{"paper_id":"48e0016b-2909-4abd-bcaa-6698807bf58f","body_text":"The Role of Neutrophil Extracellular Traps (NETs) in Non-alcoholic Fatty Liver Disease (NAFLD): A Comprehensive Analysis of NETs-related Genes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Role of Neutrophil Extracellular Traps (NETs) in Non-alcoholic Fatty Liver Disease (NAFLD): A Comprehensive Analysis of NETs-related Genes ZHIHAO FANG, Xiaoxiao Yu, Changxu Liu, Kai Yang, Yanchao Ji, Chang Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3804984/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Non-alcoholic Fatty Liver Disease (NAFLD), prevalent among adults, has become a dominant chronic liver condition worldwide, with a rising incidence of liver cirrhosis. The progression of NAFLD is critically influenced by Neutrophil Extracellular Traps (NETs), which play a key role in its pathogenesis. However, the specific functions of NETs-related genes within NAFLD necessitate further in-depth research. Our team utilized advanced methodologies including AddModuleScore, ssGSEA, and WGCNA for gene screening, identifying NETs-linked genes in single-cell and bulk transcriptomic data. Through algorithms such as Random Forest, Support Vector Machine, Least Absolute Shrinkage and Selection Operator, and Selector Operator, we identified ZFP36L2 and PHLDA1 as significant hub genes. Their role in NAFLD diagnosis was validated using the training dataset GSE164760 and further confirmed in an animal model. The study pinpointed 116 NET-associated genes, predominantly involved in immune and metabolic pathways. Notably, PHLDA1 and ZFP36L2 were determined as hub genes via machine learning techniques, contributing to a predictive model. These genes are involved in inflammatory and metabolic processes, with single-cell RNA sequencing (scRNA-seq) revealing distinct cellular communication patterns based on their expression. In conclusion, this research elucidates the molecular characteristics of NET-associated genes in NAFLD, identifying PHLDA1 and ZFP36L2 as potential biomarkers. By exploring their roles in the hepatic microenvironment, our findings offer significant insights for diagnosing and managing NAFLD, ultimately aiming to enhance patient outcomes. Non-alcoholic fatty liver disease neutrophil extracellular traps (NETs) Single-cell RNA-seq biomarker bioinformatics machine learning Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Non-alcoholic Fatty Liver Disease (NAFLD) has emerged as the most common chronic liver disease globally, with a prevalence rate of 25% among adults, and this figure is on the rise ( 1 ). This condition is marked by excessive lipid storage in hepatocytes, resulting in continuous alterations in liver enzymes, including aspartate transaminase and alanine transaminase ( 2 ). The spectrum of NAFLD includes various liver conditions, extending from Non-alcoholic Fatty Liver (NAFL) to Non-alcoholic Steatohepatitis (NASH). Without intervention, NASH may advance to cirrhosis and potentially to hepatocellular carcinoma (HCC) ( 3 ). With the aging of the affected population and prolonged disease exposure, the burden of NAFLD-related cirrhosis is increasing, projected to double or triple in many regions worldwide from 2015 to 2030 ( 4 , 5 ). Consequently, it becomes imperative to delve more deeply into the pathogenesis of NAFLD and to innovate new strategies for treatment. In the last twenty years, there has been a growing focus on studying the influence of immune cells on the transition from NAFLD to NASH fibrosis. Since that time, a multitude of research has delved into the roles of different immune cells and inflammatory factors in the development and advancement of NAFLD. Many of these studies have underscored the importance of macrophages, T cells, and cytokines in the pathogenesis of liver inflammation and fibrosis associated with NAFLD ( 6 – 10 ). Neutrophils, forming a crucial subset of white blood cells, play a central role in the immune system's frontline defense. Their primary functions include safeguarding the body against infections and diseases through mechanisms such as phagocytosis, degranulation, and neuroendocrine actions directed at combating pathogens, including viruses, bacteria, and fungi ( 11 – 13 ). The explanation of Neutrophil Extracellular Traps (NETs) has transformed our comprehension of neutrophil function and their contribution to immune responses ( 14 ). NETs, composed of chromatin, granular proteins, and histones, form a mesh-like extracellular structure. In NAFLD, the buildup of fat in the liver initiates an inflammatory reaction, which results in the mobilization of neutrophils and subsequent release of NETs.NETs not only worsen inflammation but also attract additional immune cells to the liver, including macrophages and regulatory T cells (Tregs), ultimately playing a role in the advancement of NASH-HCC ( 15 , 16 ). Therefore, NETs are regarded as a crucial element in the advancement of NAFLD. However, further extensive investigations are necessary to fully understand the involvement of genes associated with NETs in NAFLD. Researchers can now quickly evaluate the expression levels of numerous genes, thanks to the notable progress in gene microarrays and single-cell sequencing technologies. This advancement greatly contributes to our comprehension of the genetic causes of diseases. Hence, we aim to utilize bioinformatics to uncover the mechanisms through which NETs facilitate NAFLD, offering proof to guide the creation of diagnostic and therapeutic approaches for NAFLD. The study is illustrated by the workflow diagram in Fig. 1 . Materials and methods Data sources and processing: We consolidated multiple liver tissue transcriptomic datasets obtained from the Gene Expression Omnibus (GEO) database ( https://www.ncbi.nlm.nih.gov/ ). The criteria for selecting raw expression profile datasets included: 1) a focus on expression profiling via array methods; 2) inclusion of datasets containing liver tissue samples from both NAFLD patients and control subjects; 3) a minimum sample size of 15; 4) the presence of either raw data or array-based gene expression profiles in the GEO database. Consequently, four datasets met these criteria: GSE89632 (Microarray, platform GPL14951), GSE48452 (Microarray, platform GPL11532), GSE66676 (Microarray, platform GPL6244), and GSE164760 (Microarray, platform GPL13667). Additional details are available in the Supplementary Table 1. Similar to our previous study ( 17 ), we initially merged datasets GSE89632, GSE48452, and GSE66676, comprising 72 normal and 104 NAFLD samples. These datasets were then normalized using the \"sva\" package ( 18 ). Differential gene expression between NAFLD and control groups was analyzed with the \"limma\" package ( 19 ), considering p-values below 0.05 as statistically significant. For validation, datasets GSE164760 (6 normal and 74 NAFLD samples) were utilized. To identify NETs-related genes, we compiled a list of 170 genes from existing literature ( 20 , 21 ) (Supplementary Table 2). Gathering and Handling of Data for Single-Cell RNA-Seq Analysis To assess the influence of the immune microenvironment in the liver on NAFLD and fibrosis, we analyzed the scRNA-seq dataset GSE136103.In analyzing GSE136103 including four high-quality liver samples: GSM4041162, GSM4041163, GSM4041165, and GSM4041167.The \"Seurat\" package ( 22 ) was employed for single-cell sequencing data analysis. The QC process started by choosing cells that had mitochondrial gene content lower than 15% and genes that were expressed in a minimum of three cells, within an expression range of 500 to 5000. For further analysis, we pinpointed 2000 genes characterized by high variability. To minimize batch effects across the four samples, the \"Harmony\" package was employed. Subsequently, cell clusters were created using the “FindClusters” and “FindNeighbors” functions, and the “t-SNE” method was applied for visualization. The selection of marker genes, vital for annotating different cell types, was informed by previous research findings ( 23 ). The AddModuleScore function was utilized to determine each cell's unique signature score, specifically targeting NETs genes. Seurat's \"FindMarkers\" function was used to identify differentially expressed genes (DEGs) between two distinct groups. We determined the statistical significance of these DEGs by employing the Wilcoxon test, with the adjusted p-value threshold set below 0.05, while keeping other parameters at their default values. Genes exhibiting diverse expressions in cells with distinct NETs scores were identified as potential contributors to NETs at the single-cell transcriptome level. The identified genes were subsequently included in the Weighted Gene Co-expression Network Analysis (WGCNA) to conduct a more comprehensive evaluation of gene expression profiles. In addition, cell interaction dynamics were examined using the \"CellChat\" R package ( 24 ). Analysis of gene co-expression networks using weights (WGCNA) The identification of co-expression modules involved the utilization of the R package 'WGCNA' (version 1.70.3) ( 25 ). The analysis, focusing on the NAFLD group, used a combined dataset of gene expressions. To begin, we established an appropriate soft threshold β for creating a scale-free network. Afterward, the weighted adjacency matrix was converted into a topological overlap matrix (TOM), and the dissimilarity (dissTOM) was computed. Next, we utilized the dynamic tree-cut technique to group genes and identify modules. The module that demonstrated the most substantial correlation with the NETs score was earmarked for in-depth analysis. Identification of differentially expressed genes Differentially expressed genes (DEGs) were identified within batch-calibrated datasets GSE89632, GSE48452, and GSE66676. For screening DEGs between NAFLD and normal samples, the Limma program package ( 26 ) was utilized, adopting a P. adj value < 0.05 as the cutoff criterion. Due to dataset characteristics, a logFC threshold was not established. The resulting data was visualized using volcano plots and heatmaps, created with the R packages “ggplot2” and “pheatmap,” respectively. We are discovering a hub gene associated with NETs through the implementation of a machine-learning algorithm. Subsequently, we performed an intersection of the differentially expressed genes (DEGs) at the gene expression profile level with those in the NETs-related module, as identified through WGCNA. The genes found at this intersection were deemed to be involved in neutrophil extracellular traps (NETs) at both the gene expression profile and single-cell transcriptome levels. Consequently, these genes were designated as Neutrophil Extracellular Traps-related Genes (NRGs).To create a strong predictive model with improved accuracy, we utilized the Support Vector Machine (SVM), Least Absolute Shrinkage and Selection Operator (LASSO), and Random Forest (RF) machine learning algorithms. The LASSO technique is a regression approach that prioritizes variable selection to improve the predictive accuracy and interpretability of statistical models ( 27 ).RF is advantageous for its lack of variable condition constraints and superior accuracy, sensitivity, and specificity, suitable for predicting continuous variables and providing stable forecasts ( 28 ).SVM, on the other hand, constructs a hyperplane in feature space to effectively separate negative from positive instances with the maximum margin ( 29 ). We utilized the “glmnet” ( 30 ), “e1071” ( 31 ), and “randomForest” ( 32 ) R packages for conducting LASSO regression, SVM, and RF analysis, respectively. The choice of hub NAFLD genes was made according to the agreement genes identified by all three algorithms. Construction and validation of a diagnostic model for NAFLD The identified hub genes underwent multivariate logistic regression analysis using the 'ROCR' package ( 33 ) to assess their diagnostic significance in NAFLD. Additionally, the area under the receiver operator characteristic (ROC) curve (AUC) was calculated to further evaluate their predictive accuracy. Moreover, a nomograph was developed to forecast the probability of NAFLD ( 34 ), along with a calibration graph and decision curve analyses to showcase the stability of the model. Gene set variation analysis (GSVA) analysis and gene set enrichment analysis (GSEA) This study commenced with the retrieval of \"c5.go.symbols\" files from the MSigDB database. Following this, the “GSVA” R package (version 2.11) ( 35 ) was utilized to reveal differences in enrichment among Gene Ontology (GO) categories via a non-parametric, unsupervised gene set variation analysis (GSVA) approach. A threshold for statistical significance was set at a p-value lower than 0.05. Moreover, the “clusterProfiler” package (version 3.16.1) was employed for conducting Gene Set Enrichment Analysis (GSEA) to determine the abundance of significant gene clusters in KEGG pathways ( 36 ). Assessment of the infiltration of immune cells using CIBERSORTx and ssGSEA The LM22 genetic characteristic matrix algorithm ( 36 ) was used by Cibersort to evaluate the immune-system cell subtype in each sample by analyzing their gene expression profiles. Additionally, the p-value for the backfold product of each sample was computed using Monte Carlo sampling, and immune cell abundance differences between groups were estimated using the Wilcoxon rank sum test. In this study, a p-value < 0.05 was deemed statistically significant. The analysis concentrated on the expression of particular immune cell metagenes through Single-sample Gene Set Enrichment Analysis (ssGSEA). We utilized the 'GSVA' R package for the quantitative assessment of variations in immune functions between groups with high and low expressions of hub genes. The two-tailed Wilcoxon test (p-value < 0.05) was applied to pinpoint differences in immune-related functions between these groups. Subsequently, the 'vioplot' R package ( 37 ) was employed for visualizing the results. Experimental animals and histological examination In this study, twelve 6-week-old male C57BL/6J mice were used, housed in a controlled environment (ambient temperature: 23°C ± 2°C; 12-hour light/dark cycle) with free access to food and water. After an initial acclimatization period of one week, these mice were randomly segregated into two dietary groups: a normal chow (CON) group and a high-fat diet (HFD) group. The HFD group received a diet with 60% calories from fat (d12492, Medicine, Jiangsu, China), in contrast to the CON group, which was provided with standard lab chow. Following a 16-week dietary regimen, we successfully developed a mouse model indicative of non-alcoholic fatty liver disease (NAFLD) [41]. At the end of this period, the mice were sedated using 2% isoflurane and subsequently euthanized via cervical dislocation for liver tissue collection. To analyze morphological changes, liver sections (5 µm thick) embedded in paraffin were subjected to staining with hematoxylin and eosin (H&E) and Oil Red O for assessing hepatic steatosis. The Harbin Medical University's Professional Committee for Animal Protection (2022-DWSYLLCZ-20) sanctioned all the experimental methodologies employed in this study. Immunohistochemical Analyses Immunohistochemical staining of paraffin-embedded liver sections was conducted following standard protocols. Primary antibodies rabbit anti-PHLDA1 (1:100 dilution; PA5948; Abmart) and rabbit anti-ZFP36L2 (1:100 dilution; PA4972; Abmart) were incubated with the sections overnight at 4°C. The stained sections were then visualized using a light field microscope. To maintain objectivity, a blinded method was used to randomly select three mice for each section. Quantitative Polymerase Chain Reaction (RT-qPCR) Total RNA was extracted from homogenized tissue samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Following this, 1 µg of the extracted RNA underwent reverse transcription with PrimeScript reverse transcriptase (Takara, Kusatsu, Japan). The expression levels of genes were then quantified by employing 2X SYBR Green qPCR (Vazyme, Nanjing, China). For normalization purposes, β-actin was used as an internal reference. The sequences of the primers used for the target genes are specified below: ZFP36L2 CACACTTCTGTCACCCTTCTAC (F), and GTCCAGCATGTTGTTCAGATTG (R); PHLDA1 CACCAGTCAAGCTGAAGGAA (F), and GTCATCACCACAGTGAAGTACA (R). The 2^-ΔΔCt technique was utilized for the semi-quantitative assessment of mRNA expression levels in the target genes. Data analysis The study employed the R software (version 4.2.3) for conducting bioinformatics analyses. We utilized GraphPad Prism software (version 9.0) for statistical analysis and visualization of the data obtained from the animal experiment. We utilized the unpaired Student's t-test to compare the averages of two groups with variables that adhere to a Gaussian distribution. The information is displayed as the average ± deviation, and a p-value less than 0.05 is considered statistically significant. Results Neutrophil extracellular traps characteristic in single‑cell transcriptome We investigated a liver dataset (GSE136103) using single-cell RNA sequencing (scRNA-seq) to explore the contribution of different liver cell types, including hepatocytes, endothelial cells, and immune cells, to the progression of NAFLD and fibrosis. The exam involved creating transcriptomic signatures unique to every cell type, which were determined by genes primarily expressed in each cell subset. This task included the analysis of four liver samples characterized by high-quality single-cell transcriptomes, specifically GSM4041162, GSM4041163, GSM4041165, and GSM4041167.To mitigate batch effects, the Harmony package was employed, successfully integrating the four samples as depicted in Supplementary Fig. 1A and 1B.To achieve dimensionality reduction, the top 2000 genes exhibiting the greatest variability were subjected to principal component analysis (PCA) and t-distributed stochastic neighbor embedding (t-SNE) techniques. This led to the clustering of all cells into 20 distinct groups with a resolution of 0.5, as shown in Supplementary Fig. 2. For cell classification, we utilized specific marker genes corresponding to various cell types, as established in prior research ( 23 ). Figure 2 A illustrates the analyzed cell types, which encompassed Hepatocytes, Cholangiocytes, B cells, CD4 T cells, CD8 T cells, Endothelial cells, Kupffer cells, Macrophages, Monocytes, and NK cells. Figure 2 B showcases a heatmap of the top five marker genes for each of these cell groups. To assess the function of Neutrophil Extracellular Traps (NETs) in various cell types, we utilized the Seurat package's 'AddModuleScore' function to gauge the expression levels of a distinct group of 170 genes associated with NETs across all cell types (Fig. 2 C). Notably, Monocytes, Kupffer cells, and Macrophages exhibited significantly heightened levels of NETs activity, as depicted in Fi. 2D. Following this, cells were categorized into groups with high and low NETs activity. Based on this classification, 1276 differentially expressed genes (DEGs) were discerned between these two groups, setting the stage for subsequent analysis (see Supplementary Table 3). Identification of the hub module and genes related to NETs in the expression profile of the NAFLD samples The single-sample Gene Set Enrichment Analysis (ssGSEA) algorithm is widely used to assess changes in biological processes and pathway activities in individual samples. For our investigation, we utilized ssGSEA to calculate a score representing the activity of Neutrophil Extracellular Traps (NETs) for every sample in the GEO-NAFLD dataset. This score was then employed as phenotype data in the subsequent analysis of Weighted Gene Co-expression Network Analysis (WGCNA). To identify modules that are strongly correlated with NETs scores, we performed WGCNA on the 1276 DEGs associated with NETs that were identified through single-cell sequencing. Outlier samples were excluded before the analysis (see Fig. 3 A). By utilizing a soft power value of 6 (Supplementary Fig. 3), gene modules were defined and the dynamic tree-cut algorithm was employed to detect three separate co-expressed gene modules. These modules were then displayed in a topological overlap matrix (TOM) heatmap (Fig. 3 B). Our analysis revealed that the MEblue module exhibited a strong correlation with the NRGs score in the expression profile (cor = 0.59, Fig. 3 C). Moreover, the scatter diagram depicting the importance of genes (GS) compared to their membership in the blue module revealed a noteworthy association (cor = 0.68, p = 1.9e − 45, Fig. 3 D). This suggests that the genes within this module could potentially have functional significance about neutrophil extracellular traps. To depict the dissimilarly expressed genes in the expression profile of normal tissues and NAFLD samples, volcano plots and heat maps (Fig. 3 E-F) were employed. By intersecting the 209 genes from the blue module with the DEGs in the expression profile, we identified a total of 116 genes (Fig. 3 G), which are believed to be involved in Neutrophil Extracellular Traps (NETs) at both global and single-cell transcriptome levels. These genes have been designated as Neutrophil Extracellular Traps-related genes (NRGs).Gene Ontology (GO) analysis of these NRGs revealed significant enrichment in biological processes (BP) including phagocytosis, response to bacterial origin molecules, lipopolysaccharide response, and steroid hormone response. Furthermore, enhancements were observed in the cellular component (CC) classification, particularly in the extracellular matrix containing collagen, and in molecular functions (MF) like inhibitory activity of enzymes, DNA-binding transcription activator activity, and apoptotic process involving cysteine-type endopeptidase inhibitor activity (Supplementary Table 4). Identification of NETs-related hub genes for NAFLD To further identify NETs-related hub genes for NAFLD, we analyzed the 116 Neutrophil Extracellular Traps-related genes (NRGs) using a combination of three machine-learning algorithms. Initially, LASSO regression analysis was performed on the intersected genes, resulting in the identification of twenty-seven candidate hub genes (Fig. 4 A-B). Subsequently, the SVM-RFE analysis indicated that the classifier error was minimal when the eigengene number was twenty-nine (Fig. 4 C-D). Following this, the Random Forest (RF) algorithm ranked the relative importance of the genes, identifying five characteristic genes (Fig. 4 E and F). Finally, the overlapping genes determined by all three algorithms led to the selection of ZFP36L2 and PHLDA1 as the hub genes (Fig. 5 A). Evaluation of hub genes associated with NETs We developed a nomogram model centered on the two NETs-associated hub genes to estimate the probability of NAFLD onset and to evaluate their predictive accuracy (as illustrated in Fig. 5 A). The efficacy of this model was corroborated using a calibration curve (shown in Fig. 5 D) and through Decision Curve Analysis (DCA) (depicted in Fig. 5 C). Furthermore, the Receiver Operating Characteristic (ROC) analysis was utilized to ascertain the Area Under the Curve (AUC) and the 95% Confidence Intervals (CI) for each of the genes under consideration. The results were as follows: PHLDA1 (AUC: 0.783, 95% CI: 0.711 − 0.849) and ZFP36L2 (AUC: 0.713, 95% CI: 0.628 − 0.795) (Fig. 6 C and E), demonstrating substantial diagnostic efficiency. Furthermore, ROC analysis of the validation dataset GSE164760 showed similar efficacy for PHLDA1 (AUC: 0.753, 95% CI: 0.561 − 0.923) and ZFP36L2 (AUC: 0.721, 95% CI: 0.588 − 0.838) (Fig. 6 D and F). NETs-related hub genes Were Associated with NAFLD-Related Enrichment Pathways To delve deeper into the molecular mechanisms of two NETs-related hub genes in the context of NAFLD diagnosis, ssGSEA-KEGG pathway enrichment analysis was applied to each gene biomarker. The graphical representations highlighted the top six most enriched pathways (as seen in Fig.s 7A-B and Supplementary Table 5). Comprehensive analysis indicated significant enrichment of these two hub genes in pathways such as cytokine-cytokine receptor interaction, MAPK signaling, ECM receptor interaction, olfactory transduction, and the JAK-STAT signaling pathway. Subsequently, NAFLD samples were categorized into high and low-expression groups based on the median expression levels of the hub genes.GSVA enrichment analysis was then performed to investigate the differential pathways between these groups. Comprehensive analysis indicated that high expression of ZFP36L2 might activate pathways such as protein export, nonhomologous end joining, regulation of autophagy, and riboflavin metabolism. Conversely, low expression of ZFP36L2 was associated with the activation of pathways like bladder cancer, glycosaminoglycan biosynthesis - keratan sulfate, taurine and hypotaurine metabolism, and glycosaminoglycan degradation (Fig. 7 C). Similarly, high expression of PHLDA1 was linked to the activation of sulfur metabolism, base excision repair, and nonhomologous end joining pathways. In contrast, low expression of PHLDA1 was correlated with the activation of nod-like receptor signaling, leishmania infection, hematopoietic cell lineage, and glycosaminoglycan biosynthesis - chondroitin sulfate pathways (Fig. 7 D). The correlation of the NETs-related hub genes with single‑cell characteristics To evaluate the function of NRGHs in the liver's microenvironment at the single-cell transcriptomic level, we analyzed the expression patterns of PHLDA1 and ZFP36L2 across different cell types (Fig. 8 A). These results revealed that ZFP36L2 is broadly expressed in various liver cell types, with PHLDA1 predominantly expressed in Hepatocytes and Cholangiocytes (Fig. 8 B-C). Employing the “AddModuleScore” function, we determined the signature-specific score for each cell based on the NETs-related hub genes (NRGHs). Significantly, CD4 T cells, NK cells, and CD8 T cells displayed markedly higher scores (see Supplementary Fig. 4). Cells were divided into groups with high and low scores based on their NRGHs scores, followed by a subsequent differential analysis. KEGG and GSEA pathway analyses of the differentially expressed genes showed significant enrichment in pathways, including natural killer cell-mediated cytotoxicity, Th1 and Th2 cell differentiation, Th17 cell differentiation, cytokine-cytokine receptor interaction, and the chemokine signaling pathway (refer to Fig. 8 D and E). It was observed that liver cells in the microenvironment with varying NRGHs scores exhibited diverse communication patterns (Fig. 8 F). Within the microenvironment of the liver, various types of cells have the ability to act as transmitters, recipients, facilitators, and agents in the process of cellular communication, ultimately resulting in distinct intercellular cues. Our study identified significant changes and influencers in the cell communication signals of the low-score group, particularly in VISFATIN, ANGPTL, and COMPLEMENT signaling (Fig. 8 G-I). These results indicate that such signals could have a regulatory impact on inflammation, metabolism, and apoptosis in the liver microenvironment. ( 38 – 40 ). Immune Microenvironment and Immune-related Functions Analysis To investigate the immune response mechanisms in NAFLD, the CIBERSORT algorithm was employed to assess the variation in immune cell abundance between patients with NAFLD and healthy individuals (as illustrated in Fig. 9 A). Our findings indicated a notably higher presence of Macrophages M1, Macrophages M2, and resting Mast cells in NAFLD samples compared to control ones. Conversely, levels of naive B cells, Monocytes, activated Mast cells, and Neutrophils were significantly reduced in NAFLD samples relative to controls. Additionally, we investigated the differences in immune functions between groups exhibiting high and low expression of the hub genes, as shown in (see Fig. 9 B). Additionally, a correlation heatmap was used to illustrate the associations between the hub genes and different immune cells. (refer to Fig. 9 E). Hub Gene Expression Validation in NAFLD Mouse Model Hub Gene Expression Confirmation in NAFLD Mouse Model: The high-fat diet (HFD) group, exhibited severe hepatic steatosis and sporadic inflammation, as evidenced by H&E and Oil Red O staining of liver tissue sections (Fig. 10 A-B). The qRT-PCR analysis revealed that PHLDA1 and ZFP36L2 expression levels were significantly reduced in the liver tissues of the HFD group in comparison to the control group (refer to Fig. 10 E-F). This observation was corroborated by immunohistochemical staining, demonstrating lower levels of PHLDA1 and ZFP36L2 expression in the liver tissues of the HFD group compared to the control group. (Fig. 10 C-D). Discussion The development of Non-alcoholic Fatty Liver Disease (NAFLD) is intricately linked to Neutrophil Extracellular Traps (NETs). While vital for defending against infection and inflammation, excessive accumulation of NETs can lead to liver damage and disease progression, potentially culminating in liver failure. Recent studies highlight the importance of peptidyl arginine deiminase 4 (PAD 4) in NET formation, noting that neutrophils deficient in PAD 4 are unable to form NETs ( 41 ). Two members of the DNase 1 family, specifically DNase 1 and DNase 1-like 3 (DNase 1 L3), are recognized as key contributors to NET formation, effective both in vitro and in vivo ( 41 ). Abnormal lipid accumulation due to lipotoxicity is considered a key event in the progression of hepatic steatosis.NAFLD is characterized by a notable rise in the generation of Free Fatty Acids (FFAs) ( 42 , 43 ). Inhibiting fatty acid synthase (FATCH) in primary human liver tissues has been shown to prevent steatosis ( 44 ).In vitro studies have shown that FFAs, including linoleic acid (LA) and palmitic acid (PA), can induce NET formation, while oleic acid (OA) does not. However, suppressing the increase in free fatty acids (FFAs) is not accomplished by inhibiting NETs with DNase 1 or through the use of PAD 4 knockout mice, suggesting that NET formation is not a causative factor in steatosis, but rather a result of lipid accumulation ( 15 ). The underlying mechanisms in this context still warrant further investigation. At first, we examined the liver scRNA-seq dataset (GSE136103) and generated transcriptomic signatures specific to each cell subtype by identifying genes that were expressed significantly. Afterward, subsequently, the \"AddModuleScore\" function was used to determine the expression levels of 170 NETs associated genes in all cells, thereby quantifying NETs activity across various cell types. Notably, Monocytes, Kupffer cells, and Macrophages exhibited significantly higher NETs activity among ten cell types (Fig. 2 d). Based on NETs activity, cells were classified into high and low NETs score groups, and 1276 differentially expressed genes (DEGs) between these groups were identified for further analysis. To identify NETs-related genes at both single-cell and bulk transcriptome levels, we utilized a novel bioinformatics approach that combines AddModuleScore, single-sample Gene Set Enrichment Analysis (ssGSEA), and Weighted Gene Co-expression Network Analysis (WGCNA) algorithms. Weighted Gene Co-expression Network Analysis (WGCNA) results indicated that genes within the blue module might be significantly associated with Neutrophil Extracellular Traps (NETs). By using the GEO database, we examined the levels of gene expression in individuals with NAFLD and those who are in good health. We then compared the 209 genes from the blue module with the differentially expressed genes (DEGs) found in the expression profile, resulting in the identification of 116 genes. These genes are believed to participate in NETs at both global and single-cell transcriptome levels and have been named Neutrophil Extracellular Traps-related genes (NRGs). Functional enrichment analysis of these NRGs suggested their strong association with immune response pathways and DNA-binding transcription activator activity. This corroborates previous research showing that overexpression of NETs can lead to liver inflammation ( 45 – 47 ), with NETs primarily composed of DNA ( 14 ). Due to their capacity to recognize and manage high-dimensional feature data, machine learning algorithms, a crucial aspect of Artificial Intelligence (AI), have been widely employed in the identification and screening of hub genes, thanks to the swift progress of AI ( 48 ).To further identify core NETs-related genes associated with NAFLD, we analyzed the 116 NRGs using three machine learning algorithms. In the end, ZFP36L2 and PHLDA1 were chosen as central genes, and their ability to diagnose NAFLD was confirmed in a separate dataset. The decay of mRNA targets ( 49 ) is facilitated by CCCH tandem zinc finger (TZF) proteins, namely ZFP36, ZFP36L1, and ZFP36L2, which are members of the Tristetraprolin (TTP) family. An extra member, ZFP36L3, found exclusively in rodents, is specifically expressed in both the placenta and the yolk sac ( 50 ). The TTP family proteins have been recognized as crucial in controlling cell apoptosis and have a notable function in cellular differentiation ( 51 – 53 ). Targeted gene studies in mice have delineated diverse functions of ZFP36 family members, notably identifying ZFP36L2 as a crucial regulator in hematopoiesis ( 54 – 56 ). Its role extends to female fertility, with its inactivation linked to impaired lipid metabolism ( 57 , 58 ). Imbalances in T-cell responses are observed in various autoimmune diseases ( 59 ). The degradation of Ikzf2 mRNA ( 60 ) has been linked to the inhibition of induced T cell proliferation (iTregs) through the involvement of ZFP36L2 in accelerating it.ZFP36L2 is involved in the progression of human autoimmune diseases, specifically Systemic Lupus Erythematosus (SLE), due to its crucial function in the differentiation of hematopoietic stem cells and the formation of the thymus.ZFP36L2 shows notable downregulation in the PBMCs of individuals with SLE when compared to healthy individuals ( 61 ). Furthermore, ZFP36L2 has been recognized as a gene linked to increased susceptibility in Multiple Sclerosis (MS), where its expression is notably reduced in patients relative to healthy counterparts ( 62 ). Initially identified as T-cell death-associated gene 51 (TDAG 51), Pleckstrin Homology-like Domain Family A Member 1 (PHLDA1) was first linked to apoptotic processes in adaptive immunity ( 63 , 64 ). Research has shown that PHLDA1 is involved in regulating cell growth, maintaining energy balance, promoting cell specialization, and regulating programmed cell death ( 65 – 67 ). Recent research has underscored the substantial role of PHLDA1 in immune responses. As an illustration, Hossain and colleagues, as well as Han et al., have demonstrated that inhibiting PHLDA1 modifies the properties of macrophages and endothelial cells, thereby reducing oxidative and endoplasmic reticulum (ER) stress associated with atherosclerosis ( 67 ) in studies related to Parkinson's disease. According to the report, PHLDA1 has been identified as a potent controller of neuroinflammation, as its suppression greatly hampers the activation of M1 microglia ( 68 ). Another study demonstrated that compounds targeting PHLDA1 inhibition can mitigate neuroinflammation following an ischemic stroke by maintaining equilibrium between M1 and M2 polarization within microglia. ( 69 ). Additionally, recent hepatic research has uncovered that the miR-194/PHLDA1 axis is pivotal as an upstream regulator of IKK and MAPK in hepatic ischemia-reperfusion injury (IRI). Focusing on PHLDA1 might offer a promising strategy in the treatment of liver ischemia-reperfusion injury (IRI). ( 69 ). To date, there is no documentation regarding the roles of these two crucial genes in the initiation and progression of NAFLD. Nevertheless, our investigation uncovered that their primary engagement lies in pathways such as the interaction between cytokines and cytokine receptors, the signaling pathway of MAPK, the interaction with extracellular matrix receptors, the transduction of olfactory signals, and the signaling pathway of JAK-STAT. Furthermore, NF-κB is known to catalyze the production of NLRP3, the precursor of IL-1β, and additional pro-inflammatory cytokines. Potential triggers of inflammasomes include substances such as cholesterol crystals, Reactive Oxygen Species (ROS), and fatty acids, acting as Damage-Associated Molecular Patterns (DAMPs) ( 70 – 72 ). These mechanisms work together to activate toll-like receptors (TLRs), leading to the activation of NF-κB and the mitogen-activated protein kinase (MAPK) signaling pathways. These pathways play a crucial role in inflammatory and fibrotic processes ( 70 – 72 ). Recent research indicates that the JAK-STAT signaling pathway plays a crucial part in the development of inflammatory disorders. It is worth mentioning that Nicolas and his team described the disruption of the JAK-STAT pathway in conditions marked by inflammation, cancer, and neurodegeneration. Similarly, Cai and colleagues emphasized the connection between the release of different cytokines and inflammatory mediators and the JAK/STAT pathway, underscoring its regulatory function in the immune response to sepsis ( 73 ). Additionally, recent research has also validated the involvement of JAK-STAT in NASH ( 74 ).Furthermore, Wohlmann et al.It was discovered that TSLP induces inflammatory reactions in atopic conditions via the JAK-STAT signaling pathway ( 75 ). Therefore, we hypothesize that the hub genes PHLDA1 and ZFP36L2 may participate in the pathogenesis of NAFLD through toll-like receptors, the MAPK signaling pathway, and the JAK-STAT pathway, potentially becoming viable targets for NAFLD treatment. However, their detailed mechanisms warrant further investigation. Given that Neutrophil Extracellular Traps-related Hub Genes (NRGHs) were derived from single-cell transcriptomic data, we re-examined this dataset to delve into the molecular mechanisms linked to NRGHs. The \"AddModuleScore\" function was utilized to compute a signature-specific score for each cell, anchored in the NRGHs. Significantly, CD4 T cells, NK cells, and CD8 T cells displayed markedly higher scores, indicating a potential role of these genes in the functioning of immune cells. Furthermore, we identified biological processes pertinent to NAFLD progression and immune function, including natural killer cell-mediated cytotoxicity, Th1 and Th2 cell differentiation, Th17 cell differentiation, as well as cytokine-cytokine receptor interactions and chemokine signaling pathways. These findings further substantiate the involvement of NRGHs in NAFLD progression and their association with immune functions. Furthermore, by analyzing cellular communication, we have discovered unique patterns of communication between liver microenvironments that have high and low NRGHs scores. For instance, we noted significant changes and influencing factors in the low NRGHs score group’s cellular communication signals in VISFATIN, ANGPTL, and complement signaling, suggesting their potential role in regulating inflammation, metabolism, and apoptosis in the liver microenvironment ( 76 – 78 ). Furthermore, the association between the onset of inflammation and NRGHs was demonstrated by utilizing the CIBERSORT algorithm to evaluate the variances in immune cell abundance among NAFLD patients and individuals in good health, as well as by analyzing the correlation between immune cells and NRGHs.Several constraints of this research warrant attention. Initially, while gene expression results were authenticated in mouse models, the derived conclusions came from a modestly sized group of NAFLD patients, highlighting the need for larger patient cohorts to ensure more dependable and solid results. Additionally, the diagnostic model for NAFLD formulated in this study demands more comprehensive evaluation and validation from external sources before its clinical implementation. Finally, this study concentrated exclusively on gene expression data. Consequently, subsequent studies should also delve into the changes in epigenetics, proteomics, and metabolomics involved in NAFLD's development. Conclusion Based on our current understanding, this study represents the first investigation into the molecular properties of genes associated with NETs in NAFLD. It has discovered two potential biomarkers, namely PHLDA1 and ZFP36L2 , and has provided insights into their functions within the liver microenvironment. These discoveries may aid in the diagnosis and management of NAFLD, ultimately aiming to enhance patient prognosis. Abbreviations NAFLD Non-alcoholic fatty liver disease NASH Non-alcoholic steatohepatitis NAFL Non-alcoholic fatty liver GEO Gene Expression Omnibus ScRNA-seq Single-cell RNA sequencing DEGs Differentially expressed genes Log2FC Log2 fold change GSVA Gene set variation analysis GSEA Gene set enrichment analysis NETs Neutrophil extracellular traps ROC Receiver Operating Characteristic WGCNA Weighted gene co‑expression network analysis SVM Support Vector Machin LASSO Least Absolute Shrinkage and Selection Operator RF Random Fores Declarations Funding Financial support for this study was provided by the Open Fund of the State Key Laboratory of Robotics and Systems, under the grant number SKLRS-2020-KF-07. Author Contribution Zhihao Fang designed the study, Xiaoxiao Yu, Zhihao Fang, and Chang Liu developed the methodology, Changxu Liu analyzed data, Kai Yang and Zhihao Fang performed experiments and wrote the manuscript, and Yanchao Ji, Chang Liu, and Chang Liu revised the full. Data availability statement In this research, we analyzed datasets that are publicly accessible, including GSE89632, GSE48452, GSE66676, GSE164760, and GSE136103. All these datasets were sourced from the GEO database, available at http://www.ncbi.nlm.nih.gov/geo . Competing interests The authors declare no competing interests. Ethical approval All experimental procedures were approved by the Animal Experimentation Ethics Committee at Harbin Medical University (Approval #: 2022-DWSYLLCZ-20). Consent for publication Not applicable. References Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M (2016) Global Epidemiology of Nonalcoholic Fatty Liver Disease-Meta-Analytic Assessment of Prevalence, Incidence, and Outcomes. Hepatology 64(1):73–84. 10.1002/hep.28431 Sonsuz A, Basaranoglu M, Ozbay G (2000) Relationship between Aminotransferase Levels and Histopathological Findings in Patients with Nonalcoholic Steatohepatitis. Am J Gastroenterol 95(5):1370–1371 Moore JB (2019) From Sugar to Liver Fat and Public Health: Systems Biology Driven Studies in Understanding Non-Alcoholic Fatty Liver Disease Pathogenesis. Proc Nutr Soc 78(3):290–304. 10.1017/S0029665119000570 Estes C, Razavi H, Loomba R, Younossi Z, Sanyal AJ (2018) Modeling the Epidemic of Nonalcoholic Fatty Liver Disease Demonstrates an Exponential Increase in Burden of Disease. Hepatology 67(1):123–133. 10.1002/hep.29466 Estes C, Anstee QM, Arias-Loste MT, Bantel H, Bellentani S, Caballeria J et al (2018) Modeling Nafld Disease Burden in China, France, Germany, Italy, Japan, Spain, United Kingdom, and United States for the Period 2016–2030. J Hepatol 69(4):896–904. 10.1016/j.jhep.2018.05.036 Seidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H et al (2020) Niche-Specific Reprogramming of Epigenetic Landscapes Drives Myeloid Cell Diversity in Nonalcoholic Steatohepatitis. Immunity 52(6). 10.1016/j.immuni.2020.04.001 Gadd VL, Skoien R, Powell EE, Fagan KJ, Winterford C, Horsfall L et al (2014) The Portal Inflammatory Infiltrate and Ductular Reaction in Human Nonalcoholic Fatty Liver Disease. Hepatology 59(4):1393–1405. 10.1002/hep.26937 Gomes AL, Teijeiro A, Burén S, Tummala KS, Yilmaz M, Waisman A et al (2016) Metabolic Inflammation-Associated Il-17a Causes Non-Alcoholic Steatohepatitis and Hepatocellular Carcinoma. Cancer Cell 30(1):161–175. 10.1016/j.ccell.2016.05.020 Wandrer F, Liebig S, Marhenke S, Vogel A, John K, Manns MP et al (2020) Tnf-Receptor-1 Inhibition Reduces Liver Steatosis, Hepatocellular Injury and Fibrosis in Nafld Mice. Cell Death Dis 11(3):212. 10.1038/s41419-020-2411-6 Weiskirchen R, Tacke F (2016) Immune Surveillance of Liver Cancer in Non-Alcoholic Fatty Liver Disease: Excess Lipids Cause Cd4 T-Cells Loss and Promote Hepatocellular Carcinoma Development. Hepatobiliary Surg Nutr 5(5):433–437 Rawat K, Shrivastava A (2022) Neutrophils as Emerging Protagonists and Targets in Chronic Inflammatory Diseases. Inflamm Res 71(12):1477–1488. 10.1007/s00011-022-01627-6 Witter AR, Okunnu BM, Berg RE (2016) The Essential Role of Neutrophils During Infection with the Intracellular Bacterial Pathogen Listeria Monocytogenes. J Immunol 197(5):1557–1565. 10.4049/jimmunol.1600599 Galani IE, Andreakos E (2015) Neutrophils in Viral Infections: Current Concepts and Caveats. J Leukoc Biol 98(4):557–564. 10.1189/jlb.4VMR1114-555R Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS et al (2004) Neutrophil Extracellular Traps Kill Bacteria. Science 303(5663):1532–1535 van der Windt DJ, Sud V, Zhang H, Varley PR, Goswami J, Yazdani HO et al (2018) Neutrophil Extracellular Traps Promote Inflammation and Development of Hepatocellular Carcinoma in Nonalcoholic Steatohepatitis. Hepatology 68(4):1347–1360. 10.1002/hep.29914 Wang H, Zhang H, Wang Y, Brown ZJ, Xia Y, Huang Z et al (2021) Regulatory T-Cell and Neutrophil Extracellular Trap Interaction Contributes to Carcinogenesis in Non-Alcoholic Steatohepatitis. J Hepatol 75(6):1271–1283. 10.1016/j.jhep.2021.07.032 Yu X, Guo Z, Fang Z, Yang K, Liu C, Dong Z et al (2023) Identification and Validation of Disulfidptosis-Associated Molecular Clusters in Non-Alcoholic Fatty Liver Disease. Front Genet 14:1251999. 10.3389/fgene.2023.1251999 Leek JT, Johnson WE, Parker HS, Jaffe AE, Storey JD (2012) The Sva Package for Removing Batch Effects and Other Unwanted Variation in High-Throughput Experiments. Bioinformatics 28(6):882–883. 10.1093/bioinformatics/bts034 Colaprico A, Silva TC, Olsen C, Garofano L, Cava C, Garolini D et al (2016) Tcgabiolinks: An R/Bioconductor Package for Integrative Analysis of Tcga Data. Nucleic Acids Res 44(8):e71. 10.1093/nar/gkv1507 Dwyer M, Shan Q, D'Ortona S, Maurer R, Mitchell R, Olesen H et al (2014) Cystic Fibrosis Sputum DNA Has Netosis Characteristics and Neutrophil Extracellular Trap Release Is Regulated by Macrophage Migration-Inhibitory Factor. J Innate Immun 6(6):765–779. 10.1159/000363242 Papayannopoulos V (2018) Neutrophil Extracellular Traps in Immunity and Disease. Nat Rev Immunol 18(2):134–147. 10.1038/nri.2017.105 Stuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM et al (2019) Comprehensive Integration of Single-Cell Data. Cell 177(7). 10.1016/j.cell.2019.05.031 He W, Huang Y, Shi X, Wang Q, Wu M, Li H et al (2023) Identifying a Distinct Fibrosis Subset of Nafld Via Molecular Profiling and the Involvement of Profibrotic Macrophages. J Transl Med 21(1):448 Epub 2023/07/07. 10.1186/s12967-023-04300-6 Jin S, Guerrero-Juarez CF, Zhang L, Chang I, Ramos R, Kuan C-H et al (2021) Inference and Analysis of Cell-Cell Communication Using Cellchat. Nat Commun 12(1):1088. 10.1038/s41467-021-21246-9 Langfelder P, Horvath S (2008) Wgcna: An R Package for Weighted Correlation Network Analysis. BMC Bioinformatics 9:559. 10.1186/1471-2105-9-559 Liu J, Zhou S, Li S, Jiang Y, Wan Y, Ma X et al (2019) Eleven Genes Associated with Progression and Prognosis of Endometrial Cancer (Ec) Identified by Comprehensive Bioinformatics Analysis. Cancer Cell Int 19:136. 10.1186/s12935-019-0859-1 Yang C, Delcher C, Shenkman E, Ranka S (2018) Machine Learning Approaches for Predicting High Cost High Need Patient Expenditures in Health Care. Biomed Eng Online 17(Suppl 1):131. 10.1186/s12938-018-0568-3 Ellis K, Kerr J, Godbole S, Lanckriet G, Wing D, Marshall S (2014) A Random Forest Classifier for the Prediction of Energy Expenditure and Type of Physical Activity from Wrist and Hip Accelerometers. Physiol Meas 35(11):2191–2203. 10.1088/0967-3334/35/11/2191 Tan Q, Li W, Chen X (2021) Identification the Source of Fecal Contamination for Geographically Unassociated Samples with a Statistical Classification Model Based on Support Vector Machine. J Hazard Mater 407:124821. 10.1016/j.jhazmat.2020.124821 Zhang M, Zhu K, Pu H, Wang Z, Zhao H, Zhang J et al (2019) An Immune-Related Signature Predicts Survival in Patients with Lung Adenocarcinoma. Front Oncol 9:1314. 10.3389/fonc.2019.01314 Meyer D, Dimitriadou E, Hornik K, Weingessel A, Leisch F, Chang C et al (2015) Misc Functions of the Department of Statistics, Probability Theory Group (Formerly: E1071), Package E1071. TU Wien Alderden J, Pepper GA, Wilson A, Whitney JD, Richardson S, Butcher R et al (2018) Predicting Pressure Injury in Critical Care Patients: A Machine-Learning Model. Am J Crit Care 27(6):461–468. 10.4037/ajcc2018525 Robin X, Turck N, Hainard A, Tiberti N, Lisacek F, Sanchez J-C et al (2011) Proc: An Open-Source Package for R and S + to Analyze and Compare Roc Curves. BMC Bioinformatics 12:77. 10.1186/1471-2105-12-77 Fox J, Weisberg S, Friendly M, Hong J (2017) R Package Version 4.0–0. Google Scholar Hänzelmann S, Castelo R, Guinney J, Gsva (2013) Gene Set Variation Analysis for Microarray and Rna-Seq Data. BMC Bioinformatics 14:1–15 Kumar L, Futschik ME (2007) Mfuzz: A Software Package for Soft Clustering of Microarray Data. Bioinformation 2(1):5 Bindea G, Mlecnik B, Tosolini M, Kirilovsky A, Waldner M, Obenauf AC et al (2013) Spatiotemporal Dynamics of Intratumoral Immune Cells Reveal the Immune Landscape in Human Cancer. Immunity 39(4):782–795. 10.1016/j.immuni.2013.10.003 Zhang Z, Xiao K, Wang S, Ansari AR, Niu X, Yang W et al (2022) Visfatin Is a Multifaceted Molecule That Exerts Regulation Effects on Inflammation and Apoptosis in Raw264.7 Cells and Mice Immune Organs. Front Immunol 13. 10.3389/fimmu.2022.1018973 Son Y, Paton CM (2022) A Review of Free Fatty Acid-Induced Cell Signaling, Angiopoietin-Like Protein 4, and Skeletal Muscle Differentiation. Front Physiol 13. 10.3389/fphys.2022.987977 Ricklin D, Hajishengallis G, Yang K, Lambris JD (2010) Complement: A Key System for Immune Surveillance and Homeostasis. Nat Immunol 11(9):785–797. 10.1038/ni.1923 Li P, Li M, Lindberg MR, Kennett MJ, Xiong N, Wang Y (2010) Pad4 Is Essential for Antibacterial Innate Immunity Mediated by Neutrophil Extracellular Traps. J Exp Med 207(9):1853–1862. 10.1084/jem.20100239 Lambert JE, Ramos-Roman MA, Browning JD, Parks EJ (2014) Increased De Novo Lipogenesis Is a Distinct Characteristic of Individuals with Nonalcoholic Fatty Liver Disease. Gastroenterology 146(3):726–735. 10.1053/j.gastro.2013.11.049 Zhang J, Zhao Y, Xu C, Hong Y, Lu H, Wu J et al (2014) Association between Serum Free Fatty Acid Levels and Nonalcoholic Fatty Liver Disease: A Cross-Sectional Study. Sci Rep 4:5832. 10.1038/srep05832 O'Farrell M, Duke G, Crowley R, Buckley D, Martins EB, Bhattacharya D et al (2022) Fasn Inhibition Targets Multiple Drivers of Nash by Reducing Steatosis, Inflammation and Fibrosis in Preclinical Models. Sci Rep 12(1):15661. 10.1038/s41598-022-19459-z Liu K, Wang F-S, Xu R (2021) Neutrophils in Liver Diseases: Pathogenesis and Therapeutic Targets. Cell Mol Immunol 18(1):38–44. 10.1038/s41423-020-00560-0 Honda M, Kubes P (2018) Neutrophils and Neutrophil Extracellular Traps in the Liver and Gastrointestinal System. Nat Rev Gastroenterol Hepatol 15(4):206–221. 10.1038/nrgastro.2017.183 Younossi ZM, Golabi P, de Avila L, Paik JM, Srishord M, Fukui N et al (2019) The Global Epidemiology of Nafld and Nash in Patients with Type 2 Diabetes: A Systematic Review and Meta-Analysis. J Hepatol 71(4):793–801. 10.1016/j.jhep.2019.06.021 Stafford IS, Kellermann M, Mossotto E, Beattie RM, MacArthur BD, Ennis S (2020) A Systematic Review of the Applications of Artificial Intelligence and Machine Learning in Autoimmune Diseases. NPJ Digit Med 3:30. 10.1038/s41746-020-0229-3 Blackshear PJ, Perera L (2014) Phylogenetic Distribution and Evolution of the Linked Rna-Binding and Not1-Binding Domains in the Tristetraprolin Family of Tandem Ccch Zinc Finger Proteins. J Interferon Cytokine Res 34(4):297–306. 10.1089/jir.2013.0150 Blackshear PJ, Phillips RS, Ghosh S, Ramos SBV, Richfield EK, Lai WS (2005) Zfp36l3, a Rodent X Chromosome Gene Encoding a Placenta-Specific Member of the Tristetraprolin Family of Ccch Tandem Zinc Finger Proteins. Biol Reprod 73(2):297–307 Feitelson MA, Arzumanyan A, Kulathinal RJ, Blain SW, Holcombe RF, Mahajna J et al (2015) Sustained Proliferation in Cancer: Mechanisms and Novel Therapeutic Targets. Semin Cancer Biol 35(SupplSuppl):S25–S54. 10.1016/j.semcancer.2015.02.006 Tan FE, Elowitz MB (2014) Brf1 Posttranscriptionally Regulates Pluripotency and Differentiation Responses Downstream of Erk Map Kinase. Proc Natl Acad Sci U S A 111(17):E1740–E8. 10.1073/pnas.1320873111 Johnson BA, Blackwell TK (2002) Multiple Tristetraprolin Sequence Domains Required to Induce Apoptosis and Modulate Responses to Tnfalpha through Distinct Pathways. Oncogene 21(27):4237–4246 Tiedje C, Diaz-Muñoz MD, Trulley P, Ahlfors H, Laaß K, Blackshear PJ et al (2016) The Rna-Binding Protein Ttp Is a Global Post-Transcriptional Regulator of Feedback Control in Inflammation. Nucleic Acids Res 44(15):7418–7440. 10.1093/nar/gkw474 Stumpo DJ, Byrd NA, Phillips RS, Ghosh S, Maronpot RR, Castranio T et al (2004) Chorioallantoic Fusion Defects and Embryonic Lethality Resulting from Disruption of Zfp36l1, a Gene Encoding a Ccch Tandem Zinc Finger Protein of the Tristetraprolin Family. Mol Cell Biol 24(14):6445–6455 Stumpo DJ, Broxmeyer HE, Ward T, Cooper S, Hangoc G, Chung YJ et al (2009) Targeted Disruption of Zfp36l2, Encoding a Ccch Tandem Zinc Finger Rna-Binding Protein, Results in Defective Hematopoiesis. Blood 114(12):2401–2410. 10.1182/blood-2009-04-214619 Ramos SBV, Stumpo DJ, Kennington EA, Phillips RS, Bock CB, Ribeiro-Neto F et al (2004) The Ccch Tandem Zinc-Finger Protein Zfp36l2 Is Crucial for Female Fertility and Early Embryonic Development. Development 131(19):4883–4893 Adachi S, Homoto M, Tanaka R, Hioki Y, Murakami H, Suga H et al (2014) Zfp36l1 and Zfp36l2 Control Ldlr Mrna Stability Via the Erk-Rsk Pathway. Nucleic Acids Res 42(15):10037–10049. 10.1093/nar/gku652 Dominguez-Villar M, Hafler DA (2018) Regulatory T Cells in Autoimmune Disease. Nat Immunol 19(7):665–673. 10.1038/s41590-018-0120-4 Makita S, Takatori H, Iwata A, Tanaka S, Furuta S, Ikeda K et al (2020) Rna-Binding Protein Zfp36l2 Downregulates Helios Expression and Suppresses the Function of Regulatory T Cells. Front Immunol 11:1291. 10.3389/fimmu.2020.01291 Mandel M, Gurevich M, Pauzner R, Kaminski N, Achiron A (2004) Autoimmunity Gene Expression Portrait: Specific Signature That Intersects or Differentiates between Multiple Sclerosis and Systemic Lupus Erythematosus. Clin Exp Immunol 138(1):164–170 Parnell GP, Gatt PN, Krupa M, Nickles D, McKay FC, Schibeci SD et al (2014) The Autoimmune Disease-Associated Transcription Factors Eomes and Tbx21 Are Dysregulated in Multiple Sclerosis and Define a Molecular Subtype of Disease. Clin Immunol 151(1):16–24. 10.1016/j.clim.2014.01.003 Park CG, Lee SY, Kandala G, Lee SY, Choi Y (1996) A Novel Gene Product That Couples Tcr Signaling to Fas(Cd95) Expression in Activation-Induced Cell Death. Immunity 4(6):583–591 Neef R, Kuske MA, Pröls E, Johnson JP (2002) Identification of the Human Phlda1/Tdag51 Gene: Down-Regulation in Metastatic Melanoma Contributes to Apoptosis Resistance and Growth Deregulation. Cancer Res 62(20):5920–5929 Wu D, Yang N, Xu Y, Wang S, Zhang Y, Sagnelli M et al (2019) Lncrna Hif1a Antisense Rna 2 Modulates Trophoblast Cell Invasion and Proliferation through Upregulating Phlda1 Expression. Mol Ther Nucleic Acids 16:605–615. 10.1016/j.omtn.2019.04.009 Basseri S, Lhoták S, Fullerton MD, Palanivel R, Jiang H, Lynn EG et al (2013) Loss of Tdag51 Results in Mature-Onset Obesity, Hepatic Steatosis, and Insulin Resistance by Regulating Lipogenesis. Diabetes 62(1):158–169. 10.2337/db12-0256 Sellheyer K, Krahl D (2011) Phlda1 (Tdag51) Is a Follicular Stem Cell Marker and Differentiates between Morphoeic Basal Cell Carcinoma and Desmoplastic Trichoepithelioma. Br J Dermatol 164(1):141–147. 10.1111/j.1365-2133.2010.10045.x Han C, Yan P, He T, Cheng J, Zheng W, Zheng L-T et al (2020) Phlda1 Promotes Microglia-Mediated Neuroinflammation Via Regulating K63-Linked Ubiquitination of Traf6. Brain Behav Immun 88:640–653. 10.1016/j.bbi.2020.04.064 Zhao H, Liu Y, Chen N, Yu H, Liu S, Qian M et al (2022) Phlda1 Blockade Alleviates Cerebral Ischemia/Reperfusion Injury by Affecting Microglial M1/M2 Polarization and Nlrp3 Inflammasome Activation. Neuroscience 487:66–77. 10.1016/j.neuroscience.2022.01.018 Alegre F, Pelegrin P, Feldstein AE (2017) Inflammasomes in Liver Fibrosis. Semin Liver Dis 37(2):119–127. 10.1055/s-0037-1601350 Mridha AR, Wree A, Robertson AAB, Yeh MM, Johnson CD, Van Rooyen DM et al (2017) Nlrp3 Inflammasome Blockade Reduces Liver Inflammation and Fibrosis in Experimental Nash in Mice. J Hepatol 66(5):1037–1046. 10.1016/j.jhep.2017.01.022 Wu X, Dong L, Lin X, Li J (2017) Relevance of the Nlrp3 Inflammasome in the Pathogenesis of Chronic Liver Disease. Front Immunol 8:1728. 10.3389/fimmu.2017.01728 Cai B, Cai J-p, Luo Y-l, Chen C, Zhang S (2015) The Specific Roles of Jak/Stat Signaling Pathway in Sepsis. Inflammation 38(4):1599–1608. 10.1007/s10753-015-0135-z Shi SY, Luk CT, Schroer SA, Kim MJ, Dodington DW, Sivasubramaniyam T et al (2017) Janus Kinase 2 (Jak2) Dissociates Hepatosteatosis from Hepatocellular Carcinoma in Mice. J Biol Chem 292(9):3789–3799. 10.1074/jbc.M116.752519 Wohlmann A, Sebastian K, Borowski A, Krause S, Friedrich K (2010) Signal Transduction by the Atopy-Associated Human Thymic Stromal Lymphopoietin (Tslp) Receptor Depends on Janus Kinase Function. Biol Chem 391(2–3):181–186. 10.1515/bc.2010.029 Heo YJ, Choi S-E, Jeon JY, Han SJ, Kim DJ, Kang Y et al (2019) Visfatin Induces Inflammation and Insulin Resistance Via the Nf-<i > Κ B and Stat3 Signaling Pathways in Hepatocytes</i >. J Diabetes Res 2019:4021623. 10.1155/2019/4021623 Jiang S, Qiu G-H, Zhu N, Hu Z-Y, Liao D-F, Qin L (2019) Angptl3: A Novel Biomarker and Promising Therapeutic Target. J Drug Target 27(8):876–884. 10.1080/1061186X.2019.1566342 Merle NS, Noe R, Halbwachs-Mecarelli L, Fremeaux-Bacchi V, Roumenina LT (2015) Complement System Part Ii: Role in Immunity. Front Immunol 6. 10.3389/fimmu.2015.00257 Additional Declarations No competing interests reported. Supplementary Files SupplementaryTable.xlsx SupplementaryFig1.pdf Supplementary Fig. 1 The Integration of four liver samples before A and after removing batch effect B SupplementaryFig2.pdf Supplementary Fig. 2 The t-SNE plot colored by various cell clusters SupplementaryFig3.pdf Supplementary Fig. 3 The determination of the optimal soft threshold in WGCNA analysis SupplementaryFig4.pdf Supplementary Fig. 4 Boxplots showing the various NRGHs scores in different cell types Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3804984\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":263420703,\"identity\":\"34c1675d-edd2-46df-9728-c9809d5e7d12\",\"order_by\":0,\"name\":\"ZHIHAO FANG\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fourth Affiliated Hospital of Harbin Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"ZHIHAO\",\"middleName\":\"\",\"lastName\":\"FANG\",\"suffix\":\"\"},{\"id\":263420704,\"identity\":\"1c0493ef-01b4-45ee-9793-b996d2e2dbd4\",\"order_by\":1,\"name\":\"Xiaoxiao Yu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fourth Affiliated Hospital of Harbin Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaoxiao\",\"middleName\":\"\",\"lastName\":\"Yu\",\"suffix\":\"\"},{\"id\":263420705,\"identity\":\"029c52bd-11ec-44a7-853d-1d15262261f1\",\"order_by\":2,\"name\":\"Changxu Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fourth Affiliated Hospital of Harbin Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Changxu\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":263420706,\"identity\":\"7f35a0a3-4722-4422-8c2e-4ad50a1e61c3\",\"order_by\":3,\"name\":\"Kai Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fourth Affiliated Hospital of Harbin Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kai\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":263420707,\"identity\":\"dc8b49fa-2a2b-4c4c-9df1-24ede0be1613\",\"order_by\":4,\"name\":\"Yanchao Ji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fourth Affiliated Hospital of Harbin Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yanchao\",\"middleName\":\"\",\"lastName\":\"Ji\",\"suffix\":\"\"},{\"id\":263420708,\"identity\":\"a11f1e71-9fef-48d0-91d9-13f79fd53d25\",\"order_by\":5,\"name\":\"Chang Liu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYBACPgbGxsd/Kmzk+NmbDxz48IMILWwMzM0GPGfSjCV7jiUenNlDlBb2NgnetkOJBjN8jA9zsBGjhf1gm4QE24EEAwmeD4cZeBjk+cUOENDCk9hsYcBzJ89cunfD4QILBsOZsxMIaJFgbLyRIPGs2HLO2Q2HZ/AwJBjcJqylQeKAweHEDTdyHhzmYSNOS5NkQwJYCwORWoB+MWY4AA5kA2AgSxD2Cz/78YePGf+Bo/Lxhw8/bOT5pQloQQcSpCkfBaNgFIyCUYAdAAB9ikhYcUBhXwAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Fourth Affiliated Hospital of Harbin Medical University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Chang\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-12-25 15:14:09\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3804984/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3804984/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":49078452,\"identity\":\"2d1a7576-dcc7-4215-a4b0-ef20802b62c4\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:20\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":577237,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFlowchart of this study.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/ad4bbf625aa3aea91b0c1e74.png\"},{\"id\":49078453,\"identity\":\"82bbf6aa-ad3c-4b15-b5be-b30dd1496655\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":864038,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCharacteristics of Neutrophil Extracellular Traps (NETs) identified within the single-cell transcriptome. \\u003cstrong\\u003eA\\u003c/strong\\u003et-SNE plot showing cell types via marker genes. \\u003cstrong\\u003eB\\u003c/strong\\u003e Heatmap displaying each cell cluster's top five marker genes. \\u003cstrong\\u003eC\\u003c/strong\\u003e Scoring NETs activity for each cell. \\u003cstrong\\u003eD\\u003c/strong\\u003e NETs scores' variation across different cell types\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/4b43c464e6e66e11d1ef93b8.png\"},{\"id\":49078458,\"identity\":\"a3a58be2-8e65-476a-97fc-5f9701ec40be\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1130774,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIdentifying Neutrophil Extracellular Traps-related genes (NRGs). \\u003cstrong\\u003eA\\u003c/strong\\u003e Dendrogram illustrates GEO-NAFLD sample hierarchical clustering; a heatmap below displays each sample's NETs score via ssGSEA. \\u003cstrong\\u003eB\\u003c/strong\\u003e WGCNA's TOMplot. \\u003cstrong\\u003eC\\u003c/strong\\u003e Module-trait heatmap links MEblue module with the NETs trait. \\u003cstrong\\u003eD\\u003c/strong\\u003e The scatter plot correlates gene significance (GS) with module membership (MM) in the blue module. \\u003cstrong\\u003eE\\u003c/strong\\u003e DEGs heatmap, with color variations indicating gene expression trends in GEO NAFLD versus normal samples. The top 100 genes ranked by adjusted p-values are shown. \\u003cstrong\\u003eF\\u003c/strong\\u003e The volcano plot presents GEO NAFLD and normal sample differential analysis. \\u003cstrong\\u003eG\\u003c/strong\\u003e Venn diagram depicts common genes between the MEblue module and Microarray DEGs. \\u003cstrong\\u003eH \\u003c/strong\\u003eGO enrichment analysis for NRGs. \\u003cstrong\\u003eI\\u003c/strong\\u003e Circular diagram of NRGs' GO enrichment\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/e5bfead47fd916220dd0d1ac.png\"},{\"id\":49078685,\"identity\":\"8ab7a27a-6efd-4624-9f05-0d181a197cd1\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:24:21\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":854879,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIdentification of the NETs-related hub genes for NAFLD. \\u003cstrong\\u003eA-B \\u003c/strong\\u003eLASSO regression for hub gene screening. \\u003cstrong\\u003eA\\u003c/strong\\u003e LASSO coefficient spectrum for 28 genes, generating a logarithmic coefficient map. \\u003cstrong\\u003eB \\u003c/strong\\u003eOptimal lambda selection via repeated 10-fold cross-validation, guiding feature selection.\\u003cstrong\\u003e C-D\\u003c/strong\\u003e RF for candidate hub gene identification.\\u003cstrong\\u003e C\\u003c/strong\\u003e Decision tree count impacts error rates; green, red, and black represent NAFLD, non-NAFLD, and all samples respectively.\\u003cstrong\\u003e D\\u003c/strong\\u003e Gini importance plot with mean decrease Gini on the horizontal axis and NRGs on the vertical. \\u003cstrong\\u003eE-F\\u003c/strong\\u003e Finalizing 29 characteristic NRGs using SVM-RFE\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/49e43867753f7d5770946a93.png\"},{\"id\":49078846,\"identity\":\"86e1a229-ff56-48f7-9512-8bc782d46a8c\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:32:21\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":495630,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNRGHs-related Nomogram built to evaluate clinical utility. \\u003cstrong\\u003eA\\u003c/strong\\u003e Overlapping genes among three algorithms are shown in a Venn diagram. \\u003cstrong\\u003eB\\u003c/strong\\u003e A predictive nomogram for NAFLD occurrence constructed from NRGHs. \\u003cstrong\\u003eC\\u003c/strong\\u003e In decision curve analysis, red highlights the nomogram's net benefit in NAFLD prediction versus universal or no NAFLD assumptions (black and gray, respectively). \\u003cstrong\\u003eD\\u003c/strong\\u003e The calibration curve compares actual versus predicted NAFLD rates. An ideal model's perfect prediction is indicated by the dotted diagonal, with the nomogram's performance shown by the solid line, where closer proximity to the diagonal suggests higher accuracy\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/741a242620b09283687f54f5.png\"},{\"id\":49078690,\"identity\":\"e17d26fa-396a-46bb-be52-84b44f7e54b0\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:24:21\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":327426,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNRGHs' efficacy in both training and validation sets. \\u003cstrong\\u003eA\\u003c/strong\\u003e Boxplots compare \\u003cem\\u003eZFP36L2\\u003c/em\\u003eand \\u003cem\\u003ePHLDA1\\u003c/em\\u003e expressions between NAFLD and controls in the training set. \\u003cstrong\\u003eB\\u003c/strong\\u003eA similar comparison in the validation set GSE164760. \\u003cstrong\\u003eC-D\\u003c/strong\\u003e ROC curves for the \\u003cem\\u003ePHLDA1\\u003c/em\\u003e gene in diagnosing NAFLD in the training set \\u003cstrong\\u003eC\\u003c/strong\\u003e and GSE164760 validation set \\u003cstrong\\u003eD\\u003c/strong\\u003e. \\u003cstrong\\u003eE-F\\u003c/strong\\u003e ROC analysis for \\u003cem\\u003eZFP36L2\\u003c/em\\u003egene in NAFLD diagnosis within the training set \\u003cstrong\\u003eE\\u003c/strong\\u003e and GSE164760 validation set \\u003cstrong\\u003eF\\u003c/strong\\u003e. \\u003cem\\u003e*P \\u0026lt; 0.05,\\u003c/em\\u003e \\u003cem\\u003e***P \\u0026lt; 0.001\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/08c3cebba200b0dc1006f298.png\"},{\"id\":49078462,\"identity\":\"ece5715a-97f5-4e1f-9c94-e54793de276e\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":772354,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGSEA and GSVA of 2 NRGHs. GSEA of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e \\u003cstrong\\u003eA\\u003c/strong\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e \\u003cstrong\\u003eB\\u003c/strong\\u003e genes using KEGG gene sets. GSVA of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e \\u003cstrong\\u003eC\\u003c/strong\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e \\u003cstrong\\u003eD\\u003c/strong\\u003e genes using KEGG gene sets\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/b8f6175e23c8898cc2d63b31.png\"},{\"id\":49078465,\"identity\":\"8d8289d6-dae0-4da3-890d-aa434fb86505\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":725129,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNRGHs' correlation with with single-cell characteristics.\\u003cstrong\\u003e A-C\\u003c/strong\\u003e \\u003cem\\u003eZFP36L2\\u003c/em\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003eexpression across cell types was analyzed via single-cell RNA-seq.\\u003cstrong\\u003e (D)\\u003c/strong\\u003eKEGG dissects DEGs in high vs. low NRGHs score groups.\\u003cstrong\\u003e E\\u003c/strong\\u003e GSEA pinpoints GO terms prevalent in these groups by NRGHs scores. \\u003cstrong\\u003eF\\u003c/strong\\u003e Identifying distinct signal pathways in varying NRGHs score groups.\\u003cstrong\\u003e G-I\\u003c/strong\\u003e Circos plots for VISFATIN \\u003cstrong\\u003eG\\u003c/strong\\u003e, ANGPTL \\u003cstrong\\u003eH\\u003c/strong\\u003e, and COMPLEMENT\\u003cstrong\\u003e I\\u003c/strong\\u003e pathways, with heatmaps showing cell type involvement\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/c7e94d467b389f568a5e7ce0.png\"},{\"id\":49078461,\"identity\":\"f814498c-d379-4694-b6d4-c0d6c855d47a\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":820188,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAssessment of the extent of immune cell infiltration using data from the training set.\\u003cstrong\\u003e A\\u003c/strong\\u003e Immune cell proportion changes are shown in a stacked histogram. \\u003cstrong\\u003eB\\u003c/strong\\u003e NAFLD vs. control group differences in immune infiltration. ssGSEA assesses immune function differences in NRGHs' high vs. low expression groups for \\u003cem\\u003eZFP36L2\\u003c/em\\u003e \\u003cstrong\\u003eC\\u003c/strong\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e \\u003cstrong\\u003eD\\u003c/strong\\u003e. \\u003cstrong\\u003eE\\u003c/strong\\u003e The link between immune infiltration and NRGHs-inclusive genes. \\u003cem\\u003e*P \\u0026lt; 0.05, ***P \\u0026lt; 0.001\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/ddaa153fc5959cb18cdceab2.png\"},{\"id\":49078464,\"identity\":\"381484b8-1dff-4ba9-b2e2-f9a66f703dbe\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1091660,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eValidation of NRGHs expression in NAFLD mouse model. \\u003cstrong\\u003eA \\u003c/strong\\u003eLiver tissue samples from the HFD and CON groups were stained with H\\u0026amp;E. \\u003cstrong\\u003eB\\u003c/strong\\u003e Liver tissue samples from the HFD and CON groups were stained with Oil Red O.\\u003cstrong\\u003eC-D\\u003c/strong\\u003e Immunohistochemical staining was performed to assess the expression levels of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e \\u003cstrong\\u003eC\\u003c/strong\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e \\u003cstrong\\u003eD\\u003c/strong\\u003e in the Liver tissues. \\u003cstrong\\u003eE-F\\u003c/strong\\u003e mRNA expression levels of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e \\u003cstrong\\u003eE\\u003c/strong\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e \\u003cstrong\\u003eF\\u003c/strong\\u003e in Liver tissues from HFD and CON groups.\\u003cem\\u003e *P \\u0026lt; 0.05, ***P \\u0026lt; 0.001\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/ec7038fbf6855480f4818ee8.png\"},{\"id\":49079423,\"identity\":\"608a939e-4180-4269-9f95-88fc0b35ce26\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:48:23\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":6134991,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/b533fcfd-346b-4aeb-87d4-b3520c0133ac.pdf\"},{\"id\":49078844,\"identity\":\"659d45df-bef3-4506-9b30-2730f54f1cae\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:32:21\",\"extension\":\"xlsx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":186458,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryTable.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/cb2d749ce702bb668808b74c.xlsx\"},{\"id\":49078691,\"identity\":\"b86fcde1-6085-4e8e-86fe-7db49ac895e8\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:24:21\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":669487,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. 1\\u003c/strong\\u003e The Integration of four liver samples before \\u003cstrong\\u003eA\\u003c/strong\\u003e and after removing batch effect \\u003cstrong\\u003eB\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryFig1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/0b37962fa1b0b05bb2eeaf86.pdf\"},{\"id\":49078466,\"identity\":\"4425ca16-69c7-4082-9b25-4567b10c7d8e\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:16:21\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":3159821,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. 2\\u003c/strong\\u003e The\\u003cstrong\\u003e \\u003c/strong\\u003et-SNE plot colored by various cell clusters\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryFig2.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/fdc40008f64062d8f97ddee6.pdf\"},{\"id\":49078881,\"identity\":\"b788d2f2-93d6-48a1-9ee1-126ffab6af02\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:40:21\",\"extension\":\"pdf\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":136497,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. 3\\u003c/strong\\u003e The determination of the optimal soft threshold in WGCNA analysis\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryFig3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/dd87215cb7acd2734352416b.pdf\"},{\"id\":49078688,\"identity\":\"8906a826-0cf1-4f85-9cb6-e7bea469477f\",\"added_by\":\"auto\",\"created_at\":\"2024-01-02 19:24:21\",\"extension\":\"pdf\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":382096,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. 4\\u003c/strong\\u003e Boxplots showing the various NRGHs scores in different cell types\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SupplementaryFig4.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3804984/v1/02e393bd0038e63c0a95805d.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"The Role of Neutrophil Extracellular Traps (NETs) in Non-alcoholic Fatty Liver Disease (NAFLD): A Comprehensive Analysis of NETs-related Genes\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eNon-alcoholic Fatty Liver Disease (NAFLD) has emerged as the most common chronic liver disease globally, with a prevalence rate of 25% among adults, and this figure is on the rise (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). This condition is marked by excessive lipid storage in hepatocytes, resulting in continuous alterations in liver enzymes, including aspartate transaminase and alanine transaminase (\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). The spectrum of NAFLD includes various liver conditions, extending from Non-alcoholic Fatty Liver (NAFL) to Non-alcoholic Steatohepatitis (NASH). Without intervention, NASH may advance to cirrhosis and potentially to hepatocellular carcinoma (HCC) (\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). With the aging of the affected population and prolonged disease exposure, the burden of NAFLD-related cirrhosis is increasing, projected to double or triple in many regions worldwide from 2015 to 2030 (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e). Consequently, it becomes imperative to delve more deeply into the pathogenesis of NAFLD and to innovate new strategies for treatment.\\u003c/p\\u003e \\u003cp\\u003eIn the last twenty years, there has been a growing focus on studying the influence of immune cells on the transition from NAFLD to NASH fibrosis. Since that time, a multitude of research has delved into the roles of different immune cells and inflammatory factors in the development and advancement of NAFLD. Many of these studies have underscored the importance of macrophages, T cells, and cytokines in the pathogenesis of liver inflammation and fibrosis associated with NAFLD (\\u003cspan additionalcitationids=\\\"CR7 CR8 CR9\\\" citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). Neutrophils, forming a crucial subset of white blood cells, play a central role in the immune system's frontline defense. Their primary functions include safeguarding the body against infections and diseases through mechanisms such as phagocytosis, degranulation, and neuroendocrine actions directed at combating pathogens, including viruses, bacteria, and fungi (\\u003cspan additionalcitationids=\\\"CR12\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). The explanation of Neutrophil Extracellular Traps (NETs) has transformed our comprehension of neutrophil function and their contribution to immune responses (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e). NETs, composed of chromatin, granular proteins, and histones, form a mesh-like extracellular structure. In NAFLD, the buildup of fat in the liver initiates an inflammatory reaction, which results in the mobilization of neutrophils and subsequent release of NETs.NETs not only worsen inflammation but also attract additional immune cells to the liver, including macrophages and regulatory T cells (Tregs), ultimately playing a role in the advancement of NASH-HCC (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). Therefore, NETs are regarded as a crucial element in the advancement of NAFLD. However, further extensive investigations are necessary to fully understand the involvement of genes associated with NETs in NAFLD.\\u003c/p\\u003e \\u003cp\\u003eResearchers can now quickly evaluate the expression levels of numerous genes, thanks to the notable progress in gene microarrays and single-cell sequencing technologies. This advancement greatly contributes to our comprehension of the genetic causes of diseases. Hence, we aim to utilize bioinformatics to uncover the mechanisms through which NETs facilitate NAFLD, offering proof to guide the creation of diagnostic and therapeutic approaches for NAFLD. The study is illustrated by the workflow diagram in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData sources and processing:\\u003c/h2\\u003e \\u003cp\\u003eWe consolidated multiple liver tissue transcriptomic datasets obtained from the Gene Expression Omnibus (GEO) database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ncbi.nlm.nih.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.ncbi.nlm.nih.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The criteria for selecting raw expression profile datasets included: 1) a focus on expression profiling via array methods; 2) inclusion of datasets containing liver tissue samples from both NAFLD patients and control subjects; 3) a minimum sample size of 15; 4) the presence of either raw data or array-based gene expression profiles in the GEO database. Consequently, four datasets met these criteria: GSE89632 (Microarray, platform GPL14951), GSE48452 (Microarray, platform GPL11532), GSE66676 (Microarray, platform GPL6244), and GSE164760 (Microarray, platform GPL13667). Additional details are available in the Supplementary Table\\u0026nbsp;1. Similar to our previous study (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e), we initially merged datasets GSE89632, GSE48452, and GSE66676, comprising 72 normal and 104 NAFLD samples. These datasets were then normalized using the \\\"sva\\\" package (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). Differential gene expression between NAFLD and control groups was analyzed with the \\\"limma\\\" package (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e), considering p-values below 0.05 as statistically significant. For validation, datasets GSE164760 (6 normal and 74 NAFLD samples) were utilized. To identify NETs-related genes, we compiled a list of 170 genes from existing literature (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e) (Supplementary Table\\u0026nbsp;2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGathering and Handling of Data for Single-Cell RNA-Seq Analysis\\u003c/h2\\u003e \\u003cp\\u003eTo assess the influence of the immune microenvironment in the liver on NAFLD and fibrosis, we analyzed the scRNA-seq dataset GSE136103.In analyzing GSE136103 including four high-quality liver samples: GSM4041162, GSM4041163, GSM4041165, and GSM4041167.The \\\"Seurat\\\" package (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e) was employed for single-cell sequencing data analysis. The QC process started by choosing cells that had mitochondrial gene content lower than 15% and genes that were expressed in a minimum of three cells, within an expression range of 500 to 5000. For further analysis, we pinpointed 2000 genes characterized by high variability. To minimize batch effects across the four samples, the \\\"Harmony\\\" package was employed. Subsequently, cell clusters were created using the \\u0026ldquo;FindClusters\\u0026rdquo; and \\u0026ldquo;FindNeighbors\\u0026rdquo; functions, and the \\u0026ldquo;t-SNE\\u0026rdquo; method was applied for visualization. The selection of marker genes, vital for annotating different cell types, was informed by previous research findings (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). The AddModuleScore function was utilized to determine each cell's unique signature score, specifically targeting NETs genes. Seurat's \\\"FindMarkers\\\" function was used to identify differentially expressed genes (DEGs) between two distinct groups. We determined the statistical significance of these DEGs by employing the Wilcoxon test, with the adjusted p-value threshold set below 0.05, while keeping other parameters at their default values. Genes exhibiting diverse expressions in cells with distinct NETs scores were identified as potential contributors to NETs at the single-cell transcriptome level. The identified genes were subsequently included in the Weighted Gene Co-expression Network Analysis (WGCNA) to conduct a more comprehensive evaluation of gene expression profiles. In addition, cell interaction dynamics were examined using the \\\"CellChat\\\" R package (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnalysis of gene co-expression networks using weights (WGCNA)\\u003c/h2\\u003e \\u003cp\\u003eThe identification of co-expression modules involved the utilization of the R package 'WGCNA' (version 1.70.3) (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). The analysis, focusing on the NAFLD group, used a combined dataset of gene expressions. To begin, we established an appropriate soft threshold β for creating a scale-free network. Afterward, the weighted adjacency matrix was converted into a topological overlap matrix (TOM), and the dissimilarity (dissTOM) was computed. Next, we utilized the dynamic tree-cut technique to group genes and identify modules. The module that demonstrated the most substantial correlation with the NETs score was earmarked for in-depth analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIdentification of differentially expressed genes\\u003c/h2\\u003e \\u003cp\\u003eDifferentially expressed genes (DEGs) were identified within batch-calibrated datasets GSE89632, GSE48452, and GSE66676. For screening DEGs between NAFLD and normal samples, the Limma program package (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e) was utilized, adopting a P. adj value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 as the cutoff criterion. Due to dataset characteristics, a logFC threshold was not established. The resulting data was visualized using volcano plots and heatmaps, created with the R packages \\u0026ldquo;ggplot2\\u0026rdquo; and \\u0026ldquo;pheatmap,\\u0026rdquo; respectively.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eWe are discovering a hub gene associated with NETs through the implementation of a machine-learning algorithm.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eSubsequently, we performed an intersection of the differentially expressed genes (DEGs) at the gene expression profile level with those in the NETs-related module, as identified through WGCNA. The genes found at this intersection were deemed to be involved in neutrophil extracellular traps (NETs) at both the gene expression profile and single-cell transcriptome levels. Consequently, these genes were designated as Neutrophil Extracellular Traps-related Genes (NRGs).To create a strong predictive model with improved accuracy, we utilized the Support Vector Machine (SVM), Least Absolute Shrinkage and Selection Operator (LASSO), and Random Forest (RF) machine learning algorithms. The LASSO technique is a regression approach that prioritizes variable selection to improve the predictive accuracy and interpretability of statistical models (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e).RF is advantageous for its lack of variable condition constraints and superior accuracy, sensitivity, and specificity, suitable for predicting continuous variables and providing stable forecasts (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e).SVM, on the other hand, constructs a hyperplane in feature space to effectively separate negative from positive instances with the maximum margin (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e). We utilized the \\u0026ldquo;glmnet\\u0026rdquo; (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e), \\u0026ldquo;e1071\\u0026rdquo; (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e), and \\u0026ldquo;randomForest\\u0026rdquo; (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e) R packages for conducting LASSO regression, SVM, and RF analysis, respectively. The choice of hub NAFLD genes was made according to the agreement genes identified by all three algorithms.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eConstruction and validation of a diagnostic model for NAFLD\\u003c/h2\\u003e \\u003cp\\u003eThe identified hub genes underwent multivariate logistic regression analysis using the 'ROCR' package (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e) to assess their diagnostic significance in NAFLD. Additionally, the area under the receiver operator characteristic (ROC) curve (AUC) was calculated to further evaluate their predictive accuracy. Moreover, a nomograph was developed to forecast the probability of NAFLD (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e), along with a calibration graph and decision curve analyses to showcase the stability of the model.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGene set variation analysis (GSVA) analysis and gene set enrichment analysis (GSEA)\\u003c/h2\\u003e \\u003cp\\u003eThis study commenced with the retrieval of \\\"c5.go.symbols\\\" files from the MSigDB database. Following this, the \\u0026ldquo;GSVA\\u0026rdquo; R package (version 2.11) (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e) was utilized to reveal differences in enrichment among Gene Ontology (GO) categories via a non-parametric, unsupervised gene set variation analysis (GSVA) approach. A threshold for statistical significance was set at a p-value lower than 0.05. Moreover, the \\u0026ldquo;clusterProfiler\\u0026rdquo; package (version 3.16.1) was employed for conducting Gene Set Enrichment Analysis (GSEA) to determine the abundance of significant gene clusters in KEGG pathways (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of the infiltration of immune cells using CIBERSORTx and ssGSEA\\u003c/h2\\u003e \\u003cp\\u003eThe LM22 genetic characteristic matrix algorithm (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e) was used by Cibersort to evaluate the immune-system cell subtype in each sample by analyzing their gene expression profiles. Additionally, the p-value for the backfold product of each sample was computed using Monte Carlo sampling, and immune cell abundance differences between groups were estimated using the Wilcoxon rank sum test. In this study, a p-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was deemed statistically significant. The analysis concentrated on the expression of particular immune cell metagenes through Single-sample Gene Set Enrichment Analysis (ssGSEA). We utilized the 'GSVA' R package for the quantitative assessment of variations in immune functions between groups with high and low expressions of hub genes. The two-tailed Wilcoxon test (p-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) was applied to pinpoint differences in immune-related functions between these groups. Subsequently, the 'vioplot' R package (\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e) was employed for visualizing the results.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExperimental animals and histological examination\\u003c/h2\\u003e \\u003cp\\u003eIn this study, twelve 6-week-old male C57BL/6J mice were used, housed in a controlled environment (ambient temperature: 23\\u0026deg;C\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2\\u0026deg;C; 12-hour light/dark cycle) with free access to food and water. After an initial acclimatization period of one week, these mice were randomly segregated into two dietary groups: a normal chow (CON) group and a high-fat diet (HFD) group. The HFD group received a diet with 60% calories from fat (d12492, Medicine, Jiangsu, China), in contrast to the CON group, which was provided with standard lab chow. Following a 16-week dietary regimen, we successfully developed a mouse model indicative of non-alcoholic fatty liver disease (NAFLD) [41]. At the end of this period, the mice were sedated using 2% isoflurane and subsequently euthanized via cervical dislocation for liver tissue collection. To analyze morphological changes, liver sections (5 \\u0026micro;m thick) embedded in paraffin were subjected to staining with hematoxylin and eosin (H\\u0026amp;E) and Oil Red O for assessing hepatic steatosis. The Harbin Medical University's Professional Committee for Animal Protection (2022-DWSYLLCZ-20) sanctioned all the experimental methodologies employed in this study.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemical Analyses\\u003c/h2\\u003e \\u003cp\\u003eImmunohistochemical staining of paraffin-embedded liver sections was conducted following standard protocols. Primary antibodies rabbit anti-PHLDA1 (1:100 dilution; PA5948; Abmart) and rabbit anti-ZFP36L2 (1:100 dilution; PA4972; Abmart) were incubated with the sections overnight at 4\\u0026deg;C. The stained sections were then visualized using a light field microscope. To maintain objectivity, a blinded method was used to randomly select three mice for each section.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantitative Polymerase Chain Reaction (RT-qPCR)\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from homogenized tissue samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Following this, 1 \\u0026micro;g of the extracted RNA underwent reverse transcription with PrimeScript reverse transcriptase (Takara, Kusatsu, Japan). The expression levels of genes were then quantified by employing 2X SYBR Green qPCR (Vazyme, Nanjing, China). For normalization purposes, β-actin was used as an internal reference. The sequences of the primers used for the target genes are specified below:\\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eZFP36L2\\u003c/strong\\u003e \\u003cp\\u003eCACACTTCTGTCACCCTTCTAC (F), and GTCCAGCATGTTGTTCAGATTG (R);\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003ePHLDA1\\u003c/strong\\u003e \\u003cp\\u003eCACCAGTCAAGCTGAAGGAA (F), and GTCATCACCACAGTGAAGTACA (R).\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe 2^-ΔΔCt technique was utilized for the semi-quantitative assessment of mRNA expression levels in the target genes.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData analysis\\u003c/h2\\u003e \\u003cp\\u003eThe study employed the R software (version 4.2.3) for conducting bioinformatics analyses. We utilized GraphPad Prism software (version 9.0) for statistical analysis and visualization of the data obtained from the animal experiment. We utilized the unpaired Student's t-test to compare the averages of two groups with variables that adhere to a Gaussian distribution. The information is displayed as the average\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;deviation, and a p-value less than 0.05 is considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNeutrophil extracellular traps characteristic in single‑cell transcriptome\\u003c/h2\\u003e \\u003cp\\u003eWe investigated a liver dataset (GSE136103) using single-cell RNA sequencing (scRNA-seq) to explore the contribution of different liver cell types, including hepatocytes, endothelial cells, and immune cells, to the progression of NAFLD and fibrosis. The exam involved creating transcriptomic signatures unique to every cell type, which were determined by genes primarily expressed in each cell subset. This task included the analysis of four liver samples characterized by high-quality single-cell transcriptomes, specifically GSM4041162, GSM4041163, GSM4041165, and GSM4041167.To mitigate batch effects, the Harmony package was employed, successfully integrating the four samples as depicted in Supplementary Fig.\\u0026nbsp;1A and 1B.To achieve dimensionality reduction, the top 2000 genes exhibiting the greatest variability were subjected to principal component analysis (PCA) and t-distributed stochastic neighbor embedding (t-SNE) techniques. This led to the clustering of all cells into 20 distinct groups with a resolution of 0.5, as shown in Supplementary Fig.\\u0026nbsp;2. For cell classification, we utilized specific marker genes corresponding to various cell types, as established in prior research (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA illustrates the analyzed cell types, which encompassed Hepatocytes, Cholangiocytes, B cells, CD4 T cells, CD8 T cells, Endothelial cells, Kupffer cells, Macrophages, Monocytes, and NK cells. Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB showcases a heatmap of the top five marker genes for each of these cell groups. To assess the function of Neutrophil Extracellular Traps (NETs) in various cell types, we utilized the Seurat package's 'AddModuleScore' function to gauge the expression levels of a distinct group of 170 genes associated with NETs across all cell types (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). Notably, Monocytes, Kupffer cells, and Macrophages exhibited significantly heightened levels of NETs activity, as depicted in Fi. 2D. Following this, cells were categorized into groups with high and low NETs activity. Based on this classification, 1276 differentially expressed genes (DEGs) were discerned between these two groups, setting the stage for subsequent analysis (see Supplementary Table\\u0026nbsp;3).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eIdentification of the hub module and genes related to NETs in the expression profile of the NAFLD samples\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe single-sample Gene Set Enrichment Analysis (ssGSEA) algorithm is widely used to assess changes in biological processes and pathway activities in individual samples. For our investigation, we utilized ssGSEA to calculate a score representing the activity of Neutrophil Extracellular Traps (NETs) for every sample in the GEO-NAFLD dataset. This score was then employed as phenotype data in the subsequent analysis of Weighted Gene Co-expression Network Analysis (WGCNA). To identify modules that are strongly correlated with NETs scores, we performed WGCNA on the 1276 DEGs associated with NETs that were identified through single-cell sequencing. Outlier samples were excluded before the analysis (see Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). By utilizing a soft power value of 6 (Supplementary Fig.\\u0026nbsp;3), gene modules were defined and the dynamic tree-cut algorithm was employed to detect three separate co-expressed gene modules. These modules were then displayed in a topological overlap matrix (TOM) heatmap (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Our analysis revealed that the MEblue module exhibited a strong correlation with the NRGs score in the expression profile (cor\\u0026thinsp;=\\u0026thinsp;0.59, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Moreover, the scatter diagram depicting the importance of genes (GS) compared to their membership in the blue module revealed a noteworthy association (cor\\u0026thinsp;=\\u0026thinsp;0.68, p\\u0026thinsp;=\\u0026thinsp;1.9e\\u0026thinsp;\\u0026minus;\\u0026thinsp;45, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). This suggests that the genes within this module could potentially have functional significance about neutrophil extracellular traps. To depict the dissimilarly expressed genes in the expression profile of normal tissues and NAFLD samples, volcano plots and heat maps (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE-F) were employed. By intersecting the 209 genes from the blue module with the DEGs in the expression profile, we identified a total of 116 genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG), which are believed to be involved in Neutrophil Extracellular Traps (NETs) at both global and single-cell transcriptome levels. These genes have been designated as Neutrophil Extracellular Traps-related genes (NRGs).Gene Ontology (GO) analysis of these NRGs revealed significant enrichment in biological processes (BP) including phagocytosis, response to bacterial origin molecules, lipopolysaccharide response, and steroid hormone response. Furthermore, enhancements were observed in the cellular component (CC) classification, particularly in the extracellular matrix containing collagen, and in molecular functions (MF) like inhibitory activity of enzymes, DNA-binding transcription activator activity, and apoptotic process involving cysteine-type endopeptidase inhibitor activity (Supplementary Table\\u0026nbsp;4).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIdentification of NETs-related hub genes for NAFLD\\u003c/h2\\u003e \\u003cp\\u003eTo further identify NETs-related hub genes for NAFLD, we analyzed the 116 Neutrophil Extracellular Traps-related genes (NRGs) using a combination of three machine-learning algorithms. Initially, LASSO regression analysis was performed on the intersected genes, resulting in the identification of twenty-seven candidate hub genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-B). Subsequently, the SVM-RFE analysis indicated that the classifier error was minimal when the eigengene number was twenty-nine (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC-D). Following this, the Random Forest (RF) algorithm ranked the relative importance of the genes, identifying five characteristic genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE and F). Finally, the overlapping genes determined by all three algorithms led to the selection of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e as the hub genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEvaluation of hub genes associated with NETs\\u003c/h2\\u003e \\u003cp\\u003eWe developed a nomogram model centered on the two NETs-associated hub genes to estimate the probability of NAFLD onset and to evaluate their predictive accuracy (as illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). The efficacy of this model was corroborated using a calibration curve (shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD) and through Decision Curve Analysis (DCA) (depicted in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). Furthermore, the Receiver Operating Characteristic (ROC) analysis was utilized to ascertain the Area Under the Curve (AUC) and the 95% Confidence Intervals (CI) for each of the genes under consideration. The results were as follows: \\u003cem\\u003ePHLDA1\\u003c/em\\u003e (AUC: 0.783, 95% CI: 0.711\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.849) and \\u003cem\\u003eZFP36L2\\u003c/em\\u003e (AUC: 0.713, 95% CI: 0.628\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.795) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC and E), demonstrating substantial diagnostic efficiency. Furthermore, ROC analysis of the validation dataset GSE164760 showed similar efficacy for \\u003cem\\u003ePHLDA1\\u003c/em\\u003e (AUC: 0.753, 95% CI: 0.561\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.923) and \\u003cem\\u003eZFP36L2\\u003c/em\\u003e (AUC: 0.721, 95% CI: 0.588\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.838) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD and F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNETs-related hub genes Were Associated with NAFLD-Related Enrichment Pathways\\u003c/h2\\u003e \\u003cp\\u003eTo delve deeper into the molecular mechanisms of two NETs-related hub genes in the context of NAFLD diagnosis, ssGSEA-KEGG pathway enrichment analysis was applied to each gene biomarker. The graphical representations highlighted the top six most enriched pathways (as seen in Fig.s 7A-B and Supplementary Table\\u0026nbsp;5). Comprehensive analysis indicated significant enrichment of these two hub genes in pathways such as cytokine-cytokine receptor interaction, MAPK signaling, ECM receptor interaction, olfactory transduction, and the JAK-STAT signaling pathway. Subsequently, NAFLD samples were categorized into high and low-expression groups based on the median expression levels of the hub genes.GSVA enrichment analysis was then performed to investigate the differential pathways between these groups. Comprehensive analysis indicated that high expression of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e might activate pathways such as protein export, nonhomologous end joining, regulation of autophagy, and riboflavin metabolism. Conversely, low expression of \\u003cem\\u003eZFP36L2\\u003c/em\\u003e was associated with the activation of pathways like bladder cancer, glycosaminoglycan biosynthesis - keratan sulfate, taurine and hypotaurine metabolism, and glycosaminoglycan degradation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC). Similarly, high expression of \\u003cem\\u003ePHLDA1\\u003c/em\\u003e was linked to the activation of sulfur metabolism, base excision repair, and nonhomologous end joining pathways. In contrast, low expression of \\u003cem\\u003ePHLDA1\\u003c/em\\u003e was correlated with the activation of nod-like receptor signaling, leishmania infection, hematopoietic cell lineage, and glycosaminoglycan biosynthesis - chondroitin sulfate pathways (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eThe correlation of the NETs-related hub genes with single‑cell characteristics\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate the function of NRGHs in the liver's microenvironment at the single-cell transcriptomic level, we analyzed the expression patterns of \\u003cem\\u003ePHLDA1\\u003c/em\\u003e and \\u003cem\\u003eZFP36L2\\u003c/em\\u003e across different cell types (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). These results revealed that \\u003cem\\u003eZFP36L2\\u003c/em\\u003e is broadly expressed in various liver cell types, with \\u003cem\\u003ePHLDA1\\u003c/em\\u003e predominantly expressed in Hepatocytes and Cholangiocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eB-C). Employing the \\u0026ldquo;AddModuleScore\\u0026rdquo; function, we determined the signature-specific score for each cell based on the NETs-related hub genes (NRGHs). Significantly, CD4 T cells, NK cells, and CD8 T cells displayed markedly higher scores (see Supplementary Fig.\\u0026nbsp;4). Cells were divided into groups with high and low scores based on their NRGHs scores, followed by a subsequent differential analysis. KEGG and GSEA pathway analyses of the differentially expressed genes showed significant enrichment in pathways, including natural killer cell-mediated cytotoxicity, Th1 and Th2 cell differentiation, Th17 cell differentiation, cytokine-cytokine receptor interaction, and the chemokine signaling pathway (refer to Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eD and E). It was observed that liver cells in the microenvironment with varying NRGHs scores exhibited diverse communication patterns (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eF). Within the microenvironment of the liver, various types of cells have the ability to act as transmitters, recipients, facilitators, and agents in the process of cellular communication, ultimately resulting in distinct intercellular cues. Our study identified significant changes and influencers in the cell communication signals of the low-score group, particularly in VISFATIN, ANGPTL, and COMPLEMENT signaling (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eG-I). These results indicate that such signals could have a regulatory impact on inflammation, metabolism, and apoptosis in the liver microenvironment. (\\u003cspan additionalcitationids=\\\"CR39\\\" citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmune Microenvironment and Immune-related Functions Analysis\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the immune response mechanisms in NAFLD, the CIBERSORT algorithm was employed to assess the variation in immune cell abundance between patients with NAFLD and healthy individuals (as illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA). Our findings indicated a notably higher presence of Macrophages M1, Macrophages M2, and resting Mast cells in NAFLD samples compared to control ones. Conversely, levels of naive B cells, Monocytes, activated Mast cells, and Neutrophils were significantly reduced in NAFLD samples relative to controls. Additionally, we investigated the differences in immune functions between groups exhibiting high and low expression of the hub genes, as shown in (see Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eB). Additionally, a correlation heatmap was used to illustrate the associations between the hub genes and different immune cells. (refer to Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eE).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHub Gene Expression Validation in NAFLD Mouse Model\\u003c/h2\\u003e \\u003cp\\u003eHub Gene Expression Confirmation in NAFLD Mouse Model: The high-fat diet (HFD) group, exhibited severe hepatic steatosis and sporadic inflammation, as evidenced by H\\u0026amp;E and Oil Red O staining of liver tissue sections (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e10\\u003c/span\\u003eA-B). The qRT-PCR analysis revealed that \\u003cem\\u003ePHLDA1\\u003c/em\\u003e and \\u003cem\\u003eZFP36L2\\u003c/em\\u003e expression levels were significantly reduced in the liver tissues of the HFD group in comparison to the control group (refer to Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e10\\u003c/span\\u003eE-F). This observation was corroborated by immunohistochemical staining, demonstrating lower levels of PHLDA1 and ZFP36L2 expression in the liver tissues of the HFD group compared to the control group. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e10\\u003c/span\\u003eC-D).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe development of Non-alcoholic Fatty Liver Disease (NAFLD) is intricately linked to Neutrophil Extracellular Traps (NETs). While vital for defending against infection and inflammation, excessive accumulation of NETs can lead to liver damage and disease progression, potentially culminating in liver failure. Recent studies highlight the importance of peptidyl arginine deiminase 4 (PAD 4) in NET formation, noting that neutrophils deficient in PAD 4 are unable to form NETs (\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). Two members of the DNase 1 family, specifically DNase 1 and DNase 1-like 3 (DNase 1 L3), are recognized as key contributors to NET formation, effective both in vitro and in vivo (\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). Abnormal lipid accumulation due to lipotoxicity is considered a key event in the progression of hepatic steatosis.NAFLD is characterized by a notable rise in the generation of Free Fatty Acids (FFAs) (\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e). Inhibiting fatty acid synthase (FATCH) in primary human liver tissues has been shown to prevent steatosis (\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e).In vitro studies have shown that FFAs, including linoleic acid (LA) and palmitic acid (PA), can induce NET formation, while oleic acid (OA) does not. However, suppressing the increase in free fatty acids (FFAs) is not accomplished by inhibiting NETs with DNase 1 or through the use of PAD 4 knockout mice, suggesting that NET formation is not a causative factor in steatosis, but rather a result of lipid accumulation (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e). The underlying mechanisms in this context still warrant further investigation.\\u003c/p\\u003e \\u003cp\\u003eAt first, we examined the liver scRNA-seq dataset (GSE136103) and generated transcriptomic signatures specific to each cell subtype by identifying genes that were expressed significantly. Afterward, subsequently, the \\\"AddModuleScore\\\" function was used to determine the expression levels of 170 NETs associated genes in all cells, thereby quantifying NETs activity across various cell types. Notably, Monocytes, Kupffer cells, and Macrophages exhibited significantly higher NETs activity among ten cell types (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed). Based on NETs activity, cells were classified into high and low NETs score groups, and 1276 differentially expressed genes (DEGs) between these groups were identified for further analysis. To identify NETs-related genes at both single-cell and bulk transcriptome levels, we utilized a novel bioinformatics approach that combines AddModuleScore, single-sample Gene Set Enrichment Analysis (ssGSEA), and Weighted Gene Co-expression Network Analysis (WGCNA) algorithms. Weighted Gene Co-expression Network Analysis (WGCNA) results indicated that genes within the blue module might be significantly associated with Neutrophil Extracellular Traps (NETs). By using the GEO database, we examined the levels of gene expression in individuals with NAFLD and those who are in good health. We then compared the 209 genes from the blue module with the differentially expressed genes (DEGs) found in the expression profile, resulting in the identification of 116 genes. These genes are believed to participate in NETs at both global and single-cell transcriptome levels and have been named Neutrophil Extracellular Traps-related genes (NRGs). Functional enrichment analysis of these NRGs suggested their strong association with immune response pathways and DNA-binding transcription activator activity. This corroborates previous research showing that overexpression of NETs can lead to liver inflammation (\\u003cspan additionalcitationids=\\\"CR46\\\" citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e), with NETs primarily composed of DNA (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e). Due to their capacity to recognize and manage high-dimensional feature data, machine learning algorithms, a crucial aspect of Artificial Intelligence (AI), have been widely employed in the identification and screening of hub genes, thanks to the swift progress of AI (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e).To further identify core NETs-related genes associated with NAFLD, we analyzed the 116 NRGs using three machine learning algorithms. In the end, \\u003cem\\u003eZFP36L2\\u003c/em\\u003e and \\u003cem\\u003ePHLDA1\\u003c/em\\u003e were chosen as central genes, and their ability to diagnose NAFLD was confirmed in a separate dataset.\\u003c/p\\u003e \\u003cp\\u003eThe decay of mRNA targets (\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e) is facilitated by CCCH tandem zinc finger (TZF) proteins, namely ZFP36, ZFP36L1, and ZFP36L2, which are members of the Tristetraprolin (TTP) family. An extra member, ZFP36L3, found exclusively in rodents, is specifically expressed in both the placenta and the yolk sac (\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e). The TTP family proteins have been recognized as crucial in controlling cell apoptosis and have a notable function in cellular differentiation (\\u003cspan additionalcitationids=\\\"CR52\\\" citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e). Targeted gene studies in mice have delineated diverse functions of ZFP36 family members, notably identifying ZFP36L2 as a crucial regulator in hematopoiesis (\\u003cspan additionalcitationids=\\\"CR55\\\" citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e). Its role extends to female fertility, with its inactivation linked to impaired lipid metabolism (\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e). Imbalances in T-cell responses are observed in various autoimmune diseases (\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e). The degradation of Ikzf2 mRNA (\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e) has been linked to the inhibition of induced T cell proliferation (iTregs) through the involvement of ZFP36L2 in accelerating it.ZFP36L2 is involved in the progression of human autoimmune diseases, specifically Systemic Lupus Erythematosus (SLE), due to its crucial function in the differentiation of hematopoietic stem cells and the formation of the thymus.ZFP36L2 shows notable downregulation in the PBMCs of individuals with SLE when compared to healthy individuals (\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e). Furthermore, ZFP36L2 has been recognized as a gene linked to increased susceptibility in Multiple Sclerosis (MS), where its expression is notably reduced in patients relative to healthy counterparts (\\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eInitially identified as T-cell death-associated gene 51 (TDAG 51), Pleckstrin Homology-like Domain Family A Member 1 (PHLDA1) was first linked to apoptotic processes in adaptive immunity (\\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e). Research has shown that PHLDA1 is involved in regulating cell growth, maintaining energy balance, promoting cell specialization, and regulating programmed cell death (\\u003cspan additionalcitationids=\\\"CR66\\\" citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e). Recent research has underscored the substantial role of PHLDA1 in immune responses. As an illustration, Hossain and colleagues, as well as Han et al., have demonstrated that inhibiting PHLDA1 modifies the properties of macrophages and endothelial cells, thereby reducing oxidative and endoplasmic reticulum (ER) stress associated with atherosclerosis (\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e) in studies related to Parkinson's disease. According to the report, PHLDA1 has been identified as a potent controller of neuroinflammation, as its suppression greatly hampers the activation of M1 microglia (\\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e). Another study demonstrated that compounds targeting PHLDA1 inhibition can mitigate neuroinflammation following an ischemic stroke by maintaining equilibrium between M1 and M2 polarization within microglia. (\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e). Additionally, recent hepatic research has uncovered that the miR-194/PHLDA1 axis is pivotal as an upstream regulator of IKK and MAPK in hepatic ischemia-reperfusion injury (IRI). Focusing on PHLDA1 might offer a promising strategy in the treatment of liver ischemia-reperfusion injury (IRI). (\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eTo date, there is no documentation regarding the roles of these two crucial genes in the initiation and progression of NAFLD. Nevertheless, our investigation uncovered that their primary engagement lies in pathways such as the interaction between cytokines and cytokine receptors, the signaling pathway of MAPK, the interaction with extracellular matrix receptors, the transduction of olfactory signals, and the signaling pathway of JAK-STAT. Furthermore, NF-κB is known to catalyze the production of NLRP3, the precursor of IL-1β, and additional pro-inflammatory cytokines. Potential triggers of inflammasomes include substances such as cholesterol crystals, Reactive Oxygen Species (ROS), and fatty acids, acting as Damage-Associated Molecular Patterns (DAMPs) (\\u003cspan additionalcitationids=\\\"CR71\\\" citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e). These mechanisms work together to activate toll-like receptors (TLRs), leading to the activation of NF-κB and the mitogen-activated protein kinase (MAPK) signaling pathways. These pathways play a crucial role in inflammatory and fibrotic processes (\\u003cspan additionalcitationids=\\\"CR71\\\" citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e). Recent research indicates that the JAK-STAT signaling pathway plays a crucial part in the development of inflammatory disorders. It is worth mentioning that Nicolas and his team described the disruption of the JAK-STAT pathway in conditions marked by inflammation, cancer, and neurodegeneration. Similarly, Cai and colleagues emphasized the connection between the release of different cytokines and inflammatory mediators and the JAK/STAT pathway, underscoring its regulatory function in the immune response to sepsis (\\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e). Additionally, recent research has also validated the involvement of JAK-STAT in NASH (\\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e).Furthermore, Wohlmann et al.It was discovered that TSLP induces inflammatory reactions in atopic conditions via the JAK-STAT signaling pathway (\\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e). Therefore, we hypothesize that the hub genes \\u003cem\\u003ePHLDA1\\u003c/em\\u003e and \\u003cem\\u003eZFP36L2\\u003c/em\\u003e may participate in the pathogenesis of NAFLD through toll-like receptors, the MAPK signaling pathway, and the JAK-STAT pathway, potentially becoming viable targets for NAFLD treatment. However, their detailed mechanisms warrant further investigation.\\u003c/p\\u003e \\u003cp\\u003eGiven that Neutrophil Extracellular Traps-related Hub Genes (NRGHs) were derived from single-cell transcriptomic data, we re-examined this dataset to delve into the molecular mechanisms linked to NRGHs. The \\\"AddModuleScore\\\" function was utilized to compute a signature-specific score for each cell, anchored in the NRGHs. Significantly, CD4 T cells, NK cells, and CD8 T cells displayed markedly higher scores, indicating a potential role of these genes in the functioning of immune cells. Furthermore, we identified biological processes pertinent to NAFLD progression and immune function, including natural killer cell-mediated cytotoxicity, Th1 and Th2 cell differentiation, Th17 cell differentiation, as well as cytokine-cytokine receptor interactions and chemokine signaling pathways. These findings further substantiate the involvement of NRGHs in NAFLD progression and their association with immune functions. Furthermore, by analyzing cellular communication, we have discovered unique patterns of communication between liver microenvironments that have high and low NRGHs scores. For instance, we noted significant changes and influencing factors in the low NRGHs score group\\u0026rsquo;s cellular communication signals in VISFATIN, ANGPTL, and complement signaling, suggesting their potential role in regulating inflammation, metabolism, and apoptosis in the liver microenvironment (\\u003cspan additionalcitationids=\\\"CR77\\\" citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e76\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e). Furthermore, the association between the onset of inflammation and NRGHs was demonstrated by utilizing the CIBERSORT algorithm to evaluate the variances in immune cell abundance among NAFLD patients and individuals in good health, as well as by analyzing the correlation between immune cells and NRGHs.Several constraints of this research warrant attention. Initially, while gene expression results were authenticated in mouse models, the derived conclusions came from a modestly sized group of NAFLD patients, highlighting the need for larger patient cohorts to ensure more dependable and solid results. Additionally, the diagnostic model for NAFLD formulated in this study demands more comprehensive evaluation and validation from external sources before its clinical implementation. Finally, this study concentrated exclusively on gene expression data. Consequently, subsequent studies should also delve into the changes in epigenetics, proteomics, and metabolomics involved in NAFLD's development.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eBased on our current understanding, this study represents the first investigation into the molecular properties of genes associated with NETs in NAFLD. It has discovered two potential biomarkers, namely \\u003cem\\u003ePHLDA1\\u003c/em\\u003e and \\u003cem\\u003eZFP36L2\\u003c/em\\u003e, and has provided insights into their functions within the liver microenvironment. These discoveries may aid in the diagnosis and management of NAFLD, ultimately aiming to enhance patient prognosis.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003eNAFLD \\u0026nbsp;Non-alcoholic fatty liver disease\\u003c/p\\u003e\\n\\u003cp\\u003eNASH \\u0026nbsp;Non-alcoholic steatohepatitis\\u003c/p\\u003e\\n\\u003cp\\u003eNAFL \\u0026nbsp;Non-alcoholic fatty liver\\u003c/p\\u003e\\n\\u003cp\\u003eGEO \\u0026nbsp;Gene Expression Omnibus\\u003c/p\\u003e\\n\\u003cp\\u003eScRNA-seq \\u0026nbsp;Single-cell RNA sequencing\\u003c/p\\u003e\\n\\u003cp\\u003eDEGs \\u0026nbsp;Differentially expressed genes\\u003c/p\\u003e\\n\\u003cp\\u003eLog2FC \\u0026nbsp;Log2 fold change\\u003c/p\\u003e\\n\\u003cp\\u003eGSVA \\u0026nbsp;Gene set variation analysis\\u003c/p\\u003e\\n\\u003cp\\u003eGSEA \\u0026nbsp;Gene set enrichment analysis\\u003c/p\\u003e\\n\\u003cp\\u003eNETs \\u0026nbsp;Neutrophil extracellular traps\\u003c/p\\u003e\\n\\u003cp\\u003eROC \\u0026nbsp;Receiver Operating Characteristic\\u003c/p\\u003e\\n\\u003cp\\u003eWGCNA \\u0026nbsp;Weighted gene co‑expression network analysis \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eSVM \\u0026nbsp; Support Vector Machin\\u003c/p\\u003e\\n\\u003cp\\u003eLASSO \\u0026nbsp; Least Absolute Shrinkage and Selection Operator\\u003c/p\\u003e\\n\\u003cp\\u003eRF \\u0026nbsp; Random Fores\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eFinancial support for this study was provided by the Open Fund of the State Key Laboratory of Robotics and Systems, under the grant number SKLRS-2020-KF-07.\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eZhihao Fang designed the study, Xiaoxiao Yu, Zhihao Fang, and Chang Liu developed the methodology, Changxu Liu analyzed data, Kai Yang and Zhihao Fang performed experiments and wrote the manuscript, and Yanchao Ji, Chang Liu, and Chang Liu revised the full.\\u003c/p\\u003e\\u003ch2\\u003eData availability statement\\u003c/h2\\u003e \\u003cp\\u003eIn this research, we analyzed datasets that are publicly accessible, including GSE89632, GSE48452, GSE66676, GSE164760, and GSE136103. All these datasets were sourced from the GEO database, available at \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.ncbi.nlm.nih.gov/geo\\u003c/span\\u003e\\u003cspan address=\\\"http://www.ncbi.nlm.nih.gov/geo\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/p\\u003e\\n\\u003ch2\\u003eCompeting interests \\u003c/h2\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ch2\\u003eEthical approval \\u003c/h2\\u003e\\n\\u003cp\\u003eAll experimental procedures were approved by the Animal Experimentation Ethics Committee at Harbin Medical University (Approval #: 2022-DWSYLLCZ-20).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ch2\\u003eConsent for publication \\u003c/h2\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eYounossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L, Wymer M (2016) Global Epidemiology of Nonalcoholic Fatty Liver Disease-Meta-Analytic Assessment of Prevalence, Incidence, and Outcomes. Hepatology 64(1):73\\u0026ndash;84. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/hep.28431\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/hep.28431\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSonsuz A, Basaranoglu M, Ozbay G (2000) Relationship between Aminotransferase Levels and Histopathological Findings in Patients with Nonalcoholic Steatohepatitis. Am J Gastroenterol 95(5):1370\\u0026ndash;1371\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMoore JB (2019) From Sugar to Liver Fat and Public Health: Systems Biology Driven Studies in Understanding Non-Alcoholic Fatty Liver Disease Pathogenesis. Proc Nutr Soc 78(3):290\\u0026ndash;304. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1017/S0029665119000570\\u003c/span\\u003e\\u003cspan address=\\\"10.1017/S0029665119000570\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEstes C, Razavi H, Loomba R, Younossi Z, Sanyal AJ (2018) Modeling the Epidemic of Nonalcoholic Fatty Liver Disease Demonstrates an Exponential Increase in Burden of Disease. Hepatology 67(1):123\\u0026ndash;133. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/hep.29466\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/hep.29466\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEstes C, Anstee QM, Arias-Loste MT, Bantel H, Bellentani S, Caballeria J et al (2018) Modeling Nafld Disease Burden in China, France, Germany, Italy, Japan, Spain, United Kingdom, and United States for the Period 2016\\u0026ndash;2030. J Hepatol 69(4):896\\u0026ndash;904. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jhep.2018.05.036\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jhep.2018.05.036\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSeidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H et al (2020) Niche-Specific Reprogramming of Epigenetic Landscapes Drives Myeloid Cell Diversity in Nonalcoholic Steatohepatitis. Immunity 52(6). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.immuni.2020.04.001\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.immuni.2020.04.001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGadd VL, Skoien R, Powell EE, Fagan KJ, Winterford C, Horsfall L et al (2014) The Portal Inflammatory Infiltrate and Ductular Reaction in Human Nonalcoholic Fatty Liver Disease. Hepatology 59(4):1393\\u0026ndash;1405. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/hep.26937\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/hep.26937\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGomes AL, Teijeiro A, Bur\\u0026eacute;n S, Tummala KS, Yilmaz M, Waisman A et al (2016) Metabolic Inflammation-Associated Il-17a Causes Non-Alcoholic Steatohepatitis and Hepatocellular Carcinoma. Cancer Cell 30(1):161\\u0026ndash;175. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.ccell.2016.05.020\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.ccell.2016.05.020\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWandrer F, Liebig S, Marhenke S, Vogel A, John K, Manns MP et al (2020) Tnf-Receptor-1 Inhibition Reduces Liver Steatosis, Hepatocellular Injury and Fibrosis in Nafld Mice. Cell Death Dis 11(3):212. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41419-020-2411-6\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41419-020-2411-6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeiskirchen R, Tacke F (2016) Immune Surveillance of Liver Cancer in Non-Alcoholic Fatty Liver Disease: Excess Lipids Cause Cd4 T-Cells Loss and Promote Hepatocellular Carcinoma Development. Hepatobiliary Surg Nutr 5(5):433\\u0026ndash;437\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRawat K, Shrivastava A (2022) Neutrophils as Emerging Protagonists and Targets in Chronic Inflammatory Diseases. Inflamm Res 71(12):1477\\u0026ndash;1488. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00011-022-01627-6\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00011-022-01627-6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWitter AR, Okunnu BM, Berg RE (2016) The Essential Role of Neutrophils During Infection with the Intracellular Bacterial Pathogen Listeria Monocytogenes. J Immunol 197(5):1557\\u0026ndash;1565. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.4049/jimmunol.1600599\\u003c/span\\u003e\\u003cspan address=\\\"10.4049/jimmunol.1600599\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGalani IE, Andreakos E (2015) Neutrophils in Viral Infections: Current Concepts and Caveats. J Leukoc Biol 98(4):557\\u0026ndash;564. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1189/jlb.4VMR1114-555R\\u003c/span\\u003e\\u003cspan address=\\\"10.1189/jlb.4VMR1114-555R\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS et al (2004) Neutrophil Extracellular Traps Kill Bacteria. Science 303(5663):1532\\u0026ndash;1535\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003evan der Windt DJ, Sud V, Zhang H, Varley PR, Goswami J, Yazdani HO et al (2018) Neutrophil Extracellular Traps Promote Inflammation and Development of Hepatocellular Carcinoma in Nonalcoholic Steatohepatitis. Hepatology 68(4):1347\\u0026ndash;1360. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/hep.29914\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/hep.29914\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang H, Zhang H, Wang Y, Brown ZJ, Xia Y, Huang Z et al (2021) Regulatory T-Cell and Neutrophil Extracellular Trap Interaction Contributes to Carcinogenesis in Non-Alcoholic Steatohepatitis. J Hepatol 75(6):1271\\u0026ndash;1283. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jhep.2021.07.032\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jhep.2021.07.032\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu X, Guo Z, Fang Z, Yang K, Liu C, Dong Z et al (2023) Identification and Validation of Disulfidptosis-Associated Molecular Clusters in Non-Alcoholic Fatty Liver Disease. Front Genet 14:1251999. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fgene.2023.1251999\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fgene.2023.1251999\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLeek JT, Johnson WE, Parker HS, Jaffe AE, Storey JD (2012) The Sva Package for Removing Batch Effects and Other Unwanted Variation in High-Throughput Experiments. Bioinformatics 28(6):882\\u0026ndash;883. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/bioinformatics/bts034\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/bioinformatics/bts034\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eColaprico A, Silva TC, Olsen C, Garofano L, Cava C, Garolini D et al (2016) Tcgabiolinks: An R/Bioconductor Package for Integrative Analysis of Tcga Data. Nucleic Acids Res 44(8):e71. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gkv1507\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gkv1507\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDwyer M, Shan Q, D'Ortona S, Maurer R, Mitchell R, Olesen H et al (2014) Cystic Fibrosis Sputum DNA Has Netosis Characteristics and Neutrophil Extracellular Trap Release Is Regulated by Macrophage Migration-Inhibitory Factor. J Innate Immun 6(6):765\\u0026ndash;779. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1159/000363242\\u003c/span\\u003e\\u003cspan address=\\\"10.1159/000363242\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePapayannopoulos V (2018) Neutrophil Extracellular Traps in Immunity and Disease. Nat Rev Immunol 18(2):134\\u0026ndash;147. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nri.2017.105\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nri.2017.105\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStuart T, Butler A, Hoffman P, Hafemeister C, Papalexi E, Mauck WM et al (2019) Comprehensive Integration of Single-Cell Data. Cell 177(7). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.cell.2019.05.031\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cell.2019.05.031\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHe W, Huang Y, Shi X, Wang Q, Wu M, Li H et al (2023) Identifying a Distinct Fibrosis Subset of Nafld Via Molecular Profiling and the Involvement of Profibrotic Macrophages. J Transl Med 21(1):448 Epub 2023/07/07. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12967-023-04300-6\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12967-023-04300-6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJin S, Guerrero-Juarez CF, Zhang L, Chang I, Ramos R, Kuan C-H et al (2021) Inference and Analysis of Cell-Cell Communication Using Cellchat. Nat Commun 12(1):1088. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-021-21246-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-021-21246-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLangfelder P, Horvath S (2008) Wgcna: An R Package for Weighted Correlation Network Analysis. BMC Bioinformatics 9:559. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1471-2105-9-559\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/1471-2105-9-559\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu J, Zhou S, Li S, Jiang Y, Wan Y, Ma X et al (2019) Eleven Genes Associated with Progression and Prognosis of Endometrial Cancer (Ec) Identified by Comprehensive Bioinformatics Analysis. Cancer Cell Int 19:136. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12935-019-0859-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12935-019-0859-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang C, Delcher C, Shenkman E, Ranka S (2018) Machine Learning Approaches for Predicting High Cost High Need Patient Expenditures in Health Care. Biomed Eng Online 17(Suppl 1):131. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12938-018-0568-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12938-018-0568-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEllis K, Kerr J, Godbole S, Lanckriet G, Wing D, Marshall S (2014) A Random Forest Classifier for the Prediction of Energy Expenditure and Type of Physical Activity from Wrist and Hip Accelerometers. Physiol Meas 35(11):2191\\u0026ndash;2203. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1088/0967-3334/35/11/2191\\u003c/span\\u003e\\u003cspan address=\\\"10.1088/0967-3334/35/11/2191\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTan Q, Li W, Chen X (2021) Identification the Source of Fecal Contamination for Geographically Unassociated Samples with a Statistical Classification Model Based on Support Vector Machine. J Hazard Mater 407:124821. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jhazmat.2020.124821\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jhazmat.2020.124821\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang M, Zhu K, Pu H, Wang Z, Zhao H, Zhang J et al (2019) An Immune-Related Signature Predicts Survival in Patients with Lung Adenocarcinoma. Front Oncol 9:1314. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fonc.2019.01314\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fonc.2019.01314\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeyer D, Dimitriadou E, Hornik K, Weingessel A, Leisch F, Chang C et al (2015) Misc Functions of the Department of Statistics, Probability Theory Group (Formerly: E1071), Package E1071. \\u003cem\\u003eTU Wien\\u003c/em\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlderden J, Pepper GA, Wilson A, Whitney JD, Richardson S, Butcher R et al (2018) Predicting Pressure Injury in Critical Care Patients: A Machine-Learning Model. Am J Crit Care 27(6):461\\u0026ndash;468. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.4037/ajcc2018525\\u003c/span\\u003e\\u003cspan address=\\\"10.4037/ajcc2018525\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRobin X, Turck N, Hainard A, Tiberti N, Lisacek F, Sanchez J-C et al (2011) Proc: An Open-Source Package for R and S\\u0026thinsp;+\\u0026thinsp;to Analyze and Compare Roc Curves. BMC Bioinformatics 12:77. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1471-2105-12-77\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/1471-2105-12-77\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFox J, Weisberg S, Friendly M, Hong J (2017) R Package Version 4.0\\u0026ndash;0. Google Scholar\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eH\\u0026auml;nzelmann S, Castelo R, Guinney J, Gsva (2013) Gene Set Variation Analysis for Microarray and Rna-Seq Data. BMC Bioinformatics 14:1\\u0026ndash;15\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKumar L, Futschik ME (2007) Mfuzz: A Software Package for Soft Clustering of Microarray Data. Bioinformation 2(1):5\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBindea G, Mlecnik B, Tosolini M, Kirilovsky A, Waldner M, Obenauf AC et al (2013) Spatiotemporal Dynamics of Intratumoral Immune Cells Reveal the Immune Landscape in Human Cancer. Immunity 39(4):782\\u0026ndash;795. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.immuni.2013.10.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.immuni.2013.10.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang Z, Xiao K, Wang S, Ansari AR, Niu X, Yang W et al (2022) Visfatin Is a Multifaceted Molecule That Exerts Regulation Effects on Inflammation and Apoptosis in Raw264.7 Cells and Mice Immune Organs. Front Immunol 13. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2022.1018973\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2022.1018973\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSon Y, Paton CM (2022) A Review of Free Fatty Acid-Induced Cell Signaling, Angiopoietin-Like Protein 4, and Skeletal Muscle Differentiation. Front Physiol 13. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fphys.2022.987977\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fphys.2022.987977\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRicklin D, Hajishengallis G, Yang K, Lambris JD (2010) Complement: A Key System for Immune Surveillance and Homeostasis. Nat Immunol 11(9):785\\u0026ndash;797. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/ni.1923\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/ni.1923\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi P, Li M, Lindberg MR, Kennett MJ, Xiong N, Wang Y (2010) Pad4 Is Essential for Antibacterial Innate Immunity Mediated by Neutrophil Extracellular Traps. J Exp Med 207(9):1853\\u0026ndash;1862. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1084/jem.20100239\\u003c/span\\u003e\\u003cspan address=\\\"10.1084/jem.20100239\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLambert JE, Ramos-Roman MA, Browning JD, Parks EJ (2014) Increased De Novo Lipogenesis Is a Distinct Characteristic of Individuals with Nonalcoholic Fatty Liver Disease. Gastroenterology 146(3):726\\u0026ndash;735. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1053/j.gastro.2013.11.049\\u003c/span\\u003e\\u003cspan address=\\\"10.1053/j.gastro.2013.11.049\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang J, Zhao Y, Xu C, Hong Y, Lu H, Wu J et al (2014) Association between Serum Free Fatty Acid Levels and Nonalcoholic Fatty Liver Disease: A Cross-Sectional Study. Sci Rep 4:5832. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/srep05832\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/srep05832\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eO'Farrell M, Duke G, Crowley R, Buckley D, Martins EB, Bhattacharya D et al (2022) Fasn Inhibition Targets Multiple Drivers of Nash by Reducing Steatosis, Inflammation and Fibrosis in Preclinical Models. Sci Rep 12(1):15661. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-022-19459-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-022-19459-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu K, Wang F-S, Xu R (2021) Neutrophils in Liver Diseases: Pathogenesis and Therapeutic Targets. Cell Mol Immunol 18(1):38\\u0026ndash;44. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41423-020-00560-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41423-020-00560-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHonda M, Kubes P (2018) Neutrophils and Neutrophil Extracellular Traps in the Liver and Gastrointestinal System. Nat Rev Gastroenterol Hepatol 15(4):206\\u0026ndash;221. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrgastro.2017.183\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nrgastro.2017.183\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYounossi ZM, Golabi P, de Avila L, Paik JM, Srishord M, Fukui N et al (2019) The Global Epidemiology of Nafld and Nash in Patients with Type 2 Diabetes: A Systematic Review and Meta-Analysis. J Hepatol 71(4):793\\u0026ndash;801. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jhep.2019.06.021\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jhep.2019.06.021\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStafford IS, Kellermann M, Mossotto E, Beattie RM, MacArthur BD, Ennis S (2020) A Systematic Review of the Applications of Artificial Intelligence and Machine Learning in Autoimmune Diseases. NPJ Digit Med 3:30. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41746-020-0229-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41746-020-0229-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBlackshear PJ, Perera L (2014) Phylogenetic Distribution and Evolution of the Linked Rna-Binding and Not1-Binding Domains in the Tristetraprolin Family of Tandem Ccch Zinc Finger Proteins. J Interferon Cytokine Res 34(4):297\\u0026ndash;306. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1089/jir.2013.0150\\u003c/span\\u003e\\u003cspan address=\\\"10.1089/jir.2013.0150\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBlackshear PJ, Phillips RS, Ghosh S, Ramos SBV, Richfield EK, Lai WS (2005) Zfp36l3, a Rodent X Chromosome Gene Encoding a Placenta-Specific Member of the Tristetraprolin Family of Ccch Tandem Zinc Finger Proteins. Biol Reprod 73(2):297\\u0026ndash;307\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFeitelson MA, Arzumanyan A, Kulathinal RJ, Blain SW, Holcombe RF, Mahajna J et al (2015) Sustained Proliferation in Cancer: Mechanisms and Novel Therapeutic Targets. Semin Cancer Biol 35(SupplSuppl):S25\\u0026ndash;S54. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.semcancer.2015.02.006\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.semcancer.2015.02.006\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTan FE, Elowitz MB (2014) Brf1 Posttranscriptionally Regulates Pluripotency and Differentiation Responses Downstream of Erk Map Kinase. Proc Natl Acad Sci U S A 111(17):E1740\\u0026ndash;E8. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1073/pnas.1320873111\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.1320873111\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJohnson BA, Blackwell TK (2002) Multiple Tristetraprolin Sequence Domains Required to Induce Apoptosis and Modulate Responses to Tnfalpha through Distinct Pathways. Oncogene 21(27):4237\\u0026ndash;4246\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTiedje C, Diaz-Mu\\u0026ntilde;oz MD, Trulley P, Ahlfors H, Laa\\u0026szlig; K, Blackshear PJ et al (2016) The Rna-Binding Protein Ttp Is a Global Post-Transcriptional Regulator of Feedback Control in Inflammation. Nucleic Acids Res 44(15):7418\\u0026ndash;7440. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gkw474\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gkw474\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStumpo DJ, Byrd NA, Phillips RS, Ghosh S, Maronpot RR, Castranio T et al (2004) Chorioallantoic Fusion Defects and Embryonic Lethality Resulting from Disruption of Zfp36l1, a Gene Encoding a Ccch Tandem Zinc Finger Protein of the Tristetraprolin Family. Mol Cell Biol 24(14):6445\\u0026ndash;6455\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStumpo DJ, Broxmeyer HE, Ward T, Cooper S, Hangoc G, Chung YJ et al (2009) Targeted Disruption of Zfp36l2, Encoding a Ccch Tandem Zinc Finger Rna-Binding Protein, Results in Defective Hematopoiesis. Blood 114(12):2401\\u0026ndash;2410. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1182/blood-2009-04-214619\\u003c/span\\u003e\\u003cspan address=\\\"10.1182/blood-2009-04-214619\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRamos SBV, Stumpo DJ, Kennington EA, Phillips RS, Bock CB, Ribeiro-Neto F et al (2004) The Ccch Tandem Zinc-Finger Protein Zfp36l2 Is Crucial for Female Fertility and Early Embryonic Development. Development 131(19):4883\\u0026ndash;4893\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAdachi S, Homoto M, Tanaka R, Hioki Y, Murakami H, Suga H et al (2014) Zfp36l1 and Zfp36l2 Control Ldlr Mrna Stability Via the Erk-Rsk Pathway. Nucleic Acids Res 42(15):10037\\u0026ndash;10049. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gku652\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gku652\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDominguez-Villar M, Hafler DA (2018) Regulatory T Cells in Autoimmune Disease. Nat Immunol 19(7):665\\u0026ndash;673. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41590-018-0120-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41590-018-0120-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMakita S, Takatori H, Iwata A, Tanaka S, Furuta S, Ikeda K et al (2020) Rna-Binding Protein Zfp36l2 Downregulates Helios Expression and Suppresses the Function of Regulatory T Cells. Front Immunol 11:1291. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2020.01291\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2020.01291\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMandel M, Gurevich M, Pauzner R, Kaminski N, Achiron A (2004) Autoimmunity Gene Expression Portrait: Specific Signature That Intersects or Differentiates between Multiple Sclerosis and Systemic Lupus Erythematosus. Clin Exp Immunol 138(1):164\\u0026ndash;170\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eParnell GP, Gatt PN, Krupa M, Nickles D, McKay FC, Schibeci SD et al (2014) The Autoimmune Disease-Associated Transcription Factors Eomes and Tbx21 Are Dysregulated in Multiple Sclerosis and Define a Molecular Subtype of Disease. Clin Immunol 151(1):16\\u0026ndash;24. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.clim.2014.01.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.clim.2014.01.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePark CG, Lee SY, Kandala G, Lee SY, Choi Y (1996) A Novel Gene Product That Couples Tcr Signaling to Fas(Cd95) Expression in Activation-Induced Cell Death. Immunity 4(6):583\\u0026ndash;591\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNeef R, Kuske MA, Pr\\u0026ouml;ls E, Johnson JP (2002) Identification of the Human Phlda1/Tdag51 Gene: Down-Regulation in Metastatic Melanoma Contributes to Apoptosis Resistance and Growth Deregulation. Cancer Res 62(20):5920\\u0026ndash;5929\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu D, Yang N, Xu Y, Wang S, Zhang Y, Sagnelli M et al (2019) Lncrna Hif1a Antisense Rna 2 Modulates Trophoblast Cell Invasion and Proliferation through Upregulating Phlda1 Expression. Mol Ther Nucleic Acids 16:605\\u0026ndash;615. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.omtn.2019.04.009\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.omtn.2019.04.009\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBasseri S, Lhot\\u0026aacute;k S, Fullerton MD, Palanivel R, Jiang H, Lynn EG et al (2013) Loss of Tdag51 Results in Mature-Onset Obesity, Hepatic Steatosis, and Insulin Resistance by Regulating Lipogenesis. Diabetes 62(1):158\\u0026ndash;169. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.2337/db12-0256\\u003c/span\\u003e\\u003cspan address=\\\"10.2337/db12-0256\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSellheyer K, Krahl D (2011) Phlda1 (Tdag51) Is a Follicular Stem Cell Marker and Differentiates between Morphoeic Basal Cell Carcinoma and Desmoplastic Trichoepithelioma. Br J Dermatol 164(1):141\\u0026ndash;147. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1365-2133.2010.10045.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-2133.2010.10045.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHan C, Yan P, He T, Cheng J, Zheng W, Zheng L-T et al (2020) Phlda1 Promotes Microglia-Mediated Neuroinflammation Via Regulating K63-Linked Ubiquitination of Traf6. Brain Behav Immun 88:640\\u0026ndash;653. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.bbi.2020.04.064\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbi.2020.04.064\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao H, Liu Y, Chen N, Yu H, Liu S, Qian M et al (2022) Phlda1 Blockade Alleviates Cerebral Ischemia/Reperfusion Injury by Affecting Microglial M1/M2 Polarization and Nlrp3 Inflammasome Activation. Neuroscience 487:66\\u0026ndash;77. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.neuroscience.2022.01.018\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.neuroscience.2022.01.018\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlegre F, Pelegrin P, Feldstein AE (2017) Inflammasomes in Liver Fibrosis. Semin Liver Dis 37(2):119\\u0026ndash;127. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1055/s-0037-1601350\\u003c/span\\u003e\\u003cspan address=\\\"10.1055/s-0037-1601350\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMridha AR, Wree A, Robertson AAB, Yeh MM, Johnson CD, Van Rooyen DM et al (2017) Nlrp3 Inflammasome Blockade Reduces Liver Inflammation and Fibrosis in Experimental Nash in Mice. J Hepatol 66(5):1037\\u0026ndash;1046. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jhep.2017.01.022\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jhep.2017.01.022\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu X, Dong L, Lin X, Li J (2017) Relevance of the Nlrp3 Inflammasome in the Pathogenesis of Chronic Liver Disease. Front Immunol 8:1728. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2017.01728\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2017.01728\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCai B, Cai J-p, Luo Y-l, Chen C, Zhang S (2015) The Specific Roles of Jak/Stat Signaling Pathway in Sepsis. Inflammation 38(4):1599\\u0026ndash;1608. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s10753-015-0135-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s10753-015-0135-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi SY, Luk CT, Schroer SA, Kim MJ, Dodington DW, Sivasubramaniyam T et al (2017) Janus Kinase 2 (Jak2) Dissociates Hepatosteatosis from Hepatocellular Carcinoma in Mice. J Biol Chem 292(9):3789\\u0026ndash;3799. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1074/jbc.M116.752519\\u003c/span\\u003e\\u003cspan address=\\\"10.1074/jbc.M116.752519\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWohlmann A, Sebastian K, Borowski A, Krause S, Friedrich K (2010) Signal Transduction by the Atopy-Associated Human Thymic Stromal Lymphopoietin (Tslp) Receptor Depends on Janus Kinase Function. Biol Chem 391(2\\u0026ndash;3):181\\u0026ndash;186. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1515/bc.2010.029\\u003c/span\\u003e\\u003cspan address=\\\"10.1515/bc.2010.029\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHeo YJ, Choi S-E, Jeon JY, Han SJ, Kim DJ, Kang Y et al (2019) Visfatin Induces Inflammation and Insulin Resistance Via the Nf-\\u0026lt;i\\u0026thinsp;\\u0026gt; Κ\\u0026thinsp;B and Stat3 Signaling Pathways in Hepatocytes\\u0026lt;/i\\u0026thinsp;\\u0026gt;. J Diabetes Res 2019:4021623. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1155/2019/4021623\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2019/4021623\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang S, Qiu G-H, Zhu N, Hu Z-Y, Liao D-F, Qin L (2019) Angptl3: A Novel Biomarker and Promising Therapeutic Target. J Drug Target 27(8):876\\u0026ndash;884. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/1061186X.2019.1566342\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/1061186X.2019.1566342\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMerle NS, Noe R, Halbwachs-Mecarelli L, Fremeaux-Bacchi V, Roumenina LT (2015) Complement System Part Ii: Role in Immunity. Front Immunol 6. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2015.00257\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2015.00257\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Non-alcoholic fatty liver disease, neutrophil extracellular traps (NETs), Single-cell RNA-seq, biomarker, bioinformatics, machine learning\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3804984/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3804984/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eNon-alcoholic Fatty Liver Disease (NAFLD), prevalent among adults, has become a dominant chronic liver condition worldwide, with a rising incidence of liver cirrhosis. The progression of NAFLD is critically influenced by Neutrophil Extracellular Traps (NETs), which play a key role in its pathogenesis. However, the specific functions of NETs-related genes within NAFLD necessitate further in-depth research. Our team utilized advanced methodologies including AddModuleScore, ssGSEA, and WGCNA for gene screening, identifying NETs-linked genes in single-cell and bulk transcriptomic data. Through algorithms such as Random Forest, Support Vector Machine, Least Absolute Shrinkage and Selection Operator, and Selector Operator, we identified ZFP36L2 and PHLDA1 as significant hub genes. Their role in NAFLD diagnosis was validated using the training dataset GSE164760 and further confirmed in an animal model. The study pinpointed 116 NET-associated genes, predominantly involved in immune and metabolic pathways. Notably, PHLDA1 and ZFP36L2 were determined as hub genes via machine learning techniques, contributing to a predictive model. These genes are involved in inflammatory and metabolic processes, with single-cell RNA sequencing (scRNA-seq) revealing distinct cellular communication patterns based on their expression. In conclusion, this research elucidates the molecular characteristics of NET-associated genes in NAFLD, identifying PHLDA1 and ZFP36L2 as potential biomarkers. By exploring their roles in the hepatic microenvironment, our findings offer significant insights for diagnosing and managing NAFLD, ultimately aiming to enhance patient outcomes.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The Role of Neutrophil Extracellular Traps (NETs) in Non-alcoholic Fatty Liver Disease (NAFLD): A Comprehensive Analysis of NETs-related Genes\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-01-02 19:16:16\",\"doi\":\"10.21203/rs.3.rs-3804984/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"60b50615-d9b9-4f28-bb1a-66292a2e7c05\",\"owner\":[],\"postedDate\":\"January 2nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-01-03T00:39:45+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-01-02 19:16:16\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3804984\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3804984\",\"identity\":\"rs-3804984\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}