{"paper_id":"4a2f8f94-5d18-4153-86dc-d8e7da57efc0","body_text":"Effects of CwlM, a peptidoglycan synthesis regulator, on beta-lactam resistance and host-pathogen interactions | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return\"[object Function]\"==o.call(a)}function e(a){return\"string\"==typeof a}function f(){}function g(a){return!a||\"loaded\"==a||\"complete\"==a||\"uninitialized\"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){(\"c\"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){\"img\"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),\"object\"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height=\"0\",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),\"img\"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||\"j\",e(a)?i(\"c\"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName(\"script\")[0],o={}.toString,p=[],q=0,r=\"MozAppearance\"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&\"[object Opera]\"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?\"object\":l?\"script\":\"img\",v=l?\"script\":u,w=Array.isArray||function(a){return\"[object Array]\"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split(\"!\"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split(\"=\"),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(\".\").pop().split(\"?\").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split(\"/\").pop().split(\"?\")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&\"css\"==i.url.split(\".\").pop().split(\"?\").shift()?\"c\":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Effects of CwlM, a peptidoglycan synthesis regulator, on beta-lactam resistance and host-pathogen interactions View ORCID Profile Cátia Silveiro , View ORCID Profile Diana Mortinho , View ORCID Profile Francisco Olivença , View ORCID Profile Manoj Mandal , View ORCID Profile David Pires , View ORCID Profile Elsa Anes , View ORCID Profile Maria João Catalão doi: https://doi.org/10.1101/2025.07.08.663695 Cátia Silveiro 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Cátia Silveiro Diana Mortinho 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Diana Mortinho Francisco Olivença 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Francisco Olivença Manoj Mandal 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Manoj Mandal David Pires 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal 2 Universidade Católica Portuguesa, Católica Medical School, Centre for Interdisciplinary Research in Health , Lisbon, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for David Pires Elsa Anes 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Elsa Anes Maria João Catalão 1 Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa , Lisboa, Portugal Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Maria João Catalão For correspondence: mjcatalao{at}ff.ulisboa.pt Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Background The emergence and spread of multidrug-resistant (MDR) strains of Mycobacterium tuberculosis ( Mtb ) urge the development of novel drugs and efficient therapeutic programs. A recent study aiming to uncover differential beta-lactam susceptibility phenotypes in clinical strains of Mtb found that the M237V substitution in cwlM ( Rv3915 ) was associated with increased susceptibility to amoxicillin. Considering that Mycobacterium smegmatis ( Msm ) is a widely used surrogate model for Mtb , we constructed a cwlM knockdown mutant in Msm using CRISPR interference (CRISPRi) to elucidate the role of CwlM in beta-lactam susceptibility and intracellular survival. Results Quantitative RT-PCR assays confirmed the successful repression of cwlM , while the phenotyping assays confirmed the essentiality of CwlM-related processes for mycobacterial viability. Collectively, the antibiotic susceptibility assays suggested that CwlM SMEG may promote beta-lactam resistance, particularly to meropenem and cefotaxime. Moreover, CwlM SMEG was found to support M. smegmatis intracellular survival within THP-1-derived macrophages. To address conflicting reports regarding its predicted peptidoglycan (PG) hydrolase activity, we purified recombinant CwlM TB . The Micrococcus luteus -derived PG-based zymogram indicated that CwlM TB lacks PG-hydrolytic activity, suggesting it might act as a regulator of PG biosynthesis instead. Conclusions Our findings indicate that CwlM contributes to beta-lactam resistance and intracellular survival, regardless of lacking detectable PG-hydrolytic activity. Overall, CwlM was found to be essential and highly vulnerable, highlighting its potential as a therapeutic target that warrants further investigation. Background Tuberculosis (TB) remains the deadliest infectious disease worldwide, having claimed 1.25 million lives in 2023 and causing over 10 million TB cases annually, a rising trend since 2021 [ 1 ]. The emergence and dissemination of multi- and extensively-drug-resistant (MDR/XDR) TB urge the identification of novel drug targets for the development of effective curative treatments [ 1 , 2 ]. In this context, a structure worth exploring is the peculiar cell wall (CW) of mycobacteria, which is essential for its viability and virulence. The mycobacterial CW encompasses a distinctively cross-linked and enzymatically modified peptidoglycan (PG), a highly branched arabinogalactan (AG) polysaccharide and characteristic long-chain mycolic acids (MA) [ 3 , 4 ]. Despite its uniqueness, the mycobacterial PG is still overlooked when identifying antitubercular targets. The biosynthesis of PG starts in the cytoplasm with the generation of uridine diphosphate (UDP)- N -acetylglucosamine, which is then converted into UDP- N -acetylmuramic acid (UDP-Mur N Ac) by MurA and MurB [ 3 , 4 ]. After, the N -acetylmuramic acid hydroxylase NamH catalyzes the hydroxylation of UDP-Mur N Ac to UDP- N -glycolylmuramic acid (UDP-Mur N Glyc) [ 5 ]. This PG modification promotes resistance to lysozyme and beta-lactams [ 5 , 6 ] and modulates host-pathogen interactions [ 6 - 9 ]. The subsequent addition of L-Ala (MurC), D-Glu (MurD), meso -DAP (MurE) and D-Ala-D-Ala (MurF) produces the muramyl-pentapeptide, which is then anchored to the plasma membrane (PM) by MraY/MurX, generating lipid I [ 3 , 4 ]. The final intracellular step of PG synthesis, the formation of lipid II, is catalyzed by MurG. Both lipid I and II are then amidated at the α-carboxyl group of D- iso glutamate (D- i Glu) by the MurT/GatD amidotransferase complex [ 10 - 12 ]. The amidation of D- i Glu is essential for PG cross-linking in mycobacteria [ 13 , 14 ], modulates PknB-dependent cell division [ 15 ], promotes resistance to beta-lactams and lysozyme [ 6 , 14 ], and functions as an immune evasion strategy during infection [ 6 , 9 ]. Likewise, the amidation of lipid II at the ε-carboxyl group of m -DAP is catalyzed by AsnB [ 16 , 17 ]. Apart from being essential for cell growth and L, D-transpeptidase (Ldt) activity in Mycobacterium tuberculosis ( Mtb ) [ 18 ], the amidation of m -DAP also modulates resistance to antibiotics and lysozyme [ 19 , 20 ] as well as host immune responses. Once the MurJ flippase catalyzes the translocation of modified lipid II across the PM, the PG is polymerized by transglycosylases, penicillin-biding proteins (PBPs) and Ldts. Beta-lactams, a broadly employed and reliable antibiotic class, could be incorporated into alternative drug-resistant TB (DR-TB) therapeutic schemes, offering improvements over the current lengthy and toxic regimens. These regimens usually exclude beta-lactams due to the intrinsic resistance of Mtb to these antibiotics, credited not only to a potent beta-lactamase [ 21 ] but also to the impervious layer of MA and the predominance of non-classical Ldt-catalyzed 3→3 cross-links [ 22 , 23 ]. Nonetheless, several reports found that MDR-TB strains are particularly susceptible to carbapenems when combined with beta-lactamase inhibitors, such as clavulanate [ 24 - 29 ]. A previous study screened 172 clinical strains of Mtb for differential beta-lactam susceptibility phenotypes and conducted a whole genome sequencing analysis to identify cases in which the prospective addition of beta-lactams to TB therapy may yield added benefits [ 29 ]. The M237V substitution in cwlM ( Rv3915 ), present in 50/172 isolates, was associated with increased susceptibility to amoxicillin, with and without clavulanate [ 29 ]. Being highly conserved amid mycobacteria and essential for Mtb survival, CwlM is predicted to be a N -acetylmuramoyl-L-alanine amidase, a type of PG hydrolase [ 30 , 31 ]. Whereas Deng et al. [ 30 ] have shown that CwlM TB possesses autolysin activity, a recent study found the function of CwlM to be regulatory rather than enzymatic [ 31 ]. CwlM is the main substrate of the essential serine/threonine protein kinase (STPK) PknB [ 32 ]. Replicating Mtb produces two forms of CwlM: phosphorylated CwlM binds to FhaA, a fork head-associated domain protein, whereas non-phosphorylated membrane-associated CwlM interacts with the MurJ flippase [ 32 ]. In nutrient-replete conditions, CwlM is phosphorylated in the cytoplasm, binds to MurA, the first enzyme in PG biosynthesis, and stimulates its catalytic activity by ∼ 30-fold [ 31 ]. In starvation or stasis, CwlM is dephosphorylated (possibly by PstP) [ 33 ], consequently downregulating PG biosynthesis and promoting antibiotic tolerance [ 31 ]. In this case, the activity of MurJ is stimulated, resulting in the accumulation of non-incorporated PG muropeptides in the periplasm [ 32 ]. Overall, CwlM simultaneously regulates the biosynthesis of PG precursors and their translocation across the PM. Therefore, the balance between both forms of CwlM, influenced by altered PknB expression or activity, is essential for cell viability [ 32 ]. Here, we implemented the dCas9 Sth1 -based CRISPRi system [ 34 ] in Mycobacterium smegmatis , a widely used surrogate for Mtb , to uncover the role of the PG hydrolase homolog, CwlM SMEG , in susceptibility to beta-lactams and host-pathogen interactions. Additionally, we purified recombinant CwlM TB to elucidate its activity. Methods Bacterial strains, culture conditions, plasmids, cell lines, and antibiotics A description of the bacterial strains, plasmids, and cell lines employed in this study is provided in Table 1 . Escherichia coli ( E. coli ) strains were grown in Luria-Bertani (LB) media (Merck), overnight (ON) at 37°C, to amplify the CRISPRi backbone PLJR962 (Addgene #115162) and for cloning. Micrococcus luteus ( M. luteus ) strains were also grown in Luria-Bertani (LB) media and used for the zymography assay. M. smegmatis strains were grown in Middlebrook 7H9 broth (BD™ Biosciences) supplemented with 0.2% glycerol (ThermoScientific), 0.05% tyloxapol (Sigma-Aldrich), and 0.5% glucose (Sigma-Aldrich). For plating procedures, mycobacteria were grown on 7H10 agar (BD™ Biosciences) with 0.5% glycerol. Bacteria were incubated at 37°C with (liquid cultures) or devoid of (plates) shaking at 180 rpm. Media for all bacteria were supplemented with 25 μg/mL of kanamycin as appropriate. To stimulate target gene knockdown by the dCas9 Sth1 -sgRNA complex, 100 ng / mL of ATc were added to the cultures when necessary. RPMI-1640 media (Gibco) supplemented with 10% fetal bovine serum, 1% sodium pyruvate, 1% L-Glutamine, 1% HEPES buffer and 1% non-essential amino acids was used to grow THP-1 cells at 37°C, with an atmosphere of 5% of CO 2 . Antibiotic stocks of amoxicillin (AMX), cefotaxime (CTX), ethambutol (EMB), isoniazid (INH), meropenem (MEM) and vancomycin (VAN) (all from Sigma-Aldrich) were prepared in purified MilliQ water to a final concentration of 1.28 mg/mL. The stocks of ATc (Sigma-Aldrich) were prepared in dimethyl sulfoxide (DMSO) cell culture grade (AppliChem) at 10 mg/mL. The stocks of potassium clavulanate (CLA) (Sigma-Aldrich) were prepared in phosphate buffer at 0.1 M, pH 6.0. View this table: View inline View popup Download powerpoint Table 1: Bacterial strains, plasmids, and cell lines used in this study. Cloning of the CRISPRi plasmid and preparation of the cwlM knockdown mutant The cloning techniques were carried out as formerly described [ 6 , 34 , 36 ]. The non-template strand of the gene of interest (GOI), cwlM ( MSMEG_6935 ) was targeted, to produce efficient silencing. Since cwlM is putatively essential for Mtb viability [ 30 ], the template strand of cwlM was searched for a PAM associated with medium-to-low repression and accordingly guided sgRNA design ( Table 2 ). The CRISPRi backbone PLJR962 was amplified in E. coli JM109 and digested as previously described [ 6 ]. For sgRNA cloning, two complementary primers were designed (PFwd_sgRNA_cwlM: 5’ - GGGAACCCGCCGGTGACGCGTGAGC - 3’; PRv_sgRNA_cwlM: 5’ - AAACGCTCACGCGTCACCGGCGGGT - 3’), synthesized (Eurofins Genomics), annealed, and ligated to the backbone vector with T4 DNA ligase (400 U/µL; NEB). To obtain the interference plasmid, E. coli competent cells were transformed with the ligation mixture by double heat-shock, and the resulting recombinant DNA was purified with the NZYMiniprep kit (NZYTech). M. smegmatis competent cells were electroporated with 300 ng of recombinant DNA in the presence of 10% glycerol to generate the cwlM knockdown mutant (KDM) [ 6 , 37 ]. View this table: View inline View popup Download powerpoint Table 2: sgRNAs used to target cwlM in M. smegmatis . RNA extraction and quantitative reverse-transcription PCR (qRT-PCR) The collection of cultures for total RNA extraction was performed as previously described [ 6 ]. Briefly, induction with 100 ng/mL of ATc occurred at an optical density at 600 nm (OD 600 ) of about 0.1 and the cultures were then allowed to grow for 6 h at 37°C. The cells were harvested, resuspended in 500 µL of RNAprotect Bacteria Reagent (Qiagen) and stored at -80°C. Lysis was carried out with 350 µL of buffer NR (NZYTech) and 3.5 µL of beta-mercaptoethanol (Merck), followed by mechanical disruption in a BeadBug™ (Benchmark Scientific). Bead-beating occurred for 4 cycles (each with 1 min) at maximum speed, with 1 min incubations on ice between each cycle. After, the lysate was transferred into the NZYSpin Homogenization column (NZYTech), and the following steps were performed according to the instructions provided by the NZYTotal RNA Isolation Kit. RNA was eluted with warm DEPC water (Invitrogen) and rigorously treated with TurboDNase (Invitrogen) to prevent genomic DNA contamination. The obtained RNA was quantified using Nanodrop™ and the lack of DNA contamination was corroborated by PCR on the housekeeping gene sigA , followed by gel electrophoresis analysis [ 6 ]. Reverse transcription reactions were performed using 100 ng of purified RNA as template, following the instructions of the NZY First-Strand cDNA Synthesis kit (NZYTech). Afterwards, cDNA was quantified using the NZYSupreme qPCR Green Master Mix (2x), ROX (NZYTech) on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The 40-cycle qPCR reaction ensued in this way: 95°C for 2 min, then 95°C for 5 s and 60°C for 30 s. The employed primers (Eurofins Genomics; Table 3 ) were designed to amplify a specific product between 100-200 bps, and their amplification efficiency was assessed by calibration curves and proven to be 80-110%. For every run, a minimum of two technical replicates and one negative control were utilized, and the mean C T was calculated. Data were analyzed using the ΔΔC T method with sigA ( MSMEG_2758 ) as a reference gene and M. smegmatis WT as the calibrator sample [ 34 , 36 , 38 ]. Two independent measurements were used to quantify the target mRNA sequences [ 6 , 39 ]. View this table: View inline View popup Download powerpoint Table 3: Primers used to quantify the mRNA expression of target genes by qRT-PCR in M. smegmatis . Phenotyping To evaluate cell viability differences following CRISPRi induction, spotting assays were performed as previously described [ 6 ]. Briefly, cultures of M. smegmatis were allowed to reach the log phase of growth, normalized to a theoretical OD 600 of 0.001, and serially diluted. A 5 µL aliquot from each dilution was plated on agar media, which could be devoid of antibiotics or contain meropenem (MEM; 0.25, 0.5, and 1 µg/mL) or cefotaxime (CTX; 8, 16, and 32 µg/mL) at different concentrations, as indicated in brackets. The plating of each bacterial suspension occurred in both induced and non-induced conditions, following incubation at 37°C for 2 days. At least three independent experiments were performed. Minimum inhibitory concentration (MIC) determination To uncover differences in antibiotic susceptibility, the MICs of three beta-lactams (AMX, CTX and MEM), with and without the beta-lactamase inhibitor clavulanate, as well as one glycopeptide (vancomycin) and two first-line antimycobacterial agents (INH and EMB), were determined as formerly described [ 6 ]. The MIC was annotated as the lowest concentration of antibiotic capable of preventing visible bacterial growth. The median MIC values were calculated from three independent experiments. Disk diffusion assays To determine susceptibility differences on solid media following CRISPRi induction, disk diffusion assays were performed with MEM or AMX+CLA, as described previously [ 21 , 40 ]. Briefly, the cultures of M. smegmatis were grown to log phase, normalized to a theoretical OD 600 of 0.05, and uniformly distributed over the 7H10 (+ ATc) plates using a pour-plate technique. Subsequently, antibiotics were prepared at the indicated test concentrations (MEM: 256 and 512 µg/mL; AMX: 512 and 1024 µg/mL; CLA: 2.5 µg/mL). Then, 20 μL of each antibiotic dilution was added to 9 mm filter paper disks (Filterlab), which were allowed to dry and placed onto the mycobacterial lawn using a sterile needle. The plates were then incubated at 37°C for 2 days, after which photographs were captured on an iBright FL1500 Imaging System (Invitrogen) and the diameter of the zone of inhibition (halo) was measured (in mm) using the ImageJ software. Three independent experiments were performed. THP-1 infection assays and intracellular survival evaluation To explore the role of CwlM in intracellular survival, THP-1-derived macrophages were infected with control and mutant bacteria. THP-1 monocytes were passaged every 3-4 days, being kept at a density above 2 × 10 5 cells/mL. When necessary, the cells were seeded in 48-well flat-bottom tissue culture plates at a density of 1.5 × 10 5 cells/well and differentiated into macrophages with 20 nM of phorbol 12-myristate 13-acetate (PMA; Sigma-Aldrich) for 24 h [ 41 ]. On the day of THP-1 seeding, the bacterial cultures were diluted to an OD 600 of about 0.007 and incubated at 37°C with shaking till an OD 600 of approximately 0.1 was reached. At that point (∼24 h before infection), the cultures were incubated with or without 100 ng/mL of ATc. Approximately 24 h before infection, the cell media containing PMA was removed and replenished with prewarmed supplemented RPMI media. On the day of infection, bacterial cultures were centrifuged at 3,000 x g for 5 min and washed with 5 mL of PBS 1 X (Gibco) [ 42 ]. The resultant pellets were then resuspended in supplemented RPMI media, subjected to an ultrasonic bath for 5 min, and centrifuged at 500 x g for 1 min to obtain a single-cell suspension [ 43 ]. After discarding the cell media from the seeding plates, THP-1-derived macrophages were infected with mycobacteria at a multiplicity of infection (MOI) of 5 and, incubated at 37°C with 5% CO 2 for several timepoints (1 h; 4 h; 24 h) [ 6 , 42 ]. After one hour of internalization, the infection media was discarded, macrophages were washed thrice with prewarmed PBS 1 X, and resuspended in supplemented RPMI media containing 50 µg/mL gentamicin to kill extracellular bacteria and 100 ng/mL of ATc, when suitable. Following distinct pre-determined incubation times (T 1 , T 4 , T 24 ), the media was discarded, the cells were washed thrice with PBS 1 X and, incubated at 37°C with a 0.05% IGEPAL solution for 15 min to induce lysis [ 43 ]. After, the lysates were serially diluted in sterile water and plated onto 7H10 plates, which were incubated for 2 days at 37°C with 5% CO 2 [ 42 ]. Using an inverted microscope (Nikon TMS Inverted Phase Contrast Microscope), the colony-forming units (CFUs) of three independent biological replicates, each counting three technical replicates, were counted. Cloning of recombinant CwlM TB To overexpress and characterize the CwlM TB protein, the cwlM gene ( Rv3915 ) was cloned in frame with a C-terminal polyhistidine (His6) tag into the pET29b backbone, as previously described [ 40 , 44 ]. The oligonucleotides PFwd_ cwlM (5’ – GACCATATGCCGAGTCCGCGCCGCG – 3’) and PRv_ cwlM (5’ – GCCCTCGAGAGAACCGCCGAGTCTACC – 3’) were used to amplify the cwlM gene from 30 ng of Mtb H37Rv genomic DNA using 0.025 U/µL of Supreme NZYProof DNAPolymerase (NZYTech). The PCR was conducted on a thermocycler (Life Technology - SimpliAmp), with the following PCR program: 96°C for 4 min, 1 cycle; 96°C for 30 s, 63°C for 30 s and 72°C for 40 s, 30 cycles; 72°C for 10 min, 1 cycle. The 1234 bp PCR product was confirmed by 0.8% agarose gel electrophoresis and visualized using the iBright™ FL1500. Afterwards, the PCR reaction was scaled up, the PCR product was purified using the NZYGelpure kit (NZYTech) and, 800 ng of purified PCR product and 600 ng of the pET29b plasmid were then digested at 37°C for 3 h with 2.5 µL of FastDigest Xho I and Nde I (ThermoScientific) in a final volume of 80 µL. The reaction products were purified using the NZYGelpure kit (NZYTech) and separated by a 0.8% agarose gel electrophoresis, followed by visualization on iBright™ FL1500. The digested fragment was then ligated to 50 ng of digested pET29b with 80 U of T4 DNA ligase (400 U/µL; NEB) using a vector-to-insert ratio of 1:5, at 22°C for 1 h in a ThermoMixer C (Eppendorf). Afterwards, E. coli JM109 chemically competent cells were transformed with 5 μL of ligation mixture using a double heat-shock approach, and the recombinant DNA was purified according to the instructions of the NZYMiniprep kit (NZYTech). The obtained recombinant plasmid was then quantified, evaluated for purity, and sequenced using primers that specifically amplify the T7 RNA polymerase promoter PFwd_T7 (5’ – TAATACGACTCACTATAGGG – 3’) and terminator PRv_T7 (5’ – CTAGTTATTGCTCAGCGG – 3’). Expression of recombinant CwlM TB in E. coli BL21(DE3) and SDS-PAGE analysis E. coli BL21 (DE3) chemically competent cells were transformed with 300 ng of the pET29b: cwlM construct using a double-heat shock procedure [ 40 ]. Inoculums from E. coli BL21(DE3):pET29b: cwlM transformants were prepared and incubated at 37°C with shaking until the OD 600 was about 0.5. Then, cultures were induced with 1 μM of IPTG (NZYTech), incubated in two distinct conditions, at 37°C for 3 h and at 16°C overnight, collected by centrifugation, and frozen at -20°C [ 40 ]. The next day, pellets were resuspended in a lysis buffer solution [(50 mM Tris, 300 mM NaCl), supplemented with 1% of a cocktail of protease inhibitors (Calbiochem), 10 μg/mL DNAse, 10% glycerol and 0.1% Triton X-100], sonicated twice for 60 seconds (0.5 cycles, 100% amplitude, pulse on, on ice), centrifuged at 8,000 x g, 4°C for 20 min, separated from the supernatant, and stored at -20°C. SDS-PAGE analysis of the obtained pellets and supernatants was performed in a Mini-PROTEAN® Tetra Cell to verify the presence of the protein of interest, according to the standard protocol Hand Casting Polyacrylamide Gels by Bio-Rad [ 40 ]. To prepare the ready-to-load samples, 6 μL of loading dye (5 X SDS-PAGE Sample Loading Buffer; NZYTech) were combined with 24 μL of the supernatants. Pellets were resuspended in 24 μL of running buffer 1 X (50 mM Tris, 500 mM glycine (pH 8.3), 0.1% w/v SDS), and then mixed with 6 μL of loading dye (5 X SDS-PAGE Sample Loading Buffer). Afterwards, the samples were heated at 100°C for 5 min and iced for 1 min. An amount of 20 μL of each sample was applied to the gel, the stacking gel ran at 80 V and the resolving gel ran at 120 V. After the run, the gel was stained with BlueSafe (NZYTech) for approximately 30 min. Based on the comparison of soluble protein yields under both induction conditions, we chose to induce 2 L of culture at 16°C overnight [ 40 ]. Purification of CwlM TB After induction, the scaled-up 2 L culture was collected by centrifugation, and the resulting pellet of E. coli BL21(DE3) cells expressing CwlM TB was thawed on ice and resuspended in 40 mL of lysis buffer [ 40 ]. Lysis was achieved by sonication in 10 cycles of 30 s, 50% amplitude, interpolated by 40 s rest periods. Afterwards, the lysate was centrifuged (Centrifuge 5810 - Eppendorf) at 11,200 x g, 4°C, for 45 min and the supernatant was filtered using 0.45 μM and 0.2 μM filters (GE Healthcare). The soluble extract was then loaded in ÄKTAprime plus and purification of the His 6 -tagged CwlM TB protein was carried out with a HisTrap FF Crude 1 mL Column (Cytiva), according to the instructions provided by the manufacturer. Washing buffer (50 mM Tris, 300 mM NaCl, 40 mM Imidazole, 1 mM DTT, pH 8.0), elution buffer (50 mM Tris, 300 mM NaCl, 300 mM Imidazole, 1 mM DTT, pH 8.0), MilliQ water, and 20% ethanol were also loaded in the system when appropriate. The bound CwlM TB protein was eluted in the presence of imidazole, a competitive agent of His 6 -tagged proteins [ 45 ]. After elution, all fractions were collected, pooled, and the buffer was exchanged by overnight dialysis at 4°C with magnetic stirring, using dialysis buffer (20 mM Tris, 150 mM NaCl, 25% glycerol, 1 mM DTT) [ 40 ]. Next, the protein sample was centrifuged at 10,000 x g, 4°C, for 10 min and filtered using 0.2 μM filters. The purified CwlM TB protein sample was subsequently quantified by the Bradford method, using bovine serum albumin (BSA, 10 μg/mL) (Sigma-Aldrich) as a standard [ 40 ]. Zymography study to characterize the enzymatic activity of the CwlM TB protein To uncover whether the CwlM TB protein has PG-hydrolytic activity, a zymography assay was carried out against PG obtained from M. luteus . First, the bacteria were grown at 37°C for two days until exhaustion, centrifuged at 4,000 x g, 4°C, for 10 min, and the pellet was washed once with MilliQ water. The pellet was then resuspended in MilliQ water, autoclaved, and harvested by centrifugation at 12,000 x g, 4°C for 20 min. After discarding the supernatant, the pellet was dried at 37°C for 24 h, weighed, and a 2% solution of M. luteus PG in MilliQ water was prepared and stored at -20°C. The zymogram gel was prepared according to Bio-Rad instructions (12% running gel and 5% stacking gel) and the 2% solution of M. luteus PG was added to the appropriate volume of water to achieve a final concentration of 0.2% [ 40 ]. An equivalent SDS-PAGE gel without M. luteus PG was also prepared to track the run. Loaded samples comprised 5 μg of BSA (negative control, NZYTech), 5-10 μg of CwlM TB and 1-2 μg of Lysozyme (Lys, positive control, Sigma-Aldrich) in sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 5% β-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue). Samples were heated at 100°C for 5 min and iced for 1 min. A small volume (4 μL) of the NZYColour Protein Marker II (NZYTech) and 20 μL of each sample were loaded onto the gels, which were subsequently run and stained with BlueSafe. The zymogram gel was washed in distilled water for 30 min at RT, and then incubated in renaturation buffer (5% Triton X-100, 25 mM Tris-HCl, pH 7.5) at 37°C, for 16 h, with shaking at 120 rpm. After renaturation, the gel was washed twice for 15 min, tinted with a staining solution (0.2% methylene blue, 0.01% KOH) for 30 min, and repeatedly de-stained with distilled water until the protein ladder was visible 40]. Gel visualization was performed using the iBright™ FL1500. The zymography assay was only performed once. Statistical analysis GraphPad (version 8.4.3.686) was used for statistical analysis and data are here presented as mean ± SEM, unless otherwise specified. The qRT-PCR fold expression values were tested for normality using Q-Q plots, whereas the CFUs counts were analyzed through the Shapiro-Wilk Test. Multiple group comparisons were accomplished using ordinary one-way ANOVA and pairwise comparisons of selected groups were evaluated via the Holm-Sidak test. All the prerequisites of the tests were verified. Results Construction and characterization of the cwlM knockdown mutant The dCas9 Sth1 -based CRISPRi system [ 34 ] was implemented to construct a cwlM KDM in M. smegmatis . To produce an efficient repression of cwlM ( MSMEG_6935 ), the non-template strand was targeted. The efficiency of CRISPRi-mediated knockdown is influenced by several factors, including PAM strength, sgRNA-DNA target complementarity, target site, and GC content [ 6 , 34 ]. The strength of the employed PAM is often directly associated with the produced knockdown level and the resultant growth inhibition phenotypes [ 6 ]. Therefore, the repression of essential genes mediated by strong PAMs might cause cell death. Since cwlM is allegedly essential to the viability of Mtb [ 30 ], the first half of the template strand of the gene was searched for a PAM associated with medium-to-low repression ( Figure 1a ). Choosing a target site in the first half of the GOI is important to ensure that the produced mRNAs do not originate truncated proteins retaining some degree of activity. Although polar effects are common when CRISPRi is employed [ 34 , 38 - 39 ], cwlM is a non-operonic gene and its repression is not likely to affect the transcription of neighbouring genes. Before mycobacterial transformation, the cwlM -targeting CRISPRi plasmid was verified by Sanger Sequencing ( Additional file 1: Figure S1 ). Download figure Open in new tab Figure 1. CRISPRi-mediated cwlM silencing in M. smegmatis and resulting phenotypical and mRNA expression differences. (a) sgRNA-mediated repression of the cwlM gene in M. smegmatis , detailing target site (+467 bps) and the employed PAM strength (PAM14). (b) Relative gene expression of cwlM normalized to sigA , with (stripped bars) and without (smooth bars) 100 ng/mL of ATc treatment for 6 h, evaluated through qRT-PCR assays (n=2). PLJR962 is a non-targeting empty vector control. The mRNA expression levels of the calibrator sample ( M. smegmatis WT) are shown as dashed lines. The error bars represent the standard error of the mean (SEM). Comparisons between multiple groups were made using one-way ANOVA, with significance levels: * P < 0.05; ** P < 0.01. (c) Spotting dilution assays of the negative controls ( M. smegmatis WT, PLJR962) and of the cwlM knockdown mutant (n=3). Following this, the normalized relative gene expression of cwlM was determined for the controls M. smegmatis WT and PLJR962 and the cwlM KDM, with and without inducer, at 6 h post-induction. The results show that the cwlM gene was successfully silenced ( Figure 1b ). The sgRNA1-mediated knockdown of cwlM produced a very significant decrease in the target mRNA expression levels compared to WT ATc (3.8-fold; P = 0.0015) and to PLJR962 ATc (2.5-fold; P = 0.0029). The repression of cwlM was also determined as significant relative to the respective non-induced control (2.7-fold; P = 0.02) ( Figure 1b ). Afterwards, spotting dilution assays were performed to facilitate the phenotypical characterization of the cwlM KDM. The growth of negative controls M. smegmatis WT and PLJR962 was not affected by ATc treatment ( Figure 1c ). Conversely, the cwlM KDM suffered a severe reduction in cell viability in the presence of inducer ( Figure 1c ). Influence of CwlM depletion on antibiotic susceptibility To uncover whether the depletion of CwlM provokes any considerable changes in antibiotic susceptibility, the MICs of EMB, INH, VAN and of three beta-lactams (AMX, CTX and MEM) in the presence or absence of clavulanate, were determined against the control strains and the cwlM KDM ( Figure 2 ). As expected, M. smegmatis WT and PLJR962 did not suffer extensive changes in susceptibility to the tested antibiotics, even with inducer [ 40 ]. Notably, the knockdown of cwlM promoted a subtle increase in susceptibility to all tested antibiotics. Consistent with commonly accepted thresholds for microdilution susceptibility studies, 2-fold MIC changes were attributed to technical variability; therefore, only MIC differences of ≥ 4-fold were considered biologically meaningful. The depletion of CwlM did not seem to substantially affect the susceptibility of mycobacteria to first-line agents EMB and INH, AMX (+CLA), MEM (+CLA) and to the PG cross-linking inhibitor VAN [ 40 ]. Conversely, the repression of cwlM promoted a noteworthy increase in susceptibility (≥ 4-fold) to CTX (+CLA) [ 40 ]. The addition of CLA to AMX and CTX produced 16-fold and 2-fold MIC reductions, respectively. On the other hand, the addition of CLA to MEM did not provoke any MIC changes. Download figure Open in new tab Figure 2. Antibiotic susceptibility assays of the negative controls and the cwlM knockdown mutant. Heatmap of the fold differences in the minimum inhibitory concentrations (MICs; in μg/mL) between the cwlM knockdown mutant, the non-targeting control PLJR962 and M. smegmatis WT, with and without 100 ng/mL of ATc. The red shades depict an increase in the MIC while the blue shades depict a decrease in the MIC, when compared to the WT strain. AMX, amoxicillin; CLA, clavulanate; CTX, cefotaxime; EMB, ethambutol; INH, isoniazid; MEM, meropenem; VAN, vancomycin. CwlM knockdown promotes increased susceptibility to beta-lactams on solid media To validate these observations, spotting dilution assays of the control M. smegmatis WT and the cwlM KDM were performed in the presence of varying concentrations of CTX and MEM, with and without inducer ( Figure 3a ). As formerly demonstrated, the cwlM KDM suffered a severe growth defect in the presence of 100 ng/mL of inducer. The viability of M. smegmatis WT remained mostly unaffected regardless of the concentration of antibiotics tested. Nevertheless, a marked viability defect was observed with 1 μg/mL of MEM [ 40 ]. Moreover, the growth profile of the cwlM KDM in non-induced conditions was very similar to that of the WT strain, with both antibiotics. On the other hand, the induced cwlM KDM presented a slight viability loss with both MEM and CTX when compared to the control strain [ 40 ]. In fact, the ability of the induced mutant to form a spot was indirectly proportional to the concentration of antibiotic used. Download figure Open in new tab Figure 3. Susceptibility assays of the negative controls and the cwlM knockdown mutant on solid media. (a) Spotting dilution assays of the negative control strain M. smegmatis WT and the cwlM knockdown mutant, with and without 100 ng/mL of ATc, without any antibiotics and in presence of varying concentrations of cefotaxime (8, 16, and 32 μg/mL) and of meropenem (0.25, 0.5, and 1 μg/mL). (b) Average length of the diameter of the inhibition halo (in cm) obtained for amoxicillin supplemented with clavulanate (AMX+CLA) and meropenem (MEM) antibiotic disk assays performed with the negative control M. smegmatis WT and the cwlM knockdown mutant, with (striped bars) and without (smooth bars) 100 ng/mL of ATc (n=3). The diameter of the inhibition halo was measured using ImageJ. The error bars correspond to the standard deviation. Multiple group comparisons were calculated using ordinary one-way ANOVA followed by the Holm-Sidak’s test (* P < 0.05). To further consolidate these findings, AMX+CLA and MEM disk diffusion assays were performed for M. smegmatis WT and the cwlM KDM, with and devoid of inducer ( Figure 3b ). As follows, the concentrations of antibiotics used to produce a visible halo effect had to be optimized. For AMX+CLA, this concentration was 8-fold greater than the MIC determined in liquid media and for MEM, it was 64-fold the MIC. CTX was excluded from this assay due to the necessity of preparing a highly concentrated stock solution defying solubility limitations. With 256 µg/mL of MEM, no significant differences in the halo diameter were observed between the strains, regardless of ATc addition. With 512 µg/mL of MEM, the induced cwlM KDM displayed a significant increase in susceptibility to the carbapenem when compared to the induced WT strain (1.25-fold; P = 0.012) and to the respective non-induced control (1.24-fold; P = 0.015) [ 40 ]. With 512 µg/mL of AMX+CLA, no significant differences in the halo diameter were observed between the WT strain and the cwlM KDM, independently of ATc addition. With 1024 µg/mL of AMX+CLA, the induced cwlM KDM displayed a modest increase in susceptibility to the penicillin, albeit without significance [ 40 ]. Impact of CwlM depletion in the killing of mycobacteria within THP-1-derived macrophages To uncover whether CwlM contributes to survival within host macrophages, THP-1-derived macrophages were infected with the control strains and the cwlM KDM at an MOI of 5. The intracellular survival (in CFUs/mL) was then assessed following cell lysis at 1 h, 4 h and 24 h post-infection. No considerable differences in in vitro growth kinetics were observed among the study strains prior to infection; OD 600 values differed by less than 0.23 across all strains ( Additional file 1: Table S1 ). As expected, the viability of mycobacteria reduced over time [ 6 ]. Moreover, the mean intracellular survival of the negative controls M. smegmatis WT and PLJR962 was not significantly affected by the presence of inducer. The knockdown of cwlM induced a very significant reduction in intracellular survival at all time points ( P < 0.001, when compared to M. smegmatis WT ATc, PLJR962 ATc and the corresponding non-induced control) ( Figure 4 ). Notably, the survival of the induced cwlM knockdown mutant within host macrophages consistently decreased over time, being significantly lower than that of M. smegmatis PLJR962 ATc (3.1-fold; P = 0.024) and of the respective non-induced control (6.3-fold; P < 0.001) at T 24 ( Additional file 1: Figure S2 ). These results indicate that the depletion of CwlM might facilitate the macrophage-mediated immune recognition of mycobacteria, therefore promoting a faster clearance of intracellular mycobacteria. Download figure Open in new tab Figure 4. Mean survival, in CFUs/mL, of bacteria recovered from infected and disrupted PMA-differentiated THP-1-derived macrophages (n=3). The disruption macrophages occurred at 1 h, 4 h, and 24 h post-infection. Comparative effect with and without 100 ng/mL of inducer (ATc). Error bars represent the standard error of the mean (SEM). Multiple comparisons were calculated using one-way ANOVA (• P < 0.001 relatively to all pre-selected control strains). Cloning, expression and purification of recombinant CwlM TB To produce and characterize the CwlM TB protein, the pET system was employed to clone the cwlM gene ( Rv3915 ) in frame with a C-terminal polyhistidine (His 6 ) tag [ 40 ]. Following the verification of construct integrity through Sanger sequencing analysis ( Additional file 1: Figure S3 ), recombinant E. coli BL21(DE3) cells were used to overexpress cwlM [ 40 ]. Induction with 1 µM of IPTG was tested under distinct conditions (37°C for 3 h or at 16°C overnight) to optimize overexpression of the CwlM TB protein (43.9 kDa) in pET29b. SDS-PAGE analysis of the resulting fractions showed a discernible band with the expected size of 43.9 kDa in the fourth lane (CwlM at 16°C overnight), compared to the non-induced (N.I) control ( Additional file 1: Figure S4a ) [ 40 ]. Overall, these results demonstrate that CwlM TB is only effectively produced when the cells are grown at 16°C overnight. Based on these findings, a scale-up culture of 2 L of E. coli BL21(DE3):pET-29b: cwlM was prepared, grown and induced under optimal expression conditions. SDS-PAGE analysis of the resulting fractions confirmed the successful production of CwlM TB , with a visible band at 43.9 kDa in the third lane, which was absent in the N.I. control ( Additional file 1: Figure S4b ) [ 40 ]. Purification of CwlM TB yielded a strong absorbance peak between fractions 7 and 11, with a maximum of about 250 mAμ at 280 nm ( Figure 5 ). SDS-PAGE analysis confirmed that fractions 6-9 contained most of the concentrated protein, as these fractions exhibited large bands at ∼43.9 kDa in the gel, matching the expected molecular weight of CwlM TB ( Figure 5 ). After buffer exchange and imidazole removal, the final purified CwlM TB protein was obtained at a concentration of about 800 μg/μL [ 40 ]. SDS-PAGE analysis following dialysis ( Figure 5 ) revealed several bands: while the inferior bands might indicate a trivial amount of degraded protein, the upper band might represent an aggregate of CwlM with a smaller fragment. Download figure Open in new tab Figure 5. Purification of the CwlM protein. (a) Absorbance at 280 nm measured by the ÄKTAprime plus system during the elution step of the affinity purification of CwlM from an induced filtrate of E. coli BL21(DE3):pET-29b: cwlM . The collected fractions are 1 through 11 and the last dot is waste. (b) SDS-PAGE gel of the collected fractions of the CwlM protein after purification in the AKTAprime system. Lane order: NZYColour Protein Marker II ladder; fractions 3, 4, 5, 6, 7, 8, 9 and 10. (c) SDS-PAGE of the final purified CwlM protein. Lane order: NZYColour Protein Marker II ladder; CwlM protein (predicted size of 43.9 kDa). Characterization of enzymatic activity via zymography and plate assays To elucidate whether CwlM possesses any PG-hydrolytic activity, a zymogram protocol similar to the one described in [ 30 ], was performed using PG from M. luteus as substrate ( Figure 6a , b ). The zymogram displayed one translucent zone around 14 kDa, consistent with the lytic activity of lysozyme over the PG (positive control -Lys) ( Figure 6b ). Nevertheless, the Lys band displays a molecular weight between 17-25 kDa, having shifted from its predicted size. This could have occurred because of the low concentration of buffers in the zymogram gel, which may impact protein migration, or due to partial renaturation of the Lys protein resulting from prolonged heat exposure during the assay. On the other hand, no translucent zone was observed with the negative control BSA (66 kDa), as it lacks PG-hydrolytic activity. When compared to lysozyme, CwlM TB does not appear to possess any hydrolase activity against M. luteus PG ( Figure 6b ) [ 40 ]. To further validate these results, a plate assay was performed. While the PG-hydrolytic activity of Lys produced a discernible halo on a M. luteus lawn, no halo was observable with CwlM TB ( Figure 6c ) [ 40 ]. Download figure Open in new tab Figure 6. Deciphering the enzymatic activity of CwlM through a zymogram containing 2% of M. luteus -derived peptidoglycan. (a) SDS-PAGE analysis of CwlM and two controls (BSA and lysozyme). (b) The zymogram gel shows that the positive control lysozyme can cleave PG from M. luteus while the predicted PG hydrolase CwlM cannot. (a, b) Lane order of both gels: CwlM; NZYColour Protein Marker II ladder; BSA (negative control); and Lysozyme (Lys – positive control). (c) Plate of M. luteus to which the control proteins and CwlM were added. This assay demonstrates the PG-hydrolytic activity of the positive control lysozyme while reiterating the lack of PG-hydrolytic activity of CwlM. Discussion The development of novel antitubercular agents is essential to gain control of DR-TB [ 2 ]. The discovery of novel therapeutic targets can be propelled by research into mycobacterial PG biosynthesis enzymes and inhibitors. Although traditionally excluded from DR-TB therapeutic programs, beta-lactams have resurged as promising additions to pipeline drugs, especially when paired with beta-lactamase inhibitors. The WHO now includes two carbapenems in Group C of the medicines recommended for longer MDR-TB therapeutic programs [ 46 ]. Recently, we identified several genomic drivers underlying differential beta-lactam susceptibility phenotypes in Mtb [ 29 , 47 ]. Among these, the 4403900 snp A>G in cwlM was often associated with increased susceptibility to amoxicillin [ 29 ]. Therefore, we sought to investigate the role of CwlM in beta-lactam susceptibility and in intracellular survival using M. smegmatis as a model. Due to previous conflicting information, we also purified recombinant CwlM TB to characterize its function. Our findings, discussed below, suggest that CwlM SMEG contributes to beta-lactam resistance and intracellular survival, while CwlM TB lacks PG-hydrolytic activity and might act as a PG biosynthesis regulator instead [ 31 ]. First, the qRT-PCR results confirmed the successful CRISPRi-mediated knockdown of cwlM . There was barely any evidence of leaky expression phenomena except for a slight reduction in the mRNA levels of cwlM observed with the non-induced cwlM control. Notably, the observed levels of repression are mild compared to the ∼38.5-fold repression previously reported for target genes in M. smegmatis using the same PAM [ 34 ]. However, these repression levels were attained with twice the induction period here implemented. Globally, the obtained results demonstrate the efficiency of the dCas9 Sth1 -based CRISPRi system leading to effective target mRNA inhibition and, consequently, affecting the resultant phenotypes. Consistent with previous reports, the spotting dilution assays revealed a severe growth impairment upon cwlM knockdown, further supporting its reported essentiality for mycobacterial survival [ 30 , 48 - 50 ]. Notably, even when using a low-strength PAM (PAM14), CRISPRi-mediated silencing of cwlM resulted in a near-lethal phenotype, thus underscoring the high vulnerability of cwlM , a main criterion for target-based drug discovery [ 51 ]. The CwlM protein comprises two PG-binding domains and one MurNAc-LAA domain, with predicted N-acetylmuramoyl-L-alanine amidase activity. A previous report found that the overexpression of CwlM did not result in lysis, presumably due to the lack of two essential catalytic residues (R199, R270) [ 31 ]. Instead, the authors proposed a regulatory function for CwlM, demonstrating that phosphorylated CwlM stimulated the activity of MurA and promoted PG biosynthesis. As follows, the depletion of CwlM may well impair PG biosynthesis [ 32 ], severely compromising cell division. Hence, the regulatory role of CwlM might affect several pathways and justify its essentiality to cell division and survival. The MIC assays demonstrated that silencing cwlM provoked a slight increase in susceptibility to the tested antibiotics, including beta-lactams. Likewise, previous reports showed that the repression of cwlM in Mycobacterium abscessus promoted increased susceptibility to beta-lactams [ 52 , 53 ]. To cease PG biosynthesis and eradicate mycobacteria, all transpeptidases and even other PG-modifying enzymes ought to be inhibited [ 23 ]. In our experiments, no major susceptibility differences were observed with AMX, possibly because this penicillin is only able to target PBPs [ 53 ]. Whereas the addition of CLA did not greatly impact the MICs of CTX and MEM, it provoked a remarkable 16-fold reduction in the MIC of AMX. This observation is justified by the higher affinity of BlaS for penicillins, as opposed to cephalosporins and carbapenems [ 55 ]. In fact, AMX+CLA has been shown to possess bactericidal activity against Mtb in vitro [ 26 , 56 ] and to provide clinical benefit in DR-TB patients [ 57 ]. Nevertheless, the WHO has stated that AMX+CLA should not be used without imipenem–cilastatin or meropenem for MDR/RR-TB treatment [ 46 ]. Overall, MEM was very efficient at inhibiting mycobacterial growth, compared to AMX and CTX. Although MEM and CTX inhibit both PBPs and Ldts [ 58 ], only MEM can do so efficiently and simultaneously escape the hydrolyzing activity of beta-lactamases [ 59 ]. Since the activity of MEM is sufficient to inhibit all transpeptidases and, consequently, halt PG biosynthesis, the depletion of CwlM did not greatly affect the MIC of MEM. These observations support the introduction of MEM-containing therapeutic regimens for MDR-TB. Considerable susceptibility differences were only observed with CTX (+CLA), thus suggesting that the activity of CTX is facilitated by the depletion of CwlM, which is expected to cause abnormal cell elongation owing to uncoordinated synthesis of CW layers [ 31 ]. We hypothesize that some PG biosynthesis processes may remain active when cwlM is repressed and that CTX-mediated inhibition of PG cross-linking is considerably facilitated due to low PG integrity and further accentuates PG polymerization defects. Similarly to beta-lactams, the glycopeptide VAN can inhibit transpeptidation reactions by irreversibly binding the D-Ala-D-Ala dipeptide [ 60 ]. We thus expected the induced cwlM KDM to display increased susceptibility to VAN; but observed no such effect. It could be that the D-Ala-D-Ala moiety is protected by the lipid-rich CW of mycobacteria. Still, VAN might be able to inhibit mycobacterial PG biosynthesis when combined with first-line agents EMB and INH [ 40 , 60 ]. The spotting dilution assays in the presence of varying concentrations of MEM and CTX showed that the depletion of CwlM provokes subtle increases in susceptibility to both beta-lactams, with greater differences observed with CTX, consistent with the MIC assays. In contrast, MEM affected the viability of both M . smegmatis WT and the induced cwlM KDM. The disk diffusion results suggest that a reduction in CwlM protein levels may slightly increase susceptibility to MEM and AMX+CLA, although the obtained fold changes were not biologically relevant, and no statistical significance was observed in the case of AMX+CLA. These observations highlight the highly efficient antimycobacterial activity of MEM. Altogether, the susceptibility assays suggest that CwlM contributes to beta-lactam resistance, specifically to CTX and MEM. Nonetheless, we recognize that the observed changes in susceptibility may partially reflect impaired growth, rather than being solely attributable to differences in CW integrity. The cytosolic NOD-like receptors (NLRs), NOD1 and NOD2, recognize molecules containing D-Glu- m -DAP and PG–derived muramyl dipeptide (MDP), respectively [ 7 - 8 ]. The intracellular survival assays showed that the depletion of CwlM resulted in a faster clearance of intracellular mycobacteria, possibly due to increased recognition of unmodified and uncross-linked PG muropeptides by THP-1-derived macrophages innate cytosolic receptors. Phosphorylated CwlM is known to stimulate PG biosynthesis by 30-fold [ 31 ], thus promoting the activity of mycobacterial PG-modifying enzymes such as NamH, MurT/GatD, and AsnB, as well as transpeptidases. It is inferable that cwlM repression impairs PG biosynthesis, leading to deficient PG modification and polymerization, thereby facilitating immune recognition by host cells. Since the depletion of CwlM was induced 24 h before infection, the induced cwlM KDM might have already been fragile at the time of infection. Although no considerable differences were observed in the OD 600 values among the study strains, these could represent a population of compromised cells unable to withstand additional stress. Therefore, the induced cwlM KDM is likely more susceptible to intracellular stresses and macrophage-mediated antimicrobial killing, provoking a substantial survival drop shortly after internalization. This underscores the dual role of CwlM: not only is it essential for bacterial viability under basal conditions, but its depletion also curtails intracellular survival, thus highlighting its key role in sustaining survival within host macrophages. In conclusion, CwlM contributes to intracellular survival, perhaps by promoting efficient PG biosynthesis, and, in turn, enabling several mycobacterial PG-modifying immune evasion mechanisms. The CwlM protein is annotated as a PG hydrolase that cleaves an amide bond between the glycan moiety (Mur N Ac) and the peptide moiety (L-alanine) [ 30 ]. However, several studies showed that CwlM lacks enzymatic activity, rather serving a regulatory function [ 31 - 32 ]. Here, we successfully cloned cwlM in frame with a C-terminal polyhistidine tag in pET29b and purified the His 6 -tagged CwlM TB using AKTAprime. Afterwards, a zymogram was performed to determine whether CwlM TB possesses amidase activity. PG from M. luteus is frequently used for the detection of amidase activity against the CW of gram-positive bacteria [ 30 , 40 ]. In this case, the PG from M. luteus was used as a substrate because it enabled the assessment of PG-hydrolytic activity without the limitation provided by the external layers of the mAGP complex. Collectively, the zymogram and plate assays showed that CwlM TB lacks PG-hydrolytic activity. Although our results contradict the findings of a previous study [ 30 ], they are concordant with the recent hypothesis proposing that CwlM plays a regulatory role in PG biosynthesis [ 31 - 32 ]. Building on the role of CwlM in PG biosynthesis, a recent study showed that the activity of PknB, the STPK for which CwlM is a major substrate, is stimulated by the depletion of D- i Glu amidation [ 14 ]. Accordingly, the depletion of D- i Glu amidation leads to perturbed PG cross-linking, hyperactivation of PknB and, ultimately, reduced de novo PG biosynthesis. The repression of murT / gatD results in the inhibition of Ldt activity and gives a crucial meaning to the activity of PBPs, which can be easily inhibited by beta-lactams [ 14 ]. Aligned with this, we have recently demonstrated that the depletion of MurT/GatD foments increased susceptibility to beta-lactams [ 6 ]. The sensing of uncross-linked PG by PknB promotes its overactivation and, consequently, stimulates the phosphorylation of its substrates, including that of CwlM, MurA, MurJ and others [ 14 , 32 , 61 ]. In this case, phosphorylated CwlM binds to FhaA, thereby stabilizing the activity of PbpA and inhibiting the activity of MurJ. Hence, lipid II is not translocated to the periplasm and accumulates in the cytoplasm, thereby reducing de novo PG biosynthesis [ 32 ]. Should the activity of PknB remain unregulated, this will eventually cause bacteriolysis. Our work is not deprived of limitations. First, the CRISPRi-mediated repression of cwlM employed a medium- to-low strength PAM (PAM 14). Although the obtained levels of repression of cwlM were modest (about 3-fold), these were sufficient to cause observable viability defects. While our study aimed to investigate the role of cwlM in antibiotic susceptibility and intracellular survival, the observed growth impairment emphasizes the significance of CwlM for mycobacterial fitness. In fact, this near-lethal phenotype complicates the interpretation of drug susceptibility and intracellular survival data, as it may reflect the essentiality of cwlM for viability. Nonetheless, the observed loss of viability implies that cwlM is both essential and highly vulnerable, highlighting its potential as a therapeutic target. Future studies should thereby employ weaker PAMs for cwlM knockdown. Furthermore, the phosphorylation state of purified CwlM TB remains unknown, as phosphorylation studies could not be conducted. Owing to its rapid growth, genetic homology, and conservation of core metabolic pathways, M. smegmatis ( Msm ) remains a widely used surrogate model for Mtb , particularly in exploratory studies such as this one [ 62 , 63 ]. Indeed, Msm is a practical and insightful system for preliminary research on cell wall regulation and antibiotic susceptibility because of its higher permeability to beta-lactams, and its naturally occurring expression of conserved PG-modifying enzymes like CwlM. Nevertheless, we acknowledge that direct extrapolation of the obtained results to Mtb may be constrained due to differences in cell envelope composition, beta-lactamase activity, and virulence. Hence, additional assays are necessary to confirm the applicability of our findings in pathogenic Mtb . Conclusions In conclusion, our findings suggest that CwlM may contribute to beta-lactam resistance and survival within host macrophages, thereby limiting antimicrobial efficacy and facilitating immune evasion. The essentiality of cwlM further underscores its potential as a promising therapeutic target. Taken together, the evidence presented here indicates that targeting CwlM-regulated processes could improve antibiotic sensitivity, shorten treatment regimens, and ultimately improve DR-TB patient outcomes. Declarations Availability of data and materials The original contributions presented in the study are included in the main manuscript and in the provided supplementary material file, and further inquiries can be directed to the corresponding author and are available on reasonable request. Competing Interests The authors declare that they have no competing interests. Funding This work was supported by Fundação para a Ciência e Tecnologia (project PTDC/BIA-MIC/31233/2017 to MJC and the following PhD fellowships with the references SFRH/BD/136853/2018 to F.O. and 2021.05446.BD to C.S., with the DOI identifier https://doi.org/10.54499/2021.05446.BD ) and by the European Society of Clinical Microbiology and Infectious Diseases (Research Grant 2018 to MJC). Authors’ Contributions C.S., D.M., F.O., E.A. and M.J.C. conceived and designed the study. C.S., D.M., and F.O. performed the experiments. C.S. created figure 3 , D.M. and C.S. created and modified the rest, respectively. C.S., D.M., F.O., M.M., D.P., E.A. and M.J.C. analyzed the data. C.S. and D.M. wrote the original draft. All authors reviewed and approved the final version of the manuscript. Acknowledgments The authors would like to thank the colleagues Tiago Gonçalves and Leonor Raposo at Filipa Vale’s Lab for providing us with the Micrococcus luteus strain and for sharing zymography protocols. Funder Information Declared Fundação para a Ciência e Tecnologia, https://ror.org/00snfqn58 , PTDC/BIA-MIC/31233/2017 , SFRH/BD/136853/2018 , 2021.05446.BD; https://doi.org/10.54499/2021.05446.BD European Society of Clinical Microbiology and Infectious Diseases, https://ror.org/02vkssr45 , Research Grant 2018 to MJC References 1. ↵ World Health Organization . Global Tuberculosis Report 2024 . Geneva : World Health Organization ; 2024 . Available from: https://www.who.int/teams/global-tuberculosis-programme/tb-reports/global-tuberculosis-report-2024 [Accessed 1 February 2025 ]. 2. ↵ Singh V , Chibale K. Strategies to Combat Multi-Drug Resistance in Tuberculosis . Acc Chem Res . 2021 ; 54 ( 10 ): 2361 – 76 . doi: 10.1021/acs.accounts.0c00878 . OpenUrl CrossRef PubMed 3. ↵ Catalão MJ , Filipe SR , Pimentel M. Revisiting Anti-Tuberculosis Therapeutic Strategies That Target the Peptidoglycan Structure and Synthesis . Front Microbiol . 2019 ; 10 : 190 . doi: 10.3389/fmicb.2019.00190 . OpenUrl CrossRef PubMed 4. ↵ Maitra A , Munshi T , Healy J , Martin LT , Vollmer W , Keep NH , et al. Cell Wall Peptidoglycan in Mycobacterium tuberculosis: An Achilles’ Heel for the TB-Causing Pathogen . FEMS Microbiol Rev . 2019 ; 43 ( 5 ): 548 – 75 . doi: 10.1093/femsre/fuz016 . OpenUrl CrossRef PubMed 5. ↵ Raymond JB , Mahapatra S , Crick DC , Pavelka MS . Identification of the namH Gene, Encoding the Hydroxylase Responsible for the N-Glycolylation of the Mycobacterial Peptidoglycan . J Biol Chem . 2005 ; 280 ( 1 ): 326 – 33 . doi: 10.1074/jbc.M411006200 . OpenUrl Abstract / FREE Full Text 6. ↵ Silveiro C , Marques M , Olivença F , Pires D , Mortinho D , Nunes A , et al. CRISPRi-Mediated Characterization of Novel Anti-Tuberculosis Targets: Mycobacterial Peptidoglycan Modifications Promote Beta-Lactam Resistance and Intracellular Survival . Front Cell Infect Microbiol . 2023 ; 13 : 1089911 . doi: 10.3389/fcimb.2023.1089911 . OpenUrl CrossRef PubMed 7. ↵ Coulombe F , Divangahi M , Veyrier F , De Léséleuc L , Gleason JL , Yang Y , et al. Increased NOD2-Mediated Recognition of N-Glycolyl Muramyl Dipeptide . J Exp Med . 2009 ; 206 ( 8 ): 1709 – 16 . doi: 10.1084/jem.20081779 . OpenUrl Abstract / FREE Full Text 8. ↵ Hansen JM , Golchin SA , Veyrier FJ , Domenech P , Boneca IG , Azad AK , et al. N-Glycolylated Peptidoglycan Contributes to the Immunogenicity but Not Pathogenicity of Mycobacterium tuberculosis . J Infect Dis . 2014 ; 209 ( 7 ): 1045 – 54 . doi: 10.1093/infdis/jit622 . OpenUrl CrossRef PubMed 9. ↵ Wang Q , Matsuo Y , Pradipta AR , Inohara N , Fujimoto Y , Fukase K. Synthesis of Characteristic Mycobacterium Peptidoglycan (PGN) Fragments Utilizing with Chemoenzymatic Preparation of Meso-Diaminopimelic Acid (DAP), and Their Modulation of Innate Immune Responses . Org Biomol Chem . 2016 ; 14 ( 4 ): 1013 – 23 . doi: 10.1039/c5ob02145f . OpenUrl CrossRef PubMed 10. ↵ Figueiredo TA , Sobral RG , Ludovice AM , de Almeida JMF , Bui NK , Vollmer W , et al. Identification of Genetic Determinants and Enzymes Involved with the Amidation of Glutamic Acid Residues in the Peptidoglycan of Staphylococcus aureus . PLoS Pathog . 2012 ; 8 ( 2 ): e1002508 . doi: 10.1371/journal.ppat.1002508 . OpenUrl CrossRef PubMed 11. Münch D , Roemer T , Lee SH , Engeser M , Sahl HG , Schneider T. Identification and in Vitro Analysis of the GatD/MurT Enzyme-Complex Catalyzing Lipid II Amidation in Staphylococcus aureus . PLoS Pathog . 2012 ; 8 ( 2 ): e1002509 . doi: 10.1371/journal.ppat.1002509 . OpenUrl CrossRef PubMed 12. ↵ Maitra A , Nukala S , Dickman R , Martin LT , Munshi T , Gupta A , et al. Characterization of the MurT/GatD Complex in Mycobacterium tuberculosis towards Validating a Novel Anti-Tubercular Drug Target . JAC-Antimicrob Resist . 2021 ; 3 ( 1 ): dlab028 . doi: 10.1093/jacamr/dlab028 . OpenUrl CrossRef 13. ↵ Pidgeon SE , Apostolos AJ , Nelson JM , Shaku M , Rimal B , Islam MN , et al. L,D-Transpeptidase Specific Probe Reveals Spatial Activity of Peptidoglycan Cross-Linking . ACS Chem Biol . 2019 ; 14 ( 5 ):acschembio.9b00427. doi: 10.1021/acschembio.9b00427 . OpenUrl CrossRef PubMed 14. ↵ Shaku MT , Ocius KL , Apostolos AJ , Pires MM , VanNieuwenhze MS , Dhar N , et al. Amidation of Glutamate Residues in Mycobacterial Peptidoglycan Is Essential for Cell Wall Cross-Linking . Front Cell Infect Microbiol . 2023 ; 13 : 1205829 . doi: 10.3389/fcimb.2023.1205829 . OpenUrl CrossRef PubMed 15. ↵ Mir M , Asong J , Li X , Cardot J , Boons G-J , Husson RN . The Extracytoplasmic Domain of the Mycobacterium tuberculosis Ser/Thr Kinase PknB Binds Specific Muropeptides and Is Required for PknB Localization . PLoS Pathog . 2011 ; 7 ( 7 ): e1002182 . doi: 10.1371/journal.ppat.1002182 . OpenUrl CrossRef PubMed 16. ↵ Mahapatra S , Crick DC , McNeil MR , Brennan PJ . Unique Structural Features of the Peptidoglycan of Mycobacterium leprae . J Bacteriol . 2008 ; 190 ( 2 ): 655 – 61 . doi: 10.1128/JB.00982-07 . OpenUrl Abstract / FREE Full Text 17. ↵ Levefaudes M , Patin D , De Sousa-D’Auria C , Chami M , Blanot D , Hervé M , et al. Diaminopimelic Acid Amidation in Corynebacteriales New Insights into the Role of Ltsa in Peptidoglycan Modification . J Biol Chem . 2015 ; 290 ( 21 ): 13079 – 94 . doi: 10.1074/jbc.M115.642843 . OpenUrl Abstract / FREE Full Text 18. ↵ Ngadjeua F , Braud E , Saidjalolov S , Iannazzo L , Schnappinger D , Ehrt S , et al. Critical Impact of Peptidoglycan Precursor Amidation on the Activity of L,D-Transpeptidases from Enterococcus faecium and Mycobacterium tuberculosis . Chem Eur J . 2018 ; 24 ( 22 ): 5743 – 7 . doi: 10.1002/chem.201706082 . OpenUrl CrossRef 19. ↵ Ren H , Liu J. AsnB Is Involved in Natural Resistance of Mycobacterium smegmatis to Multiple Drugs . Antimicrob Agents Chemother . 2006 ; 50 ( 1 ): 250 – 5 . doi: 10.1128/AAC.50.1.250-255.2006 . OpenUrl Abstract / FREE Full Text 20. ↵ Li S , Poulton NC , Chang JS , Azadian ZA , DeJesus MA , Ruecker N , et al. CRISPRi Chemical Genetics and Comparative Genomics Identify Genes Mediating Drug Potency in Mycobacterium tuberculosis . Nat Microbiol . 2022 ; 7 ( 6 ): 766 – 79 . doi: 10.1038/s41564-022-01130-y . OpenUrl CrossRef PubMed 21. ↵ Flores AR , Parsons LM , Pavelka MS . Genetic Analysis of the β-Lactamases of Mycobacterium tuberculosis and Mycobacterium smegmatis and Susceptibility to β-Lactam Antibiotics . Microbiology . 2005 ; 151 ( 2 ): 521 – 32 . doi: 10.1099/mic.0.27629-0 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Cordillot M , Dubée V , Triboulet S , Dubost L , Marie A , Hugonnet JE , et al. In Vitro Cross-Linking of Mycobacterium tuberculosis Peptidoglycan by L,D-Transpeptidases and Inactivation of These Enzymes by Carbapenems . Antimicrob Agents Chemother . 2013 ; 57 ( 12 ): 5940 – 5 . doi: 10.1128/AAC.01663-13 . OpenUrl Abstract / FREE Full Text 23. ↵ Story-Roller E , Lamichhane G. Have We Realized the Full Potential of B-lactams for Treating Drug-resistant TB? IUBMB Life . 2018 ; 70 ( 9 ): 881 – 8 . doi: 10.1002/iub.1875 . OpenUrl CrossRef PubMed 24. ↵ Hugonnet J-E , Tremblay LW , Boshoff HI , Barry CE , Blanchard JS . Meropenem-Clavulanate Is Effective Against Extensively Drug-Resistant Mycobacterium tuberculosis . Science . 2009 ; 323 ( 5918 ): 1215 – 8 . doi: 10.1126/science.1167498 . OpenUrl Abstract / FREE Full Text 25. England K , Boshoff HIM , Arora K , Weiner D , Dayao E , Schimel D , et al. Meropenem-Clavulanic Acid Shows Activity against Mycobacterium tuberculosis In Vivo . Antimicrob Agents Chemother . 2012 ; 56 ( 6 ): 3384 – 7 . doi: 10.1128/AAC.05690-11 . OpenUrl Abstract / FREE Full Text 26. ↵ Cohen KA , El-Hay T , Wyres KL , Weissbrod O , Munsamy V , Yanover C , et al. Paradoxical Hypersusceptibility of Drug-Resistant Mycobacterium tuberculosis to β-Lactam Antibiotics . EBioMedicine . 2016 ; 9 : 170 – 9 . doi: 10.1016/j.ebiom.2016.05.041 . OpenUrl CrossRef PubMed 27. Zhang D , Wang Y , Lu J , Pang Y. In Vitro Activity of β-Lactams in Combination with β-Lactamase Inhibitors against Multidrug-Resistant Mycobacterium tuberculosis Isolates . Antimicrob Agents Chemother . 2016 ; 60 ( 1 ): 393 – 9 . doi: 10.1128/AAC.01035-15 . OpenUrl Abstract / FREE Full Text 28. van Rijn SP , Zuur MA , Anthony R , Wilffert B , van Altena R , Akkerman OW , et al. Evaluation of Carbapenems for Treatment of Multi- and Extensively Drug-Resistant Mycobacterium tuberculosis . Antimicrob Agents Chemother . 2019 ; 63 ( 1 ): e01489 – 18 . doi: 10.1128/AAC.01489-18 . OpenUrl CrossRef PubMed 29. ↵ Olivença F , Nunes A , Macedo R , Pires D , Silveiro C , Anes E , et al. Uncovering Beta-Lactam Susceptibility Patterns in Clinical Isolates of Mycobacterium tuberculosis through Whole-Genome Sequencing . Microbiol Spectr . 2022 ; 10 ( 1 ): e00674 – 22 . doi: 10.1128/spectrum.00674-22 . OpenUrl CrossRef 30. ↵ Deng LL , Humphries DE , Arbeit RD , Carlton LE , Smole SC , Carroll JD . Identification of a Novel Peptidoglycan Hydrolase CwlM in Mycobacterium tuberculosis . Biochim Biophys Acta . 2005 ; 1747 ( 1 ): 57 – 66 . doi: 10.1016/j.bbapap.2004.09.021 . OpenUrl CrossRef PubMed 31. ↵ Boutte CC , Baer CE , Papavinasasundaram K , Liu W , Chase MR , Meniche X , et al. A Cytoplasmic Peptidoglycan Amidase Homologue Controls Mycobacterial Cell Wall Synthesis . Elife . 2016 ; 5 : e14590 . doi: 10.7554/eLife.14590 . OpenUrl CrossRef PubMed 32. ↵ Turapov O , Forti F , Kadhim B , Ghisotti D , Sassine J , Straatman-Iwanowska A , et al. Two Faces of CwlM, an Essential PknB Substrate, in Mycobacterium tuberculosis . Cell Rep . 2018 ; 25 ( 1 ): 57 - 67.e5 . doi: 10.1016/j.celrep.2018.09.004 . OpenUrl CrossRef 33. ↵ Shamma F , Rego EH , Boutte CC . Mycobacterial Serine/Threonine Phosphatase PstP Is Phosphoregulated and Localized to Mediate Control of Cell Wall Metabolism . Mol Microbiol . 2022 ; 118 ( 1 ): 47 – 60 . doi: 10.1111/mmi.14951 . OpenUrl CrossRef PubMed 34. ↵ Rock JM , Hopkins FF , Chavez A , Diallo M , Chase MR , Gerrick ER , et al. Programmable Transcriptional Repression in Mycobacteria Using an Orthogonal CRISPR Interference Platform . Nat Microbiol . 2017 ; 2 : 16274 . doi: 10.1038/nmicrobiol.2016.274 . OpenUrl CrossRef PubMed 35. Snapper SB , Lugosi L , Jekkel A , Melton RE , Kieser T , Bloom BR , Jacobs WR . Lysogeny and Transformation in Mycobacteria: Stable Expression of Foreign Genes . Proc Natl Acad Sci U S A . 1988 ; 85 ( 18 ): 6987 – 91 . doi: 10.1073/pnas.85.18.6987 . OpenUrl Abstract / FREE Full Text 36. ↵ Parish T , Kumar A Wong AI , Rock JM . CRISPR Interference (CRISPRi) for Targeted Gene Silencing in Mycobacteria . In: Parish T , Kumar A , editors. Mycobacteria Protocols . New York : Springer ; 2021 . p. 343 – 64 . (Methods in Molecular Biology; vol. 2314). doi: 10.1007/978-1-0716-1406-8_19 . OpenUrl CrossRef 37. ↵ Goude R , Parish T. Electroporation of Mycobacteria . In: Mycobacteria Protocols . Totowa : Humana Press ; 2009 . p. 203 – 15 . (Methods in Molecular Biology; vol. 465). 38. ↵ Choudhary E , Thakur P , Pareek M , Agarwal N. Gene Silencing by CRISPR Interference in Mycobacteria . Nat Commun . 2015 ; 6 : 6267 . doi: 10.1038/ncomms7267 . OpenUrl CrossRef PubMed 39. ↵ Singh AK , Carette X , Potluri L-P , Sharp JD , Xu R , Prisic S , et al. Investigating Essential Gene Function in Mycobacterium tuberculosis Using an Efficient CRISPR Interference System . Nucleic Acids Res . 2016 ; 44 ( 15 ): e143 . doi: 10.1093/nar/gkw625 . OpenUrl CrossRef PubMed 40. ↵ Mortinho D. Reappraising the Use of Beta-Lactam Antibiotics against Tuberculosis: Study of Genes Associated with Beta-Lactam Susceptibility in Mycobacteria [Master’s thesis] . Lisboa: Universidade de Lisboa ; 2022 . Available from: http://hdl.handle.net/10451/56469 [Accessed 1 May 2024 ]. 41. ↵ Olivença F , Pires D , Silveiro C , Gama B , Holtreman F , Anes E , et al. Ethambutol and Meropenem/Clavulanate Synergy Promotes Enhanced Extracellular and Intracellular Killing of Mycobacterium tuberculosis . Antimicrob Agents Chemother . 2024 ; 68 ( 1 ): e01586 – 23 . doi: 10.1128/aac.01586-23 . OpenUrl CrossRef PubMed 42. ↵ Anes E , Peyron P , Staali L , Jordao L , Gutierrez MG , Kress H , et al. Dynamic Life and Death Interactions between Mycobacterium smegmatis and J774 Macrophages . Cell Microbiol . 2006 ; 8 ( 6 ): 939 – 60 . doi: 10.1111/j.1462-5822.2005.00675.x . OpenUrl CrossRef PubMed 43. ↵ Pires D , Bernard EM , Pombo JP , Carmo N , Fialho C , Gutierrez MG , et al. Mycobacterium tuberculosis Modulates MiR-106b-5p to Control Cathepsin S Expression Resulting in Higher Pathogen Survival and Poor T-Cell Activation . Front Immunol . 2017 ; 8 : 1819 . doi: 10.3389/fimmu.2017.01819 . OpenUrl CrossRef PubMed 44. ↵ Mierendorf RC , Morris BB , Hammer B , Novy RE . Expression and Purification of Recombinant Proteins Using the PET System . In: Nucleic Acid Protocols Handbook . Totowa : Humana Press ; 2003 . p. 947 – 77 . 45. ↵ Bornhorst JA , Falke JJ . Purification of Proteins Using Polyhistidine Affinity Tags . In: Methods in Enzymology . Boston : Birkhäuser ; 2000 . p. 245 – 54 . 46. ↵ World Health Organization . WHO Consolidated Guidelines on Tuberculosis. Module 4: Treatment—Drug-Resistant Tuberculosis Treatment . Geneva : World Health Organization ; 2020 . Available from: https://www.who.int/publications/i/item/9789240007048 [Accessed 17 October 2023 ]. 47. ↵ Olivença F , Ferreira C , Nunes A , Silveiro C , Pimentel M , Gomes JP , et al. Identification of Drivers of Mycobacterial Resistance to Peptidoglycan Synthesis Inhibitors . Front Microbiol . 2022 ; 13 : 985871 . doi: 10.3389/fmicb.2022.985871 . OpenUrl CrossRef PubMed 48. ↵ Sassetti CM , Boyd DH , Rubin EJ . Genes Required for Mycobacterial Growth Defined by High Density Mutagenesis . Mol Microbiol . 2003 ; 48 ( 1 ): 77 – 84 . doi: 10.1046/j.1365-2958.2003.03425.x . OpenUrl CrossRef PubMed Web of Science 49. Griffin JE , Gawronski JD , DeJesus MA , Ioerger TR , Akerley BJ , Sassetti CM . High-Resolution Phenotypic Profiling Defines Genes Essential for Mycobacterial Growth and Cholesterol Catabolism . PLoS Pathog . 2011 ; 7 ( 9 ): e1002251 . doi: 10.1371/journal.ppat.1002251 . OpenUrl CrossRef PubMed 50. ↵ DeJesus MA , Gerrick ER , Xu W , Park SW , Long JE , Boutte CC , et al. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis . MBio . 2017 ; 8 ( 1 ): e02133 – 16 . doi: 10.1128/mBio.02133-16 . OpenUrl CrossRef PubMed 51. ↵ Bosch B , DeJesus MA , Schnappinger D , Rock JM . Weak Links: Advancing Target-Based Drug Discovery by Identifying the Most Vulnerable Targets . Ann N Y Acad Sci . 2024 ; 1535 ( 1 ): 10 – 9 . doi: 10.1111/nyas.15139 . OpenUrl CrossRef PubMed 52. ↵ Kurepina N , Chen L , Composto K , Rifat D , Nuermberger EL , Kreiswirth BN . CRISPR Inhibition of Essential Peptidoglycan Biosynthesis Genes in Mycobacterium abscessus and Its Impact on β-Lactam Susceptibility . Antimicrob Agents Chemother . 2022 ; 66 ( 1 ): e00093 – 22 . doi: 10.1128/aac.00093-22 . OpenUrl CrossRef PubMed 53. ↵ Lee J , Bian X , Gupta R , Bellerose M , Parrish NM , Sassetti C. In Vitro and In Vivo Validation of cwlM and pbpB Essentiality for Viability and Resistance to Imipenem in Mycobacterium abscessus . bioRxiv . 2024 . Preprint. doi: 10.1101/2024.03.08.584109 . OpenUrl Abstract / FREE Full Text 54. Zapun A , Contreras-Martel C , Vernet T. Penicillin-Binding Proteins and β-Lactam Resistance . FEMS Microbiol Rev . 2008 ; 32 ( 3 ): 361 – 85 . doi: 10.1111/j.1574-6976.2007.00095.x . OpenUrl CrossRef PubMed Web of Science 55. ↵ Solapure S , Dinesh N , Shandil R , Ramachandran V , Sharma S , Bhattacharjee D , et al. In Vitro and In Vivo Efficacy of β-Lactams against Replicating and Slowly Growing/Nonreplicating Mycobacterium tuberculosis . Antimicrob Agents Chemother . 2013 ; 57 ( 6 ): 2506 – 10 . doi: 10.1128/AAC.00023-13 . OpenUrl Abstract / FREE Full Text 56. ↵ Pagliotto ADF , Caleffi-Ferracioli KR , Lopes MA , Baldin VP , Leite CQF , Pavan FR , et al. Anti-Mycobacterium tuberculosis Activity of Antituberculosis Drugs and Amoxicillin/Clavulanate Combination . J Microbiol Immunol Infect . 2016 ; 49 ( 6 ): 980 – 3 . doi: 10.1016/j.jmii.2015.08.025 . OpenUrl CrossRef PubMed 57. ↵ Chambers HF , Kocagoz T , Sipit T , Turner J , Hopewell PC . Activity of Amoxicillin/Clavulanate in Patients with Tuberculosis . Clin Infect Dis . 1998 ; 26 ( 4 ): 874 – 7 . doi: 10.1086/513945 . OpenUrl CrossRef PubMed 58. ↵ Dubée V , Triboulet S , Mainardi JL , Ethève-Quelquejeu M , Gutmann L , Marie A , et al. Inactivation of Mycobacterium tuberculosis L,D-Transpeptidase LdtMt1 by Carbapenems and Cephalosporins . Antimicrob Agents Chemother . 2012 ; 56 ( 8 ): 4189 – 95 . doi: 10.1128/AAC.00665-12 . OpenUrl Abstract / FREE Full Text 59. ↵ Tremblay LW , Fan F , Blanchard JS . Biochemical and Structural Characterization of Mycobacterium tuberculosis β-Lactamase with the Carbapenems Ertapenem and Doripenem . Biochemistry . 2010 ; 49 ( 17 ): 3766 – 73 . doi: 10.1021/bi100232q . OpenUrl CrossRef PubMed Web of Science 60. ↵ Soetaert K , Rens C , Wang X-M , De Bruyn J , Lanéelle M-A , Laval F , et al. Increased Vancomycin Susceptibility in Mycobacteria: A New Approach To Identify Synergistic Activity against Multidrug-Resistant Mycobacteria . Antimicrob Agents Chemother . 2015 ; 59 ( 8 ): 5057 – 60 . doi: 10.1128/AAC.04856-14 . OpenUrl Abstract / FREE Full Text 61. ↵ Kaur P , Rausch M , Malakar B , Watson U , Damle NP , Chawla Y , et al. LipidII Interaction with Specific Residues of Mycobacterium tuberculosis PknB Extra-cytoplasmic Domain Governs Its Optimal Activation . Nat Commun . 2019 ; 10 : 1231 . doi: 10.1038/s41467-019-09223-9 . OpenUrl CrossRef PubMed 62. ↵ Shiloh MU , DiGiuseppe Champion PA . To catch a killer. What can mycobacterial models teach us about Mycobacterium tuberculosis pathogenesis? Curr Opin Microbiol . 2010 ; 13 : 86 – 92 . doi: 10.1016/j.mib.2009.11.006 . OpenUrl CrossRef PubMed 63. ↵ Sparks IL , Derbyshire KM , Jacobs WR , Morita YS . Mycobacterium smegmatis: The Vanguard of Mycobacterial Research . J Bacteriol . 2023 ; 205 . doi: 10.1128/jb.00337-22 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted July 08, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Effects of CwlM, a peptidoglycan synthesis regulator, on beta-lactam resistance and host-pathogen interactions Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Effects of CwlM, a peptidoglycan synthesis regulator, on beta-lactam resistance and host-pathogen interactions Cátia Silveiro , Diana Mortinho , Francisco Olivença , Manoj Mandal , David Pires , Elsa Anes , Maria João Catalão bioRxiv 2025.07.08.663695; doi: https://doi.org/10.1101/2025.07.08.663695 Share This Article: Copy Citation Tools Effects of CwlM, a peptidoglycan synthesis regulator, on beta-lactam resistance and host-pathogen interactions Cátia Silveiro , Diana Mortinho , Francisco Olivença , Manoj Mandal , David Pires , Elsa Anes , Maria João Catalão bioRxiv 2025.07.08.663695; doi: https://doi.org/10.1101/2025.07.08.663695 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7619) Biochemistry (17642) Bioengineering (13865) Bioinformatics (41863) Biophysics (21410) Cancer Biology (18548) Cell Biology (25437) Clinical Trials (138) Developmental Biology (13359) Ecology (19863) Epidemiology (2067) Evolutionary Biology (24288) Genetics (15587) Genomics (22467) Immunology (17704) Microbiology (40301) Molecular Biology (17142) Neuroscience (88447) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4815) Physiology (7634) Plant Biology (15109) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9812) Zoology (2268)","source_license":"CC-BY-4.0","license_restricted":false}