{"paper_id":"498dbfc0-6da4-4924-aee3-5c43a3d412f4","body_text":"The SMARCA5–DMRT1 Pioneer Complex Establishes Epigenetic Priming to Direct Male Germline Development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The SMARCA5–DMRT1 Pioneer Complex Establishes Epigenetic Priming to Direct Male Germline Development Yuka Kitamura, Yasuhisa Munakata, Hironori Abe, Mengwen Hu, Satoyo Oya, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7576931/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract The establishment of cell type–specific chromatin landscapes is essential for cellular identity, but how these landscapes are generated remains poorly understood. Here, we demonstrate that the chromatin remodeler SMARCA5 establishes epigenetic priming that is required for retinoic acid (RA)–induced differentiation in the male germline. Germ cell–specific deletion of Smarca5 results in a complete loss of differentiating spermatogonia, phenocopying vitamin A-deficient mice that lack RA signaling. During the perinatal transition from prospermatogonia to undifferentiated spermatogonia, SMARCA5 is recruited to binding sites of the transcription factor DMRT1, which are located at distal putative enhancers and promoters of germline genes. The SMARCA5–DMRT1 pioneer complex establishes chromatin accessibility at these loci, generating poised enhancers and promoters that serve as RA receptor (RAR)–binding sites. Thus, SMARCA5 licenses transcriptional responses to RA that enable spermatogenic differentiation. Our findings uncover a mechanism linking pioneer factor activity to external signal responsiveness. Biological sciences/Developmental biology/Germline development/Spermatogenesis Biological sciences/Developmental biology/Epigenetic memory Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The establishment of distinct cellular identities from a shared genetic blueprint requires selective activation of lineage-specific genes and repression of alternative transcriptional programs. 1 This process is tightly regulated by epigenetic mechanisms, including chromatin remodeling and histone modifications 2 , 3 . Emerging evidence suggests that developmental enhancers often acquire accessible chromatin states prior to gene activation, indicating that chromatin preconfiguration can prime regulatory elements for future transcription 4 – 6 . However, how such epigenetic priming intersects with differentiation cues—particularly external signals—to direct gene expression programs during development remains poorly understood. Spermatogenesis offers a powerful and experimentally tractable model to investigate this question. Spermatogenesis is a highly ordered differentiation process driven by a germline stem cell system that supports unidirectional cell differentiation to produce haploid sperm 7 . This process is maintained by the balanced self-renewal and differentiation of spermatogonial stem cells (SSCs), which reside in a heterogeneous population of slow-cycling, undifferentiated type A spermatogonia (A undiff , including A single , A paired, and A aligned spermatogonia, Extended Data Fig. 1 A) 8 , 9 . Spermatogenic differentiation is orchestrated by retinoic acid (RA) signaling 10 – 12 and characterized by dramatic changes in gene expression and epigenetic remodeling 13 , 14 . In response to RA signaling, A undiff undergo irreversible commitment to become fast-cycling, KIT + differentiating spermatogonia (designated A1, A2, A3, A4, intermediate (In), and B spermatogonia), which lack stem cell potential 15 . These spermatogonia undergo a series of mitotic divisions before entering meiosis, ultimately leading to spermiogenesis (Fig. 1 a). Notably, many genes required for later stages of germ cell differentiation are epigenetically primed in undifferentiated spermatogonia prior to their activation 16 – 23 . This finding suggests that epigenetic priming plays a critical role in facilitating RA-responsive transcriptional programs 24 . Nevertheless, a key unresolved question remains: when and how is epigenetic priming established during the developmental progression that gives rise to undifferentiated spermatogonia? Chromatin accessibility is regulated by two key classes of factors: ATP-dependent chromatin remodelers and pioneer transcription factors. ISWI family remodelers, including SMARCA5 (also known as SNF2H), reposition nucleosomes to generate chromatin environments permissive for transcription factor binding and gene activation 25 – 27 . In contrast, pioneer transcription factors can engage their DNA motifs within closed chromatin and initiate local chromatin opening, often enabling recruitment of additional regulatory machinery 28 , 29 . Current models posit that pioneer factors recognize nucleosome-occupied target sites and subsequently recruit chromatin remodelers to establish fully-accessible chromatin states 30 . Although this paradigm is supported by biochemical and in vitro cellular reprogramming studies, the in vivo relevance and developmental context of this cooperation remain largely unexplored. Here, we demonstrate that SMARCA5 cooperates with the transcription factor DMRT1, a critical regulator of male germline development 31 , 32 , to establish chromatin accessibility during the perinatal transition from prospermatogonia (also known as gonocytes) to undifferentiated spermatogonia. We show that SMARCA5 is recruited to DMRT1-bound distal regulatory elements and promoters of germline genes and is essential for generating chromatin accessibility at these regions. Despite DMRT1’s intrinsic ability to bind closed chromatin, SMARCA5 is required to remodel these regions into accessible states that enable transcriptional activation of genes critical for spermatogonial maintenance and RA-induced differentiation. These findings uncover a chromatin remodeling mechanism driven by a pioneer complex that enables the external signal-dependent activation of transcriptional programs essential for spermatogenic differentiation. Results Smarca5 knockout in male germ cells causes a complete loss of spermatogonia To understand how chromatin is primed early in development to support subsequent differentiation, we sought to identify chromatin remodeling mechanisms critical for spermatogenesis. We focused on SMARCA5, which was previously identified in a genetic screen as a key regulator of paternal epigenetic inheritance 33 . To examine its expression during postnatal spermatogenesis, we reanalyzed single-cell RNA sequencing (scRNA-seq) data 34 and found that Smarca5 mRNA is highly expressed from A undiff through to post-meiotic round spermatids (Extended Data Fig. 1 b). Consistent with Smarca5 mRNA expression, SMARCA5 protein was present throughout these stages as well, with particularly high accumulation in A undiff (Extended Data Fig. 1 c). To investigate the role of SMARCA5 in male germ cells, we generated Smarca5 conditional knockout ( Smarca5 -cKO) mice by crossing mice carrying a Smarca5 floxed allele 35 and a germ cell-specific Ddx4 -Cre transgene, which is expressed from embryonic day 15 (E15) 36 (Fig. 1 b). At postnatal day 7 (P7), nearly complete loss of SMARCA5 protein was confirmed in the cKO testis by Western blotting (Extended Data Fig. 1 d), and germ cell-specific depletion of SMARCA5 protein was further confirmed by SMARCA5 immunostaining (Extended Data Fig. 1 e). Starting at postnatal day 14 (P14), Smarca5 -cKO mice exhibited reduced testicular size compared to littermate controls ( Smarca5 -ctrl), which carry one deleted and one functional Smarca5 allele. This reduction became more pronounced and was clearly evident by 2 months of age (Fig. 1 c). At this stage, the seminiferous tubules in the Smarca5 -cKO testis were atrophic and devoid of spermatocytes or spermatids (Fig. 1 d). The absence of germ cells was further confirmed by immunostaining using the germ cell marker DDX4 (Fig. 1 e). These results indicate that SMARCA5 is essential for spermatogenesis and suggest that the protein is required for both maintenance of spermatogonia and differentiation of male germ cells. SMARCA5 is required for spermatogonial differentiation Because Smarca5 -cKO testes lack differentiating germ cells, we next investigated whether SMARCA5 is required for the irreversible commitment of A undiff to KIT + differentiating spermatogonia. At postnatal day 10 (P10), when the first-wave spermatogenesis normally reaches the KIT + differentiating spermatogonia stage, Smarca5 -cKO testes contained cells positive for an A undiff marker ZBTB16 (also known as PLZF), indicating the presence of A undiff (Fig. 1 f). In contrast, KIT + differentiating spermatogonia were largely absent in Smarca5 -cKO testis (Fig. 1 f). Notably, at P10, Smarca5 -cKO testis largely lacked late differentiating spermatogonia (In and B spermatogonia), characterized by a ZBTB16 − KIT + profile 37,38 (Fig. 1 f). To further pinpoint the developmental timing of spermatogonia depletion in Smarca5 -cKO testes, we next examined samples at the earlier stage of P7. During normal spermatogonial development, ZBTB16 is present in early KIT + differentiating spermatogonia (A 1 , A 2 , A 3 , and A 4, termed differentiating Type A spermatogonia: A diff ), which have already committed to irreversible differentiation. In Smarca5 -cKO testes at P7, ZBTB16 + KIT + A diff were markedly reduced, and late-stage ZBTB16 − KIT + differentiating spermatogonia were nearly absent, similar to P10. In contrast, the proportion of ZBTB16 + KIT − A undiff was increased compared to littermate Smarca5 -ctrl testes (Extended Data Fig. 2 a). Thus, we conclude that SMARCA5 is required for spermatogonial differentiation (Fig. 1 g). Supporting this conclusion, we observed that meiosis is not initiated in Smarca5 -cKO testes, as preleptotene spermatocyte markers STRA8 39 and MEIOSIN 40 were absent (Extended Data Fig. 2 b). SMARCA5 is required for SSC maintenance in the adult testis The complete absence of germ cells by 2 months of age suggested that maintenance of A undiff is ultimately impaired in Smarca5 -cKO testis. Indeed, the number of ZBTB16 + spermatogonia decreased significantly between 4 and 6 weeks (Figs. 2 a, b), and during this period, tubules lacking ZBTB16 + spermatogonia became apparent (Fig. 2 c). Therefore, we next sought to determine how SMARCA5 deletion leads to impaired maintenance of A undiff . A undiff includes a subpopulation of a relatively small number of A single and A paired cells expressing GFRα1, which form the stem cell pool and give rise to NGN3 + cells. However, NGN3 + cells can revert to GFRα1 + cells, maintaining their long-term self-renewal ability (Extended Data Fig. 1 a) 41 , 42 . In the Smarca5 -cKO testes, the GFRα1 + population was relatively enriched compared to controls at 4 weeks (Extended Data Fig. 2 c), likely due in part to the depletion of differentiating spermatogonia. This result further supports the requirement of SMARCA5 for spermatogonial differentiation. We next examined whether Smarca5 -cKO A undiff exhibited an abnormal cell cycle profile, as slow cycling is essential for maintenance of A undiff . To this end, we assessed the proportion of active cycling A undiff cells at 2 and 4 weeks by immunostaining with Ki67, a proliferation marker present in G1, S, G2, and M phases of the cell cycle, but absent in G0 43 . Consistent with the slow cycling nature of A undiff , only 22.5% of A undiff in Smarca5- ctrl mice were Ki67 + at 2 weeks (Extended Data Fig. 2 d). However, 83.3% of A undiff in Smarca5 -cKO testes were Ki67 + , an ~ 3-fold increase compared to control testes (Extended Data Fig. 2 d). This suggests that Smarca5 -cKO A undiff are highly proliferative at 2 weeks. At 4 weeks, the proportion of Ki67 + cells remained high in Smarca5 -cKO A undiff . These findings indicate that SMARCA5 is required to maintain the slow-cycling state of A undiff , and that their overproliferation in Smarca5 -cKO testes ultimately leads to depletion of the SSC pool. SMARCA5 promotes expression of SSC maintenance genes To further determine the cause of SSC maintenance defects, we examined gene expression profiles by performing RNA-sequencing (RNA-seq) on spermatogonia at P8, a stage when sufficient numbers of both A undiff and A diff can be obtained from normal testes. We isolated A undiff and A diff from Smarca5 -ctrl males at P8 using our previously established fluorescence-activated cell sorting (FACS) method (Fig. 2 d) 8 , 44 . We utilized the cell surface marker E-Cadherin, which is expressed in both A undiff and A diff , to isolate these populations, and employed KIT expression to specifically identify A diff (Fig. 2 d). In addition, we used the cell surface marker CD9 to exclude somatic contaminants 45 , thus ensuring the isolation of a highly pure spermatogonial population. Using this method, A undiff were collected based on E-cadherin and high CD9 expression, and absence of KIT (E-cadherin + CD9 high KIT – ), while A diff were isolated based on E-cadherin and KIT expression with medium CD9 level (E-cadherin + CD9 medium KIT + ). As expected, based on our immunostaining results from the P7 testes (Extended Data Fig. 2 a), at P8, Smarca5 -cKO males lacked an A diff population (Fig. 2 d). We confirmed the high purity of A undiff and A diff (Extended Data Fig. 3 a) and observed strong similarity between biological replicates in the RNA-seq data (Extended Data Fig. 3 b). During normal spermatogonial differentiation from A undiff to A diff at P8, a major shift in gene expression occurred, with 2,639 genes upregulated and 1,559 genes downregulated (Extended Data Fig. 3 c, Supplementary Table 1). However, in Smarca5- cKO A undiff , the overall gene expression profile was distinct from both Smarca5 -ctrl A undiff and A diff (Extended Data Fig. 3 b). Compared to Smarca5- ctrl A undiff , Smarca5- cKO A undiff showed 765 upregulated genes and 1,022 downregulated genes (Fig. 2 e, Supplementary Table 2). Gene ontology (GO) analysis revealed that the upregulated genes in Smarca5- cKO A undiff were enriched for apoptosis-related terms (Extended Data Fig. 3 d). Consistent with this, the frequency of apoptotic cell death was increased in Smarca5- cKO testes (Fig. 2 f). Loss of SMARCA5 in A undiff led to the ectopic upregulation of genes that were normally upregulated from A undiff to A diff (termed “A diff -high genes”: Extended Data Fig. 3 e, f). Conversely, genes that were highly expressed in A undiff , which are typically downregulated in A diff (termed “A undiff -high genes”), were downregulated in Smarca5 -cKO A undiff (Extended Data Fig. 3 e, g). These downregulated genes in Smarca5- cKO, enriched for the GO term “regulation of transcription by RNA polymerase II” (Extended Data Fig. 3 d), which was also the top-ranked GO term among A undiff high genes (Extended Data Fig. 3 e). These findings indicate that Smarca5 -cKO A undiff exhibit impaired expression of A undiff -specific genes. Consistent with this, key SSC maintenance genes —such as Sall4 , Nanos3 , Lin28a, Gfra1, Etv5, Sox4, and Plvap —were down-regulated upon Smarca5 loss (Fig. 2 g), indicating that SMARCA5 is required for proper expression of SSC maintenance genes. Together, these results suggest that Smarca5 -cKO A undiff display upregulation of apoptosis-related genes and downregulation of SSC maintenance genes, which may ultimately lead to A undiff depletion in adult testes. SMARCA5 deficiency results in a closed chromatin state at DMRT1-binding sites As SMARCA5 is an ATP-dependent chromatin remodeler 46 , we next investigated whether SMARCA5 establishes the chromatin landscape required for SSC maintenance and spermatogonial differentiation. To this end, we performed an assay for transposase-accessible chromatin using sequencing (ATAC-seq) 47 , 48 to assess genome-wide chromatin accessibility in A undiff and A diff from Smarca5- ctrl mice and A undiff from Smarca5 -cKO mice at P8. Due to the absence of A diff in Smarca5 -cKO testes, we were unable to analyze this population. Pearson correlation coefficient analysis confirmed high correlations among biological replicates (Extended Data Fig. 4 a). Among 17,647 ATAC peaks detected in Smarca5- ctrl A diff , 11,290 peaks (64.0%) overlapped with those in A undiff (Extended Data Fig. 4 b, c), and we identified 6,203 A undiff -specific peaks and 6,357 A diff -specific peaks. This suggests that a large core set of accessible chromatin regions is shared between the two stages, although chromatin accessibility at some specific regions shifts during the transition from A undiff to A diff (Extended Data Fig. 4 c). Many of the ATAC peaks in A undiff were located within 10 kb of genes expressed in A undiff (e.g., Etv2 , Etv5 , Id4 , and Ret ) and A diff (e.g., Dmc1 , Meioc , Stra8 , and Prdm9 ) (Extended Data Fig. 4 d), suggesting that A undiff ATAC peaks serve as proximal or distal regulatory elements for both A undiff and A diff . Taken together, A undiff and A diff exhibit largely overlapping chromatin accessibility profiles, with putative regulatory elements of genes upregulated in A diff already accessible at the A undiff stage. These findings suggest that the gene expression program for spermatogonial differentiation is primed in A undiff . Notably, A undiff from Smarca5 -cKO mice exhibited a largely distinct chromatin accessibility compared to A undiff and A diff from Smarca5- ctrl mice (Extended Data Fig. 4 a, Supplementary Table 3). In A undiff , loss of SMARCA5 significantly affected the number of ATAC peaks, especially at the intergenic and intronic regions (Fig. 3 a). In contrast, ATAC peaks at promoter regions tended to be common between Smarca5 -ctrl and cKO. These results suggest that SMARCA5 primarily regulates chromatin accessibility at distal regulatory regions, such as enhancers, rather than at promoters. To determine if SMARCA5 directly binds to chromatin regions with altered accessibility in Smarca5 -cKO, we performed Cleavage Under Targets and Tagmentation (CUT&Tag) 49 analysis of SMARCA5. The majority of SMARCA5 peaks were located in intergenic (42.3%) and intronic (30.3%) regions, and 19.4% were found at promoter regions (Fig. 3 b, Supplementary Table 4). These SMARCA5 binding sites were largely accessible at both promoter regions (within ± 1 kb from transcription start sites, TSSs) and distal regions (beyond ± 1 kb from TSSs) in Smarca5 -ctrl cells. Whereas promoter accessibility was retained in Smarca5 -cKO, distal SMARCA5 peaks lost accessibility (Fig. 3 d). SMARCA5 was also enriched at ATAC peaks specific to Smarca5 -ctrl, but not at ATAC peaks specific to Smarca5 -cKO (Fig. 3 e). These findings indicate that SMARCA5 directly promotes chromatin accessibility at its binding sites, predominantly at distal regulatory regions. While Smarca5 -cKO also leads to the emergence of ectopically accessible regions, the near absence of SMARCA5 binding at these sites suggests that many of them are indirectly affected by the loss of SMARCA5. We further investigated the characteristics of ATAC peaks specific to Smarca5 -ctrl, as these are presumably direct targets of SMARCA5. Motif analysis of ATAC peaks using HOMER revealed that motifs shared by the transcription factors DMRT1 and DMRT6 were enriched in Smarca5 -ctrl A undiff -specific peaks (Fig. 3 e). Interestingly, DMRT1 is expressed in male germ cells postnatally and present in A undiff 50 , regulates SSC maintenance 51 and suppresses precocious meiotic entry in spermatogonia 52 . Thus, SMARCA5 might collaborate with DMRT1 to promote the establishment of chromatin states conducive to male germ cell development. We focused on DMRT1 rather than DMRT6 due to their distinct expression profiles; DMRT1 is expressed in male germ cells postnatally and is present in A undiff 50 , whereas DMRT6 expression begins at the A diff stage and functions during spermatogenic differentiation 53 . Therefore, DMRT6 is unlikely to be involved in SMARCA5-regulated distal accessible regions in A undiff . To further investigate the possible role of DMRT1, we performed a CUT&Tag analysis for DMRT1 in A undiff (Extended Data Fig. 4 e). DMRT1 peaks were predominantly located at intergenic (42.4%) and intronic (35.8%) regions, while 17.8% of the DMRT1 peaks were located in promoter regions (Fig. 4 a, Supplementary Table 5). Compared to previous DMRT1 ChIP-seq studies using whole testis, 51 our CUT&Tag analysis identified a greater number of promoter-associated peaks. Nonetheless, consistent with the previous study 51 , DMRT1 exhibited stronger binding at distal regions compared to promoters (Fig. 4 b). While DMRT1-bound promoter regions remained accessible in Smarca5 -cKO, distal DMRT1 peak regions showed significantly reduced accessibility upon SMARCA5 loss (Fig. 4 b). These findings indicate that SMARCA5 promotes chromatin accessibility at distal DMRT1-binding sites. SMARCA5 establishes chromatin accessibility at DMRT1-binding sites We next sought to elucidate the functions of distal regulatory elements regulated by SMARCA5 and DMRT1. To this end, we reanalyzed publicly available chromatin profiling datasets from A undiff to examine the distribution of representative histone modifications at these distal regions 44 , 54 . We found that H3K4me1 (monomethylation of histone H3 at lysine 4), a hallmark of poised enhancers, was enriched at distal DMRT1 peaks. These regions lacked the active enhancer/promoter mark H3K27ac (H3K27 acetylation) 20 and the promoter mark H3K4me3 55 (Fig. 4 c), suggesting that distal elements are poised rather than active enhancers. Additionally, these sites retained repressive histone modifications, including H2AK119ub and H3K27me3 44 , which are mediated by Polycomb repressive complexes PRC1 and PRC2, respectively. This indicates a role for Polycomb in enhancer poising. Notably, H3K4me1 was enriched specifically at regions adjacent to the peak centers. In contrast, DMRT1-associated promoters showed strong enrichment of both H3K27ac and H3K4me3, consistent with an active promoter status (Fig. 4 c). Analysis of SMARCA5 binding sites in A undiff revealed similar enrichment of H3K4me1 (Fig. 4 d). A subset of these SMARCA5-bound distal regions also displayed H2AK119ub and H3K27me3 marks. Overall, these results suggest that SMARCA5 and DMRT1 largely co-occupy putative poised enhancers, with SMARCA5-bound regions exhibiting a stronger association with Polycomb-mediated repression than those bound by DMRT1. We further investigated how individual loci are regulated by SMARCA5 and DMRT1. DMRT1 is known to bind a putative upstream enhancer of the Zbtb16 locus and regulate its expression 51 . We found that chromatin accessibility at this enhancer was also SMARCA5-dependent and that both SMARCA5 and DMRT1 bound to this region (Fig. 4 e), suggesting that they act cooperatively to activate Zbtb16 expression. In adult A undiff from Smarca5 -cKO mice, we observed reduced expression of the ZBTB16 protein (Extended Data Fig. 4 g), a phenotype resembling that of Dmrt1 -deficient spermatogonia 51 . Additionally, SMARCA5 and DMRT1 co-bound the Dmrt1 promoter, where chromatin accessibility was likewise SMARCA5-dependent (Fig. 4 f), suggesting that SMARCA5 and DMRT1 cooperate to establish the chromatin landscape at the Dmrt1 promoter. Together, these findings support a model in which SMARCA5 and DMRT1 work in concert to establish chromatin accessibility at key regulatory elements critical for spermatogenesis. SMARCA5 establishes chromatin accessibility at DMRT1-binding sites after the prospermatogonia stage A key outstanding question is when SMARCA5 establishes chromatin accessibility at DMRT1-binding sites in the male germline. To address this, we performed ATAC-seq on prospermatogonia (ProSG) at P0 (Extended Data Fig. 5 a) and examined changes in chromatin accessibility during the transition to spermatogonia. In Smarca5 -control P0 ProSG, we identified 12,780 ATAC peaks (Supplementary Table 3), approximately one-third of which were located at promoter regions (Fig. 5 a). From P0 ProSG to P8 A undiff , there was a progressive increase in ATAC peaks (Fig. 5 b). The P8 A undiff -specific peaks that emerged during this developmental window were enriched in the DMRT1/6 motif (Extended Data Fig. 5 b). When comparing the accessible chromatin landscapes of P0 ProSG and P8 A undiff , we found that stage-specific ATAC peaks were predominantly located in intergenic and intronic regions, whereas more than half of the shared peaks were found at promoter regions (Fig. 5 c). The newly acquired ATAC peaks in A undiff were enriched for the poised enhancer mark H3K4me1 (Fig. 5 c). Based on these findings, we hypothesized that SMARCA5 actively generates chromatin accessibility at these poised enhancers. Indeed, distal DMRT1-binding sites in P8 A undiff gained chromatin accessibility during this transition, and this gain was dependent on SMARCA5 (Fig. 5 g). These findings indicate that SMARCA5 establishes chromatin accessibility at distal elements of DMRT1-binding sites during the transition from P0 ProSG to P8 A undiff . SMARCA5 is recruited to distal DMRT1-binding sites to establish accessible chromatin To determine when SMARCA5 is recruited to distal DMRT1-binding sites, we performed CUT&Tag for SMARCA5 in P0 ProSG (Extended Data Fig. 5 c, Supplementary Table 4) and compared the binding profiles to P8 A undiff . We observed that 30,655 P0 ProSG SMARCA5 peaks were lost, while 15,404 new SMARCA5 peaks were gained in P8 A undiff (Fig. 5 h). Notably, DMRT1/6 motifs were enriched within the P8-specific SMARCA5 peaks (Fig. 5 h, Extended Data Fig. 5 d). At DMRT1-binding sites in P8 A undiff , SMARCA5 was newly recruited to many distal regions, whereas it was already bound to promoter regions (Fig. 5 i). This pattern was specific to DMRT1-binding sites, as SMARCA5 peaks in A undiff that did not overlap with DMRT1-binding sites were already accessible and SMARCA5-bound in ProSG (Figs. 5 j, k). Consistent with these findings, SMARCA5 was expressed in germ cells from E18.5 through P3 (Extended Data Fig. 5 e). In contrast, DMRT1 was not expressed at E18.5 but appeared in a subset of germ cells at P0 and was present in most germ cells by P3 (Extended Data Fig. 5 f). Thus, the onset of DMRT1 expression (from P0 onwards) coincided with the de novo establishment of accessibility at distal DMRT1-binding sites, suggesting that SMARCA5 recognizes distal DMRT1-binding sites upon DMRT1 expression and facilitates the generation of accessible chromatin at these sites. The SMARCA5–DMRT1 pioneer complex binds closed chromatin and facilitates DNA accessibility A previous study suggested that DMRT1 may function as a pioneer transcription factor in the context of female-to-male transdifferentiation in ovarian somatic cells, capable of binding closed chromatin and promoting chromatin accessibility to induce the male fate 56 . In line with this notion, and based on our findings, we hypothesized that DMRT1 cooperates with SMARCA5 to generate accessible chromatin at distal DMRT1-binding sites in male germ cells. To test this, we assessed DMRT1's chromatin-binding ability using CUT&Tag in P8 A undiff from Smarca5 -cKO mice (Extended Data Fig. 5 g) and compared it to control mice (Extended Data Fig. 4 f). DMRT1 enrichment at its binding sites was largely similar between Smarca5 -ctrl and cKO, with minimal differences observed at both promoter and distal regions (Fig. 6 a). Notably, DMRT1 binding was retained at sites that remained closed in Smarca5 -cKO but were accessible in controls—specifically at SMARCA5-dependent ATAC peaks (Fig. 6 b). These results indicate that DMRT1 is capable of binding closed chromatin and that SMARCA5 is required to remodel these regions into an accessible state at distal DMRT1-binding sites. Thus, SMARCA5 functions together with DMRT1 as part of a SMARCA5–DMRT1 pioneer complex, establishing chromatin accessibility at these loci. To investigate the potential mechanism of action of the SMARCA5–DMRT1 pioneer complex, we modeled chromatin relaxation by DMRT1 with and without SMARCA5 using AlphaFold3 (AF3), which enables highly accurate predictions of protein–nucleic acid complexes. 57 We used the 601 DNA sequence, commonly employed for nucleosome modeling 58 and incorporated a DMRT1-binding motif. Structural predictions were then generated for DMRT1 alone and for the DMRT1–SMARCA5 complex. The DM domain of DMRT1, known to interact with DNA, 59 was predicted to bind its motif via a major α-helix (Fig. 6 c, d). This binding mode closely matches the structure of the human DMRT1–DNA complex determined by X-ray crystallography. 60 Notably, AF3 predicts that DMRT1 can bind DNA wrapped around histones, consistent with our CUT&Tag data showing DMRT1 occupancy at inaccessible chromatin regions (Fig. 6 b, Supplementary Video 1). When SMARCA5 is included in the model, the DMRT1–DNA interactions are maintained (Fig. 6 e), but the DNA near the DMRT1 motif is displaced farther from the histone core compared to the DMRT1-only model (Fig. 6 d, f, Supplementary Video 2), indicating chromatin loosening induced by SMARCA5. These findings suggest that while DMRT1 can recognize its target motifs in closed chromatin, it requires SMARCA5 to remodel nucleosomes and generate an accessible chromatin state. SMARCA5 establishes chromatin states that confer retinoic acid responsiveness Finally, we sought to determine how de novo chromatin accessibility at distal DMRT1 binding sites contributes to spermatogenic differentiation. Loss of Smarca5 impairs the transition from A undiff to A diff , a process known to require retinoic acid (RA) signaling 61 , 62 . Notably, the absence of A diff in Smarca5 -cKO testes phenocopies that observed in vitamin A (the RA precursor)–deficient mice, which lack RA 62 . Stra8 , a well-established RA-responsive gene, is first expressed in A diff and later again in preleptotene spermatocytes 63 , 64 . Retinoic acid receptors (RARs), members of the nuclear receptor family, act as ligand-dependent transcription factors 65 . Supporting their role in RA signaling, pan-RAR ChIP-seq data from germline stem (GS) cells—an in vitro model of A undiff 66 —have shown RAR binding at the Stra8 promoter 40 . We therefore reanalyzed the pan-RAR ChIP-seq data 66 and found that both SMARCA5 and DMRT1 also bind RAR-binding sites in A undiff (Fig. 7 a). These RAR-binding regions were inaccessible in ProSG but became accessible in A undiff in a SMARCA5-dependent manner (Fig. 7 b). For example, SMARCA5-dependent accessible chromatin was established at the promoters of Stra8 and another RA-responsive gene, Rec8 , both of which are co-occupied by DMRT1 and RAR (Fig. 7 c). These findings indicate that the SMARCA5–DMRT1 pioneer complex establishes a chromatin state that permits RAR binding, thereby priming A undiff for RA-induced differentiation. We reanalyzed the H3K27ac ChIP-seq data during spermatogenesis 14 and found that SMARCA5-dependent accessible sites in A undiff were enriched for H3K27ac in both A undiff and A1 spermatogonia (a subset of A diff ), and H3K27ac signals decreased upon further differentiation (Fig. 7 d). Notably, in A undiff and A diff , H3K27ac signals were enriched in regions several hundred base pairs upstream and downstream of the ATAC-seq peak centers, while the peak centers themselves lacked H3K27ac (indicated by arrows in Fig. 7 d). This pattern likely reflects transcription factor binding at the central regions, flanked by H3K27ac-modified nucleosomes. Moreover, 5,356 genes located near these regions were highly expressed in A undiff and A diff (Fig. 7 e). These results support the notion that SMARCA5-dependent accessible sites act as enhancers in spermatogonia. In summary, SMARCA5 promotes spermatogonial differentiation by establishing chromatin accessibility at putative poised enhancers and germline gene promoters—including Dmrt1 , Stra8 , and Rec8 —thereby priming the genome for RA responsiveness during the transition from ProSG to A undiff (Fig. 7 f). Discussion In this study, we report that SMARCA5 is an essential chromatin remodeler that cooperates with the transcription factor DMRT1 to form the SMARCA5-DMRT1 pioneer complex, which primes gene regulatory elements during the transition from ProSG to A undiff (Fig. 7 f). We demonstrate that, in SMARCA5-deficient spermatogonia, many enhancers and key germline gene promoters—including those of Stra8 and Rec8 —fail to acquire chromatin accessibility. Although DMRT1 is bound to many of these loci, the chromatin remains inaccessible, indicating that SMARCA5 is required to establish a permissive chromatin environment for subsequent recruitment of transcriptional regulators such as RARs. The failure to differentiate into A diff in the absence of SMARCA5 suggests that disrupted epigenetic priming impedes RAR function. Thus, SMARCA5 confers developmental competence to male germ cells by establishing the chromatin states necessary for RA-responsive gene expression (Fig. 7 f). Our finding that DMRT1, while capable of binding closed chromatin, requires SMARCA5 to generate full chromatin accessibility at many of its target sites (Fig. 6 ) is a central conceptual advance. This observation refines the classical model of pioneer transcription factors, suggesting that in certain developmental contexts, their chromatin-opening activity depends on cooperation with chromatin remodelers. While in vitro nucleosome reconstitution assays have demonstrated that pioneer factors can open compact chromatin independently 28 , 67 , 68 , studies in cultured cells indicate that chromatin remodelers are often required to achieve chromatin accessibility 69 , 70 . Transcription requires the recruitment of various factors, including transcription factors and RNA polymerase II, a process that may involve the activity of chromatin remodelers to establish fully open chromatin regions 70 . Our findings provide in vivo evidence—using cells derived from living organisms rather than cultured cells—that chromatin remodeling is an essential step in the functional activation of pioneer factor-bound regions. Additionally, DMRT6—expressed in A diff and type B spermatogonia—binds genomic regions that largely overlap with those of DMRT1. These DMRT6 binding sites also became accessible in a SMARCA5-dependent manner during the transition from ProSG to A undiff (Extended Data Fig. 5 h), suggesting that DMRT6 functions sequentially after DMRT1 at shared regulatory sites. Of note, a recent study also reported that Smarca5 -cKO using a different Ddx4 -Cre driver 71 and the same Smarca5 -floxed allele 35 as in our study leads to male infertility 72 . However, in that model, deletion of Smarca5 did not lead to an acute and uniform loss of spermatogonia but allowed continued spermatogonial differentiation and meiotic progression 72 . This discrepancy might be due to differences in Cre-induced recombination efficiency between the two Ddx4 -Cre drivers, likely reflecting distinct levels of Cre expression. The Ddx4 -Cre driver used in our study 36 is a transgenic line with over 20 copies of the transgene inserted into the genome 73 , whereas the Ddx4 -Cre driver 71 used in the other study 72 is a knock-in line. Incomplete loss of SMARC5 during early development in that model might have allowed spermatogonia to progress, thereby revealing that SMARCA5 is also required during later stages of spermatogenesis 72 . Interestingly, SMARCA5 protein is present in the XY body of pachytene spermatocytes, a hallmark of meiotic sex chromosome inactivation (MSCI), an essential step in male meiosis 74 (Extended Data Fig. 1 c). Notably, our previous studies identified SMARCA5 in immunoprecipitation and mass spectrometry analyses of γH2AX-containing nucleosomes 13 , 75 , which are enriched in the XY body. These findings suggest that SMARCA5 also functions during later stages of spermatogenesis beyond the A diff stage. In addition to its role in differentiation, we observe that SMARCA5 is also involved in maintaining the undifferentiated state in A undiff . This function may be mediated by PRC2-dependent H3K27me3, which is enriched at many distal SMARCA5 binding sites in these cells (Fig. 4 d). H3K27me3 is a hallmark of SSCs and is typically lost during the onset of differentiation, accompanied by activation of genes such as Stra8 44 . During the transition from ProSG to A undiff , H3K27me3 is deposited at promoters already marked by H3K4me3, forming bivalent domains 76 . At key loci such as Dmrt1 and Stra8 , these bivalent domains coincide with SMARCA5-dependent accessible regions, suggesting that SMARCA5 might facilitate the establishment of a poised chromatin state necessary for SSC maintenance. Thus, SMARCA5 may serve dual roles: one in Polycomb-mediated repression to maintain SSC identity and another in Polycomb-associated epigenetic priming that prepares cells for differentiation. These functions may not be mutually exclusive and likely occur in coordination with DMRT1. Accordingly, our study also clarifies the molecular function of DMRT1 in germ cells, highlighting a parallel to its role in somatic supporting cells (Sertoli cells) in the testes, where DMRT1 partners with Polycomb complexes to repress the female transcriptional program 77 . Previous studies have shown that epigenetic states undergo substantial changes during the ProSG to A undiff transition 78 , 79 . Single-cell ATAC-seq analyses of developing testicular cells from E18.5 to P5.5 have revealed that newly accessible regions are enriched for binding motifs of various transcription factors, including DMRT1 and FOXO1 78 , a factor essential for spermatogonial maintenance 80 . Notably, FOXO1 has been identified as a pioneer factor in cancer cells 81 . In light of our new findings, these observations suggest that additional regulators may contribute to establishing accessible chromatin during this developmental transition. The current study further raises the intriguing possibility that the establishment of male epigenetic priming may suppress the female program during development from the bi-potential state of primordial germ cells, similar to the role of DMRT1 in Sertoli cells in the testes 82 . Notably, Smarca5 -cKO A undiff -specific ATAC peak regions, which in the presence of SMARC5 remain inaccessible, were enriched for binding motifs shared by the transcription factors TCF3 and TCF12 (Fig. 3 e). TCF3 and TCF12 are primarily required for the female germline, particularly in supporting oocyte growth 83 . Thus, it is tempting to speculate that loss of SMARCA5 may lead to the emergence of ectopic, female-like chromatin states. Although pioneer transcription factors have been extensively studied in the context of early embryogenesis 84 , 85 and cellular reprogramming 86 , their roles during later developmental transitions remain poorly understood. Our findings highlight that the interplay between chromatin remodelers and pioneer factors is critical not only during embryogenesis but also during germline differentiation, where they enable transcriptional programs responsive to external signals. This finding expands the conceptual framework of epigenetic priming and underscores the broader importance of chromatin remodeling in shaping cellular competence across diverse developmental systems. Methods Animals Mice were maintained on a 12:12 light cycle in a temperature and humidity-controlled vivarium (22±2°C: 40-50% humidity) with free access to food and water in a pathogen-free animal care facility. Mice were used according to the guidelines of the Institutional Animal Care and Use Committee (protocol no. IACUC2018-0040, 21943, and 23545) at Cincinnati Children’s Hospital Medical Center and the University of California, Davis. Smarca5- cKO mice ( Smarca 5 F/- ; Ddx4 -Cre [FVB-Tg ( Ddx4 -cre)1Dcas/J]) were generated from Smarca5 F/F females crossed with Smarca 5 F/+ ; Ddx4 -Cre males. Smarca5 -ctrl in experiments were Smarca5 F/+ ; Ddx4 -Cre for the next generation sequencing experiments, and Smarca5 F/+ ; Ddx4 -Cre or Smarca5 F/+ for immunostaining and testis size measurements from littermates of Smarca5 cKO. Smarca5 F/F and Ddx4 -Cre mouse lines were maintained on a background of FVB. Smarca5 F/F mice were obtained from Dr. Davis J. Picketts 35 , and Ddx4 -Cre transgenic mice were purchased from the Jackson laboratory 36 . Stella -GFP transgenic mice were obtained from Dr M. Azim Surani 87 , maintained on a mixed genetic background of FVB and C57BL/6J. Histology and immunostaining For the preparation of paraffin blocks, testes were fixed with 4% paraformaldehyde containing 0.05% Triton X-100 for 2 days at room temperature. Testes were dehydrated by a series of ethanol and then replaced with xylene and embedded in paraffin. For HE staining, 5 μm-thick paraffin sections were deparaffinized and stained with hematoxylin (Sigma, MHS16) and eosin (Sigma, 318906). For immunostaining, 5 μm-thick paraffin sections were deparaffinized and autoclaved in target retrieval solution (DAKO) for 10 min at 121°C. Sections were blocked with Blocking One Histo (Nacalai, 06349-64) for 20 min at room temperature and then incubated with primary antibodies overnight at 4°C. Sections were washed with PBST (PBS containing 0.1% Tween 20) three times at room temperature for 5 min and then incubated with the corresponding secondary antibodies. Finally, sections were counterstained with DAPI and mounted using 30 μL undiluted ProLong Gold Antifade Mountant (ThermoFisher Scientific, P36930). Primary antibodies and secondary antibodies that were used are listed in Supplementary Table 6. Images were obtained with an ECLIPSE Ti-2 microscope (Nikon) or BZ-X810 (Keyence). Western blotting Testis pieces obtained from P7 testis were homogenized in RIPA buffer (50 mM Tris–HCl, pH 7.5; 150 mM NaCl; 0.1% SDS; 1% Triton X-100; 1% sodium deoxycholate) containing a protease inhibitor cocktail (Roche, 11697498001) and a phosphatase inhibitor cocktail (Sigma, P0044). For SMARCA5 detection, 20 μg of protein were separated by electrophoresis with a 10% SDS-PAGE gel, and the proteins were transferred using Trans-Blot® Turbo Transfer System (BIO-RAD) onto a PVDF membrane (EMD Millipore; IPVH00010). The membranes were blocked with StartingBlock™ T20 (TBS) Blocking Buffer (ThermoFisher Scientific, 37543) for 30 min at room temperature and then incubated with primary antibodies overnight at 4°C. After being washed with TBST three times, membranes were then incubated with secondary antibodies conjugated to HRP (Abcam, ab131366 or ab131368) for 1 h at room temperature, and bands were visualized using an ECL kit according to the manufacturer’s instructions (EMD Millipore; WBKLS0500). Flow cytometry and cell sorting Flow cytometric experiments and cell sorting were performed using SH800S (SONY), with antibody-stained testicular single-cell suspensions prepared as described previously 44,88 with minor modifications. Briefly, to prepare single cell suspensions for cell sorting, detangled seminiferous tubules were incubated in 1× Krebs–Ringer Bicarbonate Buffer (Sigma, K4002) supplemented with 1.5 mg/ml collagenase Type 1 and 0.04 mg/ml DNase I at 37°C for 15 min with gentle agitation and dissociated using vigorous pipetting, and then add 0.75 mg/ml hyaluronidase (Sigma, H3506) and incubated at 37°C for 10 min with gentle agitation and dissociated using vigorous pipetting. The cell suspension was centrifuged at 300 × g, the cells resuspended in 10 ml FACS buffer (PBS containing 2% FBS), and then centrifuged again at 300 × g for 5 min, and this step was repeated one more time. The pelleted cells were resuspended in 1 ml FACS buffer and then filtered through a 70 μm nylon cell strainer (Falcon, 352350). The resultant single cells were stained with cocktails of antibodies diluted with FACS buffer, listed as follows: PE-conjugated anti-mouse/human CD324 (E-cadherin) antibody (1:500, Biolegend, 147303), PE/Cy7-conjugated anti-mouse CD117 (c-Kit) antibody (1:200, Biolegend, 105814), and FITC-conjugated anti-mouse CD9 antibody (1:500, Biolegend, 124808). After a 50-minute incubation on ice, cells were washed with 10 ml FACS buffer three times by centrifugation at 300 × g for 5 min and filtered into a 1 ml FACS tube through a 35 μm nylon mesh cap (Falcon, 352235). 7-AAD Viability Stain (Invitrogen, 00-6993-50) was added to the cell suspension for the exclusion of dead cells. Samples were kept on ice until sorting. Cells were analyzed after removing small and large debris in FSC-A versus SSC-A gating, doublets in FSC-W versus FSC-H gating, and 7AAD + dead cells. Then the desired cell population was collected in gates determined based on antibody staining. RNA-seq library generation and sequencing RNA-seq libraries of A undiff from Smarca5 -ctrl and cKO and A diff from Smarca5 -ctrl were prepared as described 88 ; briefly, 10,000 A undiff or A diff cells were pooled from two independent mice as one replicate, and two independent biological replicates were used for RNA-seq library generation. Total RNA was extracted using the RNeasy Plus Micro Kit (QIAGEN, Cat # 74034) according to the manufacturer’s instructions. Library preparation was performed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (NEB, E6420S) according to the manufacturer’s instructions. Prepared RNA-seq libraries were sequenced on the HiSeq X Ten system (Illumina) with paired-ended 150-bp reads. ATAC-seq library generation and sequencing ATAC-seq libraries of germ cells were prepared as described 88 ; briefly, 10,000 A undiff , A diff , or P0 prospermatogonia (ProSG) were pooled from two independent mice as one replicate. Samples were lysed in 50 μl of lysis buffer (10 mM Tris–HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, and 0.1% NP-40, 0.1% Tween-20, and 0.01% Digitonin) on ice for 5 min. Immediately after lysis, the samples were spun at 500 × g for 10 min at 4°C, and the supernatant was removed. The sedimented nuclei were then incubated in 10 μl of transposition mix (0.5 μl homemade Tn5 transposase (∼1 μg/μl), 5 μl 2× tagment DNA buffer (10 mM Tris–HCl (pH 7.6), 10 mM MgCl2, and 20% dimethyl formamide), 3.3 μl PBS, 0.1 μl 1% digitonin, 0.1 μl 10% Tween-20, and 1 μl water) at 37°C for 30 min in a thermomixer with shaking at 500 rpm. After tagmentation, the transposed DNA was purified with a MinElute kit (Qiagen). Polymerase chain reaction (PCR) was performed to amplify the library using the following conditions: 72°C for 3 min; 98°C for 30 s; thermocycling at 98°C for 10 s, 60°C for 30 s, and 72°C for 1 min. Quantitative PCR was used to estimate the number of additional cycles needed to generate products at 25% saturation. Seven to eight additional PCR cycles were added to the initial set of five cycles. Amplified DNA was purified by 1.0x SPRIselect beads (Beckman Coulter). ATAC-seq libraries were sequenced on the HiSeq X Ten system with 150-bp paired-end reads. CUT&Tag library generation and sequencing CUT&Tag libraries of ctrl A undiff and ProSG for SMARCA5 were prepared as previously described (a step-by-step protocol https://www.protocols.io/view/bench-top-cut-amp-tag-kqdg34qdpl25/v3) using CUTANA™ pAG-Tn5 (Epicypher, 15-1017) 89 . Quantitative spike-in CUT&Tag for DMRT1 of Smarca5 -ctrl and cKO A undiff was performed by adding Drosophila S2 cells at a 1:5 ratio to mouse spermatogonial cells (5,000 S2 cells to 25,000 mouse cells) in each reaction. The antibodies used were rabbit anti-SMARCA5 (1/100) or rabbit anti-DMRT1 antibody (1/50). CUT&Tag libraries were sequenced on the Novaseq X Plus system with 150-bp paired-end reads. RNA-seq data processing Raw paired-end RNA-seq reads after trimming by Trim-galore (https://github.com/FelixKrueger/TrimGalore) (version 0.6.7) were aligned to the mouse (GRCm38/mm10) genome using STAR 90 (version STAR_2.5.4b) with following options: --outSAMtype BAM SortedByCoordinate; --twopassMode Basic; --outFilterType BySJout; --outFilterMultimapNmax 1; --winAnchorMultimapNmax 50; --alignSJoverhangMin 8; --alignSJDBoverhangMin 1; --outFilterMismatchNmax 999; --outFilterMismatchNoverReadLmax 0.04; --alignIntronMin 20; --alignIntronMax 1000000; --alignMatesGapMax 1000000 for unique alignments. To quantify aligned reads in RNA-seq, aligned read counts for each gene were generated using featureCounts 91 (v2.0.1), which is part of the Subread package based on annotated genes (gencode.vM25.annotation.gtf) 92 . The transcripts per million (TPM) values of each gene were used for comparative expression analyses and computing the Pearson correlation coefficient between biological replicates using corrplot. To detect differentially-expressed genes (DEGs) between Smarca5 -ctrl A undiff and Smarca5 -ctrl A diff , or Smarca5 -ctrl A undiff and Smarca5 -cKO A undiff , DESeq2 93 (version 1.42.1) was used for differential gene expression analyses with cutoffs ≥2-fold change and binomial tests (Padj < 0.05; P-values were adjusted for multiple testing using the Benjamini–Hochberg method). Padj values were used to determine significantly dysregulated genes. GO term analysis was performed using the website tool DAVID (https://david.ncifcrf.gov/home.jsp) 94,95 . GO term was visualized by ggplot2 (version 3.4.4) of the R package based on gene number, fold enrichment, and P value. A violin plot was drawn using the R package ggplot2. ATAC-seq and CUT&Tag data processing Raw paired-end ATAC-seq reads after trimming by Trim-galore were aligned to either the mouse (GRCm38/mm10) genomes using bowtie2 (version 2.3.3.1) 96 with default arguments. Raw paired-end CUT&Tag reads after trimming by Trim-galore were aligned to either the mouse (GRCm38/mm10) genomes using Bowtie2 (version 2.3.3.1) with options: –end-to-end –very-sensitive –no-mixed –no-discordant –phred33 -I 10 -X 700. All unmapped and non-uniquely mapped reads were filtered out by samtools (version 1.9) 97 before being subjected to downstream analyses. PCR duplicates were removed using the ‘MarkDuplicates’ command in Picard tools (version 2.23.8) (https://broadinstitute.github.io/picard/, Broad Institute). For CUT&Tag on DMRT1, D. melanogaster DNA delivered by Drosophila S2 cells was used as spike-in DNA, as described 89 . For mapping D. melanogaster spike-in fragments, we also aligned to either the D. melanogaster (dm6) genome using Bowtie2 and used the '–no-overlap –no-dovetail' options to avoid cross-mapping using Bowtie2. PCR duplicates were removed using the 'MarkDuplicates’ command in Picard tools. Spike-in normalization was implemented using the exogenous scaling factor computed from the dm6 mapping files (scale factors = 10000/spike-in reads for DMRT1 CUT&Tag). Biological replicates were pooled for visualization and other analyses after validation of reproducibility. Peak calling for ATAC-seq data was performed using MACS3 (version 3.0.0a7) 98 with the parameters: -g mm --nomodel --nolambda. Peak calling for CUT&Tag data was performed using MACS2 (version 2.2.7.1) with the parameters: -g mm. We computed the number of overlapping peaks between peak files using BEDtools (version 2.28.0) 99 function intersect. To detect genes adjacent to ATAC-seq and CUT&Tag peaks, we used the HOMER (version 4.9.1) 100 function annotatePeaks.pl. The deeptools was used to draw tag density plots and heatmaps for read enrichment. To visualize ATAC-seq and CUT&Tag data on SMARCA5 using the Integrative Genomics Viewer (Broad Institute) 101 , bins per million (BPM) normalized counts data were created from sorted BAM files using the deeptools. To visualize CUT&Tag data on DMRT1, spike-in normalized genome coverage tracks with 1 bp resolution in BigWig format were generated using ‘bamCoverage’ from deepTools (version 3.5.5) 102 with the parameters ‘--binSize 1 --extendReads --samFlagInclude 64 --normalizeUsing RPKM --scaleFactor $scale_factor’. AlphaFold3 modeling AlphaFold 3 57 was run using the AlphaFold web server (https://alphafoldserver.com). Two amino acid sequences translated from Hist1h2ao, Hist1h2bb , H3f3a , and Hist2h4 were used as inputs to form a histone core. The sequence of the 601 sequence with 60 bp of flanking DNA and DMRT1 motif sequence is as follows: 5’-CTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCTTGATACATTGTATCACAGCGACCTTGCCGGTGCCAGTCGGATAGTGTTCCGAGCTCCCACTCT-3’ ChimeraX (version 1.9) was used for visualization. ChIP-seq data reanalysis Raw single-end H3K27ac ChIP-seq data were downloaded from Gene Expression Omnibus (GEO) under accession no. GSE132446 and GSE242515. Fastq files of biological replicates were merged and then trimmed by Trim-galore. Trimmed reads were aligned to the mouse (mm10) and Drosophila (dm6), respectively, using bowtie2 (version 2.3.3.1) with the parameters: --very-sensitive --phred33. PCR duplicates were removed using the ‘MarkDuplicates’ command in Picard tools (version 2.23.8). Spike-in normalization was implemented using the exogenous scaling factor computed from the dm6 mapping files (scale factors = 1000000/spike-in reads). Deeptools of the bamCoverage program was used to generate spike-in normalized coverage tracks (bigwig format) with the parameters: --binSize 10 --normalizationUsing RPGC --extendReads --effectiveGenomeSize 2652783500 --scaleFactor $scaleFactor. Statistics Statistical methods and P values for each plot are listed in the Fig. legends and/or in the Methods. Next-generation sequencing data (RNA-seq, CUT&Tag) were based on two independent replicates. No statistical methods were used to predetermine sample size in these experiments. Experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessments. Declarations Acknowledgements We thank members of the Namekawa lab, Kanako Ikami, and Shosei Yoshida for stimulating discussions; Arthur I. Skoultchi for helping share Smarca5 F/F mice; Azim Surani for providing Stella -GFP transgenic mice; So Maezawa for the homemade Tn5 transposase for ATAC-seq; Kei-Ichiro Ishiguro for the MEIOSIN antibody; and David Zarkower for the DMRT1 antibody. We acknowledge the following funding sources: JSPS Overseas Challenge Program for Young Researchers, TOYOBO Biotechnology Foundation, and JSPS Overseas Research Fellowship to Y.K.; and NIH Grants K99HD116268 to Y.K., and R35GM141085 to S.H.N. Author contribution Y.K. and S.H.N. designed the study. Y.M. performed the RNA-seq experiments and ATAC-seq experiments. Y.K., Y.M., and M.H. performed the CUT&Tag experiments. Y.K., H.A., S.M., M.R., and S.P.K. performed staining experiments. H.A. performed Western blotting experiments. Y.K. performed the computational analysis, with the contribution from Y.M. Y.K. and S.O. performed structure prediction using AlphaFold3. Y.K., Y.M., H.A., M.H., S.O., D.J.P., R.M.S., and S.H.N. interpreted the results. D.J.P. provided the Smarca5 F/F mouse line. Y.K., R.M.S., and S.H.N. wrote the manuscript with critical feedback from all authors. S.H.N. supervised the project. Competing interest statement The authors declare no competing interests. Data availability RNA-seq data, ATAC-seq, and CUT&Tag datasets were deposited in the Gene Expression Omnibus under accession no. GSE303063. ChIP-seq data for H3K27ac in A undiff (THY1 + ) spermatogonia were downloaded from GSE130652. ChIP-seq data for H3K4me3 in A undiff spermatogonia were downloaded from GSE89502. CUT&Tag data for H3K27me3 and H2AK119ub in A undiff spermatogonia were downloaded from the GSE221944. ChIP-seq data for H3K27ac in male germline were downloaded from GSE132446 and GSE242515. RNA-seq data in the male germline were downloaded from GSE242515. ChIP-seq data for RAR in GS cells were downloaded from GSE1116798. ChIP-seq data for DMRT6 in adult testis were downloaded from GSE60440. Code availability Source code for all software and tools used in this study, with documentation, examples, and additional information, is available at the URLs listed above. References Reik, W. Stability and flexibility of epigenetic gene regulation in mammalian development. Nature 447 , 425-32 (2007). Atlasi, Y. & Stunnenberg, H.G. The interplay of epigenetic marks during stem cell differentiation and development. Nat Rev Genet 18 , 643-658 (2017). Madrigal, P. et al. Epigenetic and transcriptional regulations prime cell fate before division during human pluripotent stem cell differentiation. Nat Commun 14 , 405 (2023). Frank, C.L. et al. Regulation of chromatin accessibility and Zic binding at enhancers in the developing cerebellum. Nat Neurosci 18 , 647-56 (2015). Palfy, M., Schulze, G., Valen, E. & Vastenhouw, N.L. Chromatin accessibility established by Pou5f3, Sox19b and Nanog primes genes for activity during zebrafish genome activation. PLoS Genet 16 , e1008546 (2020). Maezawa, S., Yukawa, M., Alavattam, K.G., Barski, A. & Namekawa, S.H. Dynamic reorganization of open chromatin underlies diverse transcriptomes during spermatogenesis. Nucleic Acids Res 46 , 593-608 (2018). Griswold, M.D. Spermatogenesis: The Commitment to Meiosis. Physiol Rev 96 , 1-17 (2016). Nakagawa, T. et al. A multistate stem cell dynamics maintains homeostasis in mouse spermatogenesis. Cell Rep 37 , 109875 (2021). Yoshida, S. Heterogeneous, dynamic, and stochastic nature of mammalian spermatogenic stem cells. Curr Top Dev Biol 135 , 245-285 (2019). Sugimoto, R., Nabeshima, Y. & Yoshida, S. Retinoic acid metabolism links the periodical differentiation of germ cells with the cycle of Sertoli cells in mouse seminiferous epithelium. Mech Dev 128 , 610-24 (2012). Endo, T. et al. Periodic retinoic acid-STRA8 signaling intersects with periodic germ-cell competencies to regulate spermatogenesis. Proc Natl Acad Sci U S A 112 , E2347-56 (2015). Griswold, M.D. Cellular and molecular basis for the action of retinoic acid in spermatogenesis. J Mol Endocrinol 69 , T51-t57 (2022). Hasegawa, K. et al. SCML2 establishes the male germline epigenome through regulation of histone H2A ubiquitination. Dev Cell 32 , 574-88 (2015). Lin, Z. et al. SETD1B-mediated broad H3K4me3 controls proper temporal patterns of gene expression critical for spermatid development. Cell Res (2025). Ikami, K. et al. Hierarchical differentiation competence in response to retinoic acid ensures stem cell maintenance during mouse spermatogenesis. Development 142 , 1582-92 (2015). Lesch, B.J., Dokshin, G.A., Young, R.A., McCarrey, J.R. & Page, D.C. A set of genes critical to development is epigenetically poised in mouse germ cells from fetal stages through completion of meiosis. Proc Natl Acad Sci U S A 110 , 16061-6 (2013). Hammoud, S.S. et al. Chromatin and transcription transitions of mammalian adult germline stem cells and spermatogenesis. Cell Stem Cell 15 , 239-53 (2014). Sin, H.S., Kartashov, A.V., Hasegawa, K., Barski, A. & Namekawa, S.H. Poised chromatin and bivalent domains facilitate the mitosis-to-meiosis transition in the male germline. BMC Biol 13 , 53 (2015). Cheng, K. et al. Unique Epigenetic Programming Distinguishes Regenerative Spermatogonial Stem Cells in the Developing Mouse Testis. iScience 23 , 101596 (2020). Maezawa, S. et al. Super-enhancer switching drives a burst in gene expression at the mitosis-to-meiosis transition. Nat Struct Mol Biol 27 , 978-988 (2020). Kaye, E.G. et al. RNA polymerase II pausing is essential during spermatogenesis for appropriate gene expression and completion of meiosis. Nat Commun 15 , 848 (2024). Kitamura, Y. et al. CTCF-mediated 3D chromatin sets up the gene expression program in the male germline. Nat Struct Mol Biol (2025). Yi, C., Kitamura, Y., Maezawa, S., Namekawa, S.H. & Cairns, B.R. ZBTB16/PLZF regulates juvenile spermatogonial stem cell development through an extensive transcription factor poising network. Nat Struct Mol Biol (2025). Kitamura, Y. & Namekawa, S.H. Epigenetic priming in the male germline. Curr Opin Genet Dev 86 , 102190 (2024). Gioacchini, N. & Peterson, C.L. Chromatin remodeling: a complex affair. EMBO Rep 18 , 1673-1674 (2017). Wiechens, N. et al. The Chromatin Remodelling Enzymes SNF2H and SNF2L Position Nucleosomes adjacent to CTCF and Other Transcription Factors. PLoS Genet 12 , e1005940 (2016). Bomber, M.L. et al. Human SMARCA5 is continuously required to maintain nucleosome spacing. Mol Cell 83 , 507-522 e6 (2023). Cirillo, L.A. et al. Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol Cell 9 , 279-89 (2002). Zaret, K.S. & Carroll, J.S. Pioneer transcription factors: establishing competence for gene expression. Genes Dev 25 , 2227-41 (2011). Barral, A. & Zaret, K.S. Pioneer factors: roles and their regulation in development. Trends Genet 40 , 134-148 (2024). Zhang, T. & Zarkower, D. DMRT proteins and coordination of mammalian spermatogenesis. Stem Cell Res 24 , 195-202 (2017). Zarkower, D. & Murphy, M.W. DMRT1: An Ancient Sexual Regulator Required for Human Gonadogenesis. Sex Dev 16 , 112-125 (2022). Chong, S. et al. Modifiers of epigenetic reprogramming show paternal effects in the mouse. Nat Genet 39 , 614-22 (2007). Hermann, B.P. et al. The Mammalian Spermatogenesis Single-Cell Transcriptome, from Spermatogonial Stem Cells to Spermatids. Cell Rep 25 , 1650-1667 e8 (2018). Alvarez-Saavedra, M. et al. Snf2h-mediated chromatin organization and histone H1 dynamics govern cerebellar morphogenesis and neural maturation. Nat Commun 5 , 4181 (2014). Gallardo, T., Shirley, L., John, G.B. & Castrillon, D.H. Generation of a germ cell-specific mouse transgenic Cre line, Vasa-Cre. Genesis 45 , 413-7 (2007). Costoya, J.A. et al. Essential role of Plzf in maintenance of spermatogonial stem cells. Nat Genet 36 , 653-9 (2004). Ohbo, K. et al. Identification and characterization of stem cells in prepubertal spermatogenesis in mice. Dev Biol 258 , 209-25 (2003). Anderson, E.L. et al. Stra8 and its inducer, retinoic acid, regulate meiotic initiation in both spermatogenesis and oogenesis in mice. Proc Natl Acad Sci U S A 105 , 14976-80 (2008). Ishiguro, K.I. et al. MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. Dev Cell 52 , 429-445 e10 (2020). Hara, K. et al. Mouse spermatogenic stem cells continually interconvert between equipotent singly isolated and syncytial states. Cell Stem Cell 14 , 658-72 (2014). Nakagawa, T., Nabeshima, Y. & Yoshida, S. Functional identification of the actual and potential stem cell compartments in mouse spermatogenesis. Dev Cell 12 , 195-206 (2007). Scholzen, T. & Gerdes, J. The Ki-67 protein: from the known and the unknown. J Cell Physiol 182 , 311-22 (2000). Hu, M. et al. PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiation. Nucleic Acids Res 52 , 2306-2322 (2024). La, H.M. et al. Identification of dynamic undifferentiated cell states within the male germline. Nat Commun 9 , 2819 (2018). Aihara, T. et al. Cloning and mapping of SMARCA5 encoding hSNF2H, a novel human homologue of Drosophila ISWI. Cytogenet Cell Genet 81 , 191-3 (1998). Corces, M.R. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods 14 , 959-962 (2017). Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y. & Greenleaf, W.J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10 , 1213-8 (2013). Kaya-Okur, H.S. et al. CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat Commun 10 , 1930 (2019). Lei, N. et al. Sex-specific differences in mouse DMRT1 expression are both cell type- and stage-dependent during gonad development. Biol Reprod 77 , 466-75 (2007). Zhang, T., Oatley, J., Bardwell, V.J. & Zarkower, D. DMRT1 Is Required for Mouse Spermatogonial Stem Cell Maintenance and Replenishment. PLoS Genet 12 , e1006293 (2016). Matson, C.K. et al. The mammalian doublesex homolog DMRT1 is a transcriptional gatekeeper that controls the mitosis versus meiosis decision in male germ cells. Dev Cell 19 , 612-24 (2010). Zhang, T., Murphy, M.W., Gearhart, M.D., Bardwell, V.J. & Zarkower, D. The mammalian Doublesex homolog DMRT6 coordinates the transition between mitotic and meiotic developmental programs during spermatogenesis. Development 141 , 3662-71 (2014). Chen, Y. et al. Refined spatial temporal epigenomic profiling reveals intrinsic connection between PRDM9-mediated H3K4me3 and the fate of double-stranded breaks. Cell Res 30 , 256-268 (2020). Maezawa, S. et al. Polycomb protein SCML2 facilitates H3K27me3 to establish bivalent domains in the male germline. Proc Natl Acad Sci U S A 115 , 4957-4962 (2018). Lindeman, R.E. et al. The conserved sex regulator DMRT1 recruits SOX9 in sexual cell fate reprogramming. Nucleic Acids Res 49 , 6144-6164 (2021). Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630 , 493-500 (2024). Lowary, P.T. & Widom, J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J Mol Biol 276 , 19-42 (1998). Murphy, M.W., Zarkower, D. & Bardwell, V.J. Vertebrate DM domain proteins bind similar DNA sequences and can heterodimerize on DNA. BMC Mol Biol 8 , 58 (2007). Murphy, M.W. et al. An ancient protein-DNA interaction underlying metazoan sex determination. Nat Struct Mol Biol 22 , 442-51 (2015). Morales, C. & Griswold, M.D. Retinol-induced stage synchronization in seminiferous tubules of the rat. Endocrinology 121 , 432-4 (1987). van Pelt, A.M. & de Rooij, D.G. Synchronization of the seminiferous epithelium after vitamin A replacement in vitamin A-deficient mice. Biol Reprod 43 , 363-67 (1990). Mark, M. et al. STRA8-deficient spermatocytes initiate, but fail to complete, meiosis and undergo premature chromosome condensation. J Cell Sci 121 , 3233-42 (2008). Zhou, Q. et al. Expression of stimulated by retinoic acid gene 8 (Stra8) in spermatogenic cells induced by retinoic acid: an in vivo study in vitamin A-sufficient postnatal murine testes. Biol Reprod 79 , 35-42 (2008). Giguere, V., Ong, E.S., Segui, P. & Evans, R.M. Identification of a receptor for the morphogen retinoic acid. Nature 330 , 624-9 (1987). Kanatsu-Shinohara, M. et al. Long-term culture of mouse male germline stem cells under serum-or feeder-free conditions. Biol Reprod 72 , 985-91 (2005). Dodonova, S.O., Zhu, F., Dienemann, C., Taipale, J. & Cramer, P. Nucleosome-bound SOX2 and SOX11 structures elucidate pioneer factor function. Nature 580 , 669-672 (2020). Donovan, B.T. et al. Basic helix-loop-helix pioneer factors interact with the histone octamer to invade nucleosomes and generate nucleosome-depleted regions. Mol Cell 83 , 1251-1263 e6 (2023). Gong, W. et al. ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage. Nat Cell Biol 24 , 672-684 (2022). King, H.W. & Klose, R.J. The pioneer factor OCT4 requires the chromatin remodeller BRG1 to support gene regulatory element function in mouse embryonic stem cells. Elife 6 (2017). Hu, Y.C., de Rooij, D.G. & Page, D.C. Tumor suppressor gene Rb is required for self-renewal of spermatogonial stem cells in mice. Proc Natl Acad Sci U S A 110 , 12685-90 (2013). Kataruka, S. et al. SMARCA5 restricts chromatin accessibility to promote male meiosis and fertility in mammals. Proc Natl Acad Sci U S A 122 , e2422356122 (2025). Goodwin, L.O. et al. Large-scale discovery of mouse transgenic integration sites reveals frequent structural variation and insertional mutagenesis. Genome Res 29 , 494-505 (2019). Alavattam, K.G., Maezawa, S., Andreassen, P.R. & Namekawa, S.H. Meiotic sex chromosome inactivation and the XY body: a phase separation hypothesis. Cell Mol Life Sci 79 , 18 (2021). Broering, T.J. et al. BAZ1B is dispensable for H2AX phosphorylation on Tyrosine 142 during spermatogenesis. Biol Open 4 , 873-84 (2015). Li, P. et al. Priming Epigenetic Landscape at Gene Promoters through Transcriptional Activation in Mammalian Germ Cells. bioRxiv , 2024.11.24.625111 (2024). Maezawa, S. et al. PRC1 suppresses a female gene regulatory network to ensure testicular differentiation. Cell Death Dis 14 , 501 (2023). Suen, H.C. et al. The single-cell chromatin accessibility landscape in mouse perinatal testis development. Elife 12 (2023). Yamanaka, S. et al. Broad Heterochromatic Domains Open in Gonocyte Development Prior to De Novo DNA Methylation. Dev Cell 51 , 21-34 e5 (2019). Goertz, M.J., Wu, Z., Gallardo, T.D., Hamra, F.K. & Castrillon, D.H. Foxo1 is required in mouse spermatogonial stem cells for their maintenance and the initiation of spermatogenesis. J Clin Invest 121 , 3456-66 (2011). Sunkel, B.D. et al. Evidence of pioneer factor activity of an oncogenic fusion transcription factor. iScience 24 , 102867 (2021). Matson, C.K. et al. DMRT1 prevents female reprogramming in the postnatal mammalian testis. Nature 476 , 101-4 (2011). Liu, B. et al. Mapping putative enhancers in mouse oocytes and early embryos reveals TCF3/12 as key folliculogenesis regulators. Nat Cell Biol 26 , 962-974 (2024). Gassler, J. et al. Zygotic genome activation by the totipotency pioneer factor Nr5a2. Science 378 , 1305-1315 (2022). Li, L. et al. Multifaceted SOX2-chromatin interaction underpins pluripotency progression in early embryos. Science 382 , eadi5516 (2023). Soufi, A. et al. Pioneer transcription factors target partial DNA motifs on nucleosomes to initiate reprogramming. Cell 161 , 555-568 (2015). Payer, B. et al. Generation of stella-GFP transgenic mice: a novel tool to study germ cell development. Genesis 44 , 75-83 (2006). Munakata, Y. et al. Chromatin remodeler CHD4 establishes chromatin states required for ovarian reserve formation, maintenance and male germ cell survival. Nucleic Acids Res 53 (2025). Hu, M. & Namekawa, S.H. Quantitative CUT&Tag for Epigenomic Profiling of Mouse Germ Cells. Methods Mol Biol 2954 , 27-47 (2025). Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29 , 15-21 (2013). Liao, Y., Smyth, G.K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30 , 923-30 (2014). Frankish, A. et al. GENCODE reference annotation for the human and mouse genomes. Nucleic Acids Res 47 , D766-D773 (2019). Love, M.I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15 , 550 (2014). Huang da, W., Sherman, B.T. & Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4 , 44-57 (2009). Sherman, B.T. et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res 50 , W216-W221 (2022). Langmead, B. & Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9 , 357-9 (2012). Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25 , 2078-9 (2009). Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol 9 , R137 (2008). Quinlan, A.R. & Hall, I.M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26 , 841-2 (2010). Heinz, S. et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38 , 576-89 (2010). Robinson, J.T. et al. Integrative genomics viewer. Nat Biotechnol 29 , 24-6 (2011). Ramirez, F., Dundar, F., Diehl, S., Gruning, B.A. & Manke, T. deepTools: a flexible platform for exploring deep-sequencing data. Nucleic Acids Res 42 , W187-91 (2014). Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryTable1.xlsx Supplementary Table_1 SupplementaryTable2.xlsx Supplementary Table_2 SupplementaryTable3.xlsx Supplementary Table_3 SupplementaryTable4.xlsx Supplementary Table_4 SupplementaryTable5.xlsx Supplementary Table_5 SupplementaryTable6.xlsx Supplementary Table_6 090925ExtendedFigs.pdf ExtendedDataFigs SupplementaryVideo1Dmrt1.mp4 Supplementary Video_1 SupplementaryVideo2DMRT1SMARCA5.mp4 Supplementary Video_2 Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7576931\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":515949995,\"identity\":\"1ecc59ca-6bbd-4d3b-998c-49a23f25dda9\",\"order_by\":0,\"name\":\"Yuka Kitamura\",\"email\":\"\",\"orcid\":\"https://orcid.org/0009-0001-7403-0902\",\"institution\":\"University of California, Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuka\",\"middleName\":\"\",\"lastName\":\"Kitamura\",\"suffix\":\"\"},{\"id\":515949996,\"identity\":\"a1e879cd-bee5-4417-9493-d72e43bf33e9\",\"order_by\":1,\"name\":\"Yasuhisa Munakata\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of California, Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yasuhisa\",\"middleName\":\"\",\"lastName\":\"Munakata\",\"suffix\":\"\"},{\"id\":515949997,\"identity\":\"8bc59ce0-06bf-42e6-9f28-0b7665ade3ba\",\"order_by\":2,\"name\":\"Hironori Abe\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of California Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hironori\",\"middleName\":\"\",\"lastName\":\"Abe\",\"suffix\":\"\"},{\"id\":515949998,\"identity\":\"2c328293-01ac-421e-a964-42a0af7077a6\",\"order_by\":3,\"name\":\"Mengwen Hu\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-7480-6432\",\"institution\":\"University of California, Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mengwen\",\"middleName\":\"\",\"lastName\":\"Hu\",\"suffix\":\"\"},{\"id\":515949999,\"identity\":\"3891cfa5-f3a2-4e78-bec6-4467df687c21\",\"order_by\":4,\"name\":\"Satoyo Oya\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of California Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Satoyo\",\"middleName\":\"\",\"lastName\":\"Oya\",\"suffix\":\"\"},{\"id\":515950000,\"identity\":\"2d3c5594-a024-48c1-a9b1-5b999ee296e2\",\"order_by\":5,\"name\":\"Shanmathi Murugesan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of California Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shanmathi\",\"middleName\":\"\",\"lastName\":\"Murugesan\",\"suffix\":\"\"},{\"id\":515950001,\"identity\":\"46c96714-bb49-4517-b105-042efd82d0cd\",\"order_by\":6,\"name\":\"Mahnoor Rizwan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of California Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mahnoor\",\"middleName\":\"\",\"lastName\":\"Rizwan\",\"suffix\":\"\"},{\"id\":515950002,\"identity\":\"d1248646-7ca7-482a-bdc1-b7b35b271f27\",\"order_by\":7,\"name\":\"Shawna Katz\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of California Davis\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shawna\",\"middleName\":\"\",\"lastName\":\"Katz\",\"suffix\":\"\"},{\"id\":515950003,\"identity\":\"5795c213-d6bb-4ff8-b19f-2e15db87fa74\",\"order_by\":8,\"name\":\"David Picketts\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-9227-2016\",\"institution\":\"Ottawa Hospital Research Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"David\",\"middleName\":\"\",\"lastName\":\"Picketts\",\"suffix\":\"\"},{\"id\":515950004,\"identity\":\"14a102ea-3bc3-44c8-9869-ada7e3763d1e\",\"order_by\":9,\"name\":\"Richard Schultz\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-5923-6825\",\"institution\":\"University of Pennsylvania\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Richard\",\"middleName\":\"\",\"lastName\":\"Schultz\",\"suffix\":\"\"},{\"id\":515949994,\"identity\":\"6ce47ae8-6bc9-4ca5-aacc-5f67c4e8d49f\",\"order_by\":10,\"name\":\"Satoshi Namekawa\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYNCCA0DM3sDAwANGDAwSxGnhOUCyFokEqHpCWuRnNz/d8OGMXWL/zDeGH97UHJaRb2A+eJsHjxaDO8fMbs64kZw443aOseScY4d5DA6wJVvj1SKRYHab5wNzbsPtHDNmHrY0HgMGHjNpfFrkZ6R/u/3nQ33u/JtngFr+pfHIN/B/w6uF4UaO2W2GG4dzN9zgMWPmbbPhYTjAw4ZXi8GNnLKbPWeO1288k1YsObfPhsfgMJux5Rz8Dtt248examO544c3fnjzTcJevr354Y03+ByGCZhJUz4KRsEoGAWjAAsAAACxUA5ZDSIXAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0002-1052-943X\",\"institution\":\"University of California Davis\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Satoshi\",\"middleName\":\"\",\"lastName\":\"Namekawa\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-09-09 20:25:47\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7576931/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7576931/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":93019309,\"identity\":\"ed5668b1-77b6-440b-a36c-67e5db72ff6d\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:38:12\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3567057,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSMARCA5 is required for spermatogonial differentiation.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eSchematic of the stages of mouse spermatogenesis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eb. \\u003c/strong\\u003eTimeline and genotype of the \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO used in this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec.\\u003c/strong\\u003e Image of testes from a \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mouse and a control littermate at 2 months of age. Scale bar, 5 mm. The lower graph shows the testis-to-body weight ratio (mg/g), calculated as the average weight of one testis divided by body weight. Individual data points from each mouse are shown as dots. Error bars represent mean ± standard deviation (s.d.). Statistical significance was assessed using a two-tailed unpaired Student’s t-test with equal variances (n = 3–5 per group).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ed. \\u003c/strong\\u003eTestis section of \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO and control littermate at 2 months, stained with hematoxylin and eosin. Scare bars, 100 μm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ee. \\u003c/strong\\u003eImmunofluorescence staining of testis sections from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO and control littermate at 2 months using DAPI and antibodies against DDX4 (germ cell marker) and GATA4 (Sertoli cell marker). Scare bars, 100 μm. The graph shows the number of DDX4⁺ cells per tubule cross-section (19 sections counted per sample). Individual data points represent values from individual mice. Error bars indicate mean ± s.d. Statistical significance was determined by a two-tailed unpaired Student’s t-test assuming equal variances (n = 3 per group).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ef. \\u003c/strong\\u003eImmunofluorescence staining of testis sections from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO and control littermates at P10 using DAPI and antibodies against ZBTB16 (undifferentiated spermatogonia marker) and KIT (differentiating spermatogonia marker). Asterisks indicate tubule cross-sections containing ZBTB16⁻/KIT⁺ cells, which are marked with arrows. Scale bars, 100 μm. The graph shows the percentage of tubule cross-sections containing ZBTB16⁻/KIT⁺ cells (≥50 cross-sections counted per sample). Individual values represent biological replicates. Error bars indicate mean ± s.d. Statistical significance was determined using a two-tailed unpaired Student’s t-test assuming equal variances (n = 3 per group).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eg. \\u003c/strong\\u003eSummary of the phenotype observed in juvenile \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mice.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/278800bc9719010b4e4da8e4.png\"},{\"id\":93019022,\"identity\":\"33a3b1fc-6344-4eea-a67a-32a49de2c3a0\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:30:12\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2431671,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSMARCA5 is required for spermatogonial maintenance in the adult testis.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eTestis sections of \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO and control littermate stained with DAPI and antibodies against ZBTB16 and GATA4 at P7, 2 weeks (2w), 3 weeks (3w), 4 weeks (4w), and 6 weeks (6w). Scare bars, 100 μm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eb. \\u003c/strong\\u003eQuantification of ZBTB16⁺ cells per tubule cross-section. At least 30 tubule cross-sections were counted per sample. Error bars represent mean ± standard deviation (s.d.). Statistical significance was determined using a two-tailed unpaired Student’s t-test assuming equal variances (n = 3 per group).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec. \\u003c/strong\\u003eProportion of tubule cross-sections containing ZBTB16⁺ cells. Error bars represent mean ± s.d. Statistical significance was determined using a two-tailed unpaired Student’s t-test assuming equal variances (n = 3 per group).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ed. \\u003c/strong\\u003eLeft: Schematic overview of the experimental workflow for isolating A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e. Right: FACS profiles showing sorting of A\\u003csub\\u003eundiff\\u003c/sub\\u003e (green gate) and A\\u003csub\\u003ediff\\u003c/sub\\u003e (pink gate) populations from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-control and -cKO testes.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ee. \\u003c/strong\\u003eTranscriptome comparison between\\u003cem\\u003e Smarca5\\u003c/em\\u003e-ctrl and cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e. Differentially expressed genes (DEGs) are defined as those with Log\\u003csub\\u003e2\\u003c/sub\\u003e fold change \\u0026gt; 2, \\u003cem\\u003ePadj\\u003c/em\\u003e \\u0026lt; 0.05, based on a binomial test with Benjamini-Hochberg correction.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ef. \\u003c/strong\\u003eTUNEL staining of testis sections from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO and control littermates at 2 weeks. TUNEL⁺ cells are indicated by arrows. Scare bars, 100 μm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eg. \\u003c/strong\\u003eHeatmap showing gene expression of representative A\\u003csub\\u003eundiff \\u003c/sub\\u003emarkers in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ectrl and cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e. *: \\u003cem\\u003ePadj\\u003c/em\\u003e \\u0026lt; 0.05, **: \\u003cem\\u003ePadj\\u003c/em\\u003e \\u0026lt; 0.05 and Log\\u003csub\\u003e2\\u003c/sub\\u003e fold change \\u0026gt; 1.\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/57984b5f98a363cfc843b40b.png\"},{\"id\":93017854,\"identity\":\"5a7dfb19-24d6-4cd7-902e-2b53718cf24b\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":693428,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSMARCA5 directly promotes chromatin accessibility at its binding sites, predominantly at distal regulatory regions.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eNumbers and genomic distribution of ATAC-seq peaks in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eb. \\u003c/strong\\u003eNumbers and genomic distribution of SMARCA5 CUT\\u0026amp;Tag peaks in A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec. \\u003c/strong\\u003eHeatmaps and average tag density plots showing ATAC enrichment in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e at promoter regions (top) and distal SMARCA5-binding peaks\\u003csub\\u003e \\u003c/sub\\u003e(bottom).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ed. \\u003c/strong\\u003eHeatmaps and average tag density plots showing SMARCA5 enrichment at \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl-specific ATAC peaks or \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO-specific ATAC peaks.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ee. \\u003c/strong\\u003eHOMER known motif analyses of ATAC-seq peaks at \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl-specific, cKO-specific, and common sites.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/3b97d62f98254fb56ec4c69e.png\"},{\"id\":93017856,\"identity\":\"bb34280d-d09e-48a4-a8a7-66be25b4ec18\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1474095,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSMARCA5 establishes chromatin accessibility at DMRT1-binding sites.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eNumber and genomic distribution of DMRT1 CUT\\u0026amp;Tag peaks in A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eb. \\u003c/strong\\u003eHeatmaps showing DMRT1 CUT\\u0026amp;Tag and ATAC enrichment in\\u003cem\\u003e Smarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e and\\u003cem\\u003e Smarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e at promoter regions and distal DMRT1-binding peaks.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec, d.\\u003c/strong\\u003e Heatmaps showing enrichment of the indicated factors (DMRT1, SMARCA5, H3K4me1, H3K27ac, H3K4me3, H3K27me3, and H2AK119ub) in A\\u003csub\\u003eundiff\\u003c/sub\\u003e at promoter regions and distal DMRT1-binding peaks (\\u003cstrong\\u003ec\\u003c/strong\\u003e) or distal SMARCA5-binding peaks (\\u003cstrong\\u003ed\\u003c/strong\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ee, f. \\u003c/strong\\u003eTrack view of \\u003cem\\u003eZbtb16\\u003c/em\\u003e (\\u003cstrong\\u003ee\\u003c/strong\\u003e)\\u003cem\\u003e \\u003c/em\\u003eand\\u003cem\\u003e Dmrt1 \\u003c/em\\u003e(\\u003cstrong\\u003ef\\u003c/strong\\u003e) gene loci showing ATAC peaks in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO A\\u003csub\\u003eundiff \\u003c/sub\\u003eand CUT\\u0026amp;Tag profiles for SMARCA5 and DMRT1 in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e. Regions with reduced ATAC signal upon \\u003cem\\u003eSmarca5\\u003c/em\\u003e deletion—corresponding to a putative enhancer of \\u003cem\\u003eZbtb16\\u003c/em\\u003e (\\u003cstrong\\u003ee\\u003c/strong\\u003e) and the \\u003cem\\u003eDmrt1 \\u003c/em\\u003epromoter (\\u003cstrong\\u003ef\\u003c/strong\\u003e)—are highlighted in yellow.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/2c21587a9d2e6d7e635a36c2.png\"},{\"id\":93017858,\"identity\":\"adc884e4-0c41-4176-bb52-6f6e7fe4c26c\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1929361,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSMARCA5 is recruited to distal regions of DMRT1-binding sites during the transition from ProSG to A\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003eundiff\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003e.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea. \\u003c/strong\\u003eNumber and genomic distribution of ATAC peaks in P0 ProSG.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eb. \\u003c/strong\\u003eHeatmap of k-means clustering showing progressive gain of chromatin accessibility from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec. \\u003c/strong\\u003eNumber and genomic distribution of ATAC-seq peaks in P0 ProSG and P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ed. \\u003c/strong\\u003eHeatmaps showing enrichment of H3K4me1, H3K27ac, and H3K4me3 in A\\u003csub\\u003eundiff\\u003c/sub\\u003e at promoter regions and distal peaks of de novo accessible region acquired during the ProSG-to-A\\u003csub\\u003eundiff\\u003c/sub\\u003e transition.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ee. \\u003c/strong\\u003eSchematic model illustrating potential mechanisms underlying chromatin state changes during the ProSG-to-A\\u003csub\\u003eundiff \\u003c/sub\\u003etransition.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ef, h.\\u003c/strong\\u003e Left: Venn diagram comparing ATAC-seq peaks (\\u003cstrong\\u003ef\\u003c/strong\\u003e) and SMARCA5 peaks (\\u003cstrong\\u003ef\\u003c/strong\\u003e) in ProSG and A\\u003csub\\u003eundiff\\u003c/sub\\u003e. Right: HOMER known motif analysis of A\\u003csub\\u003eundiff\\u003c/sub\\u003e-specific ATAC-seq peaks (\\u003cstrong\\u003ef\\u003c/strong\\u003e) and SMARCA5 peaks (\\u003cstrong\\u003eh\\u003c/strong\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eg, i\\u003c/strong\\u003e. Heatmaps showing ATAC enrichment (\\u003cstrong\\u003eg\\u003c/strong\\u003e) and SMARCA5 enrichment (\\u003cstrong\\u003ei\\u003c/strong\\u003e) at promoter regions and distal DMRT1-binding peaks identified in A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ej, k.\\u003c/strong\\u003e Heatmaps showing ATAC enrichment (\\u003cstrong\\u003ej\\u003c/strong\\u003e) and SMARCA5 enrichment (\\u003cstrong\\u003ek\\u003c/strong\\u003e) at SMARCA5-binding sites that do not overlap with DMRT1-binding sites in A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/1beb4b498e6f35827a5833c6.png\"},{\"id\":93019026,\"identity\":\"6df89cbc-9cc0-42f6-ba05-89fbdff2377b\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:30:12\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3340918,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe SMARCA5-DMRT1 pioneering complex establishes chromatin accessibility.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea.\\u003c/strong\\u003e Heatmaps showing DMRT1 CUT\\u0026amp;Tag signal in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e-at promoter regions and distal DMRT1-binding peaks identified in A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eb.\\u003c/strong\\u003e Heatmaps showing ATAC-seq and DMRT1 enrichment in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e at ATAC peaks specific to \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e. Signal intensities (bar plots below the heatmaps) are normalized using BPM (Bins Per Million mapped reads) for ATAC-seq and RPKM (Reads Per Kilobase per Million mapped reads) for DMRT1 CUT\\u0026amp;Tag.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec-f.\\u003c/strong\\u003e Structural predictions of DMRT1–nucleosome (\\u003cstrong\\u003ec, d\\u003c/strong\\u003e) and DMRT1–SMARCA5–nucleosome (\\u003cstrong\\u003ee, f\\u003c/strong\\u003e) interactions using AF3. To compare the distance between the histone core and DNA, the region of DNA furthest from the histone core is marked with a red dotted line in (\\u003cstrong\\u003ed\\u003c/strong\\u003e). In (\\u003cstrong\\u003ef\\u003c/strong\\u003e), red arrows indicate the displacement of DNA in the presence of SMARCA5, suggesting chromatin loosening upon complex formation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/a62297637d96ef26d7e879d5.png\"},{\"id\":93017863,\"identity\":\"1e6dcafd-8baa-434f-80be-4e53fe62f3a2\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1984293,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSMARCA5 shapes chromatin states that enable retinoic acid responsiveness.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ea, b.\\u003c/strong\\u003e Heatmaps showing SMARCA5 and DMRT1 enrichment (\\u003cstrong\\u003ea\\u003c/strong\\u003e), and ATAC enrichment (\\u003cstrong\\u003eb\\u003c/strong\\u003e) at RAR binding sites identified in GS cells (n = 4,607).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ec.\\u003c/strong\\u003e Track views of the \\u003cem\\u003eStra8\\u003c/em\\u003e and \\u003cem\\u003eRec8\\u003c/em\\u003e loci showing ATAC-seq signals, CUT\\u0026amp;Tag profiles for SMARCA5 and DMRT1, and RAR ChIP-seq signals.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ed.\\u003c/strong\\u003e Heatmap showing H3K27ac enrichment at \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl-specific ATAC peaks (n=7,701) during spermatogenesis, from A\\u003csub\\u003eundiff\\u003c/sub\\u003e to round spermatids. Developmental stages: A1, Type A1 spermatogonia; TypeB, Type B spermatogonia; pL, preleptotene; L, leptotene; mP, mid-pachytene; D, diplotene; R2, steps 1–2 round spermatids; R4, steps 3–4; R8, steps 7–8. Arrows below the A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A1 panels indicate the absence of H3K27ac peaks at the center of ATAC-seq peaks.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ee.\\u003c/strong\\u003e Violin plots of RNA-seq expression (log\\u003csub\\u003e10 \\u003c/sub\\u003e(TPM+1)) for genes associated with \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl-specific ATAC peak regions (n = 5,356). Z: zygotene spermatocytes. \\u003cstrong\\u003ef.\\u003c/strong\\u003e Model summarizing SMARCA5 functions during the transition from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e. SMARCA5 cooperates with DMRT1 to prime gene regulatory elements during the transition from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e and is essential for establishing a permissive chromatin environment for subsequent RAR recruitment. By doing so, SMARCA5 licenses transcriptional responses to retinoic acid (RA) that enable spermatogenic differentiation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/42ba1e59ee5788ad77ca4bc1.png\"},{\"id\":94225541,\"identity\":\"d0bf79fc-e558-42ea-abe3-b4fd4139e3fd\",\"added_by\":\"auto\",\"created_at\":\"2025-10-23 19:30:46\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":18988258,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/91bc7f0e-134b-41f4-87f5-16a3e2599c2f.pdf\"},{\"id\":93017860,\"identity\":\"53557563-045f-4963-b0cb-550cd691c9f7\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"xlsx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":5577645,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Table_1\",\"description\":\"\",\"filename\":\"SupplementaryTable1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/2af944e038108dba0cb64d8d.xlsx\"},{\"id\":93017865,\"identity\":\"7120fed8-8878-465b-97f5-392e7189f263\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"xlsx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":5561460,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Table_2\",\"description\":\"\",\"filename\":\"SupplementaryTable2.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/7ada9e0cb41fb32db475418a.xlsx\"},{\"id\":93019024,\"identity\":\"bb9858c7-848e-4d99-870a-ba87dd3142ca\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:30:12\",\"extension\":\"xlsx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":11743637,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Table_3\",\"description\":\"\",\"filename\":\"SupplementaryTable3.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/71d4c3bdffe8603f342f2090.xlsx\"},{\"id\":93017866,\"identity\":\"eeee4572-2f5d-4160-80dc-2b1d09b8086e\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"xlsx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":9742771,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Table_4\",\"description\":\"\",\"filename\":\"SupplementaryTable4.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/c9a8c9d8f421494c5385eb4a.xlsx\"},{\"id\":93017862,\"identity\":\"9117f776-70af-4abb-8fe6-f1f9d1d6917b\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"xlsx\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":5917080,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Table_5\",\"description\":\"\",\"filename\":\"SupplementaryTable5.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/0b1aeda58b0514100be2158a.xlsx\"},{\"id\":93019310,\"identity\":\"89b02dce-21d7-43e2-b6ea-b88801f79d11\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:38:12\",\"extension\":\"xlsx\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10421,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Table_6\",\"description\":\"\",\"filename\":\"SupplementaryTable6.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/e487bc7e5052959561e6819b.xlsx\"},{\"id\":93017868,\"identity\":\"c495323e-a716-42da-b6f9-d62f27cebf4b\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"pdf\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":5857929,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExtendedDataFigs\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"090925ExtendedFigs.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/9fc3865d17a7fbc549d7e809.pdf\"},{\"id\":93017870,\"identity\":\"07a793e1-1cfb-4d9b-a3d2-788792f26186\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"mp4\",\"order_by\":8,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":10461569,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Video_1\",\"description\":\"\",\"filename\":\"SupplementaryVideo1Dmrt1.mp4\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/b295a9c125cd643b42e36bdf.mp4\"},{\"id\":93017869,\"identity\":\"63b93f56-7ee4-4a94-8b87-d0df939b5c25\",\"added_by\":\"auto\",\"created_at\":\"2025-10-08 08:22:12\",\"extension\":\"mp4\",\"order_by\":9,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":16387390,\"visible\":true,\"origin\":\"\",\"legend\":\"Supplementary Video_2\",\"description\":\"\",\"filename\":\"SupplementaryVideo2DMRT1SMARCA5.mp4\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7576931/v1/c82e4dc7701cff6e3d7a69da.mp4\"}],\"financialInterests\":\"There is \\u003cb\\u003eNO\\u003c/b\\u003e Competing Interest.\",\"formattedTitle\":\"The SMARCA5–DMRT1 Pioneer Complex Establishes Epigenetic Priming to Direct Male Germline Development\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe establishment of distinct cellular identities from a shared genetic blueprint requires selective activation of lineage-specific genes and repression of alternative transcriptional programs.\\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e This process is tightly regulated by epigenetic mechanisms, including chromatin remodeling and histone modifications\\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e. Emerging evidence suggests that developmental enhancers often acquire accessible chromatin states prior to gene activation, indicating that chromatin preconfiguration can prime regulatory elements for future transcription\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR5\\\" citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. However, how such epigenetic priming intersects with differentiation cues\\u0026mdash;particularly external signals\\u0026mdash;to direct gene expression programs during development remains poorly understood. Spermatogenesis offers a powerful and experimentally tractable model to investigate this question.\\u003c/p\\u003e\\u003cp\\u003eSpermatogenesis is a highly ordered differentiation process driven by a germline stem cell system that supports unidirectional cell differentiation to produce haploid sperm\\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e. This process is maintained by the balanced self-renewal and differentiation of spermatogonial stem cells (SSCs), which reside in a heterogeneous population of slow-cycling, undifferentiated type A spermatogonia (A\\u003csub\\u003eundiff\\u003c/sub\\u003e, including A\\u003csub\\u003esingle\\u003c/sub\\u003e, A\\u003csub\\u003epaired,\\u003c/sub\\u003e and A\\u003csub\\u003ealigned\\u003c/sub\\u003e spermatogonia, Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA)\\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. Spermatogenic differentiation is orchestrated by retinoic acid (RA) signaling\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR11\\\" citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e and characterized by dramatic changes in gene expression and epigenetic remodeling\\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. In response to RA signaling, A\\u003csub\\u003eundiff\\u003c/sub\\u003e undergo irreversible commitment to become fast-cycling, KIT\\u003csup\\u003e+\\u003c/sup\\u003e differentiating spermatogonia (designated A1, A2, A3, A4, intermediate (In), and B spermatogonia), which lack stem cell potential\\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. These spermatogonia undergo a series of mitotic divisions before entering meiosis, ultimately leading to spermiogenesis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). Notably, many genes required for later stages of germ cell differentiation are epigenetically primed in undifferentiated spermatogonia prior to their activation\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR17 CR18 CR19 CR20 CR21 CR22\\\" citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e. This finding suggests that epigenetic priming plays a critical role in facilitating RA-responsive transcriptional programs\\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. Nevertheless, a key unresolved question remains: when and how is epigenetic priming established during the developmental progression that gives rise to undifferentiated spermatogonia?\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eChromatin accessibility is regulated by two key classes of factors: ATP-dependent chromatin remodelers and pioneer transcription factors. ISWI family remodelers, including SMARCA5 (also known as SNF2H), reposition nucleosomes to generate chromatin environments permissive for transcription factor binding and gene activation\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR26\\\" citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. In contrast, pioneer transcription factors can engage their DNA motifs within closed chromatin and initiate local chromatin opening, often enabling recruitment of additional regulatory machinery\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. Current models posit that pioneer factors recognize nucleosome-occupied target sites and subsequently recruit chromatin remodelers to establish fully-accessible chromatin states\\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e. Although this paradigm is supported by biochemical and \\u003cem\\u003ein vitro\\u003c/em\\u003e cellular reprogramming studies, the \\u003cem\\u003ein vivo\\u003c/em\\u003e relevance and developmental context of this cooperation remain largely unexplored.\\u003c/p\\u003e\\u003cp\\u003eHere, we demonstrate that SMARCA5 cooperates with the transcription factor DMRT1, a critical regulator of male germline development\\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e, to establish chromatin accessibility during the perinatal transition from prospermatogonia (also known as gonocytes) to undifferentiated spermatogonia. We show that SMARCA5 is recruited to DMRT1-bound distal regulatory elements and promoters of germline genes and is essential for generating chromatin accessibility at these regions. Despite DMRT1\\u0026rsquo;s intrinsic ability to bind closed chromatin, SMARCA5 is required to remodel these regions into accessible states that enable transcriptional activation of genes critical for spermatogonial maintenance and RA-induced differentiation. These findings uncover a chromatin remodeling mechanism driven by a pioneer complex that enables the external signal-dependent activation of transcriptional programs essential for spermatogenic differentiation.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eSmarca5\\u003c/b\\u003e \\u003cb\\u003eknockout in male germ cells causes a complete loss of spermatogonia\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo understand how chromatin is primed early in development to support subsequent differentiation, we sought to identify chromatin remodeling mechanisms critical for spermatogenesis. We focused on SMARCA5, which was previously identified in a genetic screen as a key regulator of paternal epigenetic inheritance\\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e. To examine its expression during postnatal spermatogenesis, we reanalyzed single-cell RNA sequencing (scRNA-seq) data\\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e and found that \\u003cem\\u003eSmarca5\\u003c/em\\u003e mRNA is highly expressed from A\\u003csub\\u003eundiff\\u003c/sub\\u003e through to post-meiotic round spermatids (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). Consistent with \\u003cem\\u003eSmarca5\\u003c/em\\u003e mRNA expression, SMARCA5 protein was present throughout these stages as well, with particularly high accumulation in A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec).\\u003c/p\\u003e\\u003cp\\u003eTo investigate the role of SMARCA5 in male germ cells, we generated \\u003cem\\u003eSmarca5\\u003c/em\\u003e conditional knockout (\\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO) mice by crossing mice carrying a \\u003cem\\u003eSmarca5\\u003c/em\\u003e floxed allele\\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e and a germ cell-specific \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre transgene, which is expressed from embryonic day 15 (E15)\\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). At postnatal day 7 (P7), nearly complete loss of SMARCA5 protein was confirmed in the cKO testis by Western blotting (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed), and germ cell-specific depletion of SMARCA5 protein was further confirmed by SMARCA5 immunostaining (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ee). Starting at postnatal day 14 (P14), \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mice exhibited reduced testicular size compared to littermate controls (\\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl), which carry one deleted and one functional \\u003cem\\u003eSmarca5\\u003c/em\\u003e allele. This reduction became more pronounced and was clearly evident by 2 months of age (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). At this stage, the seminiferous tubules in the \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testis were atrophic and devoid of spermatocytes or spermatids (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed). The absence of germ cells was further confirmed by immunostaining using the germ cell marker DDX4 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ee). These results indicate that SMARCA5 is essential for spermatogenesis and suggest that the protein is required for both maintenance of spermatogonia and differentiation of male germ cells.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eSMARCA5 is required for spermatogonial differentiation\\u003c/h2\\u003e\\u003cp\\u003eBecause \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes lack differentiating germ cells, we next investigated whether SMARCA5 is required for the irreversible commitment of A\\u003csub\\u003eundiff\\u003c/sub\\u003e to KIT\\u003csup\\u003e+\\u003c/sup\\u003e differentiating spermatogonia. At postnatal day 10 (P10), when the first-wave spermatogenesis normally reaches the KIT\\u003csup\\u003e+\\u003c/sup\\u003e differentiating spermatogonia stage, \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes contained cells positive for an A\\u003csub\\u003eundiff\\u003c/sub\\u003e marker ZBTB16 (also known as PLZF), indicating the presence of A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ef). In contrast, KIT\\u003csup\\u003e+\\u003c/sup\\u003e differentiating spermatogonia were largely absent in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ef). Notably, at P10, \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testis largely lacked late differentiating spermatogonia (In and B spermatogonia), characterized by a ZBTB16\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003eKIT\\u003csup\\u003e+\\u003c/sup\\u003e profile\\u003csup\\u003e37,38\\u003c/sup\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ef).\\u003c/p\\u003e\\u003cp\\u003eTo further pinpoint the developmental timing of spermatogonia depletion in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes, we next examined samples at the earlier stage of P7. During normal spermatogonial development, ZBTB16 is present in early KIT\\u003csup\\u003e+\\u003c/sup\\u003e differentiating spermatogonia (A\\u003csub\\u003e1\\u003c/sub\\u003e, A\\u003csub\\u003e2\\u003c/sub\\u003e, A\\u003csub\\u003e3\\u003c/sub\\u003e, and A\\u003csub\\u003e4,\\u003c/sub\\u003e termed differentiating Type A spermatogonia: A\\u003csub\\u003ediff\\u003c/sub\\u003e), which have already committed to irreversible differentiation. In \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes at P7, ZBTB16\\u003csup\\u003e+\\u003c/sup\\u003eKIT\\u003csup\\u003e+\\u003c/sup\\u003e A\\u003csub\\u003ediff\\u003c/sub\\u003e were markedly reduced, and late-stage ZBTB16\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003eKIT\\u003csup\\u003e+\\u003c/sup\\u003e differentiating spermatogonia were nearly absent, similar to P10. In contrast, the proportion of ZBTB16\\u003csup\\u003e+\\u003c/sup\\u003eKIT\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e A\\u003csub\\u003eundiff\\u003c/sub\\u003e was increased compared to littermate \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl testes (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). Thus, we conclude that SMARCA5 is required for spermatogonial differentiation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eg). Supporting this conclusion, we observed that meiosis is not initiated in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes, as preleptotene spermatocyte markers STRA8\\u003csup\\u003e39\\u003c/sup\\u003e and MEIOSIN\\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e were absent (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eSMARCA5 is required for SSC maintenance in the adult testis\\u003c/h3\\u003e\\n\\u003cp\\u003eThe complete absence of germ cells by 2 months of age suggested that maintenance of A\\u003csub\\u003eundiff\\u003c/sub\\u003e is ultimately impaired in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testis. Indeed, the number of ZBTB16\\u003csup\\u003e+\\u003c/sup\\u003e spermatogonia decreased significantly between 4 and 6 weeks (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea, b), and during this period, tubules lacking ZBTB16\\u003csup\\u003e+\\u003c/sup\\u003e spermatogonia became apparent (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec). Therefore, we next sought to determine how SMARCA5 deletion leads to impaired maintenance of A\\u003csub\\u003eundiff\\u003c/sub\\u003e. A\\u003csub\\u003eundiff\\u003c/sub\\u003e includes a subpopulation of a relatively small number of A\\u003csub\\u003esingle\\u003c/sub\\u003e and A\\u003csub\\u003epaired\\u003c/sub\\u003e cells expressing GFRα1, which form the stem cell pool and give rise to NGN3\\u003csup\\u003e+\\u003c/sup\\u003e cells. However, NGN3\\u003csup\\u003e+\\u003c/sup\\u003e cells can revert to GFRα1\\u003csup\\u003e+\\u003c/sup\\u003e cells, maintaining their long-term self-renewal ability (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea)\\u003csup\\u003e\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. In the \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes, the GFRα1\\u003csup\\u003e+\\u003c/sup\\u003e population was relatively enriched compared to controls at 4 weeks (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec), likely due in part to the depletion of differentiating spermatogonia. This result further supports the requirement of SMARCA5 for spermatogonial differentiation.\\u003c/p\\u003e\\u003cp\\u003eWe next examined whether \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e exhibited an abnormal cell cycle profile, as slow cycling is essential for maintenance of A\\u003csub\\u003eundiff\\u003c/sub\\u003e. To this end, we assessed the proportion of active cycling A\\u003csub\\u003eundiff\\u003c/sub\\u003e cells at 2 and 4 weeks by immunostaining with Ki67, a proliferation marker present in G1, S, G2, and M phases of the cell cycle, but absent in G0\\u003csup\\u003e43\\u003c/sup\\u003e. Consistent with the slow cycling nature of A\\u003csub\\u003eundiff\\u003c/sub\\u003e, only 22.5% of A\\u003csub\\u003eundiff\\u003c/sub\\u003e in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ectrl mice were Ki67\\u003csup\\u003e+\\u003c/sup\\u003e at 2 weeks (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed). However, 83.3% of A\\u003csub\\u003eundiff\\u003c/sub\\u003e in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes were Ki67\\u003csup\\u003e+\\u003c/sup\\u003e, an ~\\u0026thinsp;3-fold increase compared to control testes (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed). This suggests that \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e are highly proliferative at 2 weeks. At 4 weeks, the proportion of Ki67\\u003csup\\u003e+\\u003c/sup\\u003ecells remained high in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e. These findings indicate that SMARCA5 is required to maintain the slow-cycling state of A\\u003csub\\u003eundiff\\u003c/sub\\u003e, and that their overproliferation in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes ultimately leads to depletion of the SSC pool.\\u003c/p\\u003e\\n\\u003ch3\\u003eSMARCA5 promotes expression of SSC maintenance genes\\u003c/h3\\u003e\\n\\u003cp\\u003eTo further determine the cause of SSC maintenance defects, we examined gene expression profiles by performing RNA-sequencing (RNA-seq) on spermatogonia at P8, a stage when sufficient numbers of both A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e can be obtained from normal testes. We isolated A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl males at P8 using our previously established fluorescence-activated cell sorting (FACS) method (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed)\\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e. We utilized the cell surface marker E-Cadherin, which is expressed in both A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e, to isolate these populations, and employed KIT expression to specifically identify A\\u003csub\\u003ediff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed). In addition, we used the cell surface marker CD9 to exclude somatic contaminants\\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u003c/sup\\u003e, thus ensuring the isolation of a highly pure spermatogonial population. Using this method, A\\u003csub\\u003eundiff\\u003c/sub\\u003e were collected based on E-cadherin and high CD9 expression, and absence of KIT (E-cadherin\\u003csup\\u003e+\\u003c/sup\\u003eCD9\\u003csup\\u003ehigh\\u003c/sup\\u003eKIT\\u003csup\\u003e\\u0026ndash;\\u003c/sup\\u003e), while A\\u003csub\\u003ediff\\u003c/sub\\u003e were isolated based on E-cadherin and KIT expression with medium CD9 level (E-cadherin\\u003csup\\u003e+\\u003c/sup\\u003eCD9\\u003csup\\u003emedium\\u003c/sup\\u003eKIT\\u003csup\\u003e+\\u003c/sup\\u003e). As expected, based on our immunostaining results from the P7 testes (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea), at P8, \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO males lacked an A\\u003csub\\u003ediff\\u003c/sub\\u003e population (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed). We confirmed the high purity of A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea) and observed strong similarity between biological replicates in the RNA-seq data (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eDuring normal spermatogonial differentiation from A\\u003csub\\u003eundiff\\u003c/sub\\u003e to A\\u003csub\\u003ediff\\u003c/sub\\u003e at P8, a major shift in gene expression occurred, with 2,639 genes upregulated and 1,559 genes downregulated (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec, Supplementary Table\\u0026nbsp;1). However, in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ecKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e, the overall gene expression profile was distinct from both \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb). Compared to \\u003cem\\u003eSmarca5-\\u003c/em\\u003ectrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e, \\u003cem\\u003eSmarca5-\\u003c/em\\u003ecKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e showed 765 upregulated genes and 1,022 downregulated genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ee, Supplementary Table\\u0026nbsp;2). Gene ontology (GO) analysis revealed that the upregulated genes in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ecKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e were enriched for apoptosis-related terms (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ed). Consistent with this, the frequency of apoptotic cell death was increased in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ecKO testes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ef).\\u003c/p\\u003e\\u003cp\\u003eLoss of SMARCA5 in A\\u003csub\\u003eundiff\\u003c/sub\\u003e led to the ectopic upregulation of genes that were normally upregulated from A\\u003csub\\u003eundiff\\u003c/sub\\u003e to A\\u003csub\\u003ediff\\u003c/sub\\u003e (termed \\u0026ldquo;A\\u003csub\\u003ediff\\u003c/sub\\u003e-high genes\\u0026rdquo;: Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee, f). Conversely, genes that were highly expressed in A\\u003csub\\u003eundiff\\u003c/sub\\u003e, which are typically downregulated in A\\u003csub\\u003ediff\\u003c/sub\\u003e (termed \\u0026ldquo;A\\u003csub\\u003eundiff\\u003c/sub\\u003e-high genes\\u0026rdquo;), were downregulated in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee, g). These downregulated genes in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ecKO, enriched for the GO term \\u0026ldquo;regulation of transcription by RNA polymerase II\\u0026rdquo; (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ed), which was also the top-ranked GO term among A\\u003csub\\u003eundiff\\u003c/sub\\u003e high genes (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee). These findings indicate that \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e exhibit impaired expression of A\\u003csub\\u003eundiff\\u003c/sub\\u003e-specific genes. Consistent with this, key SSC maintenance genes \\u0026mdash;such as \\u003cem\\u003eSall4\\u003c/em\\u003e, \\u003cem\\u003eNanos3\\u003c/em\\u003e, \\u003cem\\u003eLin28a, Gfra1, Etv5, Sox4, and Plvap\\u003c/em\\u003e\\u0026mdash;were down-regulated upon \\u003cem\\u003eSmarca5\\u003c/em\\u003e loss (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eg), indicating that SMARCA5 is required for proper expression of SSC maintenance genes. Together, these results suggest that \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e display upregulation of apoptosis-related genes and downregulation of SSC maintenance genes, which may ultimately lead to A\\u003csub\\u003eundiff\\u003c/sub\\u003e depletion in adult testes.\\u003c/p\\u003e\\n\\u003ch3\\u003eSMARCA5 deficiency results in a closed chromatin state at DMRT1-binding sites\\u003c/h3\\u003e\\n\\u003cp\\u003eAs SMARCA5 is an ATP-dependent chromatin remodeler\\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e, we next investigated whether SMARCA5 establishes the chromatin landscape required for SSC maintenance and spermatogonial differentiation. To this end, we performed an assay for transposase-accessible chromatin using sequencing (ATAC-seq)\\u003csup\\u003e\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u003c/sup\\u003e to assess genome-wide chromatin accessibility in A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5-\\u003c/em\\u003ectrl mice and A\\u003csub\\u003eundiff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mice at P8. Due to the absence of A\\u003csub\\u003ediff\\u003c/sub\\u003e in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes, we were unable to analyze this population. Pearson correlation coefficient analysis confirmed high correlations among biological replicates (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea). Among 17,647 ATAC peaks detected in \\u003cem\\u003eSmarca5-\\u003c/em\\u003ectrl A\\u003csub\\u003ediff\\u003c/sub\\u003e, 11,290 peaks (64.0%) overlapped with those in A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb, c), and we identified 6,203 A\\u003csub\\u003eundiff\\u003c/sub\\u003e-specific peaks and 6,357 A\\u003csub\\u003ediff\\u003c/sub\\u003e-specific peaks. This suggests that a large core set of accessible chromatin regions is shared between the two stages, although chromatin accessibility at some specific regions shifts during the transition from A\\u003csub\\u003eundiff\\u003c/sub\\u003e to A\\u003csub\\u003ediff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec). Many of the ATAC peaks in A\\u003csub\\u003eundiff\\u003c/sub\\u003e were located within 10 kb of genes expressed in A\\u003csub\\u003eundiff\\u003c/sub\\u003e (e.g., \\u003cem\\u003eEtv2\\u003c/em\\u003e, \\u003cem\\u003eEtv5\\u003c/em\\u003e, \\u003cem\\u003eId4\\u003c/em\\u003e, and \\u003cem\\u003eRet\\u003c/em\\u003e) and A\\u003csub\\u003ediff\\u003c/sub\\u003e (e.g., \\u003cem\\u003eDmc1\\u003c/em\\u003e, \\u003cem\\u003eMeioc\\u003c/em\\u003e, \\u003cem\\u003eStra8\\u003c/em\\u003e, and \\u003cem\\u003ePrdm9\\u003c/em\\u003e) (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ed), suggesting that A\\u003csub\\u003eundiff\\u003c/sub\\u003e ATAC peaks serve as proximal or distal regulatory elements for both A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e. Taken together, A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e exhibit largely overlapping chromatin accessibility profiles, with putative regulatory elements of genes upregulated in A\\u003csub\\u003ediff\\u003c/sub\\u003e already accessible at the A\\u003csub\\u003eundiff\\u003c/sub\\u003e stage. These findings suggest that the gene expression program for spermatogonial differentiation is primed in A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eNotably, A\\u003csub\\u003eundiff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mice exhibited a largely distinct chromatin accessibility compared to A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5-\\u003c/em\\u003ectrl mice (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea, Supplementary Table\\u0026nbsp;3). In A\\u003csub\\u003eundiff\\u003c/sub\\u003e, loss of SMARCA5 significantly affected the number of ATAC peaks, especially at the intergenic and intronic regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). In contrast, ATAC peaks at promoter regions tended to be common between \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO. These results suggest that SMARCA5 primarily regulates chromatin accessibility at distal regulatory regions, such as enhancers, rather than at promoters.\\u003c/p\\u003e\\u003cp\\u003eTo determine if SMARCA5 directly binds to chromatin regions with altered accessibility in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO, we performed Cleavage Under Targets and Tagmentation (CUT\\u0026amp;Tag)\\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e\\u003c/sup\\u003e analysis of SMARCA5. The majority of SMARCA5 peaks were located in intergenic (42.3%) and intronic (30.3%) regions, and 19.4% were found at promoter regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb, Supplementary Table\\u0026nbsp;4). These SMARCA5 binding sites were largely accessible at both promoter regions (within \\u0026plusmn; 1 kb from transcription start sites, TSSs) and distal regions (beyond \\u0026plusmn; 1 kb from TSSs) in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl cells. Whereas promoter accessibility was retained in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO, distal SMARCA5 peaks lost accessibility (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ed). SMARCA5 was also enriched at ATAC peaks specific to \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl, but not at ATAC peaks specific to \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee). These findings indicate that SMARCA5 directly promotes chromatin accessibility at its binding sites, predominantly at distal regulatory regions. While \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO also leads to the emergence of ectopically accessible regions, the near absence of SMARCA5 binding at these sites suggests that many of them are indirectly affected by the loss of SMARCA5.\\u003c/p\\u003e\\u003cp\\u003eWe further investigated the characteristics of ATAC peaks specific to \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl, as these are presumably direct targets of SMARCA5. Motif analysis of ATAC peaks using HOMER revealed that motifs shared by the transcription factors DMRT1 and DMRT6 were enriched in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e-specific peaks (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee). Interestingly, DMRT1 is expressed in male germ cells postnatally and present in A\\u003csub\\u003eundiff\\u003c/sub\\u003e \\u003csup\\u003e\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e, regulates SSC maintenance\\u003csup\\u003e\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e\\u003c/sup\\u003e and suppresses precocious meiotic entry in spermatogonia\\u003csup\\u003e\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e\\u003c/sup\\u003e. Thus, SMARCA5 might collaborate with DMRT1 to promote the establishment of chromatin states conducive to male germ cell development. We focused on DMRT1 rather than DMRT6 due to their distinct expression profiles; DMRT1 is expressed in male germ cells postnatally and is present in A\\u003csub\\u003eundiff\\u003c/sub\\u003e\\u003csup\\u003e\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e, whereas DMRT6 expression begins at the A\\u003csub\\u003ediff\\u003c/sub\\u003e stage and functions during spermatogenic differentiation\\u003csup\\u003e\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, DMRT6 is unlikely to be involved in SMARCA5-regulated distal accessible regions in A\\u003csub\\u003eundiff\\u003c/sub\\u003e. To further investigate the possible role of DMRT1, we performed a CUT\\u0026amp;Tag analysis for DMRT1 in A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ee). DMRT1 peaks were predominantly located at intergenic (42.4%) and intronic (35.8%) regions, while 17.8% of the DMRT1 peaks were located in promoter regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea, Supplementary Table\\u0026nbsp;5). Compared to previous DMRT1 ChIP-seq studies using whole testis,\\u003csup\\u003e51\\u003c/sup\\u003e our CUT\\u0026amp;Tag analysis identified a greater number of promoter-associated peaks. Nonetheless, consistent with the previous study\\u003csup\\u003e\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e\\u003c/sup\\u003e, DMRT1 exhibited stronger binding at distal regions compared to promoters (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb). While DMRT1-bound promoter regions remained accessible in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO, distal DMRT1 peak regions showed significantly reduced accessibility upon SMARCA5 loss (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb). These findings indicate that SMARCA5 promotes chromatin accessibility at distal DMRT1-binding sites.\\u003c/p\\u003e\\n\\u003ch3\\u003eSMARCA5 establishes chromatin accessibility at DMRT1-binding sites\\u003c/h3\\u003e\\n\\u003cp\\u003eWe next sought to elucidate the functions of distal regulatory elements regulated by SMARCA5 and DMRT1. To this end, we reanalyzed publicly available chromatin profiling datasets from A\\u003csub\\u003eundiff\\u003c/sub\\u003e to examine the distribution of representative histone modifications at these distal regions\\u003csup\\u003e\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e\\u003c/sup\\u003e. We found that H3K4me1 (monomethylation of histone H3 at lysine 4), a hallmark of poised enhancers, was enriched at distal DMRT1 peaks. These regions lacked the active enhancer/promoter mark H3K27ac (H3K27 acetylation)\\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e and the promoter mark H3K4me3\\u003csup\\u003e55\\u003c/sup\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec), suggesting that distal elements are poised rather than active enhancers. Additionally, these sites retained repressive histone modifications, including H2AK119ub and H3K27me3\\u003csup\\u003e44\\u003c/sup\\u003e, which are mediated by Polycomb repressive complexes PRC1 and PRC2, respectively. This indicates a role for Polycomb in enhancer poising. Notably, H3K4me1 was enriched specifically at regions adjacent to the peak centers. In contrast, DMRT1-associated promoters showed strong enrichment of both H3K27ac and H3K4me3, consistent with an active promoter status (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec). Analysis of SMARCA5 binding sites in A\\u003csub\\u003eundiff\\u003c/sub\\u003e revealed similar enrichment of H3K4me1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ed). A subset of these SMARCA5-bound distal regions also displayed H2AK119ub and H3K27me3 marks. Overall, these results suggest that SMARCA5 and DMRT1 largely co-occupy putative poised enhancers, with SMARCA5-bound regions exhibiting a stronger association with Polycomb-mediated repression than those bound by DMRT1.\\u003c/p\\u003e\\u003cp\\u003eWe further investigated how individual loci are regulated by SMARCA5 and DMRT1. DMRT1 is known to bind a putative upstream enhancer of the \\u003cem\\u003eZbtb16\\u003c/em\\u003e locus and regulate its expression\\u003csup\\u003e\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e\\u003c/sup\\u003e. We found that chromatin accessibility at this enhancer was also SMARCA5-dependent and that both SMARCA5 and DMRT1 bound to this region (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ee), suggesting that they act cooperatively to activate \\u003cem\\u003eZbtb16\\u003c/em\\u003e expression. In adult A\\u003csub\\u003eundiff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mice, we observed reduced expression of the ZBTB16 protein (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eg), a phenotype resembling that of \\u003cem\\u003eDmrt1\\u003c/em\\u003e-deficient spermatogonia\\u003csup\\u003e\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e\\u003c/sup\\u003e. Additionally, SMARCA5 and DMRT1 co-bound the \\u003cem\\u003eDmrt1\\u003c/em\\u003e promoter, where chromatin accessibility was likewise SMARCA5-dependent (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ef), suggesting that SMARCA5 and DMRT1 cooperate to establish the chromatin landscape at the \\u003cem\\u003eDmrt1\\u003c/em\\u003e promoter. Together, these findings support a model in which SMARCA5 and DMRT1 work in concert to establish chromatin accessibility at key regulatory elements critical for spermatogenesis.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eSMARCA5 establishes chromatin accessibility at DMRT1-binding sites after the prospermatogonia stage\\u003c/h2\\u003e\\u003cp\\u003eA key outstanding question is when SMARCA5 establishes chromatin accessibility at DMRT1-binding sites in the male germline. To address this, we performed ATAC-seq on prospermatogonia (ProSG) at P0 (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea) and examined changes in chromatin accessibility during the transition to spermatogonia. In \\u003cem\\u003eSmarca5\\u003c/em\\u003e-control P0 ProSG, we identified 12,780 ATAC peaks (Supplementary Table\\u0026nbsp;3), approximately one-third of which were located at promoter regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea). From P0 ProSG to P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e, there was a progressive increase in ATAC peaks (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb). The P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e-specific peaks that emerged during this developmental window were enriched in the DMRT1/6 motif (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb). When comparing the accessible chromatin landscapes of P0 ProSG and P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e, we found that stage-specific ATAC peaks were predominantly located in intergenic and intronic regions, whereas more than half of the shared peaks were found at promoter regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec). The newly acquired ATAC peaks in A\\u003csub\\u003eundiff\\u003c/sub\\u003e were enriched for the poised enhancer mark H3K4me1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec). Based on these findings, we hypothesized that SMARCA5 actively generates chromatin accessibility at these poised enhancers. Indeed, distal DMRT1-binding sites in P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e gained chromatin accessibility during this transition, and this gain was dependent on SMARCA5 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eg). These findings indicate that SMARCA5 establishes chromatin accessibility at distal elements of DMRT1-binding sites during the transition from P0 ProSG to P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\n\\u003ch3\\u003eSMARCA5 is recruited to distal DMRT1-binding sites to establish accessible chromatin\\u003c/h3\\u003e\\n\\u003cp\\u003eTo determine when SMARCA5 is recruited to distal DMRT1-binding sites, we performed CUT\\u0026amp;Tag for SMARCA5 in P0 ProSG (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec, Supplementary Table\\u0026nbsp;4) and compared the binding profiles to P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e. We observed that 30,655 P0 ProSG SMARCA5 peaks were lost, while 15,404 new SMARCA5 peaks were gained in P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eh). Notably, DMRT1/6 motifs were enriched within the P8-specific SMARCA5 peaks (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eh, Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ed). At DMRT1-binding sites in P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e, SMARCA5 was newly recruited to many distal regions, whereas it was already bound to promoter regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ei). This pattern was specific to DMRT1-binding sites, as SMARCA5 peaks in A\\u003csub\\u003eundiff\\u003c/sub\\u003e that did not overlap with DMRT1-binding sites were already accessible and SMARCA5-bound in ProSG (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ej, k). Consistent with these findings, SMARCA5 was expressed in germ cells from E18.5 through P3 (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ee). In contrast, DMRT1 was not expressed at E18.5 but appeared in a subset of germ cells at P0 and was present in most germ cells by P3 (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ef). Thus, the onset of DMRT1 expression (from P0 onwards) coincided with the \\u003cem\\u003ede novo\\u003c/em\\u003e establishment of accessibility at distal DMRT1-binding sites, suggesting that SMARCA5 recognizes distal DMRT1-binding sites upon DMRT1 expression and facilitates the generation of accessible chromatin at these sites.\\u003c/p\\u003e\\n\\u003ch3\\u003eThe SMARCA5–DMRT1 pioneer complex binds closed chromatin and facilitates DNA accessibility\\u003c/h3\\u003e\\n\\u003cp\\u003eA previous study suggested that DMRT1 may function as a pioneer transcription factor in the context of female-to-male transdifferentiation in ovarian somatic cells, capable of binding closed chromatin and promoting chromatin accessibility to induce the male fate\\u003csup\\u003e\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e\\u003c/sup\\u003e. In line with this notion, and based on our findings, we hypothesized that DMRT1 cooperates with SMARCA5 to generate accessible chromatin at distal DMRT1-binding sites in male germ cells. To test this, we assessed DMRT1's chromatin-binding ability using CUT\\u0026amp;Tag in P8 A\\u003csub\\u003eundiff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO mice (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eg) and compared it to control mice (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ef). DMRT1 enrichment at its binding sites was largely similar between \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO, with minimal differences observed at both promoter and distal regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ea). Notably, DMRT1 binding was retained at sites that remained closed in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO but were accessible in controls\\u0026mdash;specifically at SMARCA5-dependent ATAC peaks (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eb). These results indicate that DMRT1 is capable of binding closed chromatin and that SMARCA5 is required to remodel these regions into an accessible state at distal DMRT1-binding sites. Thus, SMARCA5 functions together with DMRT1 as part of a SMARCA5\\u0026ndash;DMRT1 pioneer complex, establishing chromatin accessibility at these loci.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo investigate the potential mechanism of action of the SMARCA5\\u0026ndash;DMRT1 pioneer complex, we modeled chromatin relaxation by DMRT1 with and without SMARCA5 using AlphaFold3 (AF3), which enables highly accurate predictions of protein\\u0026ndash;nucleic acid complexes.\\u003csup\\u003e\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e\\u003c/sup\\u003e We used the 601 DNA sequence, commonly employed for nucleosome modeling\\u003csup\\u003e\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e\\u003c/sup\\u003e and incorporated a DMRT1-binding motif. Structural predictions were then generated for DMRT1 alone and for the DMRT1\\u0026ndash;SMARCA5 complex. The DM domain of DMRT1, known to interact with DNA,\\u003csup\\u003e59\\u003c/sup\\u003e was predicted to bind its motif via a major α-helix (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ec, d). This binding mode closely matches the structure of the human DMRT1\\u0026ndash;DNA complex determined by X-ray crystallography.\\u003csup\\u003e\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e\\u003c/sup\\u003e Notably, AF3 predicts that DMRT1 can bind DNA wrapped around histones, consistent with our CUT\\u0026amp;Tag data showing DMRT1 occupancy at inaccessible chromatin regions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eb, Supplementary Video 1).\\u003c/p\\u003e\\u003cp\\u003eWhen SMARCA5 is included in the model, the DMRT1\\u0026ndash;DNA interactions are maintained (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ee), but the DNA near the DMRT1 motif is displaced farther from the histone core compared to the DMRT1-only model (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ed, f, Supplementary Video 2), indicating chromatin loosening induced by SMARCA5. These findings suggest that while DMRT1 can recognize its target motifs in closed chromatin, it requires SMARCA5 to remodel nucleosomes and generate an accessible chromatin state.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eSMARCA5 establishes chromatin states that confer retinoic acid responsiveness\\u003c/h2\\u003e\\u003cp\\u003eFinally, we sought to determine how \\u003cem\\u003ede novo\\u003c/em\\u003e chromatin accessibility at distal DMRT1 binding sites contributes to spermatogenic differentiation. Loss of \\u003cem\\u003eSmarca5\\u003c/em\\u003e impairs the transition from A\\u003csub\\u003eundiff\\u003c/sub\\u003e to A\\u003csub\\u003ediff\\u003c/sub\\u003e, a process known to require retinoic acid (RA) signaling\\u003csup\\u003e\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e\\u003c/sup\\u003e. Notably, the absence of A\\u003csub\\u003ediff\\u003c/sub\\u003e in \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO testes phenocopies that observed in vitamin A (the RA precursor)\\u0026ndash;deficient mice, which lack RA\\u003csup\\u003e62\\u003c/sup\\u003e. \\u003cem\\u003eStra8\\u003c/em\\u003e, a well-established RA-responsive gene, is first expressed in A\\u003csub\\u003ediff\\u003c/sub\\u003e and later again in preleptotene spermatocytes\\u003csup\\u003e\\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e\\u003c/sup\\u003e. Retinoic acid receptors (RARs), members of the nuclear receptor family, act as ligand-dependent transcription factors\\u003csup\\u003e\\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e\\u003c/sup\\u003e. Supporting their role in RA signaling, pan-RAR ChIP-seq data from germline stem (GS) cells\\u0026mdash;an in vitro model of A\\u003csub\\u003eundiff\\u003c/sub\\u003e\\u003csup\\u003e\\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e66\\u003c/span\\u003e\\u003c/sup\\u003e\\u0026mdash;have shown RAR binding at the \\u003cem\\u003eStra8\\u003c/em\\u003e promoter\\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003eWe therefore reanalyzed the pan-RAR ChIP-seq data\\u003csup\\u003e\\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e66\\u003c/span\\u003e\\u003c/sup\\u003e and found that both SMARCA5 and DMRT1 also bind RAR-binding sites in A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ea). These RAR-binding regions were inaccessible in ProSG but became accessible in A\\u003csub\\u003eundiff\\u003c/sub\\u003e in a SMARCA5-dependent manner (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eb). For example, SMARCA5-dependent accessible chromatin was established at the promoters of \\u003cem\\u003eStra8\\u003c/em\\u003e and another RA-responsive gene, \\u003cem\\u003eRec8\\u003c/em\\u003e, both of which are co-occupied by DMRT1 and RAR (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ec). These findings indicate that the SMARCA5\\u0026ndash;DMRT1 pioneer complex establishes a chromatin state that permits RAR binding, thereby priming A\\u003csub\\u003eundiff\\u003c/sub\\u003e for RA-induced differentiation.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eWe reanalyzed the H3K27ac ChIP-seq data during spermatogenesis\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e and found that SMARCA5-dependent accessible sites in A\\u003csub\\u003eundiff\\u003c/sub\\u003e were enriched for H3K27ac in both A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A1 spermatogonia (a subset of A\\u003csub\\u003ediff\\u003c/sub\\u003e), and H3K27ac signals decreased upon further differentiation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ed). Notably, in A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e, H3K27ac signals were enriched in regions several hundred base pairs upstream and downstream of the ATAC-seq peak centers, while the peak centers themselves lacked H3K27ac (indicated by arrows in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ed). This pattern likely reflects transcription factor binding at the central regions, flanked by H3K27ac-modified nucleosomes. Moreover, 5,356 genes located near these regions were highly expressed in A\\u003csub\\u003eundiff\\u003c/sub\\u003e and A\\u003csub\\u003ediff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ee). These results support the notion that SMARCA5-dependent accessible sites act as enhancers in spermatogonia. In summary, SMARCA5 promotes spermatogonial differentiation by establishing chromatin accessibility at putative poised enhancers and germline gene promoters\\u0026mdash;including \\u003cem\\u003eDmrt1\\u003c/em\\u003e, \\u003cem\\u003eStra8\\u003c/em\\u003e, and \\u003cem\\u003eRec8\\u003c/em\\u003e\\u0026mdash;thereby priming the genome for RA responsiveness during the transition from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ef).\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn this study, we report that SMARCA5 is an essential chromatin remodeler that cooperates with the transcription factor DMRT1 to form the SMARCA5-DMRT1 pioneer complex, which primes gene regulatory elements during the transition from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ef). We demonstrate that, in SMARCA5-deficient spermatogonia, many enhancers and key germline gene promoters\\u0026mdash;including those of \\u003cem\\u003eStra8\\u003c/em\\u003e and \\u003cem\\u003eRec8\\u003c/em\\u003e\\u0026mdash;fail to acquire chromatin accessibility. Although DMRT1 is bound to many of these loci, the chromatin remains inaccessible, indicating that SMARCA5 is required to establish a permissive chromatin environment for subsequent recruitment of transcriptional regulators such as RARs. The failure to differentiate into A\\u003csub\\u003ediff\\u003c/sub\\u003e in the absence of SMARCA5 suggests that disrupted epigenetic priming impedes RAR function. Thus, SMARCA5 confers developmental competence to male germ cells by establishing the chromatin states necessary for RA-responsive gene expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ef).\\u003c/p\\u003e\\u003cp\\u003eOur finding that DMRT1, while capable of binding closed chromatin, requires SMARCA5 to generate full chromatin accessibility at many of its target sites (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e) is a central conceptual advance. This observation refines the classical model of pioneer transcription factors, suggesting that in certain developmental contexts, their chromatin-opening activity depends on cooperation with chromatin remodelers. While in vitro nucleosome reconstitution assays have demonstrated that pioneer factors can open compact chromatin independently\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e\\u003c/sup\\u003e, studies in cultured cells indicate that chromatin remodelers are often required to achieve chromatin accessibility\\u003csup\\u003e\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e\\u003c/sup\\u003e. Transcription requires the recruitment of various factors, including transcription factors and RNA polymerase II, a process that may involve the activity of chromatin remodelers to establish fully open chromatin regions\\u003csup\\u003e\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e\\u003c/sup\\u003e. Our findings provide \\u003cem\\u003ein vivo\\u003c/em\\u003e evidence\\u0026mdash;using cells derived from living organisms rather than cultured cells\\u0026mdash;that chromatin remodeling is an essential step in the functional activation of pioneer factor-bound regions.\\u003c/p\\u003e\\u003cp\\u003eAdditionally, DMRT6\\u0026mdash;expressed in A\\u003csub\\u003ediff\\u003c/sub\\u003e and type B spermatogonia\\u0026mdash;binds genomic regions that largely overlap with those of DMRT1. These DMRT6 binding sites also became accessible in a SMARCA5-dependent manner during the transition from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eh), suggesting that DMRT6 functions sequentially after DMRT1 at shared regulatory sites.\\u003c/p\\u003e\\u003cp\\u003eOf note, a recent study also reported that \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO using a different \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre driver\\u003csup\\u003e\\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e\\u003c/sup\\u003e and the same \\u003cem\\u003eSmarca5\\u003c/em\\u003e-floxed allele\\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e as in our study leads to male infertility\\u003csup\\u003e\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e\\u003c/sup\\u003e. However, in that model, deletion of \\u003cem\\u003eSmarca5\\u003c/em\\u003e did not lead to an acute and uniform loss of spermatogonia but allowed continued spermatogonial differentiation and meiotic progression\\u003csup\\u003e\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e\\u003c/sup\\u003e. This discrepancy might be due to differences in Cre-induced recombination efficiency between the two \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre drivers, likely reflecting distinct levels of Cre expression. The \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre driver used in our study\\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e is a transgenic line with over 20 copies of the transgene inserted into the genome\\u003csup\\u003e\\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e\\u003c/sup\\u003e, whereas the \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre driver\\u003csup\\u003e\\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e\\u003c/sup\\u003e used in the other study\\u003csup\\u003e\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e\\u003c/sup\\u003e is a knock-in line. Incomplete loss of SMARC5 during early development in that model might have allowed spermatogonia to progress, thereby revealing that SMARCA5 is also required during later stages of spermatogenesis\\u003csup\\u003e\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e\\u003c/sup\\u003e. Interestingly, SMARCA5 protein is present in the XY body of pachytene spermatocytes, a hallmark of meiotic sex chromosome inactivation (MSCI), an essential step in male meiosis\\u003csup\\u003e\\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e\\u003c/sup\\u003e (Extended Data Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). Notably, our previous studies identified SMARCA5 in immunoprecipitation and mass spectrometry analyses of γH2AX-containing nucleosomes\\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e\\u003c/sup\\u003e, which are enriched in the XY body. These findings suggest that SMARCA5 also functions during later stages of spermatogenesis beyond the A\\u003csub\\u003ediff\\u003c/sub\\u003e stage.\\u003c/p\\u003e\\u003cp\\u003eIn addition to its role in differentiation, we observe that SMARCA5 is also involved in maintaining the undifferentiated state in A\\u003csub\\u003eundiff\\u003c/sub\\u003e. This function may be mediated by PRC2-dependent H3K27me3, which is enriched at many distal SMARCA5 binding sites in these cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ed). H3K27me3 is a hallmark of SSCs and is typically lost during the onset of differentiation, accompanied by activation of genes such as \\u003cem\\u003eStra8\\u003c/em\\u003e\\u003csup\\u003e44\\u003c/sup\\u003e. During the transition from ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e, H3K27me3 is deposited at promoters already marked by H3K4me3, forming bivalent domains\\u003csup\\u003e\\u003cspan citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e76\\u003c/span\\u003e\\u003c/sup\\u003e. At key loci such as \\u003cem\\u003eDmrt1\\u003c/em\\u003e and \\u003cem\\u003eStra8\\u003c/em\\u003e, these bivalent domains coincide with SMARCA5-dependent accessible regions, suggesting that SMARCA5 might facilitate the establishment of a poised chromatin state necessary for SSC maintenance. Thus, SMARCA5 may serve dual roles: one in Polycomb-mediated repression to maintain SSC identity and another in Polycomb-associated epigenetic priming that prepares cells for differentiation. These functions may not be mutually exclusive and likely occur in coordination with DMRT1. Accordingly, our study also clarifies the molecular function of DMRT1 in germ cells, highlighting a parallel to its role in somatic supporting cells (Sertoli cells) in the testes, where DMRT1 partners with Polycomb complexes to repress the female transcriptional program\\u003csup\\u003e\\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e77\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003ePrevious studies have shown that epigenetic states undergo substantial changes during the ProSG to A\\u003csub\\u003eundiff\\u003c/sub\\u003e transition\\u003csup\\u003e\\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e79\\u003c/span\\u003e\\u003c/sup\\u003e. Single-cell ATAC-seq analyses of developing testicular cells from E18.5 to P5.5 have revealed that newly accessible regions are enriched for binding motifs of various transcription factors, including DMRT1 and FOXO1\\u003csup\\u003e78\\u003c/sup\\u003e, a factor essential for spermatogonial maintenance\\u003csup\\u003e\\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e\\u003c/sup\\u003e. Notably, FOXO1 has been identified as a pioneer factor in cancer cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e81\\u003c/span\\u003e\\u003c/sup\\u003e. In light of our new findings, these observations suggest that additional regulators may contribute to establishing accessible chromatin during this developmental transition.\\u003c/p\\u003e\\u003cp\\u003eThe current study further raises the intriguing possibility that the establishment of male epigenetic priming may suppress the female program during development from the bi-potential state of primordial germ cells, similar to the role of DMRT1 in Sertoli cells in the testes\\u003csup\\u003e\\u003cspan citationid=\\\"CR82\\\" class=\\\"CitationRef\\\"\\u003e82\\u003c/span\\u003e\\u003c/sup\\u003e. Notably, \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e-specific ATAC peak regions, which in the presence of SMARC5 remain inaccessible, were enriched for binding motifs shared by the transcription factors TCF3 and TCF12 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee). TCF3 and TCF12 are primarily required for the female germline, particularly in supporting oocyte growth\\u003csup\\u003e\\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e83\\u003c/span\\u003e\\u003c/sup\\u003e. Thus, it is tempting to speculate that loss of SMARCA5 may lead to the emergence of ectopic, female-like chromatin states.\\u003c/p\\u003e\\u003cp\\u003eAlthough pioneer transcription factors have been extensively studied in the context of early embryogenesis\\u003csup\\u003e\\u003cspan citationid=\\\"CR84\\\" class=\\\"CitationRef\\\"\\u003e84\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR85\\\" class=\\\"CitationRef\\\"\\u003e85\\u003c/span\\u003e\\u003c/sup\\u003e and cellular reprogramming\\u003csup\\u003e\\u003cspan citationid=\\\"CR86\\\" class=\\\"CitationRef\\\"\\u003e86\\u003c/span\\u003e\\u003c/sup\\u003e, their roles during later developmental transitions remain poorly understood. Our findings highlight that the interplay between chromatin remodelers and pioneer factors is critical not only during embryogenesis but also during germline differentiation, where they enable transcriptional programs responsive to external signals. This finding expands the conceptual framework of epigenetic priming and underscores the broader importance of chromatin remodeling in shaping cellular competence across diverse developmental systems.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAnimals\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMice were maintained on a 12:12 light cycle in a temperature and humidity-controlled vivarium (22±2°C: 40-50% humidity) with free access to food and water in a pathogen-free animal care facility. Mice were used according to the guidelines of the Institutional Animal Care and Use Committee (protocol no. IACUC2018-0040, 21943, and 23545) at Cincinnati Children’s Hospital Medical Center and the University of California, Davis. \\u003cem\\u003eSmarca5-\\u003c/em\\u003ecKO mice (\\u003cem\\u003eSmarca\\u003c/em\\u003e5\\u003cem\\u003e\\u003csup\\u003eF/-\\u003c/sup\\u003e\\u003c/em\\u003e; \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre [FVB-Tg (\\u003cem\\u003eDdx4\\u003c/em\\u003e-cre)1Dcas/J]) were generated from \\u003cem\\u003eSmarca5\\u003csup\\u003eF/F \\u003c/sup\\u003e\\u003c/em\\u003efemales crossed with \\u003cem\\u003eSmarca\\u003c/em\\u003e5\\u003cem\\u003e\\u003csup\\u003eF/+\\u003c/sup\\u003e\\u003c/em\\u003e; \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre males. \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl in experiments were \\u003cem\\u003eSmarca5\\u003csup\\u003eF/+\\u003c/sup\\u003e\\u003c/em\\u003e; \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre for the next generation sequencing experiments, and \\u003cem\\u003eSmarca5\\u003csup\\u003eF/+\\u003c/sup\\u003e\\u003c/em\\u003e; \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre or \\u003cem\\u003eSmarca5\\u003csup\\u003eF/+\\u003c/sup\\u003e\\u003c/em\\u003e for immunostaining and testis size measurements from littermates of \\u003cem\\u003eSmarca5\\u003c/em\\u003e cKO. \\u003cem\\u003eSmarca5\\u003csup\\u003eF/F \\u003c/sup\\u003e\\u003c/em\\u003eand \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre mouse lines were maintained on a background of FVB. \\u003cem\\u003eSmarca5\\u003csup\\u003eF/F \\u003c/sup\\u003e\\u003c/em\\u003emice were obtained from Dr. Davis J. Picketts\\u003csup\\u003e35\\u003c/sup\\u003e, and \\u003cem\\u003eDdx4\\u003c/em\\u003e-Cre transgenic mice were purchased from the Jackson laboratory\\u003csup\\u003e36\\u003c/sup\\u003e. \\u003cem\\u003eStella\\u003c/em\\u003e-GFP transgenic mice were obtained from Dr M. Azim Surani\\u003csup\\u003e87\\u003c/sup\\u003e, maintained on a mixed genetic background of FVB and C57BL/6J.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHistology and immunostaining\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFor the preparation of paraffin blocks, testes were fixed with 4% paraformaldehyde containing 0.05% Triton X-100 for 2 days at room temperature. Testes were dehydrated by a series of ethanol and then replaced with xylene and embedded in paraffin. For HE staining, 5 μm-thick paraffin sections were deparaffinized and stained with hematoxylin (Sigma, MHS16) and eosin (Sigma, 318906). For immunostaining, 5 μm-thick paraffin sections were deparaffinized and autoclaved in target retrieval solution (DAKO) for 10 min at 121°C. Sections were blocked with Blocking One Histo (Nacalai, 06349-64) for 20 min at room temperature and then incubated with primary antibodies overnight at 4°C. Sections were washed with PBST (PBS containing 0.1% Tween 20) three times at room temperature for 5 min and then incubated with the corresponding secondary antibodies. Finally, sections were counterstained with DAPI and mounted using 30 μL undiluted ProLong Gold Antifade Mountant (ThermoFisher Scientific, P36930). Primary antibodies and secondary antibodies that were used are listed in Supplementary Table 6. Images were obtained with an ECLIPSE Ti-2 microscope (Nikon) or BZ-X810 (Keyence). \\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eWestern blotting\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTestis pieces obtained from P7 testis were homogenized in RIPA buffer (50 mM Tris–HCl, pH 7.5; 150 mM NaCl; 0.1% SDS; 1% Triton X-100; 1% sodium deoxycholate) containing a protease inhibitor cocktail (Roche, 11697498001) and a phosphatase inhibitor cocktail (Sigma, P0044). For SMARCA5 detection, 20 μg of protein were separated by electrophoresis with a 10% SDS-PAGE gel, and the proteins were transferred using Trans-Blot® Turbo Transfer System (BIO-RAD) onto a PVDF membrane (EMD Millipore; IPVH00010). The membranes were blocked with StartingBlock™ T20 (TBS) Blocking Buffer (ThermoFisher Scientific, 37543) for 30 min at room temperature and then incubated with primary antibodies overnight at 4°C. After being washed with TBST three times, membranes were then incubated with secondary antibodies conjugated to HRP (Abcam, ab131366 or ab131368) for 1 h at room temperature, and bands were visualized using an ECL kit according to the manufacturer’s instructions (EMD Millipore; WBKLS0500).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFlow cytometry and cell sorting\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFlow cytometric experiments and cell sorting were performed using SH800S (SONY), with antibody-stained testicular single-cell suspensions prepared as described previously\\u003csup\\u003e44,88\\u003c/sup\\u003e with minor modifications. Briefly, to prepare single cell suspensions for cell sorting, detangled seminiferous tubules were incubated in 1× Krebs–Ringer Bicarbonate Buffer (Sigma, K4002) supplemented with 1.5 mg/ml collagenase Type 1 and 0.04 mg/ml DNase I at 37°C for 15 min with gentle agitation and dissociated using vigorous pipetting, and then add 0.75 mg/ml hyaluronidase (Sigma, H3506) and incubated at 37°C for 10 min with gentle agitation and dissociated using vigorous pipetting. The cell suspension was centrifuged at 300 × g, the cells resuspended in 10 ml FACS buffer (PBS containing 2% FBS), and then centrifuged again at 300 × g for 5 min, and this step was repeated one more time. The pelleted cells were resuspended in 1 ml FACS buffer and then filtered through a 70 μm nylon cell strainer (Falcon, 352350). The resultant single cells were stained with cocktails of antibodies diluted with FACS buffer, listed as follows: PE-conjugated anti-mouse/human CD324 (E-cadherin) antibody (1:500, Biolegend, 147303), PE/Cy7-conjugated anti-mouse CD117 (c-Kit) antibody (1:200, Biolegend, 105814), and FITC-conjugated anti-mouse CD9 antibody (1:500, Biolegend, 124808). After a 50-minute incubation on ice, cells were washed with 10 ml FACS buffer three times by centrifugation at 300 × g for 5 min and filtered into a 1 ml FACS tube through a 35 μm nylon mesh cap (Falcon, 352235). 7-AAD Viability Stain (Invitrogen, 00-6993-50) was added to the cell suspension for the exclusion of dead cells. Samples were kept on ice until sorting. Cells were analyzed after removing small and large debris in FSC-A versus SSC-A gating, doublets in FSC-W versus FSC-H gating, and 7AAD\\u003csup\\u003e+\\u003c/sup\\u003e dead cells. Then the desired cell population was collected in gates determined based on antibody staining.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eRNA-seq library generation and sequencing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRNA-seq libraries of A\\u003csub\\u003eundiff\\u003c/sub\\u003e from \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO and A\\u003csub\\u003ediff \\u003c/sub\\u003efrom \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl were prepared as described\\u003csup\\u003e88\\u003c/sup\\u003e; briefly, 10,000 A\\u003csub\\u003eundiff\\u003c/sub\\u003e or A\\u003csub\\u003ediff\\u003c/sub\\u003e cells were pooled from two independent mice as one replicate, and two independent biological replicates were used for RNA-seq library generation. Total RNA was extracted using the RNeasy Plus Micro Kit (QIAGEN, Cat # 74034) according to the manufacturer’s instructions. Library preparation was performed with NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (NEB, E6420S) according to the manufacturer’s instructions. Prepared RNA-seq libraries were sequenced on the HiSeq X Ten system (Illumina) with paired-ended 150-bp reads.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eATAC-seq library generation and sequencing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eATAC-seq libraries of germ cells were prepared as described\\u003csup\\u003e88\\u003c/sup\\u003e; briefly, 10,000 A\\u003csub\\u003eundiff\\u003c/sub\\u003e, A\\u003csub\\u003ediff\\u003c/sub\\u003e, or P0 prospermatogonia (ProSG) were pooled from two independent mice as one replicate. Samples were lysed in 50 μl of lysis buffer (10 mM Tris–HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, and 0.1% NP-40, 0.1% Tween-20, and 0.01% Digitonin) on ice for 5 min. Immediately after lysis, the samples were spun at 500 × g for 10 min at 4°C, and the supernatant was removed. The sedimented nuclei were then incubated in 10 μl of transposition mix (0.5 μl homemade Tn5 transposase (∼1 μg/μl), 5 μl 2× tagment DNA buffer (10 mM Tris–HCl (pH 7.6), 10 mM MgCl2, and 20% dimethyl formamide), 3.3 μl PBS, 0.1 μl 1% digitonin, 0.1 μl 10% Tween-20, and 1 μl water) at 37°C for 30 min in a thermomixer with shaking at 500 rpm. After tagmentation, the transposed DNA was purified with a MinElute kit (Qiagen). Polymerase chain reaction (PCR) was performed to amplify the library using the following conditions: 72°C for 3 min; 98°C for 30 s; thermocycling at 98°C for 10 s, 60°C for 30 s, and 72°C for 1 min. Quantitative PCR was used to estimate the number of additional cycles needed to generate products at 25% saturation. Seven to eight additional PCR cycles were added to the initial set of five cycles. Amplified DNA was purified by 1.0x SPRIselect beads (Beckman Coulter). ATAC-seq libraries were sequenced on the HiSeq X Ten system with 150-bp paired-end reads.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCUT\\u0026amp;Tag library generation and sequencing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCUT\\u0026amp;Tag libraries of ctrl A\\u003csub\\u003eundiff\\u003c/sub\\u003e and ProSG for SMARCA5 were prepared as previously described (a step-by-step protocol https://www.protocols.io/view/bench-top-cut-amp-tag-kqdg34qdpl25/v3) using CUTANA™ pAG-Tn5 (Epicypher, 15-1017)\\u003csup\\u003e89\\u003c/sup\\u003e. Quantitative spike-in CUT\\u0026amp;Tag for DMRT1 of \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl and cKO A\\u003csub\\u003eundiff \\u003c/sub\\u003ewas performed by adding \\u003cem\\u003eDrosophila\\u003c/em\\u003e S2 cells at a 1:5 ratio to mouse spermatogonial cells (5,000 S2 cells to 25,000 mouse cells) in each reaction. The antibodies used were rabbit anti-SMARCA5 (1/100) or rabbit anti-DMRT1 antibody (1/50). CUT\\u0026amp;Tag libraries were sequenced on the Novaseq X Plus system with 150-bp paired-end reads.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eRNA-seq data processing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRaw paired-end RNA-seq reads after trimming by Trim-galore (https://github.com/FelixKrueger/TrimGalore) (version 0.6.7) were aligned to the mouse (GRCm38/mm10) genome using STAR\\u003csup\\u003e90\\u003c/sup\\u003e (version STAR_2.5.4b) with following options: --outSAMtype BAM SortedByCoordinate; --twopassMode Basic; --outFilterType BySJout; --outFilterMultimapNmax 1; --winAnchorMultimapNmax 50; --alignSJoverhangMin 8; --alignSJDBoverhangMin 1; --outFilterMismatchNmax 999; --outFilterMismatchNoverReadLmax 0.04; --alignIntronMin 20; --alignIntronMax 1000000; --alignMatesGapMax 1000000 for unique alignments. To quantify aligned reads in RNA-seq, aligned read counts for each gene were generated using featureCounts\\u003csup\\u003e91\\u003c/sup\\u003e (v2.0.1), which is part of the Subread package based on annotated genes (gencode.vM25.annotation.gtf)\\u003csup\\u003e92\\u003c/sup\\u003e. The transcripts per million (TPM) values of each gene were used for comparative expression analyses and computing the Pearson correlation coefficient between biological replicates using corrplot.\\u003c/p\\u003e\\n\\u003cp\\u003eTo detect differentially-expressed genes (DEGs) between \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff \\u003c/sub\\u003eand \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003ediff\\u003c/sub\\u003e, or \\u003cem\\u003eSmarca5\\u003c/em\\u003e-ctrl A\\u003csub\\u003eundiff \\u003c/sub\\u003eand \\u003cem\\u003eSmarca5\\u003c/em\\u003e-cKO A\\u003csub\\u003eundiff\\u003c/sub\\u003e, DESeq2\\u003csup\\u003e93\\u003c/sup\\u003e (version 1.42.1) was used for differential gene expression analyses with cutoffs ≥2-fold change and binomial tests (Padj \\u0026lt; 0.05; P-values were adjusted for multiple testing using the Benjamini–Hochberg method). Padj values were used to determine significantly dysregulated genes.\\u003c/p\\u003e\\n\\u003cp\\u003eGO term analysis was performed using the website tool DAVID (https://david.ncifcrf.gov/home.jsp)\\u003csup\\u003e94,95\\u003c/sup\\u003e. GO term was visualized by ggplot2 (version 3.4.4) of the R package based on gene number, fold enrichment, and \\u003cem\\u003eP\\u003c/em\\u003e value. A violin plot was drawn using the R package ggplot2.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eATAC-seq and CUT\\u0026amp;Tag data processing\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRaw paired-end ATAC-seq reads after trimming by Trim-galore were aligned to either the mouse (GRCm38/mm10) genomes using bowtie2 (version 2.3.3.1)\\u003csup\\u003e96\\u003c/sup\\u003e with default arguments. Raw paired-end CUT\\u0026amp;Tag reads after trimming by Trim-galore were aligned to either the mouse (GRCm38/mm10) genomes using Bowtie2 (version 2.3.3.1) with options: –end-to-end –very-sensitive –no-mixed –no-discordant –phred33 -I 10 -X 700. All unmapped and non-uniquely mapped reads were filtered out by samtools (version 1.9)\\u003csup\\u003e97\\u003c/sup\\u003e before being subjected to downstream analyses. PCR duplicates were removed using the ‘MarkDuplicates’ command in Picard tools (version 2.23.8) (https://broadinstitute.github.io/picard/, Broad Institute). For CUT\\u0026amp;Tag on DMRT1, \\u003cem\\u003eD. melanogaster\\u003c/em\\u003e DNA delivered by Drosophila S2 cells was used as spike-in DNA, as described\\u003csup\\u003e89\\u003c/sup\\u003e. For mapping \\u003cem\\u003eD. melanogaster \\u003c/em\\u003espike-in fragments, we also aligned to either the \\u003cem\\u003eD. melanogaster\\u003c/em\\u003e (dm6) genome using Bowtie2 and used the '–no-overlap –no-dovetail' options to avoid cross-mapping using Bowtie2. PCR duplicates were removed using the 'MarkDuplicates’ command in Picard tools. Spike-in normalization was implemented using the exogenous scaling factor computed from the dm6 mapping files (scale factors = 10000/spike-in reads for DMRT1 CUT\\u0026amp;Tag).\\u003c/p\\u003e\\n\\u003cp\\u003eBiological replicates were pooled for visualization and other analyses after validation of reproducibility. Peak calling for ATAC-seq data was performed using MACS3 (version 3.0.0a7)\\u003csup\\u003e98\\u003c/sup\\u003e with the parameters: -g mm --nomodel --nolambda. Peak calling for CUT\\u0026amp;Tag data was performed using MACS2 (version 2.2.7.1) with the parameters: -g mm. We computed the number of overlapping peaks between peak files using BEDtools (version 2.28.0)\\u003csup\\u003e99\\u003c/sup\\u003e function intersect. To detect genes adjacent to ATAC-seq and CUT\\u0026amp;Tag peaks, we used the HOMER (version 4.9.1)\\u003csup\\u003e100\\u003c/sup\\u003e function annotatePeaks.pl. The deeptools was used to draw tag density plots and heatmaps for read enrichment. To visualize ATAC-seq and CUT\\u0026amp;Tag data on SMARCA5 using the Integrative Genomics Viewer (Broad Institute)\\u003csup\\u003e101\\u003c/sup\\u003e, bins per million (BPM) normalized counts data were created from sorted BAM files using the deeptools. To visualize CUT\\u0026amp;Tag data on DMRT1, spike-in normalized genome coverage tracks with 1 bp resolution in BigWig format were generated using ‘bamCoverage’ from deepTools (version 3.5.5)\\u003csup\\u003e102\\u003c/sup\\u003e with the parameters ‘--binSize 1 --extendReads --samFlagInclude 64 --normalizeUsing RPKM --scaleFactor $scale_factor’.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAlphaFold3 modeling\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAlphaFold 3\\u003csup\\u003e57\\u003c/sup\\u003e was run using the AlphaFold web server (https://alphafoldserver.com). Two amino acid sequences translated from \\u003cem\\u003eHist1h2ao,\\u003c/em\\u003e \\u003cem\\u003eHist1h2bb\\u003c/em\\u003e, \\u003cem\\u003eH3f3a\\u003c/em\\u003e, and \\u003cem\\u003eHist2h4 \\u003c/em\\u003ewere used as inputs to form a histone core. The sequence of the 601 sequence with 60 bp of flanking DNA and DMRT1 motif sequence is as follows: \\u003c/p\\u003e\\n\\u003cp\\u003e5’-CTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCTTGATACATTGTATCACAGCGACCTTGCCGGTGCCAGTCGGATAGTGTTCCGAGCTCCCACTCT-3’\\u003c/p\\u003e\\n\\u003cp\\u003eChimeraX (version 1.9) was used for visualization.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eChIP-seq data reanalysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRaw single-end H3K27ac ChIP-seq data were downloaded from Gene Expression Omnibus (GEO) under accession no. GSE132446 and GSE242515. Fastq files of biological replicates were merged and then trimmed by Trim-galore. Trimmed reads were aligned to the mouse (mm10) and Drosophila (dm6), respectively, using bowtie2 (version 2.3.3.1) with the parameters: --very-sensitive --phred33. PCR duplicates were removed using the ‘MarkDuplicates’ command in Picard tools (version 2.23.8). Spike-in normalization was implemented using the exogenous scaling factor computed from the dm6 mapping files (scale factors = 1000000/spike-in reads). Deeptools of the bamCoverage program was used to generate spike-in normalized coverage tracks (bigwig format) with the parameters: --binSize 10 --normalizationUsing RPGC --extendReads --effectiveGenomeSize 2652783500 --scaleFactor $scaleFactor.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistics\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eStatistical methods and\\u003cem\\u003e P\\u003c/em\\u003e values for each plot are listed in the Fig. legends and/or in the Methods. Next-generation sequencing data (RNA-seq, CUT\\u0026amp;Tag) were based on two independent replicates. No statistical methods were used to predetermine sample size in these experiments. Experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessments.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank members of the Namekawa lab, Kanako Ikami, and Shosei Yoshida for stimulating discussions; Arthur I. Skoultchi for helping share \\u003cem\\u003eSmarca5\\u003csup\\u003eF/F\\u0026nbsp;\\u003c/sup\\u003e\\u003c/em\\u003emice; Azim Surani for providing \\u003cem\\u003eStella\\u003c/em\\u003e-GFP transgenic mice; So Maezawa for the homemade Tn5 transposase for ATAC-seq; Kei-Ichiro Ishiguro for the MEIOSIN antibody; and David Zarkower for the DMRT1 antibody. We acknowledge the following funding sources: JSPS Overseas Challenge Program for Young Researchers, TOYOBO Biotechnology Foundation, and JSPS Overseas Research Fellowship to Y.K.; and NIH Grants K99HD116268 to Y.K., and R35GM141085 to S.H.N.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contribution\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eY.K. and S.H.N. designed the study. Y.M. performed the RNA-seq experiments and ATAC-seq experiments. Y.K., Y.M., and M.H. performed the CUT\\u0026amp;Tag experiments. Y.K., H.A., S.M., M.R., and S.P.K. performed staining experiments. H.A. performed Western blotting experiments. Y.K. performed the computational analysis, with the contribution from Y.M. Y.K. and S.O. performed structure prediction using AlphaFold3. Y.K., Y.M., H.A., M.H., S.O., D.J.P., R.M.S., and S.H.N. interpreted the results. D.J.P. provided the \\u003cem\\u003eSmarca5\\u003csup\\u003eF/F\\u0026nbsp;\\u003c/sup\\u003e\\u003c/em\\u003emouse line. Y.K., R.M.S., and S.H.N. wrote the manuscript with critical feedback from all authors. S.H.N. supervised the project.\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interest statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRNA-seq data, ATAC-seq, and CUT\\u0026amp;Tag datasets were deposited in the Gene Expression Omnibus under accession no.\\u0026nbsp;GSE303063. ChIP-seq data for H3K27ac in A\\u003csub\\u003eundiff\\u003c/sub\\u003e (THY1\\u003csup\\u003e+\\u003c/sup\\u003e) spermatogonia were downloaded from GSE130652. ChIP-seq data for H3K4me3 in A\\u003csub\\u003eundiff\\u003c/sub\\u003e spermatogonia were downloaded from GSE89502. CUT\\u0026amp;Tag data for H3K27me3 and H2AK119ub in A\\u003csub\\u003eundiff\\u003c/sub\\u003e spermatogonia were downloaded from the GSE221944. ChIP-seq data for H3K27ac in male germline were downloaded from GSE132446 and GSE242515. RNA-seq data in the male germline were downloaded from GSE242515. ChIP-seq data for RAR in GS cells were downloaded from GSE1116798. ChIP-seq data for DMRT6 in adult testis were downloaded from GSE60440.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eCode availability\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSource code for all software and tools used in this study, with documentation, examples, and additional information, is available at the URLs listed above.\\u003c/p\\u003e\\n\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eReik, W. Stability and flexibility of epigenetic gene regulation in mammalian development. \\u003cem\\u003eNature\\u003c/em\\u003e \\u003cstrong\\u003e447\\u003c/strong\\u003e, 425-32 (2007).\\u003c/li\\u003e\\n\\u003cli\\u003eAtlasi, Y. \\u0026amp; Stunnenberg, H.G. The interplay of epigenetic marks during stem cell differentiation and development. \\u003cem\\u003eNat Rev Genet\\u003c/em\\u003e \\u003cstrong\\u003e18\\u003c/strong\\u003e, 643-658 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eMadrigal, P.\\u003cem\\u003e et al.\\u003c/em\\u003e Epigenetic and transcriptional regulations prime cell fate before division during human pluripotent stem cell differentiation. \\u003cem\\u003eNat Commun\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 405 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eFrank, C.L.\\u003cem\\u003e et al.\\u003c/em\\u003e Regulation of chromatin accessibility and Zic binding at enhancers in the developing cerebellum. \\u003cem\\u003eNat Neurosci\\u003c/em\\u003e \\u003cstrong\\u003e18\\u003c/strong\\u003e, 647-56 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003ePalfy, M., Schulze, G., Valen, E. \\u0026amp; Vastenhouw, N.L. Chromatin accessibility established by Pou5f3, Sox19b and Nanog primes genes for activity during zebrafish genome activation. \\u003cem\\u003ePLoS Genet\\u003c/em\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e, e1008546 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eMaezawa, S., Yukawa, M., Alavattam, K.G., Barski, A. \\u0026amp; Namekawa, S.H. Dynamic reorganization of open chromatin underlies diverse transcriptomes during spermatogenesis. \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e46\\u003c/strong\\u003e, 593-608 (2018).\\u003c/li\\u003e\\n\\u003cli\\u003eGriswold, M.D. Spermatogenesis: The Commitment to Meiosis. \\u003cem\\u003ePhysiol Rev\\u003c/em\\u003e \\u003cstrong\\u003e96\\u003c/strong\\u003e, 1-17 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eNakagawa, T.\\u003cem\\u003e et al.\\u003c/em\\u003e A multistate stem cell dynamics maintains homeostasis in mouse spermatogenesis. \\u003cem\\u003eCell Rep\\u003c/em\\u003e \\u003cstrong\\u003e37\\u003c/strong\\u003e, 109875 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eYoshida, S. Heterogeneous, dynamic, and stochastic nature of mammalian spermatogenic stem cells. \\u003cem\\u003eCurr Top Dev Biol\\u003c/em\\u003e \\u003cstrong\\u003e135\\u003c/strong\\u003e, 245-285 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eSugimoto, R., Nabeshima, Y. \\u0026amp; Yoshida, S. Retinoic acid metabolism links the periodical differentiation of germ cells with the cycle of Sertoli cells in mouse seminiferous epithelium. \\u003cem\\u003eMech Dev\\u003c/em\\u003e \\u003cstrong\\u003e128\\u003c/strong\\u003e, 610-24 (2012).\\u003c/li\\u003e\\n\\u003cli\\u003eEndo, T.\\u003cem\\u003e et al.\\u003c/em\\u003e Periodic retinoic acid-STRA8 signaling intersects with periodic germ-cell competencies to regulate spermatogenesis. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e \\u003cstrong\\u003e112\\u003c/strong\\u003e, E2347-56 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eGriswold, M.D. Cellular and molecular basis for the action of retinoic acid in spermatogenesis. \\u003cem\\u003eJ Mol Endocrinol\\u003c/em\\u003e \\u003cstrong\\u003e69\\u003c/strong\\u003e, T51-t57 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eHasegawa, K.\\u003cem\\u003e et al.\\u003c/em\\u003e SCML2 establishes the male germline epigenome through regulation of histone H2A ubiquitination. \\u003cem\\u003eDev Cell\\u003c/em\\u003e \\u003cstrong\\u003e32\\u003c/strong\\u003e, 574-88 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eLin, Z.\\u003cem\\u003e et al.\\u003c/em\\u003e SETD1B-mediated broad H3K4me3 controls proper temporal patterns of gene expression critical for spermatid development. \\u003cem\\u003eCell Res\\u003c/em\\u003e (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eIkami, K.\\u003cem\\u003e et al.\\u003c/em\\u003e Hierarchical differentiation competence in response to retinoic acid ensures stem cell maintenance during mouse spermatogenesis. \\u003cem\\u003eDevelopment\\u003c/em\\u003e \\u003cstrong\\u003e142\\u003c/strong\\u003e, 1582-92 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eLesch, B.J., Dokshin, G.A., Young, R.A., McCarrey, J.R. \\u0026amp; Page, D.C. A set of genes critical to development is epigenetically poised in mouse germ cells from fetal stages through completion of meiosis. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e \\u003cstrong\\u003e110\\u003c/strong\\u003e, 16061-6 (2013).\\u003c/li\\u003e\\n\\u003cli\\u003eHammoud, S.S.\\u003cem\\u003e et al.\\u003c/em\\u003e Chromatin and transcription transitions of mammalian adult germline stem cells and spermatogenesis. \\u003cem\\u003eCell Stem Cell\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 239-53 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eSin, H.S., Kartashov, A.V., Hasegawa, K., Barski, A. \\u0026amp; Namekawa, S.H. Poised chromatin and bivalent domains facilitate the mitosis-to-meiosis transition in the male germline. \\u003cem\\u003eBMC Biol\\u003c/em\\u003e \\u003cstrong\\u003e13\\u003c/strong\\u003e, 53 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eCheng, K.\\u003cem\\u003e et al.\\u003c/em\\u003e Unique Epigenetic Programming Distinguishes Regenerative Spermatogonial Stem Cells in the Developing Mouse Testis. \\u003cem\\u003eiScience\\u003c/em\\u003e \\u003cstrong\\u003e23\\u003c/strong\\u003e, 101596 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eMaezawa, S.\\u003cem\\u003e et al.\\u003c/em\\u003e Super-enhancer switching drives a burst in gene expression at the mitosis-to-meiosis transition. \\u003cem\\u003eNat Struct Mol Biol\\u003c/em\\u003e \\u003cstrong\\u003e27\\u003c/strong\\u003e, 978-988 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eKaye, E.G.\\u003cem\\u003e et al.\\u003c/em\\u003e RNA polymerase II pausing is essential during spermatogenesis for appropriate gene expression and completion of meiosis. \\u003cem\\u003eNat Commun\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 848 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eKitamura, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e CTCF-mediated 3D chromatin sets up the gene expression program in the male germline. \\u003cem\\u003eNat Struct Mol Biol\\u003c/em\\u003e (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eYi, C., Kitamura, Y., Maezawa, S., Namekawa, S.H. \\u0026amp; Cairns, B.R. ZBTB16/PLZF regulates juvenile spermatogonial stem cell development through an extensive transcription factor poising network. \\u003cem\\u003eNat Struct Mol Biol\\u003c/em\\u003e (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eKitamura, Y. \\u0026amp; Namekawa, S.H. Epigenetic priming in the male germline. \\u003cem\\u003eCurr Opin Genet Dev\\u003c/em\\u003e \\u003cstrong\\u003e86\\u003c/strong\\u003e, 102190 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eGioacchini, N. \\u0026amp; Peterson, C.L. Chromatin remodeling: a complex affair. \\u003cem\\u003eEMBO Rep\\u003c/em\\u003e \\u003cstrong\\u003e18\\u003c/strong\\u003e, 1673-1674 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eWiechens, N.\\u003cem\\u003e et al.\\u003c/em\\u003e The Chromatin Remodelling Enzymes SNF2H and SNF2L Position Nucleosomes adjacent to CTCF and Other Transcription Factors. \\u003cem\\u003ePLoS Genet\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e, e1005940 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eBomber, M.L.\\u003cem\\u003e et al.\\u003c/em\\u003e Human SMARCA5 is continuously required to maintain nucleosome spacing. \\u003cem\\u003eMol Cell\\u003c/em\\u003e \\u003cstrong\\u003e83\\u003c/strong\\u003e, 507-522 e6 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eCirillo, L.A.\\u003cem\\u003e et al.\\u003c/em\\u003e Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. \\u003cem\\u003eMol Cell\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 279-89 (2002).\\u003c/li\\u003e\\n\\u003cli\\u003eZaret, K.S. \\u0026amp; Carroll, J.S. Pioneer transcription factors: establishing competence for gene expression. \\u003cem\\u003eGenes Dev\\u003c/em\\u003e \\u003cstrong\\u003e25\\u003c/strong\\u003e, 2227-41 (2011).\\u003c/li\\u003e\\n\\u003cli\\u003eBarral, A. \\u0026amp; Zaret, K.S. Pioneer factors: roles and their regulation in development. \\u003cem\\u003eTrends Genet\\u003c/em\\u003e \\u003cstrong\\u003e40\\u003c/strong\\u003e, 134-148 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, T. \\u0026amp; Zarkower, D. DMRT proteins and coordination of mammalian spermatogenesis. \\u003cem\\u003eStem Cell Res\\u003c/em\\u003e \\u003cstrong\\u003e24\\u003c/strong\\u003e, 195-202 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eZarkower, D. \\u0026amp; Murphy, M.W. DMRT1: An Ancient Sexual Regulator Required for Human Gonadogenesis. \\u003cem\\u003eSex Dev\\u003c/em\\u003e \\u003cstrong\\u003e16\\u003c/strong\\u003e, 112-125 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eChong, S.\\u003cem\\u003e et al.\\u003c/em\\u003e Modifiers of epigenetic reprogramming show paternal effects in the mouse. \\u003cem\\u003eNat Genet\\u003c/em\\u003e \\u003cstrong\\u003e39\\u003c/strong\\u003e, 614-22 (2007).\\u003c/li\\u003e\\n\\u003cli\\u003eHermann, B.P.\\u003cem\\u003e et al.\\u003c/em\\u003e The Mammalian Spermatogenesis Single-Cell Transcriptome, from Spermatogonial Stem Cells to Spermatids. \\u003cem\\u003eCell Rep\\u003c/em\\u003e \\u003cstrong\\u003e25\\u003c/strong\\u003e, 1650-1667 e8 (2018).\\u003c/li\\u003e\\n\\u003cli\\u003eAlvarez-Saavedra, M.\\u003cem\\u003e et al.\\u003c/em\\u003e Snf2h-mediated chromatin organization and histone H1 dynamics govern cerebellar morphogenesis and neural maturation. \\u003cem\\u003eNat Commun\\u003c/em\\u003e \\u003cstrong\\u003e5\\u003c/strong\\u003e, 4181 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eGallardo, T., Shirley, L., John, G.B. \\u0026amp; Castrillon, D.H. Generation of a germ cell-specific mouse transgenic Cre line, Vasa-Cre. \\u003cem\\u003eGenesis\\u003c/em\\u003e \\u003cstrong\\u003e45\\u003c/strong\\u003e, 413-7 (2007).\\u003c/li\\u003e\\n\\u003cli\\u003eCostoya, J.A.\\u003cem\\u003e et al.\\u003c/em\\u003e Essential role of Plzf in maintenance of spermatogonial stem cells. \\u003cem\\u003eNat Genet\\u003c/em\\u003e \\u003cstrong\\u003e36\\u003c/strong\\u003e, 653-9 (2004).\\u003c/li\\u003e\\n\\u003cli\\u003eOhbo, K.\\u003cem\\u003e et al.\\u003c/em\\u003e Identification and characterization of stem cells in prepubertal spermatogenesis in mice. \\u003cem\\u003eDev Biol\\u003c/em\\u003e \\u003cstrong\\u003e258\\u003c/strong\\u003e, 209-25 (2003).\\u003c/li\\u003e\\n\\u003cli\\u003eAnderson, E.L.\\u003cem\\u003e et al.\\u003c/em\\u003e Stra8 and its inducer, retinoic acid, regulate meiotic initiation in both spermatogenesis and oogenesis in mice. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e \\u003cstrong\\u003e105\\u003c/strong\\u003e, 14976-80 (2008).\\u003c/li\\u003e\\n\\u003cli\\u003eIshiguro, K.I.\\u003cem\\u003e et al.\\u003c/em\\u003e MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. \\u003cem\\u003eDev Cell\\u003c/em\\u003e \\u003cstrong\\u003e52\\u003c/strong\\u003e, 429-445 e10 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eHara, K.\\u003cem\\u003e et al.\\u003c/em\\u003e Mouse spermatogenic stem cells continually interconvert between equipotent singly isolated and syncytial states. \\u003cem\\u003eCell Stem Cell\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 658-72 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eNakagawa, T., Nabeshima, Y. \\u0026amp; Yoshida, S. Functional identification of the actual and potential stem cell compartments in mouse spermatogenesis. \\u003cem\\u003eDev Cell\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e, 195-206 (2007).\\u003c/li\\u003e\\n\\u003cli\\u003eScholzen, T. \\u0026amp; Gerdes, J. The Ki-67 protein: from the known and the unknown. \\u003cem\\u003eJ Cell Physiol\\u003c/em\\u003e \\u003cstrong\\u003e182\\u003c/strong\\u003e, 311-22 (2000).\\u003c/li\\u003e\\n\\u003cli\\u003eHu, M.\\u003cem\\u003e et al.\\u003c/em\\u003e PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiation. \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e52\\u003c/strong\\u003e, 2306-2322 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eLa, H.M.\\u003cem\\u003e et al.\\u003c/em\\u003e Identification of dynamic undifferentiated cell states within the male germline. \\u003cem\\u003eNat Commun\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 2819 (2018).\\u003c/li\\u003e\\n\\u003cli\\u003eAihara, T.\\u003cem\\u003e et al.\\u003c/em\\u003e Cloning and mapping of SMARCA5 encoding hSNF2H, a novel human homologue of Drosophila ISWI. \\u003cem\\u003eCytogenet Cell Genet\\u003c/em\\u003e \\u003cstrong\\u003e81\\u003c/strong\\u003e, 191-3 (1998).\\u003c/li\\u003e\\n\\u003cli\\u003eCorces, M.R.\\u003cem\\u003e et al.\\u003c/em\\u003e An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. \\u003cem\\u003eNat Methods\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 959-962 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eBuenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y. \\u0026amp; Greenleaf, W.J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. \\u003cem\\u003eNat Methods\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 1213-8 (2013).\\u003c/li\\u003e\\n\\u003cli\\u003eKaya-Okur, H.S.\\u003cem\\u003e et al.\\u003c/em\\u003e CUT\\u0026amp;Tag for efficient epigenomic profiling of small samples and single cells. \\u003cem\\u003eNat Commun\\u003c/em\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e, 1930 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eLei, N.\\u003cem\\u003e et al.\\u003c/em\\u003e Sex-specific differences in mouse DMRT1 expression are both cell type- and stage-dependent during gonad development. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e \\u003cstrong\\u003e77\\u003c/strong\\u003e, 466-75 (2007).\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, T., Oatley, J., Bardwell, V.J. \\u0026amp; Zarkower, D. DMRT1 Is Required for Mouse Spermatogonial Stem Cell Maintenance and Replenishment. \\u003cem\\u003ePLoS Genet\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e, e1006293 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eMatson, C.K.\\u003cem\\u003e et al.\\u003c/em\\u003e The mammalian doublesex homolog DMRT1 is a transcriptional gatekeeper that controls the mitosis versus meiosis decision in male germ cells. \\u003cem\\u003eDev Cell\\u003c/em\\u003e \\u003cstrong\\u003e19\\u003c/strong\\u003e, 612-24 (2010).\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, T., Murphy, M.W., Gearhart, M.D., Bardwell, V.J. \\u0026amp; Zarkower, D. The mammalian Doublesex homolog DMRT6 coordinates the transition between mitotic and meiotic developmental programs during spermatogenesis. \\u003cem\\u003eDevelopment\\u003c/em\\u003e \\u003cstrong\\u003e141\\u003c/strong\\u003e, 3662-71 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eChen, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Refined spatial temporal epigenomic profiling reveals intrinsic connection between PRDM9-mediated H3K4me3 and the fate of double-stranded breaks. \\u003cem\\u003eCell Res\\u003c/em\\u003e \\u003cstrong\\u003e30\\u003c/strong\\u003e, 256-268 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eMaezawa, S.\\u003cem\\u003e et al.\\u003c/em\\u003e Polycomb protein SCML2 facilitates H3K27me3 to establish bivalent domains in the male germline. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e \\u003cstrong\\u003e115\\u003c/strong\\u003e, 4957-4962 (2018).\\u003c/li\\u003e\\n\\u003cli\\u003eLindeman, R.E.\\u003cem\\u003e et al.\\u003c/em\\u003e The conserved sex regulator DMRT1 recruits SOX9 in sexual cell fate reprogramming. \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e49\\u003c/strong\\u003e, 6144-6164 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eAbramson, J.\\u003cem\\u003e et al.\\u003c/em\\u003e Accurate structure prediction of biomolecular interactions with AlphaFold 3. \\u003cem\\u003eNature\\u003c/em\\u003e \\u003cstrong\\u003e630\\u003c/strong\\u003e, 493-500 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eLowary, P.T. \\u0026amp; Widom, J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. \\u003cem\\u003eJ Mol Biol\\u003c/em\\u003e \\u003cstrong\\u003e276\\u003c/strong\\u003e, 19-42 (1998).\\u003c/li\\u003e\\n\\u003cli\\u003eMurphy, M.W., Zarkower, D. \\u0026amp; Bardwell, V.J. Vertebrate DM domain proteins bind similar DNA sequences and can heterodimerize on DNA. \\u003cem\\u003eBMC Mol Biol\\u003c/em\\u003e \\u003cstrong\\u003e8\\u003c/strong\\u003e, 58 (2007).\\u003c/li\\u003e\\n\\u003cli\\u003eMurphy, M.W.\\u003cem\\u003e et al.\\u003c/em\\u003e An ancient protein-DNA interaction underlying metazoan sex determination. \\u003cem\\u003eNat Struct Mol Biol\\u003c/em\\u003e \\u003cstrong\\u003e22\\u003c/strong\\u003e, 442-51 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eMorales, C. \\u0026amp; Griswold, M.D. Retinol-induced stage synchronization in seminiferous tubules of the rat. \\u003cem\\u003eEndocrinology\\u003c/em\\u003e \\u003cstrong\\u003e121\\u003c/strong\\u003e, 432-4 (1987).\\u003c/li\\u003e\\n\\u003cli\\u003evan Pelt, A.M. \\u0026amp; de Rooij, D.G. Synchronization of the seminiferous epithelium after vitamin A replacement in vitamin A-deficient mice. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e \\u003cstrong\\u003e43\\u003c/strong\\u003e, 363-67 (1990).\\u003c/li\\u003e\\n\\u003cli\\u003eMark, M.\\u003cem\\u003e et al.\\u003c/em\\u003e STRA8-deficient spermatocytes initiate, but fail to complete, meiosis and undergo premature chromosome condensation. \\u003cem\\u003eJ Cell Sci\\u003c/em\\u003e \\u003cstrong\\u003e121\\u003c/strong\\u003e, 3233-42 (2008).\\u003c/li\\u003e\\n\\u003cli\\u003eZhou, Q.\\u003cem\\u003e et al.\\u003c/em\\u003e Expression of stimulated by retinoic acid gene 8 (Stra8) in spermatogenic cells induced by retinoic acid: an in vivo study in vitamin A-sufficient postnatal murine testes. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e \\u003cstrong\\u003e79\\u003c/strong\\u003e, 35-42 (2008).\\u003c/li\\u003e\\n\\u003cli\\u003eGiguere, V., Ong, E.S., Segui, P. \\u0026amp; Evans, R.M. Identification of a receptor for the morphogen retinoic acid. \\u003cem\\u003eNature\\u003c/em\\u003e \\u003cstrong\\u003e330\\u003c/strong\\u003e, 624-9 (1987).\\u003c/li\\u003e\\n\\u003cli\\u003eKanatsu-Shinohara, M.\\u003cem\\u003e et al.\\u003c/em\\u003e Long-term culture of mouse male germline stem cells under serum-or feeder-free conditions. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e \\u003cstrong\\u003e72\\u003c/strong\\u003e, 985-91 (2005).\\u003c/li\\u003e\\n\\u003cli\\u003eDodonova, S.O., Zhu, F., Dienemann, C., Taipale, J. \\u0026amp; Cramer, P. Nucleosome-bound SOX2 and SOX11 structures elucidate pioneer factor function. \\u003cem\\u003eNature\\u003c/em\\u003e \\u003cstrong\\u003e580\\u003c/strong\\u003e, 669-672 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eDonovan, B.T.\\u003cem\\u003e et al.\\u003c/em\\u003e Basic helix-loop-helix pioneer factors interact with the histone octamer to invade nucleosomes and generate nucleosome-depleted regions. \\u003cem\\u003eMol Cell\\u003c/em\\u003e \\u003cstrong\\u003e83\\u003c/strong\\u003e, 1251-1263 e6 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eGong, W.\\u003cem\\u003e et al.\\u003c/em\\u003e ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage. \\u003cem\\u003eNat Cell Biol\\u003c/em\\u003e \\u003cstrong\\u003e24\\u003c/strong\\u003e, 672-684 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eKing, H.W. \\u0026amp; Klose, R.J. The pioneer factor OCT4 requires the chromatin remodeller BRG1 to support gene regulatory element function in mouse embryonic stem cells. \\u003cem\\u003eElife\\u003c/em\\u003e \\u003cstrong\\u003e6\\u003c/strong\\u003e(2017).\\u003c/li\\u003e\\n\\u003cli\\u003eHu, Y.C., de Rooij, D.G. \\u0026amp; Page, D.C. Tumor suppressor gene Rb is required for self-renewal of spermatogonial stem cells in mice. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e \\u003cstrong\\u003e110\\u003c/strong\\u003e, 12685-90 (2013).\\u003c/li\\u003e\\n\\u003cli\\u003eKataruka, S.\\u003cem\\u003e et al.\\u003c/em\\u003e SMARCA5 restricts chromatin accessibility to promote male meiosis and fertility in mammals. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e \\u003cstrong\\u003e122\\u003c/strong\\u003e, e2422356122 (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eGoodwin, L.O.\\u003cem\\u003e et al.\\u003c/em\\u003e Large-scale discovery of mouse transgenic integration sites reveals frequent structural variation and insertional mutagenesis. \\u003cem\\u003eGenome Res\\u003c/em\\u003e \\u003cstrong\\u003e29\\u003c/strong\\u003e, 494-505 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eAlavattam, K.G., Maezawa, S., Andreassen, P.R. \\u0026amp; Namekawa, S.H. Meiotic sex chromosome inactivation and the XY body: a phase separation hypothesis. \\u003cem\\u003eCell Mol Life Sci\\u003c/em\\u003e \\u003cstrong\\u003e79\\u003c/strong\\u003e, 18 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eBroering, T.J.\\u003cem\\u003e et al.\\u003c/em\\u003e BAZ1B is dispensable for H2AX phosphorylation on Tyrosine 142 during spermatogenesis. \\u003cem\\u003eBiol Open\\u003c/em\\u003e \\u003cstrong\\u003e4\\u003c/strong\\u003e, 873-84 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eLi, P.\\u003cem\\u003e et al.\\u003c/em\\u003e Priming Epigenetic Landscape at Gene Promoters through Transcriptional Activation in Mammalian Germ Cells. \\u003cem\\u003ebioRxiv\\u003c/em\\u003e, 2024.11.24.625111 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eMaezawa, S.\\u003cem\\u003e et al.\\u003c/em\\u003e PRC1 suppresses a female gene regulatory network to ensure testicular differentiation. \\u003cem\\u003eCell Death Dis\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 501 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eSuen, H.C.\\u003cem\\u003e et al.\\u003c/em\\u003e The single-cell chromatin accessibility landscape in mouse perinatal testis development. \\u003cem\\u003eElife\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e(2023).\\u003c/li\\u003e\\n\\u003cli\\u003eYamanaka, S.\\u003cem\\u003e et al.\\u003c/em\\u003e Broad Heterochromatic Domains Open in Gonocyte Development Prior to De Novo DNA Methylation. \\u003cem\\u003eDev Cell\\u003c/em\\u003e \\u003cstrong\\u003e51\\u003c/strong\\u003e, 21-34 e5 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eGoertz, M.J., Wu, Z., Gallardo, T.D., Hamra, F.K. \\u0026amp; Castrillon, D.H. Foxo1 is required in mouse spermatogonial stem cells for their maintenance and the initiation of spermatogenesis. \\u003cem\\u003eJ Clin Invest\\u003c/em\\u003e \\u003cstrong\\u003e121\\u003c/strong\\u003e, 3456-66 (2011).\\u003c/li\\u003e\\n\\u003cli\\u003eSunkel, B.D.\\u003cem\\u003e et al.\\u003c/em\\u003e Evidence of pioneer factor activity of an oncogenic fusion transcription factor. \\u003cem\\u003eiScience\\u003c/em\\u003e \\u003cstrong\\u003e24\\u003c/strong\\u003e, 102867 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eMatson, C.K.\\u003cem\\u003e et al.\\u003c/em\\u003e DMRT1 prevents female reprogramming in the postnatal mammalian testis. \\u003cem\\u003eNature\\u003c/em\\u003e \\u003cstrong\\u003e476\\u003c/strong\\u003e, 101-4 (2011).\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, B.\\u003cem\\u003e et al.\\u003c/em\\u003e Mapping putative enhancers in mouse oocytes and early embryos reveals TCF3/12 as key folliculogenesis regulators. \\u003cem\\u003eNat Cell Biol\\u003c/em\\u003e \\u003cstrong\\u003e26\\u003c/strong\\u003e, 962-974 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003eGassler, J.\\u003cem\\u003e et al.\\u003c/em\\u003e Zygotic genome activation by the totipotency pioneer factor Nr5a2. \\u003cem\\u003eScience\\u003c/em\\u003e \\u003cstrong\\u003e378\\u003c/strong\\u003e, 1305-1315 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eLi, L.\\u003cem\\u003e et al.\\u003c/em\\u003e Multifaceted SOX2-chromatin interaction underpins pluripotency progression in early embryos. \\u003cem\\u003eScience\\u003c/em\\u003e \\u003cstrong\\u003e382\\u003c/strong\\u003e, eadi5516 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eSoufi, A.\\u003cem\\u003e et al.\\u003c/em\\u003e Pioneer transcription factors target partial DNA motifs on nucleosomes to initiate reprogramming. \\u003cem\\u003eCell\\u003c/em\\u003e \\u003cstrong\\u003e161\\u003c/strong\\u003e, 555-568 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003ePayer, B.\\u003cem\\u003e et al.\\u003c/em\\u003e Generation of stella-GFP transgenic mice: a novel tool to study germ cell development. \\u003cem\\u003eGenesis\\u003c/em\\u003e \\u003cstrong\\u003e44\\u003c/strong\\u003e, 75-83 (2006).\\u003c/li\\u003e\\n\\u003cli\\u003eMunakata, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Chromatin remodeler CHD4 establishes chromatin states required for ovarian reserve formation, maintenance and male germ cell survival. \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e53\\u003c/strong\\u003e(2025).\\u003c/li\\u003e\\n\\u003cli\\u003eHu, M. \\u0026amp; Namekawa, S.H. Quantitative CUT\\u0026amp;Tag for Epigenomic Profiling of Mouse Germ Cells. \\u003cem\\u003eMethods Mol Biol\\u003c/em\\u003e \\u003cstrong\\u003e2954\\u003c/strong\\u003e, 27-47 (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eDobin, A.\\u003cem\\u003e et al.\\u003c/em\\u003e STAR: ultrafast universal RNA-seq aligner. \\u003cem\\u003eBioinformatics\\u003c/em\\u003e \\u003cstrong\\u003e29\\u003c/strong\\u003e, 15-21 (2013).\\u003c/li\\u003e\\n\\u003cli\\u003eLiao, Y., Smyth, G.K. \\u0026amp; Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. \\u003cem\\u003eBioinformatics\\u003c/em\\u003e \\u003cstrong\\u003e30\\u003c/strong\\u003e, 923-30 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eFrankish, A.\\u003cem\\u003e et al.\\u003c/em\\u003e GENCODE reference annotation for the human and mouse genomes. \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e47\\u003c/strong\\u003e, D766-D773 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eLove, M.I., Huber, W. \\u0026amp; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. \\u003cem\\u003eGenome Biol\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 550 (2014).\\u003c/li\\u003e\\n\\u003cli\\u003eHuang da, W., Sherman, B.T. \\u0026amp; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. \\u003cem\\u003eNat Protoc\\u003c/em\\u003e \\u003cstrong\\u003e4\\u003c/strong\\u003e, 44-57 (2009).\\u003c/li\\u003e\\n\\u003cli\\u003eSherman, B.T.\\u003cem\\u003e et al.\\u003c/em\\u003e DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e50\\u003c/strong\\u003e, W216-W221 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eLangmead, B. \\u0026amp; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. \\u003cem\\u003eNat Methods\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, 357-9 (2012).\\u003c/li\\u003e\\n\\u003cli\\u003eLi, H.\\u003cem\\u003e et al.\\u003c/em\\u003e The Sequence Alignment/Map format and SAMtools. \\u003cem\\u003eBioinformatics\\u003c/em\\u003e \\u003cstrong\\u003e25\\u003c/strong\\u003e, 2078-9 (2009).\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Model-based analysis of ChIP-Seq (MACS). \\u003cem\\u003eGenome Biol\\u003c/em\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e, R137 (2008).\\u003c/li\\u003e\\n\\u003cli\\u003eQuinlan, A.R. \\u0026amp; Hall, I.M. BEDTools: a flexible suite of utilities for comparing genomic features. \\u003cem\\u003eBioinformatics\\u003c/em\\u003e \\u003cstrong\\u003e26\\u003c/strong\\u003e, 841-2 (2010).\\u003c/li\\u003e\\n\\u003cli\\u003eHeinz, S.\\u003cem\\u003e et al.\\u003c/em\\u003e Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. \\u003cem\\u003eMol Cell\\u003c/em\\u003e \\u003cstrong\\u003e38\\u003c/strong\\u003e, 576-89 (2010).\\u003c/li\\u003e\\n\\u003cli\\u003eRobinson, J.T.\\u003cem\\u003e et al.\\u003c/em\\u003e Integrative genomics viewer. \\u003cem\\u003eNat Biotechnol\\u003c/em\\u003e \\u003cstrong\\u003e29\\u003c/strong\\u003e, 24-6 (2011).\\u003c/li\\u003e\\n\\u003cli\\u003eRamirez, F., Dundar, F., Diehl, S., Gruning, B.A. \\u0026amp; Manke, T. deepTools: a flexible platform for exploring deep-sequencing data. \\u003cem\\u003eNucleic Acids Res\\u003c/em\\u003e \\u003cstrong\\u003e42\\u003c/strong\\u003e, W187-91 (2014).\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"nature-portfolio\",\"isNatureJournal\":true,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Nature Portfolio\",\"twitterHandle\":\"\",\"acdcEnabled\":false,\"dfaEnabled\":false,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7576931/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7576931/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe establishment of cell type\\u0026ndash;specific chromatin landscapes is essential for cellular identity, but how these landscapes are generated remains poorly understood. Here, we demonstrate that the chromatin remodeler SMARCA5 establishes epigenetic priming that is required for retinoic acid (RA)\\u0026ndash;induced differentiation in the male germline. Germ cell\\u0026ndash;specific deletion of \\u003cem\\u003eSmarca5\\u003c/em\\u003e results in a complete loss of differentiating spermatogonia, phenocopying vitamin A-deficient mice that lack RA signaling. During the perinatal transition from prospermatogonia to undifferentiated spermatogonia, SMARCA5 is recruited to binding sites of the transcription factor DMRT1, which are located at distal putative enhancers and promoters of germline genes. The SMARCA5\\u0026ndash;DMRT1 pioneer complex establishes chromatin accessibility at these loci, generating poised enhancers and promoters that serve as RA receptor (RAR)\\u0026ndash;binding sites. Thus, SMARCA5 licenses transcriptional responses to RA that enable spermatogenic differentiation. Our findings uncover a mechanism linking pioneer factor activity to external signal responsiveness.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The SMARCA5–DMRT1 Pioneer Complex Establishes Epigenetic Priming to Direct Male Germline Development\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-10-08 08:22:07\",\"doi\":\"10.21203/rs.3.rs-7576931/v1\",\"editorialEvents\":[],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"nature-communications\",\"isNatureJournal\":true,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"NCOMMS\",\"sideBox\":\"Learn more about [Nature Communications](http://www.nature.com/ncomms/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://mts-ncomms.nature.com/\",\"title\":\"Nature Communications\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature Communications\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"2708274d-c560-4e41-b8ca-a4a4baedc57c\",\"owner\":[],\"postedDate\":\"October 8th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[{\"id\":54812908,\"name\":\"Biological sciences/Developmental biology/Germline development/Spermatogenesis\"},{\"id\":54812909,\"name\":\"Biological sciences/Developmental biology/Epigenetic memory\"}],\"tags\":[],\"updatedAt\":\"2025-10-08T08:22:07+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-10-08 08:22:07\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7576931\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7576931\",\"identity\":\"rs-7576931\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}