\\u003e \\u003cp\\u003eIn summary, we conducted a comprehensive analysis of the clinical significance, immunoprofile and potential mechanisms of NT5E in colorectal cancer. The results indicate that NT5E is frequently overexpressed in colorectal cancer, and that high NT5E expression is associated with lymph node metastasis, poor prognosis and an immunosuppressive tumor microenvironment. Current evidence suggests that NT5E exhibits malignant biological behavior in colorectal cancer; furthermore, NT5E is co-expressed with various immune checkpoint molecules. This may provide new insights into the prognostic assessment and immunotherapy of colorectal cancer, whilst offering potential targets for combination therapy. This study is expected to point the way towards new directions in the clinical diagnosis and treatment of colorectal cancer.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eFull form\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eAbbreviation\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eMetastatic colorectal cancer\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003emCRC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eEcto-5\\u0026apos;-nucleotidase\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eNT5E\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eAdenosine\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eADO\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eCopy number variation\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eCNV\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eOverall survival\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eOS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eRecurrence-free survival\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eRFS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eHazard ratios\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eHR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eConfidence intervals\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eCI\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eGene Set Enrichment Analysis\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eGSEA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eKyoto Encyclopedia of Genes and Genomes\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eKEGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eTranscripts Per Million\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eTPM\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eHuman Proteome Atlas\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eHPA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eImmunohistochemical\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eIHC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eFetal bovine serum\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eFBS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eNegative control\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eNC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eOptical density\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eOD\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eConsensus Molecular Subtypes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eCMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 387px;\\\"\\u003e\\n \\u003cp\\u003eEpithelial-mesenchymal transition\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 166px;\\\"\\u003e\\n \\u003cp\\u003eEMT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics Approval:\\u003c/strong\\u003e The study was conducted in accordance with the Declaration of Helsinki (2013 revision) and was approved by the Ethics Committee of Qinhuangdao First Hospital (Approval No.: 2025K-255-01). Informed consent was obtained from all patients.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of Data and Materials\\u003c/strong\\u003e: The datasets generated in the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of Interest\\u003c/strong\\u003e: The authors declare that they have no conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding Statement:\\u003c/strong\\u003e This research received support from various funding sources, including the Research Project of Hebei Provincial Administration of Traditional Chinese Medicine (Grant No. 2026136), Qinhuangdao City Science and Technology Program Project (Grant No. 202501A026), The Natural Science Foundation of Hebei Province (Grant No. C2025107013), The Hebei Province Medical-Research-Enterprise Joint Innovation Special Program（Grant No. LH20250022）.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e: All authors contributed to this study. Weixing Wu completed most of the experiments, analyzed the data, and edited the manuscript. Cheng Cheng and Weishan Meng participated in research design, literature search, graph drawing, and data processing.Tao Yang and Yimin Wang provided technical support as well as all reagents and chemical reagents. All authors have read and approved the final version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement:\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eThe authors thank MS Jiaqi Gu and MS Wanlu Zhang for excellent technical assistance, and all the investigators for participating in this study. \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229-63.\\u003c/li\\u003e\\n\\u003cli\\u003eVan Cutsem E, Cervantes A, Adam R, Sobrero A, Van Krieken JH, Aderka D, et al. ESMO consensus guidelines for the management of patients with metastatic colorectal cancer. Annals of oncology : official journal of the European Society for Medical Oncology. 2016;27(8):1386-422.\\u003c/li\\u003e\\n\\u003cli\\u003eBenson AB, Venook AP, Adam M, Chang G, Chen YJ, Ciombor KK, et al. Colon Cancer, Version 3.2024, NCCN Clinical Practice Guidelines in Oncology. Journal of the National Comprehensive Cancer Network : JNCCN. 2024;22(2 d).\\u003c/li\\u003e\\n\\u003cli\\u003eLe DT, Durham JN, Smith KN, Wang H, Bartlett BR, Aulakh LK, et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade. Science (New York, NY). 2017;357(6349):409-13.\\u003c/li\\u003e\\n\\u003cli\\u003eWeng J, Li S, Zhu Z, Liu Q, Zhang R, Yang Y, et al. Exploring immunotherapy in colorectal cancer. Journal of hematology \\u0026amp; oncology. 2022;15(1):95.\\u003c/li\\u003e\\n\\u003cli\\u003eSun Y, Li L, Cai L, Yang J, Qian J, Wang F, et al. Prognostic value and clinical significance of tumoral PD-L1 and stromal \\u0026alpha;-SMA expression in diffuse pleural mesothelioma. Neoplasma. 2026.\\u003c/li\\u003e\\n\\u003cli\\u003eXie M, Qin H, Luo Q, Huang Q, He X, Yang Z, et al. MicroRNA-30a regulates cell proliferation and tumor growth of colorectal cancer by targeting CD73. BMC cancer. 2017;17(1):305.\\u003c/li\\u003e\\n\\u003cli\\u003eAntonioli L, Hask\\u0026oacute; G, Fornai M, Colucci R, Blandizzi C. Adenosine pathway and cancer: where do we go from here? Expert opinion on therapeutic targets. 2014;18(9):973-7.\\u003c/li\\u003e\\n\\u003cli\\u003eCerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer discovery. 2012;2(5):401-4.\\u003c/li\\u003e\\n\\u003cli\\u003eGyőrffy B. Integrated analysis of public datasets for the discovery and validation of survival-associated genes in solid tumors. Innovation (Cambridge (Mass)). 2024;5(3):100625.\\u003c/li\\u003e\\n\\u003cli\\u003eUhl\\u0026eacute;n M, Fagerberg L, Hallstr\\u0026ouml;m BM, Lindskog C, Oksvold P, Mardinoglu A, et al. Proteomics. Tissue-based map of the human proteome. Science (New York, NY). 2015;347(6220):1260419.\\u003c/li\\u003e\\n\\u003cli\\u003eGao ZW, Dong K, Zhang HZ. The roles of CD73 in cancer. BioMed research international. 2014;2014:460654.\\u003c/li\\u003e\\n\\u003cli\\u003eYang J, Liao X, Yu J, Zhou P. Role of CD73 in Disease: Promising Prognostic Indicator and Therapeutic Target. Curr Med Chem. 2018;25(19):2260-71.\\u003c/li\\u003e\\n\\u003cli\\u003eCheng C, Shi C, Wu S, Wu W, Li J, Gao S, et al. Tumor-expressing PD-L1 regulates NT5E expression through MAPK/ERK pathway in triple-negative breast cancer. Oncology research. 2025;33(7):1633-48.\\u003c/li\\u003e\\n\\u003cli\\u003eWu XR, He XS, Chen YF, Yuan RX, Zeng Y, Lian L, et al. High expression of CD73 as a poor prognostic biomarker in human colorectal cancer. Journal of surgical oncology. 2012;106(2):130-7.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu N, Fang XD, Vadis Q. CD73 as a novel prognostic biomarker for human colorectal cancer. Journal of surgical oncology. 2012;106(7):918-9; author reply 20.\\u003c/li\\u003e\\n\\u003cli\\u003eChowdhury S, Xiu J, Ribeiro JR, Nicolaides T, Zhang J, Korn WM, et al. Consensus molecular subtyping of metastatic colorectal cancer expands biomarker-directed therapeutic benefit for patients with CMS1 and CMS2 tumors. British journal of cancer. 2024;131(8):1328-39.\\u003c/li\\u003e\\n\\u003cli\\u003eGao ZW, Wang HP, Lin F, Wang X, Long M, Zhang HZ, et al. CD73 promotes proliferation and migration of human cervical cancer cells independent of its enzyme activity. BMC cancer. 2017;17(1):135.\\u003c/li\\u003e\\n\\u003cli\\u003eWang L, Fan J, Thompson LF, Zhang Y, Shin T, Curiel TJ, et al. CD73 has distinct roles in nonhematopoietic and hematopoietic cells to promote tumor growth in mice. J Clin Invest. 2011;121(6):2371-82.\\u003c/li\\u003e\\n\\u003cli\\u003eAllard B, Longhi MS, Robson SC, Stagg J. The ectonucleotidases CD39 and CD73: Novel checkpoint inhibitor targets. Immunological reviews. 2017;276(1):121-44.\\u003c/li\\u003e\\n\\u003cli\\u003eOhta A, Gorelik E, Prasad SJ, Ronchese F, Lukashev D, Wong MK, et al. A2A adenosine receptor protects tumors from antitumor T cells. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(35):13132-7.\\u003c/li\\u003e\\n\\u003cli\\u003eLin X, Zhuang S, Chen X, Du J, Zhong L, Ding J, et al. lncRNA ITGB8-AS1 functions as a ceRNA to promote colorectal cancer growth and migration through integrin-mediated focal adhesion signaling. Molecular therapy : the journal of the American Society of Gene Therapy. 2022;30(2):688-702.\\u003c/li\\u003e\\n\\u003cli\\u003eOgretmen B. Sphingolipid metabolism in cancer signalling and therapy. Nature reviews Cancer. 2018;18(1):33-50.\\u003c/li\\u003e\\n\\u003cli\\u003eLappalainen P, Kotila T, J\\u0026eacute;gou A, Romet-Lemonne G. Biochemical and mechanical regulation of actin dynamics. Nature reviews Molecular cell biology. 2022;23(12):836-52.\\u003c/li\\u003e\\n\\u003cli\\u003eNajm P, El-Sibai M. Palladin regulation of the actin structures needed for cancer invasion. Cell adhesion \\u0026amp; migration. 2014;8(1):29-35.\\u003c/li\\u003e\\n\\u003cli\\u003eDong Y, Jin Q, Sun M, Qi D, Qu H, Wang X, et al. CLDN6 inhibits breast cancer metastasis through WIP-dependent actin cytoskeleton-mediated autophagy. Journal of experimental \\u0026amp; clinical cancer research : CR. 2023;42(1):68.\\u003c/li\\u003e\\n\\u003cli\\u003eLian W, Jiang D, Lin W, Jiang M, Zhang Y, Wang H, et al. Dual role of CD73 as a signaling molecule and adenosine-generating enzyme in colorectal cancer progression and immune evasion. International journal of biological sciences. 2024;20(1):137-51.\\u003c/li\\u003e\\n\\u003cli\\u003eNoh JY, Lee IP, Han NR, Kim M, Min YK, Lee SY, et al. Additive Effect of CD73 Inhibitor in Colorectal Cancer Treatment With CDK4/6 Inhibitor Through Regulation of PD-L1. Cellular and molecular gastroenterology and hepatology. 2022;14(4):769-88.\\u003c/li\\u003e\\n\\u003cli\\u003eAria H, Bakherad H, Mehdipour AR, Azizi M, Rezaei M. Design, engineering, and functional evaluation of nanobody-based anti-CD73 for immunogenic cell death induction in chemoresistant colorectal Cancer cell line. International immunopharmacology. 2026;172:116174.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-cancer\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"bcan\",\"sideBox\":\"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/bcan/default.aspx\",\"title\":\"BMC Cancer\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Colon Cancer, NT5E, PD-L1, Tumor Microenvironment, Prognosis, Immunotherapy\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9339416/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9339416/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eExtracellular 5'-nucleotidase (NT5E/CD73) plays a pivotal role in the tumor immune microenvironment by catalysing the production of adenosine. This study aims to evaluate the expression and function of NT5E in colorectal cancer progression, and to explore its potential as a novel biomarker and for associated immunotherapy.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eGenomic alterations, prognostic significance, and immune landscape of NT5E were analyzed using cBioPortal, Kaplan‑Meier Plotter, the cancer genome atlas(TCGA)and the Human Protein Atlas. Following siRNA‑mediated knockdown in HCT116 cells, proliferation, migration, and invasion were assessed. NT5E and PD‑L1 expression were examined in 40 paired colorectal cancer specimens by qRT‑PCR. The regulatory relationship between PD‑L1 and NT5E was further validated in vitro.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eNT5E alterations were identified in 5.17% of CRC patients, primarily manifested as high mRNA expression and amplification. Elevated NT5E expression was significantly correlated with poorer overall survival and relapse‑free survival, particularly in patients with advanced stage, CMS1 (Consensus Molecular Subtypes 1), CMS4, and high microsatellite instability (MSI-H) subtypes. Gene set enrichment analysis revealed enrichment of purine metabolism, sphingolipid signaling, focal adhesion, and T cell receptor signaling pathways in NT5E‑high tumors. NT5E expression was positively correlated with helper T cells, macrophages, and mast cells, while negatively correlated with NK CD56dim cells. A significant positive correlation was observed between NT5E and PD‑L1, HAVCR2, and TIGIT. In clinical specimens, NT5E was upregulated in 65% of colorectal cancer tissues and positively associated with lymph node metastasis and PD‑L1 expression. In vitro experiments demonstrated that NT5E knockdown suppressed the proliferation, migration, and invasion of colorectal cancer cells, and confirmed that PD‑L1 regulates NT5E expression in colon cancer cells.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eNT5E accelerates disease progression by promoting malignant biological behaviors in colorectal cancer and synergistically shaping an immunosuppressive microenvironment with PD-L1. Its overexpression constitutes an independent adverse prognostic factor. This discovery offers novel insights for anti-PD-1/PD-L1 combination immunotherapy.\\u003c/p\\u003e\",\"manuscriptTitle\":\"NT5E Promotes Colorectal Cancer Progression and Correlates with PD-L1 Expression: Evidence from Multi-Omics Analysis, Clinical Samples, and Cellular Functional Assays\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-05-07 16:59:29\",\"doi\":\"10.21203/rs.3.rs-9339416/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-05-11T12:29:43+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-07T16:31:38+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"240530964380550431865111633307579369717\",\"date\":\"2026-05-05T19:50:39+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"26788120434484568774113572564631053003\",\"date\":\"2026-05-05T07:09:29+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"85715828003231319883080115433576320873\",\"date\":\"2026-04-30T17:30:33+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-26T10:59:07+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"163550514215326323003754449109233551205\",\"date\":\"2026-04-23T11:58:31+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"277841798289043316108380290151773576055\",\"date\":\"2026-04-23T10:05:33+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-23T05:38:48+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-04-23T05:33:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2026-04-20T14:31:47+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-04-20T13:17:58+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"BMC Cancer\",\"date\":\"2026-04-20T12:22:35+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-cancer\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"bcan\",\"sideBox\":\"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/bcan/default.aspx\",\"title\":\"BMC Cancer\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"53c07aa8-0f25-49d8-9cc9-e34765014736\",\"owner\":[],\"postedDate\":\"May 7th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-05-11T12:29:43+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-07T16:31:38+00:00\",\"index\":62,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"240530964380550431865111633307579369717\",\"date\":\"2026-05-05T19:50:39+00:00\",\"index\":60,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"26788120434484568774113572564631053003\",\"date\":\"2026-05-05T07:09:29+00:00\",\"index\":58,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"85715828003231319883080115433576320873\",\"date\":\"2026-04-30T17:30:33+00:00\",\"index\":46,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"in-revision\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-05-11T12:54:46+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-05-07 16:59:29\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9339416\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9339416\",\"identity\":\"rs-9339416\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}