{"paper_id":"494c7de2-86b7-43d2-ad12-36aa6172b16f","body_text":"Benzoylaconine Modulates LPS-Induced Responses through Inhibition of Toll-Like Receptor-Mediated NF-κB and MAPK Signaling in RAW264.7 Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Benzoylaconine Modulates LPS-Induced Responses through Inhibition of Toll-Like Receptor-Mediated NF-κB and MAPK Signaling in RAW264.7 Cells Changkai Zhou, Jing Gao, Hongyan Ji, Wenjing Li, Xiaomin Xing, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-190441/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Jul, 2021 Read the published version in Inflammation → Version 1 posted 4 You are reading this latest preprint version Abstract Previous studies have shown that benzoylaconine (BAC), a representative monoester alkaloid, has a potential anti-inflammatory effect. This study investigated the underlying molecular mechanisms using the mode of LPS-activated RAW264.7 macrophage cells. Our findings showed that BAC significantly suppressed the release of pro-inflammatory cytokines and mediators, including IL-6, TNF-α, IL-1β, ROS, NO, and PGE 2 . BAC treatment also effectively downregulated the elevated protein levels of iNOS and COX-2 induced by LPS in a dose-dependent manner. In this study, we found that BAC inhibited LPS-induced NF-κB activation by reducing the phosphorylation and degradation of IκBα by Western blotting and blocking the nuclear translocation of p65 using an immunofluorescence assay. The elevated protein levels of JNK, p38, and ERK phosphorylation after LPS stimulation were restored effectively by BAC treatment. Moreover, LPS-induced phosphorylation of TAK1, which is a crucial upstream regulatory factor of Toll-like receptor-induced MAPK and NF-κB signaling, was inhibited by BAC in activated RAW264.7 macrophages. These findings demonstrated that BAC exhibited an anti-inflammatory effect by inhibition of Toll-like receptor-induced MAPK and NF-κB pathways, indicating that it could potentially be used for treating inflammatory diseases. Clinical Pharmacology BAC TLR TAK1 NF-κB MAPKs anti-inflammation. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Inflammation has a protective role when the body is exposed to harmful stimulation, such as tissue injury and infection. Numerous diseases, including cancer, arthritis, atherosclerosis, asthma, and sepsis, are closely associated with an uncontrolled inflammatory response [1, 2, 3]. Thus, exploring new drugs that can target uncontrolled inflammatory processes is considered an effective strategy to treat these diseases [4]. During immune response processes, such as the secretion of cytokines and antigen presentation, macrophages belonging to the group of innate immune cells can be recruited to the site of inflammation [5, 6]. After LPS stimulation, macrophages initiate a series of inflammatory responses by activating specific signaling cascades and releasing both pro-inflammatory cytokines and mediators, including interleukin (IL)-6, tumor necrosis factor (TNF)-α, IL-1β, reactive oxygen species (ROS), nitric oxide (NO), and prostaglandin E 2 (PGE 2 ). Toll-like receptors (TLRs), transmembrane proteins expressed on various immune cells, influence innate immune cell activation [7]. For macrophages to induce inflammatory responses, it is essential that the N-terminal region of a TLR recognizes a pathogen molecule, such as LPS [8]. Then, the LPS-induced TLR activation triggers downstream signaling pathways involving both nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) [9]. The NF-κB pathway has a key role during inflammatory responses by regulating the transcription of certain genes encoding growth factors, pro-inflammatory cytokines, and inducible enzymes, including cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) [10, 11]. Upstream IκB kinase (IKK) phosphorylation triggered by activated transforming growth factor beta-activated kinase 1 (TAK1) when LPS binds to TLR is a key step for NF-κB activation. IKK activation leads to IκB phosphorylation and ubiquitin-dependent degradation, promoting NF-κB dissociation from the IκB/NF-κB in the cytoplasm and translocation to the nucleus, which subsequently initiates pro-inflammatory gene expression and the inflammatory response [10, 12]. Furthermore, TAK1 activation also activates the MAPK family, including c-Jun N-terminal kinase (JNK), p38, and extracellular signal-regulated kinase (ERK), which then regulates the expression of transcription factor activator protein-1 (AP-1), a protein closely linked to various cellular processes, such as cell survival, differentiation, apoptosis, and pro-inflammatory cytokine production [13]. Therefore, downstream signaling molecules of TLR involving MAPK and NF-κB pathways are effective therapeutic targets of anti-inflammatory drugs for inflammation treatment. BAC (Fig. 1) is widely found in Aconitum plants, which are traditional Chinese medicines that have various pharmacological properties, such as anti-inflammatory, analgesic, and anti-tumor activities. The main pharmacological activity components of Aconitum plants are different forms of alkaloids, such as diester-diterpenoid and monoester-diterpenoid alkaloids, which are closely associated with pharmacological effects and toxicity. Compared to aconitine (AC), which belongs to diester-diterpenoid alkaloids possessing highly neurotoxic and cardiotoxic activities with an LD 50 of approximately 1.8 mg/kg in mice, BAC is a monoester-diterpenoid alkaloid that has a LD 50 of 1,500 mg/kg, i.e., it possesses a much lower toxicity [14, 15]. The following research focused on BAC due to its considerable pharmacological activity and low toxicity. Previous studies have reported that BAC possesses potential anti-inflammatory activity, but its molecular mechanisms of anti-inflammatory action have remained unclear until now, preventing BAC’s clinical use as a therapeutic drug for inflammation-related diseases. Our current study investigated the molecular mechanisms underlying the anti-inflammatory action of BAC in LPS-activated RAW264.7 macrophage cells. We found that the anti-inflammatory activity of BAC is mediated by the suppression of TLR-induced MAPK and NF-κB activation. Materials And Methods Materials BAC (purity ≥ 98%) and RAW264.7 cells were provided by Yousi Scientific Co., Ltd., and the Chinese Academy of Sciences (Shanghai, China). LPS from Escherichia coli and TPCK (NF-κB inhibitor) were obtained from Sigma (St. Louis, MO, USA). SB202190 (p38 MAPK inhibitor), U0126 (ERK inhibitor), SP600125 (JNK inhibitor), and Cell-Counting Kit-8 (CCK-8) were obtained from Medchem Express (St. Louis, MO, USA). Trizol and phenylmethanesulfonyl fluoride (PMSF) were acquired from Ambion (CA, USA) and Aladdin (Shanghai, China). HiScript Reverse Transcriptase and SYBR Green Master Mix were provided by VAZYME (Nanjing, China). ROS Assay Kit, BCA Protein Assay Kit, radioimmunoprecipitation assay (RIPA), and phosphatase inhibitor cocktail were acquired from Beyotime (Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were obtained from Gibco (Grand Island, NY). Anti-NF-κB, anti-JNK, anti-p38, anti-ERK1/2, anti-TAK1, anti-p-NF-κB, anti-p-JNK, anti-p-p38, anti-p-ERK1/2, and anti-p-TAK1 antibodies were purchased from Abcam (Cambridge, UK). Anti-IκBα and anti-p-IκBα antibodies were obtained from Affinity Bio Reagents (Golden, CO, USA). RAW264.7 Murine Macrophage Culture Culture medium was used to dilute the stock solution of LPS to 1 μg/mL before use. Cells cultured in DMEM containing 10% FBS at 37°C in a 5% CO 2 moist atmosphere were pretreated with the indicated concentrations of BAC for 1 h before co-treatment with 1 μg/mL LPS at different time points. CCK-8 Assay RAW264.7 cells were plated at 1.5×10 4 cells/well in 96-well plates overnight and treated with BAC (0.1, 1, 10, 100 and 500 μM) for 1 h before 1 μg/mL LPS stimulation in triplicate. Then, 10 mL of CCK-8 buffer was added to each well, and cells were incubated at 37°C for 24 h. FlexStation 3 microplate reader (Molecular Devices, CA, USA) was used to detect the absorbance at the wavelength of 450 nm. NO Assay NO levels in activated macrophages were determined using Griess reagent, which could measure the nitrates and nitrites concentrations. U0126, SB202190, TPCK, and SP600125 was administered to cells separately with or without BAC (10 μM) for 1 h before LPS (1 μg/mL) stimulation for an additional 24 h period. Then, 50 μL of Griess reagent was mixed with 50 μL of culture medium in 96-well plates and the reaction was left to proceed for 5 min. After collecting the supernatant, an NO Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) was used to determine the NO production in activated macrophages, and a microplate reader was used to detect the absorbance at 540 nm. ROS Assay Cells were pretreated with BAC (1, 10, and 100 μM) for 1 h before LPS (1 μg/mL) stimulation for 24 h to detect the intracellular ROS levels. The media were then removed before cells were incubated with DCFH-DA (10 μM) for 20 min. Olympus BX53 fluorescence microscope (Olympus, Japan) was used to measure ROS’s level as the mean fluorescence intensity after sufficient washing. Excitation and emission were detected at the wavelengths of 488 nm and 525 nm, respectively. ELISA Cells were pretreated with BAC (1, 10, and 100 μM) for 1 h before LPS (1 μg/mL) stimulation for 24 h in the medium to detect pro-inflammatory cytokine levels. ELISA kits (Elabscience, Wuhan, China) were used to determine the production of IL-6, IL-1β, TNF-α, and PGE 2 following the manufacturer's instructions. Quantitative Real-Time PCR Detecting After treatment, total RNA was extracted with Trizol and converted to cDNA using the HiScript Reverse Transcriptase, according to the manufacturer’s recommendations. The primer sequences used in our study were as follows: β-actin (sense: CACGATGGAGGGGCCGGACTCATC, antisense: TAAAGACCTCTATGCCAACACAGT); IL-1β (sense: TCAGGCAGGCAGTATCACTC, antisense: AGCTCATATGGGTCCGACAG); TNF-α (sense: GCCTATGTCTCAGCCTCTTCT, antisense: TTGTGAGTGTGAGGGTCTGG); and IL-6 (sense: GGAGTTCCGTTTCTACCTGG, antisense: GCCGAGTAGACCTCATAGTG). SYBR Green Master Mix and ABI QuantStudio 6 Real-Time PCR System were used to quantitate the relative mRNA concentrations. β-actin was used as a reference gene, and data from the relative gene expression were analyzed using the 2 -ΔΔCt method. Western Blot Assay After BAC or/and LPS treatment, macrophages were washed three times with ice-cold phosphate-buffered saline (PBS), and the whole-cell proteins were extracted using RIPA buffer supplemented with PMSF and phosphatase inhibitor cocktail. Subsequently, the total protein concentration was measured using the BCA protein assay. After separation by electrophoresis, 40 μg protein was transferred onto the PVDF membranes (Millipore, Billerica, MA, USA), which were then blocked for 2 h with 5% nonfat milk Tris-buffered saline Tween 20 (TBST). Subsequently, membranes were incubated with specific primary rabbit antibodies and washed five times with TBST, followed by incubation for 2 h with goat anti-rabbit IgG HRP at room temperature. Finally, each membrane was washed with TBST and visualized using the ECL substrate (Beyotime, Shanghai, China). Immunofluorescent Assay After BAC (100 μM) pretreatment for 1 h, LPS stimulation for 20 min, macrophages were stimulated by LPS (1 μg/mL) for 30 min to detect the location of NF-κB p65 in activated macrophages. After washing twice with PBS for 20 min, cells fixed with 4% paraformaldehyde for 15 min were permeabilized with 0.5% Triton X-100 for 30 min. Then cells were blocked with normal goat serum before incubation with rabbit anti-NF-κB p65 antibody (dilution 1:100) at 4°C overnight. After incubation with Cy3-labeled goat anti-rabbit IgG (dilution 1:100) as secondary antibodies in the dark for 30 min and sufficient washing, cells were stained with DAPI (0.5 μg/mL) for 10 min. Stained cells were visualized under a BX53 fluorescence microscope (Olympus, Japan). Statistical Analysis All data were presented as mean ± SD. Statistical analyses were performed using SPSS v22 software (IBM, Armonk, NY, USA). P-values of < 0.05 were considered statistically significant. Results The effect of BAC on cell viability and production of pro-inflammatory cytokines The CCK-8 assay was used to detect the viability of activated macrophages. Indicated concentrations of BAC had no obvious cytotoxicity up to 500 μM (Fig. 2a), suggesting that BAC does not affect cells with subsequent experimental concentrations. Next, the effect of BAC on the levels of pro-inflammatory cytokines was investigated by ELISA. LPS treatment significantly increased IL-1β, TNF-α, and IL-6 levels to 111.30, 1591.12, and 960.90 pg/mL; however, treatment with BAC markedly decreased their levels to 43.34, 75.96, and 83.40 pg/mL (Fig. 2b, c, d), respectively. Moreover, we used quantitative real-time PCR to determine if the inhibitory effects of BAC on this cytokine release correlated with gene expression regulation. Treatment with BAC dose-dependently downregulated the mRNA transcription of these cytokines (Fig. 2e, f, g). Our results suggested that BAC attenuated the inflammatory response by suppressing these cytokines’ synthesis and release in activated macrophages. The effect of BAC on pro-inflammatory mediators production ELISA was used to determine the anti-inflammatory effect of BAC on PGE 2 , NO, and ROS levels in activated macrophages. The production of PGE 2 was significantly upregulated compared with control cells after LPS stimulation, whereas 1, 10, or 100 μM BAC treatment markedly decreased PGE 2 levels by 8.2%, 46.6%, and 73.0% (Fig. 3a), respectively. LPS treatment induced an observable elevation of NO levels in RAW264.7 macrophages, while BAC treatment significantly suppressed NO production as expected. Meanwhile, treatment with 1, 10, or 100 μM BAC dose-dependently decreased ROS levels (Fig. 3c), indicating that BAC also showed an inhibitory effect on ROS release. Together, these results suggested that the extensive anti-inflammatory effects of BAC were exerted by suppressing these mediators production in LPS-induced macrophages. Furthermore, treatment of BAC combined with SB202190, SP600125, U0126, or TPCK resulted in less LPS-induced NO production in macrophages (Fig. 3b), suggesting that the anti-inflammatory activity of BAC might be associated with effects on the MAPK and NF-κB pathways. The effect of BAC on the expression of COX-2 and iNOS COX-2 and iNOS play critical roles in the generation of PGE 2 and NO, respectively [16]. Here, we used Western blot to examine the regulatory effect of BAC on the protein levels of COX-2 and iNOS. LPS-stimulated RAW264.7 cells exhibited remarkably elevated protein levels, whereas treatment with BAC effectively downregulated these expressions, and a dose-dependent response was seen for BAC (Fig. 4). These results provided supportive evidence that suppression of PGE 2 and NO release by BAC was related to the downregulation of COX-2 and iNOS levels. The effect of BAC on the MAPK Pathway MAPKs function as critical regulators in the inflammatory process by regulating AP-1 transcription factor activation [17, 18, 19]. Hence, to further explore the possible mechanism of BAC for suppressing pro-inflammatory mediator production, we examined the effect of BAC on the expression of MAPKs in activated macrophages. As expected, LPS induced an increase in the phosphorylation of MAPKs, an alteration that was counteracted effectively by BAC treatment in a dose-dependent manner. For instance, the values of p-p38/p38, p-JNK/JNK, and p-ERK/ERK decreased by 13.6%–58.9%, 18.3%–52.7%, and 39.4%–64.9% with 1, 10, or 100 μM BAC compared with activated macrophages (Fig. 5). Meanwhile, both BAC and LPS did not affect the non-phosphorylated MAPK’s levels. Therefore, the above findings suggest that the BAC’s inhibitory effect in activated macrophages might be related to the regulation of the MAPK signaling cascade. The effect of BAC on activation of NF-κB Since NF-κB, which can be activated by LPS stimulation in macrophages, is a vital regulatory factor in the expression of inflammation-related mediators and cytokines, we next investigated whether treatment with BAC could affect the NF-κB activation. Moreover, the nuclear fractions of LPS-activated RAW264.7 macrophages were isolated to measure the effect on nuclear translocation. Stimulation by LPS remarkably induced an elevation of p65 phosphorylation levels and nuclear translocation, whereas treatment with BAC could dose-dependently inhibit elevations of the p65 phosphorylation and nuclear translocation (Fig. 6a, b, d). The location of the p65 subunit of NF-κB was detected using immunofluorescence assay, which further supported our above findings (Fig. 6e). Furthermore, BAC significantly dose-dependently attenuated IκBα phosphorylation and degradation in activated macrophages(Fig. 6c). These results suggested that one of the mechanisms by which BAC attenuates inflammatory responses induced by LPS is through inhibition of NF-κB activation. The effect of BAC on TAK1 phosphorylation TAK1 is a crucial upstream adaptor protein in TLR-mediated MAPK and NF-κB pathways. Next, the effect of BAC on TAK1 phosphorylation was assessed to investigate whether its inhibition of MAPK and NF-κB was related to TLR signaling regulation. LPS stimulation significantly increased the protein level of phosphorylated TAK1. However, BAC treatment markedly downregulated the elevation of phosphorylated TAK1 in LPS-activated RAW264.7 macrophages (Fig. 7). These findings indicated that BAC exhibited significant anti-inflammatory activity in activated macrophages by inhibiting TLR-mediated MAPK and NF-κB signaling pathways. Discussion Classic non-steroidal anti-inflammatory drugs may lead to patient intolerance and cause some side effects when used for inflammatory diseases [20]. Thus, it is necessary to explore and develop new anti-inflammatory drugs. Recent studies have shown that some natural monomer components extracted from herbs exert anti-inflammatory activity, such as BAC, which is widely found in Aconitum plants. However, the molecular mechanisms by which BAC regulates the inflammatory process in activated macrophages have not been systemically elucidated. This study confirmed the anti-inflammation property of BAC and investigated its mechanism of action by LPS-treated macrophages. Our study is the first to show that BAC exerts an anti-inflammatory effect in LPS-activated macrophages via inhibition of the TLR-related NF-κB and MAPK pathways. Furthermore, our results revealed that BAC could be used as both a promising anti-inflammatory drug and a new inhibitor of MAPK and NF-κB signaling. Inflammation is an essential pathological process of living tissues to eliminate causative agents and promote tissue repair [21]. As we know, macrophages can modulate inflammation processes by regulating the production of various cytokines. Cytokines released by macrophages can cause the neutrophils activation in the early stages of inflammation, leading to inflammatory damage. LPS-activated macrophages are the most common model for studying inflammatory responses. LPS-induced activation of innate immune cells like macrophages could trigger an inflammatory response, leading to excess production of TNF-α, IL-6, ROS, NO, IL-1β, and PGE 2 [22, 23, 24]. An excessive release could cause tissue damage and pathological changes, contributing to the progression and exacerbation of inflammation. Our experiment demonstrated that BAC significantly suppressed the production of these cytokines and mediators in LPS-activated macrophages. Meanwhile, quantitative real-time PCR results showed that the gene transcription of IL-1β, IL-6, and TNF-α was also significantly and dose-dependently downregulated by BAC. Previous studies have revealed the vital roles of COX-2 and iNOS, which are specific inducible enzymes in cells modulating the production of key inflammatory mediators, such as PGE 2 and NO, during the development of inflammatory diseases [16]. Their expression is upregulated, which serves as a host defense against harmful stimulation. However, their overexpression is associated with various diseases, including cancer, arthritis, and asthma [25, 26, 27, 28]. Thus, the regulation of their expression is a promising anti-inflammatory strategy. We found that BAC effectively inhibited their expression in LPS-activated macrophages, indicating that the suppression of several mediators released by BAC is related to the downregulation of iNOS and COX-2 expression. Above all, our present data showed that BAC has a promising therapeutic potential in clinical inflammatory diseases by regulating iNOS and COX-2 expression. Our subsequent experiments focused on the molecular mechanisms of the anti-inflammatory properties of BAC. As recognition receptors that initiate defense reactions by sensing various endogenous molecules and invading pathogens, TLRs have a critical effect on the activation of specific signaling cascades, such as NF-κB and MAPKs. LPS is the most important ligand of TLR4, which is one of the TLRs expressed in the surface of macrophages and can cause the oligomerization of TLR4 when binding to it, further leading to the permutations and combinations of Toll-interleukin-1 receptor (TIR) domains to recruit downstream adapter molecules to initiate signal transduction in the cytoplasm. Until now, five adaptor proteins have been identified, namely TIRAP, MyD88, TRAM, TRIF, and SARM [4]. Cell-signaling is initiated by activated TLR4 via MyD88-dependent or independent pathways to synthesize several downstream products [29]. The NF-κB family, which consists of NF-κB1 (p50), NF-κB2 (p52), RelA (p65), RelB, and c-Rel proteins, was previously shown to be closely related to various human diseases and plays a crucial role in inflammatory processes [30]. In non-activated macrophages, the NF-κB dimer is bound to IκBα, which belongs to the IκB family of inhibitory protein, and therefore exists in an inactive form in the cytosol. When LPS binds to TLRs in the macrophage membrane, NF-κB signaling is initiated in response to stimulation by LPS [31]. TLR4 expression in macrophages induced by LPS leads to the IκB kinase activation during the process of NF-κB activation, and then triggers the IκBα phosphorylation and degradation. The nuclear localization signals on the NF-κB subunits are unmasked by the IκBα degradation, permitting the p65 subunit, which is separated from NF-κB/Rel complexes, to translocate from the cytoplasm to the nucleus and bind to a specific DNA site to initiate the expression of genes associated to the inflammatory process [10]. The most critical step is the NF-κB p50/p65 dimer translocation to the nucleus for the NF-κB pathway activation [32]. In this study, an immunofluorescence assay was used to observe the p65 subunit location, and we concluded that BAC significantly inhibited p65 translocation in activated macrophages by inhibiting IκBα phosphorylation and degradation. Moreover, the above results demonstrated that BAC could decrease pro-inflammatory cytokines and enzyme expression by suppressing the activation of NF-κB p65. The MAPK signaling pathway is linked to some biological processes, such as gene transcription, apoptosis, proliferation, and differentiation. Besides the NF-κB pathways, MAPKs have a major role in numerous pro-inflammatory gene expression. For example, iNOS and COX-2 expression induced by some inflammatory products like LPS is regulated by MAPKs. Furthermore, multiple lines of evidence have demonstrated that MAPKs are associated with regulating the transcriptional activity of NF-κB and are considered a promising target for reducing inflammation. The phosphorylation of JNK, p38, and ERK triggered by TLR4 that transduces LPS signaling, is linked with the activation of the MAPK pathways, which can activate transcription factors and induce the expression of inflammatory molecules in the nucleus [33, 34]. Our present study revealed that treatment with BAC has a significant inhibitory effect on the expression of p-JNK, p-p38, and p-ERK protein in LPS-activated macrophages. Moreover, LPS-activated macrophages treated with BAC combined with p38, NF-κB, JNK, or ERK inhibitor produced less NO than when treated with BAC alone. Hence, our data indicated that BAC mitigated the LPS-induced inflammatory response through the inhibition of the MAPK and NF-κB signaling pathways. TAK1, a vital signaling molecule belonging to the MAP kinase kinase kinase (MAP3K) family, is activated by a TLR-TIRAP-MyD88 dependent pathway, triggering downstream pathways, including JNK, p38, ERK, and NF-κB [34, 35, 36]. LPS stimulation recruits TAK1 to TLR4 and leads to NF-κB activation via IκB proteins phosphorylation and degradation. Meanwhile, MEK1/2MKK3/6 and MKK4/7 are directly phosphorylated by p-TAK1, which could activate the MAPK signaling pathway [35, 36]. Thus, TAK1 is believed to be a crucial adaptor protein connecting TLR4 with two vital downstream cascade branches, MAPK and NF-κB, in the macrophage model stimulated by LPS. In our present study, whether BAC affected the activation of TAK1 was investigated in LPS-activated macrophages. The results demonstrated that BAC could significantly downregulate the elevation of p-TAK1, which subsequently suppressed downstream MAPK and NF-κB pathways. As mentioned above, we found that blocking the activation of a key upstream factor, TAK1, was a reason for inhibiting TLR-mediated NF-κB and MAPK pathways by BAC. Signaling pathways related to the anti-inflammatory activity of BAC are shown in Fig. 8. To sum up, our results first demonstrate that the mechanism underlying the attenuation of inflammatory responses by BAC in activated macrophages is through the inhibition of the TLR/NF-κB and MAPK pathways, contributing to the decrease in the levels of pro-inflammatory mediators and cytokine production. Our novel findings provide valuable information for the potential of BAC as a therapeutic agent able to target specific signal transduction for inflammation-related diseases. Declarations Funding This work was supported by the Major Science and Technology Innovation Project of Shandong Province (2018CXGC1304), Science and Technology Development Project of Traditional Chinese Medicine of Shandong Province (2019-0400), Technology Development Project of Traditional Chinese Medicine of Qingdao (2020-zyy031). Conflict of interest The authors declare that they have no conflict of interest. Ethics approval and Consent to participate Not applicable Consent for publication All the authors agree to submit the final version of manuscript for publication. Availability of data and material All data generated or analyzed during this study are included in this published article. Code availability Not applicable Authors' contributions Study design: Changkai Zhou and Fanbo Jing Definition of intellectual content: Hongyan Ji Literature research: Wenjing Li and Minxiao Xing Experimental studies: Donghua Liu Data acquisition: Qie Guo Data analysis: Donghua Liu and Qie Guo Statistical analysis: Lihua Zhou Manuscript preparation: Changkai Zhou Manuscript editing: Hongyan Ji Manuscript review: Fanbo Jing References Medzhitov, R. 2008. Origin and physiological roles of inflammation. Nature 454 (24): 428–435. Christian, F., E. L. Smith, and R. J. Carmody. 2016. The regulation of NF-kappa B subunits by phosphorylation. Cells 5 (1): 12. Su, H., Z. Mo, Z. Chen, and Z. Guo. 2017. Severe disease of immune imbalance in ICU: persistent inflammation immunosuppression catabolism syndrome. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue 29 (8): 760–764. Han, J. M., E. K. Lee, S. Y. Gong, J. K. Sohng, Y. J. Kang, and H. J. Jung. 2019. Sparassiscrispa exerts anti-inflammatory activity via suppression of TLR-mediated NF-κB and MAPK signaling pathways in LPS-induced RAW264.7 macrophage cells. Journal of Ethnopharmacology 231 (1): 10–18. He, J., J. Li, H. Liu, Z. Yang, F. Zhou, T. Wei, Y. Dong, H. Xue, L. Tang, and M. Liu. 2018. Scandoside exerts anti-inflammatory effect via suppressing NF-κB and MAPK signaling pathways in LPS-induced RAW 264.7 macrophages. International Journal of Molecular Sciences 19 (2): 457. Roger, T., A. L. Chanson, M. Knaup-Reymond, and T. Calandra. 2005. Macrophage migration inhibitory factor promotes innate immune responses by suppressing glucocorticoid-induced expression of mitogen-activated protein kinase phosphatase-1. European Journal of Immunology 35 (12): 3405–3413. Yee, N. K., and J. A. Hamerman. 2013. β 2 integrins inhibit TLR responses by regulating NF-κB pathway and p38 MAPK activation. European Journal of Immunology 43 (3): 779–792. Doyle, S. L., and L. A. O'Neill. 2006. Toll-like receptors: from the discovery of NF-κB to new insights into transcriptional regulations in innate immunity. Biochemical Pharmacology 72 (9): 1102–1113. Li, H., J. H. Yoon, and H. J. Won, et al. 2017. Isotrifoliol inhibits pro-inflammatory mediators by suppression of TLR/NF-κB and TLR /MAPK signaling in LPS-induced RAW264.7 cells. International Immunopharmacology 45: 110–119. Zhang, Z., and B. Rigas. 2006. NF-kappaB, inflammation and pancreatic carcinogenesis: NF-kappaB as a chemoprevention target (review). International Journal of Oncology 29 (1): 185–192. Perkins, N. D. 2007. Integrating cell-signalling pathways with NF-kappaB and IKK function. Nature Reviews Molecular Cell Biology 8 (1): 49–62. Zeng, K. W., H. Fu, G. X. Liu, and X. M. Wang. 2010. Icariin attenuates lipopolysaccharide-induced microglial activation and resultant death of neurons by inhibiting TAK1/IKK/NF-κB and JNK/p38 MAPK pathways. International Immunopharmacology 10 (6): 668–678. Kim, E. K., and E.J.Choi. 2010. Pathological roles of MAPK signaling pathways in human diseases. Biochim Biophys Acta 1802 (4): 396–405. Zhang, H.,S., W. Sun, X. Zhang, Z. Xie, Y. Zhu, Chai, and G. Zhang. 2016. Biological activities and pharmacokinetics of aconitine, benzoylaconine, and aconine after oral administration in rats. Drug Testing and Analysis 8 (8): 839–846. Deng, X. H., J. J. Liu, X. J. Sun, J. C. Dong, and J. H. Huang. 2019. Benzoylaconine induces mitochondrial biogenesis in mice via activating AMPK signaling cascade. Acta Pharmacologica Sinica 40 (5): 658–665. Xiong, H., Y. Cheng, X. Zhang, and X. Zhang. 2014. Effects of taraxasterol on iNOS and COX-2 expression in LPS-induced RAW 264.7 macrophages. Journal of Ethnopharmacology 155 (1): 753–757. Yu, D., D. Yu, M. Shi, J. Bao, X. Yu, Y. Li, and W. Liu. 2016. Genipin ameliorates hypertension-induced renal damage via the angiotensin II-TLR/MyD88/MAPK pathway. Fitoterapia 112: 244–253. Moon, D. O., Y. H. Choi, N. D. Kim, Y. M. Park, and G. Y. Kim. 2007. Anti-inflammatory effect of β-lapachone in lipopolysaccharide-stimulated BV2 microglia. International Immunopharmacology 7 (4): 506–514. Lai, J. L., Y. H. Liu, C. Liu, M. P. Qi, R. N. Liu, X. F. Zhu, Q. G. Zhou, Y. Y. Chen, A. Z. Guo, and C. M. Hu. 2017. Indirubin inhibits LPS-induced inflammation via TLR4 abrogation mediated by the NF-κB and MAPK signaling pathways. Inflammation 40 (1): 1–12. Mu, C. Y., M. F. Wu, and Z. Li. 2018. Anti-inflammatory effect of novel 7-substituted coumarin derivatives through inhibition of NF-κB signaling pathway. Chemistry & Biodiversity 16 (3): e1800559. Liang, N., Y. Sang, W. Liu, W. Yu, and X. Wang. 2018. Anti-inflammatory effects of gingerol on lipopolysaccharide-stimulated RAW 264.7 cells by inhibiting NF-κB signaling pathway. Inflammation 41 (3): 835–845. Moon, S. M., S. A. Lee, J. H. Hong, J. S. Kim, D. K. Kim, and C. S. Kim. 2018. Oleamide suppresses inflammatory responses in lps-induced raw264.7 murine macrophages and alleviates paw edema in a carrageenan-induced inflammatory rat model. International Immunopharmacology 56: 179–185. Fan, G. W., Y. Zhang, X. Jiang, Y. Zhu, B. Wang, L. Su, W. Cao, H. Zhang, and X. Gao. 2013. Anti-inflammatory activity of baicalein in LPS-stimulated RAW 264.7 macrophages via estrogen receptor and NF-κB-dependent pathways. Inflammation 36 (6): 1584–1591. Hu, W., X. Yang, C. Zhe, Q. Zhang, L. Sun, and K. Cao. 2011. Puerarin inhibits iNOS, COX-2 and CRP expression via suppression of NF-κB activation in LPS-induced RAW 264.7 macrophage cells. Pharmacological Reports 63 (3): 781–789. El-Ashmawy, N. E., N. F. Khedr, H. A. El-Bahrawy, and S. A. El-Adawy. 2017. Downregulation of iNOS and elevation of camp mediate the anti-inflammatory effect of glabridin in rats with ulcerative colitis. Inflammopharmacology 26 (2): 551–559. Inam, A., M. Shahzad, A. Shabbir, H. Shahid, and K. Shahid, andA. Javeed. 2017. Carica papaya ameliorates allergic asthma via down regulation of IL-4, IL-5, eotaxin, TNF-α, NF-κB, and iNOS levels. Phytomedicine 32: 1–7. Hashemi Goradel, N., et al. 2019. Cyclooxygenase-2 in cancer: a review. Journal of Cellular Physiology 234 (5): 5683–5699. Zhang, Z. B., et al. 2020. Copper oxide nanoparticles from Rabdosiarubescens attenuates the complete Freund’s adjuvant (CFA) induced rheumatoid arthritis in rats via suppressing the inflammatory protein COX-2/PGE2. Arabian Journal of Chemistry 13 (6): 5639–5650. Berghaus, L. J., J. N. Moore, D. J. Hurley, M. L. Vandenplas, B. P. Fortes, M. A. Wolfert, and G. J. Boons. 2010. Innate immune responses of primary murine macrophage-lineage cells and RAW 264.7 cells to ligands of Toll-like receptors 2, 3, and 4. Comparative Immunology Microbiology & Infectious Diseases 33 (5): 443–454. Vallabhapurapu, S., and M. Karin. 2009. Regulation and function of NF-kappaB transcription factors in the immune system. Annual Review of Immunology 27: 693–733. Olefsky, J. M., and C. K. Glass. 2010. Macrophages, inflammation, and insulin resistance. Annual Review of Physiology 72: 219–246. Baldwin, A. S. Jr. 1996. The NF-kappa B and I kappa B protein: new discoveries and insights. Annual Review of Immunology 14: 649–683. Xie, Y. H., L. Wang, and H. Sun, et al. 2018. Polysaccharide from alfalfa activated raw 264.7 macrophages through mapk and NF-κB signaling pathways. International Journal of Biological Macromolecules 126: 960–968. Kagan, J. C., and R. Medzhitov. 2006. Phosphoinositide-mediated adaptor recruitment controls toll-like receptor signaling. Cell 125 (5): 943–955. Dai, W. L., B. Yan, Y. N. Bao, J. F. Fan, and J. H. Liu. 2020. Suppression of peripheral NGF attenuates neuropathic pain induced by chronic constriction injury through the TAK1-MAPK/NF-κB signaling pathways. Cell Commun and Signal 18 (1): 66. Ding, Y., H. L. Yang, W. Xiang, X. J. He, W. Liao, and Z. W. Yi. 2015. CD200R1 agonist attenuates lipopolysaccharide-induced inflammatory response in human renal proximal tubular epithelial cells by regulating TLR4-MyD88-TAK1-mediated NF-κB and MAPK pathway. Biochemical and Biophysical Research Communications 460 (2): 287–294. Cite Share Download PDF Status: Published Journal Publication published 16 Jul, 2021 Read the published version in Inflammation → Version 1 posted Reviews received at journal 15 Feb, 2021 Reviewers invited by journal 14 Feb, 2021 Editor assigned by journal 04 Feb, 2021 First submitted to journal 30 Jan, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-190441\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":12133103,\"identity\":\"a835e6ea-55e8-4bbe-bba7-ce5c0905565c\",\"order_by\":0,\"name\":\"Changkai Zhou\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-0675-069X\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Changkai\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":12133104,\"identity\":\"c43668b5-f2a9-4234-9b82-c245f05f79ef\",\"order_by\":1,\"name\":\"Jing Gao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Third People's Hospital of Qingdao\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing\",\"middleName\":\"\",\"lastName\":\"Gao\",\"suffix\":\"\"},{\"id\":12133105,\"identity\":\"06404df3-4813-49d4-a872-be3d5bc82ac8\",\"order_by\":2,\"name\":\"Hongyan Ji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hongyan\",\"middleName\":\"\",\"lastName\":\"Ji\",\"suffix\":\"\"},{\"id\":12133106,\"identity\":\"1fb86391-2844-4478-b465-292e7458b4e7\",\"order_by\":3,\"name\":\"Wenjing Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wenjing\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":12133107,\"identity\":\"aeb96b71-fe68-4030-b3ab-4fac9e6d04ad\",\"order_by\":4,\"name\":\"Xiaomin Xing\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaomin\",\"middleName\":\"\",\"lastName\":\"Xing\",\"suffix\":\"\"},{\"id\":12133108,\"identity\":\"c75d517d-3694-4dab-b9c0-1509b8476bad\",\"order_by\":5,\"name\":\"Donghua Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Donghua\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":12133109,\"identity\":\"e72a5c67-c3ed-446a-9cc1-9578c8711947\",\"order_by\":6,\"name\":\"Qie Guo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qie\",\"middleName\":\"\",\"lastName\":\"Guo\",\"suffix\":\"\"},{\"id\":12133110,\"identity\":\"b89d4985-825a-4147-8293-34f5f053de1e\",\"order_by\":7,\"name\":\"Lihua Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lihua\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":12133111,\"identity\":\"5dd018c2-6043-422c-879b-bc183f5a0e58\",\"order_by\":8,\"name\":\"Fanbo Jing\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBACxmYGBmYGG4n6fvbGxocfiNeSZsE4s+dws7EEsTYBtVQwbriR3ibAQ5Tydt7DrwsSJJglZz5sY5BgsJPTbSDoML406xkJEmz80oltDwoYko3NDhDUwmNmzPtDgkdydmK7gQTDgcRtRGnhSZCQMLh5sE2Ch0gtxo+BWgwMbjASr8WMGeiXBMmeRGAgGxDhF8P+M8afCxLqEvjZjz98+KHCTo6wlgYGNqQINCCgHATkgVFDVDIZBaNgFIyCEQwAomc+Jy/pK0gAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0000-0003-4666-8316\",\"institution\":\"The Affiliated Hospital of Qingdao University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fanbo\",\"middleName\":\"\",\"lastName\":\"Jing\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-01-30 11:04:11\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-190441/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-190441/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s10753-021-01478-z\",\"type\":\"published\",\"date\":\"2021-07-16T15:07:50+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":6113246,\"identity\":\"9fb93e10-a6c3-4925-bf93-9047c3042895\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:31:31\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":103061,\"visible\":true,\"origin\":\"\",\"legend\":\"Chemical structure of BAC\",\"description\":\"\",\"filename\":\"fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/1456e81602ad018ca2e02512.png\"},{\"id\":6113475,\"identity\":\"02174f16-e8e5-4fc1-a63f-221c371033b5\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:34:31\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":225646,\"visible\":true,\"origin\":\"\",\"legend\":\"Effect of BAC on cell viability and LPS-induced pro-inflammatory cytokines production in macrophages. a Macrophages were treated with BAC (0.1, 1, 10, 100, 500 μM) for 1 h and followed by LPS (1 μg/mL) stimulation for 24 h. Cell viability was measured by CCK-8 assay. b–d Macrophages were incubated with BAC (1, 10, 100 μM) for 1 h before LPS (1 μg/mL) stimulation for 24 h. ELISA was used to determine IL-1β, TNF-α, and IL-6 production. e–g Macrophages were incubated with BAC (1, 10, 100 μM ) for 1 h before LPS (1 μg/mL) stimulation for 24 h. The mRNA expression of these pro-inflammatory cytokines was determined by real-time PCR. Data are mean ± SD of three independent experiments (#P \\u003c 0.05 vs. the control group, *P \\u003c 0.05, **P \\u003c 0.01 vs. LPS-treated group).\",\"description\":\"\",\"filename\":\"fig2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/67f06eb1af963d4d93006c24.jpg\"},{\"id\":6113471,\"identity\":\"8287147c-4264-432d-8237-58147bf33edf\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:34:31\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":54492,\"visible\":true,\"origin\":\"\",\"legend\":\"Effect of BAC on LPS-induced pro-inflammatory mediators production in macrophages. Macrophages were pretreated with BAC (1, 10, 100 μM ) 1 h and followed by LPS (1 μg/mL) stimulation for 24 h. ELISA and fluorescence microscopy were used to detect a PGE2 and c ROS production, respectively. b U0126, SB202190, TPCK, and SP600125 were administered to cells separately with or without BAC (10 μM) for 1 h before LPS (1 μg/mL) stimulation for 24 h. A microplate reader was used to detect the absorbance at 540 nm.\",\"description\":\"\",\"filename\":\"fig3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/3d92db2047448297ed862866.jpg\"},{\"id\":6113473,\"identity\":\"30f58372-4b5d-4bff-8cd8-51a35ae43a3d\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:34:31\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":47591,\"visible\":true,\"origin\":\"\",\"legend\":\"Effect of BAC on LPS-induced COX-2 and iNOS protein expression in macrophages. Macrophages were pretreated with BAC (1, 10, 100 μM ) for 1 h and followed by LPS (1 μg/mL) stimulation for 24 h. a Western blotting was used to determine the protein levels. b The relative protein level of COX-2. c The relative protein level of iNOS. Data are mean ± SD of three independent experiments (#P \\u003c 0.05 vs. the control group, *P \\u003c 0.05, **P \\u003c 0.01 vs. LPS-treated group).\",\"description\":\"\",\"filename\":\"fig4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/c0625f77a9e3253acd29cbaf.jpg\"},{\"id\":6113728,\"identity\":\"d91cb89a-78d9-4be7-811a-4c486f40ca85\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:37:31\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":70155,\"visible\":true,\"origin\":\"\",\"legend\":\"Effect of BAC on LPS-induced p38, JNK, and ERK protein expression in macrophages. Macrophages were pretreated with BAC (1, 10, 100 μM ) for 1 h and followed by LPS (1 μg/mL) stimulation for 24 h. a Western blotting was used to determine protein levels. b The phosphorylation of p38. c The phosphorylation of JNK. d The phosphorylation of ERK. Data are mean ± SD of three independent experiments (#P \\u003c 0.05 vs. the control group, *P \\u003c 0.05, **P \\u003c 0.01 vs. LPS-treated group).\",\"description\":\"\",\"filename\":\"fig5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/2ace3c14d53564198a36b3a3.jpg\"},{\"id\":6113250,\"identity\":\"19a3b0b0-31f5-4393-b64d-9e866bf7589a\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:31:31\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":263121,\"visible\":true,\"origin\":\"\",\"legend\":\"Effect of BAC on LPS-induced NF-κB activation in macrophages. Macrophages were pretreated with BAC (1, 10, 100 μM ) for 1 h and then stimulated by LPS (1 μg/mL) for 30 min (d) and 24 h (b, c). Western blotting was used to determine protein levels. b LPS-induced p65 phosphorylation in macrophages. c LPS-induced IκBα phosphorylation and degradation in macrophages. d The LPS-induced translocation of p65 in the nucleus. e Images of NF-κB p65 (red) and nucleus (blue) were obtained using a fluorescence microscope (400×). Data are mean ± SD of three independent experiments (#P \\u003c 0.05 vs. the control group, *P \\u003c 0.05, **P \\u003c 0.01 vs. LPS-treated group).\",\"description\":\"\",\"filename\":\"fig6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/cc3ff34af6f0498d9802d02b.jpg\"},{\"id\":6113249,\"identity\":\"0f72f8cd-5a16-412d-b53a-0f4478af1812\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:31:31\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":32280,\"visible\":true,\"origin\":\"\",\"legend\":\"Effect of BAC on LPS-induced TAK1 phosphorylation in macrophages. Macrophages were pretreated with BAC (1, 10, 100 μM ) for 1 h and followed by LPS (1 μg/mL) stimulation for 6 h. a Western blotting was used to determine protein levels. b The phosphorylation of TAK1. Data are mean ± SD of three independent experiments (#P \\u003c 0.05 vs. the control group, *P \\u003c 0.05, **P \\u003c 0.01 vs. LPS-treated group).\",\"description\":\"\",\"filename\":\"fig7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/e7accf562ceb3317006d2525.jpg\"},{\"id\":6113729,\"identity\":\"33e41100-c6bd-4a52-b0cc-0e5e0ad3dbfb\",\"added_by\":\"auto\",\"created_at\":\"2021-02-18 22:37:31\",\"extension\":\"jpg\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":34265,\"visible\":true,\"origin\":\"\",\"legend\":\"The potential molecular mechanism of the anti-inflammatory effect by BAC.\",\"description\":\"\",\"filename\":\"fig8.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/14e0dc15de01ad8de86e9274.jpg\"},{\"id\":13666849,\"identity\":\"89ee2a5f-76b4-4ea2-ad9c-1a60d30cdcd3\",\"added_by\":\"auto\",\"created_at\":\"2021-09-17 10:50:30\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":775970,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-190441/v1/7068674b-b54e-4df0-9d0f-df535b1c4f02.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"\\u003cp\\u003eBenzoylaconine Modulates LPS-Induced Responses through Inhibition of Toll-Like Receptor-Mediated NF-κB and MAPK Signaling in RAW264.7 Cells\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eInflammation has a protective role when the body is exposed to harmful stimulation, such as tissue injury and infection. Numerous diseases, including cancer, arthritis, atherosclerosis, asthma, and sepsis, are closely associated with an uncontrolled inflammatory response [1, 2, 3]. Thus, exploring new drugs that can target uncontrolled inflammatory processes is considered an effective strategy to treat these diseases [4]. During immune response processes, such as the secretion of cytokines and antigen presentation, macrophages belonging to the group of innate immune cells can be recruited to the site of inflammation [5, 6]. After LPS stimulation, macrophages initiate a series of inflammatory responses by activating specific signaling cascades and releasing both pro-inflammatory cytokines and mediators, including interleukin (IL)-6, tumor necrosis factor (TNF)-\\u0026alpha;, IL-1\\u0026beta;, reactive oxygen species (ROS), nitric oxide (NO), and prostaglandin E\\u003csub\\u003e2\\u003c/sub\\u003e (PGE\\u003csub\\u003e2\\u003c/sub\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003eToll-like receptors (TLRs), transmembrane proteins expressed on various immune cells, influence innate immune cell activation [7]. For macrophages to induce inflammatory responses, it is essential that the N-terminal region of a TLR recognizes a pathogen molecule, such as LPS [8]. Then, the LPS-induced TLR activation triggers downstream signaling pathways involving both nuclear factor-\\u0026kappa;B (NF-\\u0026kappa;B) and mitogen-activated protein kinase (MAPK) [9]. The NF-\\u0026kappa;B pathway has a key role during inflammatory responses by regulating the transcription of certain genes encoding growth factors, pro-inflammatory cytokines, and inducible enzymes, including cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) [10, 11]. Upstream I\\u0026kappa;B kinase (IKK) phosphorylation triggered by activated transforming growth factor beta-activated kinase 1 (TAK1) when LPS binds to TLR is a key step for NF-\\u0026kappa;B activation. IKK activation leads to I\\u0026kappa;B phosphorylation and ubiquitin-dependent degradation, promoting NF-\\u0026kappa;B dissociation from the I\\u0026kappa;B/NF-\\u0026kappa;B in the cytoplasm and translocation to the nucleus, which subsequently initiates pro-inflammatory gene expression and the inflammatory response [10, 12]. Furthermore, TAK1 activation also activates the MAPK family, including c-Jun N-terminal kinase (JNK), p38, and extracellular signal-regulated kinase (ERK), which then regulates the expression of transcription factor activator protein-1 (AP-1), a protein closely linked to various cellular processes, such as cell survival, differentiation, apoptosis, and pro-inflammatory cytokine production [13]. Therefore, downstream signaling molecules of TLR involving MAPK and NF-\\u0026kappa;B pathways are effective\\u0026nbsp;therapeutic targets of anti-inflammatory drugs for inflammation treatment.\\u003c/p\\u003e\\n\\u003cp\\u003eBAC (Fig. 1) is widely found in\\u0026nbsp;\\u003cem\\u003eAconitum\\u003c/em\\u003e\\u0026nbsp;plants, which are traditional Chinese medicines that have various pharmacological properties, such as anti-inflammatory, analgesic, and anti-tumor activities. The main pharmacological activity components of\\u0026nbsp;\\u003cem\\u003eAconitum\\u003c/em\\u003e\\u0026nbsp;plants are different forms of alkaloids, such as diester-diterpenoid and monoester-diterpenoid alkaloids, which are closely associated with pharmacological effects and toxicity. Compared to aconitine (AC), which belongs to diester-diterpenoid alkaloids possessing highly neurotoxic and cardiotoxic activities with an LD\\u003csub\\u003e50\\u003c/sub\\u003e of approximately 1.8 mg/kg in mice, BAC is a monoester-diterpenoid alkaloid that has a LD\\u003csub\\u003e50\\u003c/sub\\u003e of 1,500 mg/kg, i.e., it possesses a much lower toxicity [14, 15]. The following research focused on BAC due to its considerable pharmacological activity and low toxicity.\\u003c/p\\u003e\\n\\u003cp\\u003ePrevious studies have reported that BAC possesses potential anti-inflammatory activity, but its molecular mechanisms of anti-inflammatory action have remained unclear until now, preventing BAC\\u0026rsquo;s clinical use as a therapeutic drug for inflammation-related diseases. Our current study investigated the molecular mechanisms underlying the anti-inflammatory action of BAC in LPS-activated RAW264.7 macrophage cells. We found that the anti-inflammatory activity of BAC is mediated by the suppression of TLR-induced MAPK and NF-\\u0026kappa;B activation.\\u003c/p\\u003e\"},{\"header\":\"Materials And Methods\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaterials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBAC (purity \\u0026ge; 98%) and RAW264.7 cells were provided by Yousi Scientific Co., Ltd., and the Chinese Academy of Sciences (Shanghai, China). LPS from\\u0026nbsp;\\u003cem\\u003eEscherichia coli\\u003c/em\\u003e\\u0026nbsp;and TPCK (NF-\\u0026kappa;B inhibitor) were obtained from Sigma (St. Louis, MO, USA). SB202190 (p38 MAPK inhibitor), U0126 (ERK inhibitor), SP600125 (JNK inhibitor), and Cell-Counting Kit-8 (CCK-8) were obtained from Medchem Express (St. Louis, MO, USA). Trizol and phenylmethanesulfonyl fluoride (PMSF) were acquired from Ambion (CA, USA) and Aladdin (Shanghai, China). HiScript Reverse Transcriptase and SYBR Green Master Mix were provided by VAZYME (Nanjing, China). ROS Assay Kit, BCA Protein Assay Kit, radioimmunoprecipitation assay (RIPA), and phosphatase inhibitor cocktail were acquired from Beyotime (Shanghai, China). Dulbecco\\u0026rsquo;s modified Eagle\\u0026rsquo;s medium (DMEM) and fetal bovine serum (FBS) were obtained from Gibco (Grand Island, NY). Anti-NF-\\u0026kappa;B, anti-JNK, anti-p38, anti-ERK1/2, anti-TAK1, anti-p-NF-\\u0026kappa;B, anti-p-JNK, anti-p-p38, anti-p-ERK1/2, and anti-p-TAK1 antibodies were purchased from Abcam (Cambridge, UK). Anti-I\\u0026kappa;B\\u0026alpha; and anti-p-I\\u0026kappa;B\\u0026alpha; antibodies were obtained from Affinity Bio Reagents (Golden, CO, USA).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eRAW264.7 Murine Macrophage Culture\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCulture medium was used to dilute the stock solution of LPS to 1 \\u0026mu;g/mL before use. Cells cultured in DMEM containing 10% FBS at 37\\u0026deg;C in a 5% CO\\u003csub\\u003e2 \\u003c/sub\\u003emoist atmosphere were pretreated with the indicated concentrations of BAC for 1 h before co-treatment with 1 \\u0026mu;g/mL LPS at different time points.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCCK-8 Assay\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRAW264.7 cells were plated at 1.5\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well in 96-well plates overnight and treated with BAC (0.1, 1, 10, 100 and 500 \\u0026mu;M) for 1 h before 1 \\u0026mu;g/mL LPS stimulation in triplicate. Then, 10 mL of CCK-8 buffer was added to each well, and cells were incubated at 37\\u0026deg;C for 24 h. FlexStation 3 microplate reader (Molecular Devices, CA, USA) was used to detect the absorbance at the wavelength of 450 nm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eNO Assay\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNO levels in activated macrophages were determined using Griess reagent, which could measure the nitrates and nitrites concentrations. U0126, SB202190, TPCK, and SP600125 was administered to cells separately with or without BAC (10 \\u0026mu;M) for 1 h before LPS (1 \\u0026mu;g/mL) stimulation for an additional 24 h period. Then, 50 \\u0026mu;L of Griess reagent was mixed with 50 \\u0026mu;L of culture medium in 96-well plates and the reaction was left to proceed for 5 min. After collecting the supernatant, an NO Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China) was used to determine the NO production in activated macrophages, and a microplate reader was used to detect the absorbance at 540 nm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eROS Assay\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCells were pretreated with BAC (1, 10, and 100 \\u0026mu;M) for 1 h before LPS (1 \\u0026mu;g/mL) stimulation for 24 h to detect the intracellular ROS levels. The media were then removed before cells were incubated with DCFH-DA (10 \\u0026mu;M) for 20 min. Olympus BX53 fluorescence microscope (Olympus, Japan) was used to measure ROS\\u0026rsquo;s level as the mean fluorescence intensity after sufficient washing. Excitation and emission were detected at the wavelengths of 488 nm and 525 nm, respectively.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eELISA\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCells were pretreated with BAC (1, 10, and 100 \\u0026mu;M) for 1 h before LPS (1 \\u0026mu;g/mL) stimulation for 24 h in the medium to detect pro-inflammatory cytokine levels. ELISA kits (Elabscience, Wuhan, China) were used to determine the production of IL-6, IL-1\\u0026beta;, TNF-\\u0026alpha;, and PGE\\u003csub\\u003e2\\u003c/sub\\u003e following the manufacturer's instructions.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eQuantitative Real-Time PCR Detecting\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAfter treatment, total RNA was extracted with Trizol and converted to cDNA using the HiScript Reverse Transcriptase, according to the manufacturer\\u0026rsquo;s recommendations. The primer sequences used in our study were as follows: \\u0026beta;-actin (sense: CACGATGGAGGGGCCGGACTCATC, antisense: TAAAGACCTCTATGCCAACACAGT); IL-1\\u0026beta; (sense: TCAGGCAGGCAGTATCACTC, antisense: AGCTCATATGGGTCCGACAG); TNF-\\u0026alpha; (sense: GCCTATGTCTCAGCCTCTTCT, antisense: TTGTGAGTGTGAGGGTCTGG); and IL-6 (sense: GGAGTTCCGTTTCTACCTGG, antisense: GCCGAGTAGACCTCATAGTG). SYBR Green Master Mix and ABI QuantStudio 6 Real-Time PCR System were used to quantitate the relative mRNA concentrations. \\u0026beta;-actin was used as a reference gene, and data from the relative gene expression were analyzed using the 2\\u003csup\\u003e-\\u0026Delta;\\u0026Delta;Ct \\u003c/sup\\u003emethod.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eWestern Blot Assay\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAfter BAC or/and LPS treatment, macrophages were washed three times with ice-cold phosphate-buffered saline (PBS), and the whole-cell proteins were extracted using RIPA buffer supplemented with PMSF and phosphatase inhibitor cocktail. Subsequently, the total protein concentration was measured using the BCA protein assay. After separation by electrophoresis, 40 \\u0026mu;g protein was transferred onto the PVDF membranes (Millipore, Billerica, MA, USA), which were then blocked for 2 h with 5% nonfat milk Tris-buffered saline Tween 20 (TBST). Subsequently, membranes were incubated with specific primary rabbit antibodies and washed five times with TBST, followed by incubation for 2 h with goat anti-rabbit IgG HRP at room temperature. Finally, each membrane was washed with TBST and visualized using the ECL substrate (Beyotime, Shanghai, China).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eImmunofluorescent Assay\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAfter BAC (100 \\u0026mu;M) pretreatment for 1 h, LPS stimulation for 20 min, macrophages were stimulated by LPS (1 \\u0026mu;g/mL) for 30 min to detect the location of NF-\\u0026kappa;B p65 in activated macrophages. After washing twice with PBS for 20 min, cells fixed with 4% paraformaldehyde for 15 min were permeabilized with 0.5% Triton X-100 for 30 min. Then cells were blocked with normal goat serum before incubation with rabbit anti-NF-\\u0026kappa;B p65 antibody (dilution 1:100) at 4\\u0026deg;C overnight. After incubation with Cy3-labeled goat anti-rabbit IgG (dilution 1:100) as secondary antibodies in the dark for 30 min and sufficient washing, cells were stained with DAPI (0.5 \\u0026mu;g/mL) for 10 min. Stained cells were visualized under a BX53 fluorescence microscope (Olympus, Japan).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistical Analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data were presented as mean \\u0026plusmn; SD. Statistical analyses were performed using SPSS v22 software (IBM, Armonk, NY, USA). P-values of \\u0026lt; 0.05 were considered statistically significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe effect of BAC on cell viability and production of pro-inflammatory cytokines\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe CCK-8 assay was used to detect the viability of activated macrophages. Indicated concentrations of BAC had no obvious cytotoxicity up to 500 \\u0026mu;M (Fig. 2a), suggesting that BAC does not affect cells with subsequent experimental concentrations. Next, the effect of BAC on the levels of pro-inflammatory cytokines was investigated by ELISA. LPS treatment significantly increased IL-1\\u0026beta;, TNF-\\u0026alpha;, and IL-6 levels to 111.30, 1591.12, and 960.90 pg/mL; however, treatment with BAC markedly decreased their levels to 43.34, 75.96, and 83.40 pg/mL (Fig. 2b, c, d), respectively.\\u003c/p\\u003e\\n\\u003cp\\u003eMoreover, we used quantitative real-time PCR to determine if the inhibitory effects of BAC on this cytokine release correlated with gene expression regulation. Treatment with BAC dose-dependently downregulated the mRNA transcription of these cytokines (Fig. 2e, f, g). Our results suggested that BAC attenuated the inflammatory response by suppressing these cytokines\\u0026rsquo; synthesis and release in activated macrophages.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eThe effect of BAC on pro-inflammatory mediators production\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eELISA was used to determine the anti-inflammatory effect of BAC on PGE\\u003csub\\u003e2\\u003c/sub\\u003e, NO, and ROS levels in activated macrophages. The production of PGE\\u003csub\\u003e2\\u003c/sub\\u003e was significantly upregulated compared with control cells after LPS stimulation, whereas 1, 10, or 100 \\u0026mu;M BAC treatment markedly decreased PGE\\u003csub\\u003e2 \\u003c/sub\\u003elevels by 8.2%, 46.6%, and 73.0% (Fig. 3a), respectively. LPS treatment induced an observable elevation of NO levels in RAW264.7 macrophages, while BAC treatment significantly suppressed NO production as expected. Meanwhile, treatment with 1, 10, or 100 \\u0026mu;M BAC dose-dependently decreased ROS levels (Fig. 3c), indicating that BAC also showed an inhibitory effect on ROS release. Together, these results suggested that the extensive anti-inflammatory effects of BAC were exerted by suppressing these mediators production in LPS-induced macrophages. Furthermore, treatment of BAC combined with SB202190, SP600125, U0126, or TPCK resulted in less LPS-induced NO production in macrophages (Fig. 3b), suggesting that the anti-inflammatory activity of BAC might be associated with effects on the MAPK and NF-\\u0026kappa;B pathways.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eThe effect of BAC on the expression of COX-2 and iNOS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCOX-2 and iNOS play critical roles in the generation of PGE\\u003csub\\u003e2\\u003c/sub\\u003e and NO, respectively [16]. Here, we used Western blot to examine the regulatory effect of BAC on the protein levels of COX-2 and iNOS. LPS-stimulated RAW264.7 cells exhibited remarkably elevated protein levels, whereas treatment with BAC effectively downregulated these expressions, and a dose-dependent response was seen for BAC (Fig. 4). These results provided supportive evidence that suppression of PGE\\u003csub\\u003e2 \\u003c/sub\\u003eand NO release by BAC was related to the downregulation of COX-2 and iNOS levels.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eThe effect of BAC on the MAPK Pathway\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMAPKs function as critical regulators in the inflammatory process by regulating AP-1 transcription factor activation [17, 18, 19]. Hence, to further explore the possible mechanism of BAC for suppressing pro-inflammatory mediator production, we examined the effect of BAC on the expression of MAPKs in activated macrophages. As expected, LPS induced an increase in the phosphorylation of MAPKs, an alteration that was counteracted effectively by BAC treatment in a dose-dependent manner. For instance, the values of p-p38/p38, p-JNK/JNK, and p-ERK/ERK decreased by 13.6%\\u0026ndash;58.9%, 18.3%\\u0026ndash;52.7%, and 39.4%\\u0026ndash;64.9% with 1, 10, or 100 \\u0026mu;M BAC compared with activated macrophages (Fig. 5). Meanwhile, both BAC and LPS did not affect the non-phosphorylated MAPK\\u0026rsquo;s levels. Therefore, the above findings suggest that the BAC\\u0026rsquo;s inhibitory effect in activated macrophages might be related to the regulation of the MAPK signaling cascade.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eThe effect of BAC on activation of NF-\\u0026kappa;B\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSince NF-\\u0026kappa;B, which can be activated by LPS stimulation in macrophages, is a vital regulatory factor in the expression of inflammation-related mediators and cytokines, we next investigated whether treatment with BAC could affect the NF-\\u0026kappa;B activation. Moreover, the nuclear fractions of LPS-activated RAW264.7 macrophages were isolated to measure the effect on nuclear translocation. Stimulation by LPS remarkably induced an elevation of p65 phosphorylation levels and nuclear translocation, whereas treatment with BAC could dose-dependently inhibit elevations of the p65 phosphorylation and nuclear translocation (Fig. 6a, b, d). The location of the p65 subunit of NF-\\u0026kappa;B was detected using immunofluorescence assay, which further supported our above findings (Fig. 6e). Furthermore, BAC significantly dose-dependently attenuated I\\u0026kappa;B\\u0026alpha; phosphorylation and degradation in activated macrophages(Fig. 6c). These results suggested that one of the mechanisms by which BAC attenuates inflammatory responses induced by LPS is through inhibition of NF-\\u0026kappa;B activation.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eThe effect of BAC on TAK1 phosphorylation\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTAK1 is a crucial upstream adaptor protein in TLR-mediated MAPK and NF-\\u0026kappa;B pathways. Next, the effect of BAC on TAK1 phosphorylation was assessed to investigate whether its inhibition of MAPK and NF-\\u0026kappa;B was related to TLR signaling regulation. LPS stimulation significantly increased the protein level of phosphorylated TAK1. However, BAC treatment markedly downregulated the elevation of phosphorylated TAK1 in LPS-activated RAW264.7 macrophages (Fig. 7). These findings indicated that BAC exhibited significant anti-inflammatory activity in activated macrophages by inhibiting TLR-mediated MAPK and NF-\\u0026kappa;B signaling pathways.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eClassic non-steroidal anti-inflammatory drugs may lead to patient intolerance and cause some side effects when used for inflammatory diseases [20]. Thus, it is necessary to explore and develop new anti-inflammatory drugs. Recent studies have shown that some natural monomer components extracted from herbs exert anti-inflammatory activity, such as BAC, which is widely found in\\u0026nbsp;\\u003cem\\u003eAconitum\\u003c/em\\u003eplants. However, the molecular mechanisms by which BAC regulates the inflammatory\\u0026nbsp;\\u003ca href=\\\"http://med.wanfangdata.com.cn/Paper/Detail/PeriodicalPaper_PM10452974\\\"\\u003eprocess\\u003c/a\\u003e\\u0026nbsp;in activated macrophages have not been systemically elucidated. This study confirmed the anti-inflammation property of BAC and investigated its mechanism of action by LPS-treated macrophages. Our study is the first to show that BAC exerts an anti-inflammatory effect in LPS-activated macrophages via inhibition of the TLR-related NF-\\u0026kappa;B and MAPK pathways. Furthermore, our results revealed that BAC could be used as both a promising anti-inflammatory drug and a new inhibitor of MAPK and NF-\\u0026kappa;B signaling.\\u003c/p\\u003e\\n\\u003cp\\u003eInflammation is an essential pathological process of living tissues to eliminate causative agents and promote tissue repair [21]. As we know, macrophages can modulate inflammation processes by regulating the production of various cytokines. Cytokines released by macrophages can cause the neutrophils activation in the early stages of inflammation, leading to inflammatory damage. LPS-activated macrophages are the most common model for studying inflammatory responses. LPS-induced activation of innate immune cells like macrophages could trigger an inflammatory response, leading to excess production of TNF-\\u0026alpha;, IL-6, ROS, NO, IL-1\\u0026beta;, and PGE\\u003csub\\u003e2\\u003c/sub\\u003e [22, 23, 24]. An excessive release could cause tissue damage and pathological changes, contributing to the progression and exacerbation of inflammation. Our experiment demonstrated that BAC significantly suppressed the production of these cytokines and mediators in LPS-activated macrophages.\\u003c/p\\u003e\\n\\u003cp\\u003eMeanwhile, quantitative real-time PCR results showed that the gene transcription of IL-1\\u0026beta;, IL-6, and TNF-\\u0026alpha; was also significantly and dose-dependently downregulated by BAC. Previous studies have revealed the vital roles of COX-2 and iNOS, which are specific inducible enzymes in cells modulating the production of key inflammatory mediators, such as PGE\\u003csub\\u003e2\\u003c/sub\\u003e and NO, during the development of inflammatory diseases [16]. Their expression is upregulated, which serves as a host defense against harmful stimulation. However, their overexpression is associated with various diseases, including cancer, arthritis, and asthma [25, 26, 27, 28]. Thus, the regulation of their expression is a promising anti-inflammatory strategy. We found that BAC effectively inhibited their expression in LPS-activated macrophages, indicating that the suppression of several mediators released by BAC is related to the downregulation of iNOS and COX-2 expression. Above all, our present data showed that BAC has a promising therapeutic potential in clinical inflammatory diseases by regulating iNOS and COX-2 expression.\\u003c/p\\u003e\\n\\u003cp\\u003eOur subsequent experiments focused on the molecular mechanisms of the anti-inflammatory properties of BAC. As recognition receptors that initiate defense reactions by sensing various endogenous molecules and invading pathogens, TLRs have a critical effect on the activation of specific signaling cascades, such as NF-\\u0026kappa;B and MAPKs. LPS is the most important ligand of TLR4, which is one of the TLRs expressed in the surface of macrophages and can cause the oligomerization of TLR4 when binding to it, further leading to the permutations and combinations of Toll-interleukin-1 receptor (TIR) domains to recruit downstream adapter molecules to initiate signal transduction in the cytoplasm. Until now, five adaptor proteins have been identified, namely TIRAP, MyD88, TRAM, TRIF, and SARM [4]. Cell-signaling is initiated by activated TLR4 via MyD88-dependent or independent pathways to synthesize several downstream products [29]. The NF-\\u0026kappa;B family, which consists of NF-\\u0026kappa;B1 (p50), NF-\\u0026kappa;B2 (p52), RelA (p65), RelB, and c-Rel proteins, was previously shown to be closely related to various human diseases and plays a crucial role in inflammatory processes [30]. In non-activated macrophages, the NF-\\u0026kappa;B dimer is bound to I\\u0026kappa;B\\u0026alpha;, which belongs to the I\\u0026kappa;B family of inhibitory protein, and therefore exists in an inactive form in the cytosol. When LPS binds to TLRs in the macrophage membrane, NF-\\u0026kappa;B signaling is initiated in response to stimulation by LPS [31]. TLR4 expression in macrophages induced by LPS leads to the I\\u0026kappa;B kinase activation during the process of NF-\\u0026kappa;B activation, and then triggers the I\\u0026kappa;B\\u0026alpha; phosphorylation and degradation. The nuclear localization signals on the NF-\\u0026kappa;B subunits are unmasked by the I\\u0026kappa;B\\u0026alpha; degradation, permitting the p65 subunit, which is separated from NF-\\u0026kappa;B/Rel complexes, to translocate from the cytoplasm to the nucleus and bind to a specific DNA site to initiate the expression of genes associated to the inflammatory process [10]. The most critical step is the NF-\\u0026kappa;B p50/p65 dimer translocation to the nucleus for the NF-\\u0026kappa;B pathway activation [32]. In this study, an immunofluorescence assay was used to observe the p65 subunit location, and we concluded that BAC significantly inhibited p65 translocation in activated macrophages by inhibiting I\\u0026kappa;B\\u0026alpha; phosphorylation and degradation. Moreover, the above results demonstrated that BAC could decrease pro-inflammatory cytokines and enzyme expression by suppressing the activation of NF-\\u0026kappa;B p65.\\u003c/p\\u003e\\n\\u003cp\\u003eThe MAPK signaling pathway is linked to some biological processes, such as gene transcription, apoptosis, proliferation, and differentiation. Besides the NF-\\u0026kappa;B pathways, MAPKs have a major role in numerous pro-inflammatory gene expression. For example, iNOS and COX-2 expression induced by some inflammatory products like LPS is regulated by MAPKs. Furthermore, multiple lines of evidence have demonstrated that MAPKs are associated with regulating the transcriptional activity of NF-\\u0026kappa;B and are considered a promising target for reducing inflammation. The phosphorylation of JNK, p38, and ERK triggered by TLR4 that transduces LPS signaling, is linked with the activation of the MAPK pathways, which can activate transcription factors and induce the expression of inflammatory molecules in the nucleus [33, 34]. Our present study revealed that treatment with BAC has a significant inhibitory effect on the expression of p-JNK, p-p38, and p-ERK protein in LPS-activated macrophages. Moreover, LPS-activated macrophages treated with BAC combined with p38, NF-\\u0026kappa;B, JNK, or ERK inhibitor produced less NO than when treated with BAC alone. Hence, our data indicated that BAC mitigated the LPS-induced inflammatory response through the inhibition of the MAPK and NF-\\u0026kappa;B signaling pathways.\\u003c/p\\u003e\\n\\u003cp\\u003eTAK1, a vital signaling molecule belonging to the MAP kinase kinase kinase (MAP3K) family, is activated by a TLR-TIRAP-MyD88 dependent pathway, triggering downstream pathways, including JNK, p38, ERK, and NF-\\u0026kappa;B [34, 35, 36]. LPS stimulation recruits TAK1 to TLR4 and leads to NF-\\u0026kappa;B activation via I\\u0026kappa;B proteins phosphorylation and degradation. Meanwhile, MEK1/2MKK3/6 and MKK4/7 are directly phosphorylated by p-TAK1, which could activate the MAPK signaling pathway [35, 36]. Thus, TAK1 is believed to be a crucial adaptor protein connecting TLR4 with two vital downstream cascade branches, MAPK and NF-\\u0026kappa;B, in the macrophage model stimulated by LPS. In our present study, whether BAC affected the activation of TAK1 was investigated in LPS-activated macrophages. The results demonstrated that BAC could significantly downregulate the elevation of p-TAK1, which subsequently suppressed downstream MAPK and NF-\\u0026kappa;B pathways. As mentioned above, we found that blocking the activation of a key upstream factor, TAK1, was a reason for inhibiting TLR-mediated NF-\\u0026kappa;B and MAPK pathways by BAC. Signaling pathways related to the anti-inflammatory activity of BAC are shown in Fig. 8.\\u003c/p\\u003e\\n\\u003cp\\u003eTo sum up, our results first demonstrate that the mechanism underlying the attenuation of inflammatory responses by BAC in activated macrophages is through the inhibition of the TLR/NF-\\u0026kappa;B and MAPK pathways, contributing to the decrease in the levels of pro-inflammatory mediators and cytokine production. Our novel findings provide valuable information for the potential of BAC as a therapeutic agent able to target specific signal transduction for inflammation-related diseases.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Major Science and Technology Innovation Project of Shandong Province (2018CXGC1304), Science and Technology Development Project of Traditional Chinese Medicine of Shandong Province (2019-0400), Technology Development Project of Traditional Chinese Medicine of Qingdao (2020-zyy031).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and Consent to participate \\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll the authors agree to submit the final version of manuscript for publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analyzed during this study are included in this published article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCode availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors' contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eStudy design: Changkai Zhou and Fanbo Jing\\u003c/p\\u003e\\n\\u003cp\\u003eDefinition of intellectual content: Hongyan Ji\\u003c/p\\u003e\\n\\u003cp\\u003eLiterature research: Wenjing Li and Minxiao Xing\\u003c/p\\u003e\\n\\u003cp\\u003eExperimental studies: Donghua Liu\\u003c/p\\u003e\\n\\u003cp\\u003eData acquisition: Qie Guo\\u003c/p\\u003e\\n\\u003cp\\u003eData analysis: Donghua Liu and Qie Guo\\u003c/p\\u003e\\n\\u003cp\\u003eStatistical analysis: Lihua Zhou\\u003c/p\\u003e\\n\\u003cp\\u003eManuscript preparation: Changkai Zhou\\u003c/p\\u003e\\n\\u003cp\\u003eManuscript editing: Hongyan Ji\\u003c/p\\u003e\\n\\u003cp\\u003eManuscript review: Fanbo Jing\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eMedzhitov, R. 2008. Origin and physiological roles of inflammation. \\u003cem\\u003eNature\\u003c/em\\u003e 454 (24): 428\\u0026ndash;435.\\u003c/li\\u003e\\n\\u003cli\\u003eChristian, F., E. L. Smith, and R. J. Carmody. 2016. The regulation of NF-kappa B subunits by phosphorylation. \\u003cem\\u003eCells\\u003c/em\\u003e 5 (1): 12.\\u003c/li\\u003e\\n\\u003cli\\u003eSu, H., Z. Mo, Z. Chen, and Z. Guo. 2017. Severe disease of immune imbalance in ICU: persistent inflammation immunosuppression catabolism syndrome. \\u003cem\\u003eZhonghua Wei Zhong Bing Ji Jiu Yi Xue\\u003c/em\\u003e 29 (8): 760\\u0026ndash;764.\\u003c/li\\u003e\\n\\u003cli\\u003eHan, J. M., E. K. Lee, S. Y. Gong, J. K. Sohng, Y. J. Kang, and H. J. Jung. 2019. Sparassiscrispa exerts anti-inflammatory activity via suppression of TLR-mediated NF-\\u0026kappa;B and MAPK signaling pathways in LPS-induced RAW264.7 macrophage cells. \\u003cem\\u003eJournal of Ethnopharmacology\\u003c/em\\u003e 231 (1): 10\\u0026ndash;18.\\u003c/li\\u003e\\n\\u003cli\\u003eHe, J., J. Li, H. Liu, Z. Yang, F. Zhou, T. Wei, Y. Dong, H. Xue, L. Tang, and M. Liu. 2018. Scandoside exerts anti-inflammatory effect via suppressing NF-\\u0026kappa;B and MAPK signaling pathways in LPS-induced RAW 264.7 macrophages. \\u003cem\\u003eInternational Journal of Molecular Sciences\\u003c/em\\u003e 19 (2): 457.\\u003c/li\\u003e\\n\\u003cli\\u003eRoger, T., A. L. Chanson, M. Knaup-Reymond, and T. Calandra. 2005. Macrophage migration inhibitory factor promotes innate immune responses by suppressing glucocorticoid-induced expression of mitogen-activated protein kinase phosphatase-1. \\u003cem\\u003eEuropean Journal of Immunology\\u003c/em\\u003e 35 (12): 3405\\u0026ndash;3413.\\u003c/li\\u003e\\n\\u003cli\\u003eYee, N. K., and J. A. Hamerman. 2013. \\u0026beta;\\u003csub\\u003e2\\u003c/sub\\u003e integrins inhibit TLR responses by regulating NF-\\u0026kappa;B pathway and p38 MAPK activation. \\u003cem\\u003eEuropean Journal of Immunology\\u003c/em\\u003e 43 (3): 779\\u0026ndash;792.\\u003c/li\\u003e\\n\\u003cli\\u003eDoyle, S. L., and L. A. O'Neill. 2006. Toll-like receptors: from the discovery of NF-\\u0026kappa;B to new insights into transcriptional regulations in innate immunity. \\u003cem\\u003eBiochemical Pharmacology\\u003c/em\\u003e 72 (9): 1102\\u0026ndash;1113.\\u003c/li\\u003e\\n\\u003cli\\u003eLi, H., J. H. Yoon, and H. J. Won, et al. 2017. Isotrifoliol inhibits pro-inflammatory mediators by suppression of TLR/NF-\\u0026kappa;B and TLR /MAPK signaling in LPS-induced RAW264.7 cells. \\u003cem\\u003eInternational Immunopharmacology\\u003c/em\\u003e 45: 110\\u0026ndash;119.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, Z., and B. Rigas. 2006. NF-kappaB, inflammation and pancreatic carcinogenesis: NF-kappaB as a chemoprevention target (review). \\u003cem\\u003eInternational Journal of Oncology\\u003c/em\\u003e 29 (1): 185\\u0026ndash;192.\\u003c/li\\u003e\\n\\u003cli\\u003ePerkins, N. D. 2007. Integrating cell-signalling pathways with NF-kappaB and IKK function. \\u003cem\\u003eNature Reviews Molecular Cell Biology\\u003c/em\\u003e 8 (1): 49\\u0026ndash;62.\\u003c/li\\u003e\\n\\u003cli\\u003eZeng, K. W., H. Fu, G. X. Liu, and X. M. Wang. 2010. Icariin attenuates lipopolysaccharide-induced microglial activation and resultant death of neurons by inhibiting TAK1/IKK/NF-\\u0026kappa;B and JNK/p38 MAPK pathways. \\u003cem\\u003eInternational Immunopharmacology\\u003c/em\\u003e 10 (6): 668\\u0026ndash;678.\\u003c/li\\u003e\\n\\u003cli\\u003eKim, E. K., and E.J.Choi. 2010. Pathological roles of MAPK signaling pathways in human diseases. \\u003cem\\u003eBiochim Biophys Acta\\u003c/em\\u003e 1802 (4): 396\\u0026ndash;405.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, H.,S., W. Sun, X. Zhang, Z. Xie, Y. Zhu, Chai, and G. Zhang. 2016. Biological activities and pharmacokinetics of aconitine, benzoylaconine, and aconine after oral administration in rats. \\u003cem\\u003eDrug Testing and Analysis\\u003c/em\\u003e 8 (8): 839\\u0026ndash;846.\\u003c/li\\u003e\\n\\u003cli\\u003eDeng, X. H., J. J. Liu, X. J. Sun, J. C. Dong, and J. H. Huang. 2019. Benzoylaconine induces mitochondrial biogenesis in mice via activating AMPK signaling cascade. \\u003cem\\u003eActa Pharmacologica Sinica\\u003c/em\\u003e 40 (5): 658\\u0026ndash;665.\\u003c/li\\u003e\\n\\u003cli\\u003eXiong, H., Y. Cheng, X. Zhang, and X. Zhang. 2014. Effects of taraxasterol on iNOS and COX-2 expression in LPS-induced RAW 264.7 macrophages. \\u003cem\\u003eJournal of Ethnopharmacology\\u003c/em\\u003e 155 (1): 753\\u0026ndash;757.\\u003c/li\\u003e\\n\\u003cli\\u003eYu, D., D. Yu, M. Shi, J. Bao, X. Yu, Y. Li, and W. Liu. 2016. Genipin ameliorates hypertension-induced renal damage via the angiotensin II-TLR/MyD88/MAPK pathway. \\u003cem\\u003eFitoterapia\\u003c/em\\u003e 112: 244\\u0026ndash;253.\\u003c/li\\u003e\\n\\u003cli\\u003eMoon, D. O., Y. H. Choi, N. D. Kim, Y. M. Park, and G. Y. Kim. 2007. Anti-inflammatory effect of \\u0026beta;-lapachone in lipopolysaccharide-stimulated BV2 microglia. \\u003cem\\u003eInternational Immunopharmacology\\u003c/em\\u003e 7 (4): 506\\u0026ndash;514.\\u003c/li\\u003e\\n\\u003cli\\u003eLai, J. L., Y. H. Liu, C. Liu, M. P. Qi, R. N. Liu, X. F. Zhu, Q. G. Zhou, Y. Y. Chen, A. Z. Guo, and C. M. Hu. 2017. Indirubin inhibits LPS-induced inflammation via TLR4 abrogation mediated by the NF-\\u0026kappa;B and MAPK signaling pathways. \\u003cem\\u003eInflammation\\u003c/em\\u003e 40 (1): 1\\u0026ndash;12.\\u003c/li\\u003e\\n\\u003cli\\u003eMu, C. Y., M. F. Wu, and Z. Li. 2018. Anti-inflammatory effect of novel 7-substituted coumarin derivatives through inhibition of NF-\\u0026kappa;B signaling pathway. \\u003cem\\u003eChemistry \\u0026amp; Biodiversity\\u003c/em\\u003e 16 (3): e1800559.\\u003c/li\\u003e\\n\\u003cli\\u003eLiang, N., Y. Sang, W. Liu, W. Yu, and X. Wang. 2018. Anti-inflammatory effects of gingerol on lipopolysaccharide-stimulated RAW 264.7 cells by inhibiting NF-\\u0026kappa;B signaling pathway. \\u003cem\\u003eInflammation\\u003c/em\\u003e 41 (3): 835\\u0026ndash;845.\\u003c/li\\u003e\\n\\u003cli\\u003eMoon, S. M., S. A. Lee, J. H. Hong, J. S. Kim, D. K. Kim, and C. S. Kim. 2018. Oleamide suppresses inflammatory responses in lps-induced raw264.7 murine macrophages and alleviates paw edema in a carrageenan-induced inflammatory rat model. \\u003cem\\u003eInternational Immunopharmacology\\u003c/em\\u003e 56: 179\\u0026ndash;185.\\u003c/li\\u003e\\n\\u003cli\\u003eFan, G. W., Y. Zhang, X. Jiang, Y. Zhu, B. Wang, L. Su, W. Cao, H. Zhang, and X. Gao. 2013. Anti-inflammatory activity of baicalein in LPS-stimulated RAW 264.7 macrophages via estrogen receptor and NF-\\u0026kappa;B-dependent pathways. \\u003cem\\u003eInflammation\\u003c/em\\u003e 36 (6): 1584\\u0026ndash;1591.\\u003c/li\\u003e\\n\\u003cli\\u003eHu, W., X. Yang, C. Zhe, Q. Zhang, L. Sun, and K. Cao. 2011. Puerarin inhibits iNOS, COX-2 and CRP expression via suppression of NF-\\u0026kappa;B activation in LPS-induced RAW 264.7 macrophage cells. \\u003cem\\u003ePharmacological Reports\\u003c/em\\u003e 63 (3): 781\\u0026ndash;789.\\u003c/li\\u003e\\n\\u003cli\\u003eEl-Ashmawy, N. E., N. F. Khedr, H. A. El-Bahrawy, and S. A. El-Adawy. 2017. Downregulation of iNOS and elevation of camp mediate the anti-inflammatory effect of glabridin in rats with ulcerative colitis. \\u003cem\\u003eInflammopharmacology\\u003c/em\\u003e 26 (2): 551\\u0026ndash;559.\\u003c/li\\u003e\\n\\u003cli\\u003eInam, A., M. Shahzad, A. Shabbir, H. Shahid, and K. Shahid, andA. Javeed. 2017. Carica papaya ameliorates allergic asthma via down regulation of IL-4, IL-5, eotaxin, TNF-\\u0026alpha;, NF-\\u0026kappa;B, and iNOS levels. \\u003cem\\u003ePhytomedicine\\u003c/em\\u003e 32: 1\\u0026ndash;7.\\u003c/li\\u003e\\n\\u003cli\\u003eHashemi Goradel, N., et al. 2019. Cyclooxygenase-2 in cancer: a review. \\u003cem\\u003eJournal of Cellular Physiology\\u003c/em\\u003e 234 (5): 5683\\u0026ndash;5699.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, Z. B., et al. 2020. Copper oxide nanoparticles from Rabdosiarubescens attenuates the complete Freund\\u0026rsquo;s adjuvant (CFA) induced rheumatoid arthritis in rats via suppressing the inflammatory protein COX-2/PGE2. \\u003cem\\u003eArabian Journal of Chemistry\\u003c/em\\u003e 13 (6): 5639\\u0026ndash;5650.\\u003c/li\\u003e\\n\\u003cli\\u003eBerghaus, L. J., J. N. Moore, D. J. Hurley, M. L. Vandenplas, B. P. Fortes, M. A. Wolfert, and G. J. Boons. 2010. Innate immune responses of primary murine macrophage-lineage cells and RAW 264.7 cells to ligands of Toll-like receptors 2, 3, and 4. \\u003cem\\u003eComparative Immunology Microbiology \\u0026amp; Infectious Diseases\\u003c/em\\u003e 33 (5): 443\\u0026ndash;454.\\u003c/li\\u003e\\n\\u003cli\\u003eVallabhapurapu, S., and M. Karin. 2009. Regulation and function of NF-kappaB transcription factors in the immune system. \\u003cem\\u003eAnnual Review of Immunology\\u003c/em\\u003e 27: 693\\u0026ndash;733.\\u003c/li\\u003e\\n\\u003cli\\u003eOlefsky, J. M., and C. K. Glass. 2010. Macrophages, inflammation, and insulin resistance. \\u003cem\\u003eAnnual Review of Physiology\\u003c/em\\u003e 72: 219\\u0026ndash;246.\\u003c/li\\u003e\\n\\u003cli\\u003eBaldwin, A. S. Jr. 1996. The NF-kappa B and I kappa B protein: new discoveries and insights. \\u003cem\\u003eAnnual Review of Immunology\\u003c/em\\u003e 14: 649\\u0026ndash;683.\\u003c/li\\u003e\\n\\u003cli\\u003eXie, Y. H., L. Wang, and H. Sun, et al. 2018. Polysaccharide from alfalfa activated raw 264.7 macrophages through mapk and NF-\\u0026kappa;B signaling pathways. \\u003cem\\u003eInternational Journal of Biological Macromolecules\\u003c/em\\u003e 126: 960\\u0026ndash;968.\\u003c/li\\u003e\\n\\u003cli\\u003eKagan, J. C., and R. Medzhitov. 2006. Phosphoinositide-mediated adaptor recruitment controls toll-like receptor signaling. \\u003cem\\u003eCell\\u003c/em\\u003e 125 (5): 943\\u0026ndash;955.\\u003c/li\\u003e\\n\\u003cli\\u003eDai, W. L., B. Yan, Y. N. Bao, J. F. Fan, and J. H. Liu. 2020. Suppression of peripheral NGF attenuates neuropathic pain induced by chronic constriction injury through the TAK1-MAPK/NF-\\u0026kappa;B signaling pathways. \\u003cem\\u003eCell Commun and Signal\\u003c/em\\u003e 18 (1): 66.\\u003c/li\\u003e\\n\\u003cli\\u003eDing, Y., H. L. Yang, W. Xiang, X. J. He, W. Liao, and Z. W. Yi. 2015. CD200R1 agonist attenuates lipopolysaccharide-induced inflammatory response in human renal proximal tubular epithelial cells by regulating TLR4-MyD88-TAK1-mediated NF-\\u0026kappa;B and MAPK pathway. \\u003cem\\u003eBiochemical and Biophysical Research Communications\\u003c/em\\u003e 460 (2): 287\\u0026ndash;294.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"inflammation\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ifla\",\"sideBox\":\"Learn more about [Inflammation](https://www.springer.com/journal/10753)\",\"snPcode\":\"10753\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10753/3\",\"title\":\"Inflammation\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"BAC, TLR, TAK1, NF-κB, MAPKs, anti-inflammation.\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-190441/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-190441/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003ePrevious studies have shown that benzoylaconine (BAC), a representative monoester alkaloid, has a potential anti-inflammatory effect. This study investigated the underlying molecular mechanisms using the mode of LPS-activated RAW264.7 macrophage cells. Our findings showed that BAC significantly suppressed the release of pro-inflammatory cytokines and mediators, including IL-6, TNF-α, IL-1β, ROS, NO, and PGE\\u003csub\\u003e2\\u003c/sub\\u003e. BAC treatment also effectively downregulated the elevated protein levels of iNOS and COX-2 induced by LPS in a dose-dependent manner. In this study, we found that BAC inhibited LPS-induced NF-κB activation by reducing the phosphorylation and degradation of IκBα by Western blotting and blocking the nuclear translocation of p65 using an immunofluorescence assay. The elevated protein levels of JNK, p38, and ERK phosphorylation after LPS stimulation were restored effectively by BAC treatment. Moreover, LPS-induced phosphorylation of TAK1, which is a crucial upstream regulatory factor of Toll-like receptor-induced MAPK and\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eNF-κB signaling, was inhibited by BAC in activated RAW264.7 macrophages. These findings demonstrated that BAC exhibited an anti-inflammatory effect by inhibition of Toll-like receptor-induced MAPK and NF-κB pathways, indicating that it could potentially be used for treating inflammatory diseases.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Benzoylaconine Modulates LPS-Induced Responses through Inhibition of Toll-Like Receptor-Mediated NF-κB and MAPK Signaling in RAW264.7 Cells\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-02-18 22:31:29\",\"doi\":\"10.21203/rs.3.rs-190441/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2021-02-16T00:00:00+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2021-02-15T00:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2021-02-05T00:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Inflammation\",\"date\":\"2021-01-30T06:04:07+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"inflammation\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ifla\",\"sideBox\":\"Learn more about [Inflammation](https://www.springer.com/journal/10753)\",\"snPcode\":\"10753\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10753/3\",\"title\":\"Inflammation\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"ad45a074-49b2-4c87-b7f4-806e95ef65c4\",\"owner\":[],\"postedDate\":\"February 18th, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":2480522,\"name\":\"Clinical Pharmacology\"}],\"tags\":[],\"updatedAt\":\"2021-08-22T15:26:41+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-190441\",\"link\":\"https://doi.org/10.1007/s10753-021-01478-z\",\"journal\":{\"identity\":\"inflammation\",\"isVorOnly\":false,\"title\":\"Inflammation\"},\"publishedOn\":\"2021-07-16 15:07:50\",\"publishedOnDateReadable\":\"July 16th, 2021\"},\"versionCreatedAt\":\"2021-02-18 22:31:29\",\"video\":\"\",\"vorDoi\":\"10.1007/s10753-021-01478-z\",\"vorDoiUrl\":\"https://doi.org/10.1007/s10753-021-01478-z\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-190441\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-190441\",\"identity\":\"rs-190441\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}