{"paper_id":"489ec7ff-a627-4ea6-bdf3-781d6270fcab","body_text":"Platelet CKB as a potential contributor to serum creatine kinase abnormalities and metastasis in cancer patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Platelet CKB as a potential contributor to serum creatine kinase abnormalities and metastasis in cancer patients Lubei Rao, Chao Hu, Yan Yue, Yajun Luo, Bo Ye, Yue Liang, Guanbin Zhang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7113855/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Nov, 2025 Read the published version in Clinical and Experimental Medicine → Version 1 posted 7 You are reading this latest preprint version Abstract Background An unusual clinical laboratory phenomenon—serum creatine kinase-MB (CK-MB) activity exceeding total creatine kinase (CK) activity (CK-MB > CK)—is frequently observed in cancer patients, yet its molecular origin and relevance to tumor biology remain unclear. Methods We conducted an integrated analysis combining a large retrospective cancer cohort (n = 1,651), serum CK isoenzyme electrophoresis, and qRT-PCR analysis of paired serum and platelet samples. Public RNA sequencing datasets, including tumor-educated platelets (TEPs) and single-cell data from lung cancer metastases, were utilized to explore the molecular basis and clinical significance of CK isoenzyme alterations. Results Colorectal and lung cancers were the most frequently associated malignancies with CK-MB > CK abnormalities, particularly in advanced stages. Electrophoresis and transcript profiling revealed that this paradoxical elevation was driven by aberrant increases in non-cardiac CK isoenzymes, especially brain-type creatine kinase (CK-BB) and mitochondrial CK. A composite index (CK-Sub), integrating CK-BB and mitochondrial CK isoforms, was developed and found to be associated with advanced disease and poor prognosis in colorectal cancer. Notably, CKB mRNA was significantly elevated in platelets from lung cancer patients and exceeded paired serum levels, with a strong positive correlation (R² = 0.33, p < 0.001), suggesting that platelets may contribute to the circulating isoenzyme pool. This observation was supported by the TEPs RNA-seq data, which confirmed higher CKB expression in lung cancer patients (p = 7.7 × 10⁻¹¹). Single-cell RNA-seq analysis further showed that CKB expression was enriched in metastatic tumor cells but not in primary lesions. Functional gene enrichment analysis revealed associated pathways involved in metabolism, oxidative stress, and intercellular signaling. Conclusion Our findings suggest that platelet-related CKB may be linked to metastatic potential in lung cancer and represent a previously underrecognized component in cancer associated biochemical alterations. This study provides novel insights into the non-canonical roles of platelets in cancer biology and highlights CK isoenzyme profiling as a clinically relevant tool for tumor characterization. Cancer Creatine kinase Platelet Biomarker Metastasis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Creatine kinase (CK) is a central regulator of cellular energy homeostasis[ 1 ]. It catalyzes the reversible transfer of a phosphate group from adenosine triphosphate (ATP) to creatine, forming phosphocreatine and adenosine di-phosphate (ADP) [ 2 ]. Through this reaction, CK plays a vital role in tissues with high energy demands, such as skeletal muscle, heart, and brain. CK is encoded by multiple genes, forming tissue-specific isoenzyme subtypes. Among them, CKB encodes the creatine kinase brain-type isoenzyme (CK-BB); CKM encodes the creatine kinase muscle-type isoenzyme (CK-MM); and the hybrid creatine kinase-MB isoenzyme (CK-MB) is a heterodimer composed of CKB and CKM gene products. These isoforms are predominantly cytoplasmic[ 3 , 4 ]. In addition, mitochondrial creatine kinase (MtCK), encoded by the CKMT1 and CKMT2 genes, is predominantly located within mitochondria, and exists in the form of mito-chondrial creatine kinase isoenzyme II (CKII, dimeric form) and mitochondrial creatine kinase isoenzyme I (CKI, monomeric form) [ 5 , 6 ], playing a key role in ATP buffering in oxidative tissues. In healthy individuals, the serum CK pool is predominantly composed of CK-MM, with negligible amounts of other isoenzymes. During myocardial injury, CK-MB is released into the circulation, and serum CK-MB activity measurement is widely used for the diagnosis of myocardial infarction[ 7 – 11 ]. However, serum CK-MB activity de-tected by the immunoinhibition assay[ 12 ] may be influenced by the presence of non-CK-MB isoenzymes[ 13 ]. In particular, elevated levels of CK-BB[ 14 ] and mitochondrial CK isoenzymes (CKII)[ 2 , 15 ]in the serum may cause a falsely elevated CK-MB activity even in the absence of myocardial injury[ 14 , 16 ]. Studies have shown that when tumor cells enter the blood circulation and face hypoxia, CKB can be released from the cell into the extracellular space and catalyze the production of extracellular creatine phosphate, increase ATP content, maintain the energy required for tumor cell survival, and thus promote metastasis[ 2 , 13 , 17 – 22 ]. Ele-vated circulating CKB can also interfere with CK-MB and CK activity assays, potentially explaining paradoxical CK-MB > CK patterns observed in cancer patients[ 23 ]. While sporadic case reports have documented such anomalies, the biological origin and clinical relevance remain poorly characterized[ 24 – 27 ]. Our institution, the largest can-cer-specialized hospital in Southwest China, frequently observes this abnormal pattern in cancer patients. However, it remains unclear whether this is primarily driven by elevated CKB or other isoforms[ 28 , 29 ]. Currently, the regulatory mechanisms underlying hematogenous metastasis of tumor cells remain poorly un-derstood. This process is highly inefficient—fewer than 0.1% of tumor cells that enter the bloodstream ultimately succeed in forming metastatic colonies, largely due to environmental shifts and stressors such as hypoxia[ 17 , 30 ]. As the bloodstream serves as the primary route for cancer cells to disseminate from the primary site to distant organs, understanding how tumor cells interact with cellular and acellular components in the circulation may offer novel strategies for identifying or intercepting metastasis[ 30 ]. Recent studies underscore the importance of platelet–tumor cell interactions in this process[ 31 – 34 ]. Circulating tumor cells (CTCs) can bind to and internalize platelet compo-nents, co-opting the platelet transcriptome and proteome to gain metastatic advantage [ 35 ]. Tumor-educated platelets (TEPs)—platelets reprogrammed by the tumor microenvironment—may facilitate tumor metastasis by secreting or transferring bioactive molecules[ 36 – 39 ]. As the second most abundant cell population in the blood-stream, it remains unclear whether platelets can promote tumor hematogenous metastasis through factors such as CKB. Our previous preliminary research indicated that colorectal cancer patients who developed CK-MB > CK ab-normalities after curative resection exhibited significantly poorer prognoses compared to contemporaneous patients without such anomalies, characterized by shorter overall survival and a higher risk of recurrence and metastasis[ 40 ]. A deeper investigation into the factors contributing to the CK-MB > CK abnormality, and the role played by tu-mor-educated platelets in this process, may offer new insights into the mechanisms of hematogenous tumor me-tastasis. In this study, we conducted a comprehensive investigation integrating retrospective cohort analysis, serum CK isoenzyme electrophoresis, and transcriptomic profiling of paired serum and platelet samples. In addition, we lev-eraged public RNA sequencing datasets to validate the involvement of platelet-associated CKB in lung cancer and to explore its potential role in metastatic dissemination. Our goal was to elucidate the cellular source and clinical im-plications of CK-MB > CK abnormalities, with a particular focus on the interplay between CK isoenzyme dysregu-lation, platelet biology, and the metastatic phenotype in cancer. 2. Materials and methods 2.1. Patient enrollment and data collection This study combined retrospective data analysis with prospective sample collection, both of which were approved by the Institutional Ethics Committee of Sichuan Cancer Hospital and exempted from informed consent (IRB No. SCCHEC-02-2022-017). For the retrospective component, patients diagnosed with malignant tumors and hospitalized at our institution between January 1, 2019, and December 31, 2022, were reviewed. For the prospective component, fresh serum and platelet samples were collected from a subset of colorectal and lung cancer patients admitted between April 1, 2022, and May 31, 2023. Inclusion criteria required that patients had undergone serum CK-MB and total CK activity testing and exhibited CK-MB > CK abnormalities. The following exclusion criteria were applied: (1) presence of severe skeletal muscle injury or major cardiovascular diseases (e.g., acute myocardial infarction, myocarditis); (2) serum samples showing hemolysis or severe lipemia; (3) age younger than 18 or older than 100 years; (4) incomplete clinical data. Clinical information including sex, age, diagnosis, TNM stage, laboratory indices (CK-MB and total CK activity, platelet-related test results), treatment modalities (chemotherapy, radiotherapy, immunotherapy, targeted therapy), metastasis status, and survival outcomes was extracted from the electronic medical record system. Overall survival (OS) was defined as the time from the date of diagnosis to the date of death or the last follow-up. All data were anonymized prior to analysis, and no personally identifiable information was accessible to the researchers. This study was conducted in accordance with the Declaration of Helsinki and complied with institutional and international ethical guidelines for human research. All data were independently reviewed and verified by two researchers. 2.2. Serum sample collection and laboratory testing Peripheral venous blood samples were collected using BD Vacutainer tubes with clot activator and gel separator (BD, USA). Samples were centrifuged at 4,000 rpm for 8 minutes, and the supernatant serum was carefully transferred into RNase-free Eppendorf tubes and immediately stored at -80°C. Hemolytic, icteric, or lipemic samples were excluded from the analysis. Serum total CK and CK-MB activities were measured using the phosphocreatine substrate method and immunoinhibition assay, respectively, on a Mindray BS-2000M automated biochemical analyzer (Mindray, China). The reference range for CK-MB was ≤ 25 U/L. The reference range for total CK was 24–194 U/L in males and 24–170 U/L in females. An abnormal result was defined as a CK-MB/CK ratio greater than 1. Quantitative analysis of CK isoenzyme subtypes in serum samples was performed using the semi-automated HYDRASYS electrophoresis system and the HYDRAGEL ISO-CK kit (Sebia, France). Electrophoresis was conducted on an agarose gel in an alkaline buffer (pH 8.4). Densitometric analysis was performed after electrophoresis to obtain the relative quantification of each CK isoenzyme fraction. In this study, we defined a novel composite index termed CK-Sub, representing the sum of non-CK-MM and non-CK-MB isoenzymes detected by serum isoenzyme electrophoresis. Specifically, CK-Sub was calculated as the combined relative abundance of CK-BB, CKII, and CKI. CK-Sub = CK-BB + CKII + CKI This composite measure was designed to reflect the overall contribution of non-cardiac, non-skeletal muscle CK isoenzymes, and to better capture the atypical CK isoenzyme activation patterns observed in cancer patients with CK-MB > CK abnormalities (defined as CK-MB/CK ratio abnormalities). 2.3. Platelet testing, separation and purity verification First, venous blood was collected using EDTA anticoagulation tubes (BD, USA), and platelet-related parameters, including platelet count (PLT), mean platelet volume (MPV), and platelet distribution width (PDW), were measured using BC-5390 and BC-6800 fully automatic hematology analyzers (Mindray, Shenzhen). The instrument was internally quality controlled daily and calibrated weekly, and all results met the acceptable standards. Then, whole blood samples (1.5 mL), anticoagulated with EDTA, were transferred into 2 mL microcentrifuge tubes. To obtain platelet-rich plasma (PRP), samples were centrifuged at 120 × g for 20 minutes (Shuke Instruments, Sichuan, China), effectively separating platelets from nucleated cells. To reduce contamination from leukocytes and erythrocytes, only the upper 80% of the PRP layer was carefully aspirated for subsequent procedures. Platelets were then pelleted by a second centrifugation step at 360 × g for 20 minutes. All isolation steps were completed within 2 hours of venipuncture to prevent RNA degradation. Platelet purity was assessed using morphological examination and automated platelet counts, and samples were considered acceptable if leukocyte contamination was below 5 white blood cells per 1 million platelets. 2.4. Quantitative reverse transcription PCR Primer sequences were designed and synthesized by Tsingke Biological Technology Co., Ltd. (Beijing, China). The relative gene expression was quantified using the ΔCT method, with GAPDH serving as the internal control. The primer sequences used in this study were as follows: GAPDH (forward: GGAGCGAGATCCCTCCAAAAT; reverse: GGCTGTTGTCATACTTCTCATGG), CKB (forward: GCTGCGACTTCAGAAGCGA; reverse: GGCATGAGGTCGTCGATGG), CKMT1 (forward: TTGATTGTGAACGGCGTCTG; reverse: ATGCTTGGTGTGGATGACAG), and CKMT2 (forward: AGGTGACACCCAACGGCTA; reverse: TGACGGGGTCAAAAAGGTCAG). All RT-qPCR amplification experiments were performed on a LightCycler 480 system (Roche Diagnostics). The reactions utilized the TB Green Premix Ex Taq II kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. Each assay was carried out in triplicate for biological validation. Reactions were set up in a total volume of 20 µL, consisting of 10 µL of SYBR Green Master Mix, 0.8 µL of each forward and reverse primer, 2 µL of cDNA template, and 6.4 µL of RNase-/DNase-free water. The thermal cycling conditions were: initial denaturation at 95°C for 2 minutes and 30 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds and annealing/extension at 60°C for 30 seconds. Primer specificity was confirmed by observing a single peak in the melting curve analysis. 2.5. Data acquisition from public repositories Transcriptomic datasets were obtained from the Gene Expression Omnibus (GEO) database ( https://www.ncbi.nlm.nih.gov/geo/ ). The dataset GSE89843 contains RNA-sequencing profiles of tumor-educated platelets (TEPs) from 402 non-small cell lung cancer (NSCLC) patients and 377 control individuals. The dataset GSE123902 includes single-cell RNA-seq data from clinical specimens across different disease stages: non-tumor-involved lung tissue (n = 4), primary lung adenocarcinomas (n = 8), and distant metastatic lesions located in the brain (n = 3), bone (n = 1), and adrenal gland (n = 1). The GSE74639 dataset includes RNA-Seq data of primary lung tumor cells, circulating lung tumor cells, and peripheral blood leukocytes. Additionally, bulk RNA-seq data of primary lung tumors and corresponding clinical information were retrieved from The Cancer Genome Atlas (TCGA) via the Genomic Data Commons (GDC) portal ( https://portal.gdc.cancer.gov/ ) to assess the clinical and prognostic relevance of CKB expression in tumor tissue. 2.6. Statistical analysis All statistical analyses were performed using R software (version 4.3.1; R Foundation for Statistical Computing, Vienna, Austria. http://www.r-project.org accessed on June 16, 2023). Continuous variables were presented as medians with interquartile ranges (IQRs), and categorical variables were summarized as counts and percentages. For group comparisons of continuous variables, the Wilcoxon rank-sum test was used due to non-normal data distributions. Enrichment ratio was calculated as the proportion of each cancer type among CK-MB > CK abnormal cases divided by the proportion of that cancer type in the overall cancer patient cohort: $$\\:Enrichment\\:ratio=\\left(\\frac{N\\:abnormal/Total\\:abnormal\\:cases}{N\\:cancer/Total\\:cancer\\:patients}\\right)$$ Abnormality rate for each cancer type was calculated as: $$\\:Abnormality\\:rate\\:\\left(\\%\\right)=\\left(\\frac{N\\:abnormal\\:cases}{N\\:cancer\\:patients}\\right)\\times\\:100$$ Multivariate linear regression analysis was conducted to identify independent clinical predictors of CK-MB/CK ratio, with CK-MB/CK ratio as the dependent variable, and age, sex, tumor stage, and treatment status as covariates. Treatment status was categorized as yes or no based on whether patients received any form of adjuvant therapy. Principal component analysis (PCA) was performed to explore the overall patterns of CK isoenzyme expression profiles, and PERMANOVA (permutational multivariate analysis of variance) was used to assess statistical differences between groups. Linear regression analysis was performed to assess the association between CK-Sub levels and CK-MB/CK ratio. Patients were stratified into high and low expression groups based on the optimal cutoff determined by the Youden index from receiver operating characteristic (ROC) curve analysis. Survival analyses were conducted using Kaplan-Meier curves, and differences between survival distributions were compared using the log-rank test. To explore the potential involvement of platelets in the development of abnormal CK isoenzyme profiles, we evaluated the correlation between CK-Sub, CKBB, or CKII levels and platelet-related hematological indices, PLT, MPV, and PDW. Spearman correlation analysis was first performed to identify monotonic relationships between CK-Sub, CKBB, or CKII and each platelet parameter. Subsequently, multivariate linear regression models were constructed with CK-Sub, CKBB, or CKII as the dependent variable, adjusting for potential confounders such as tumor type, TNM stage, age, and sex. The variance inflation factor (VIF) was calculated to assess multicollinearity. Gene expression levels were quantified as ΔCT values, and relative expression was calculated using the 2^-ΔCT method. For paired samples (i.e., matched serum and platelet samples from the same patient), the Wilcoxon signed-rank test was used to compare gene expression between compartments. If the data met normality and homogeneity assumptions, a paired t-test was applied instead. For unpaired comparisons (e.g., platelet or serum expression between colorectal and lung cancer patients), the Mann–Whitney U test or independent-samples t-test was employed depending on the distribution of the data. Raw gene expression matrices were retrieved and processed using the GEOquery package (v2.66.0) and limma (v3.56.2). Normalized CKB mRNA expression levels were extracted and, where necessary, transformed into log₂(TPM + 1). Statistical comparisons between groups were conducted using the Wilcoxon rank-sum test or paired Wilcoxon signed-rank test, as appropriate. TCGA-LUAD RNA sequencing data and corresponding clinical survival information were accessed via the UCSC Xena browser. Patients were stratified into high and low CKB expression groups based on the median CKB expression level. Kaplan-Meier survival curves were plotted, and log-rank tests were used to assess statistical significance. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated using Cox proportional hazards regression analysis. For differential gene expression (DEG) analysis of platelet RNA-seq data from lung cancer patients, the DESeq2 package (v1.36.0) was applied. Genes significantly correlated with platelet CKB expression (adjusted p < 0.05 and |log₂FC| >1) were intersected with CKB-associated DEGs from tumor tissues. Functional enrichment analyses, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, were performed using the clusterProfiler package (v4.4.4). Data visualization, including expression distribution and group comparisons, was performed using ggplot2 (v3.4.2). A two-tailed P-value < 0.05 was considered statistically significant for all analyses. 3. Results At first, patients with CK-MB > CK anomalies were retrospectively identified from a large-scale cancer cohort, and cancer types with high prevalence or enrichment were characterized. Then, CK isoenzyme profiles in serum were analyzed using electrophoresis and qRT-PCR to identify cancer-specific patterns. Next, correlations between platelet parameters and CK isoenzymes were explored, and the expression of CKB in paired serum and platelet samples was quantitatively validated. Finally, public transcriptomic datasets were utilized to confirm CKB overexpression in lung cancer platelets, investigate its metastatic relevance, and elucidate potential functional pathways. The overall workflow and key findings were illustrated in Fig. 1 . 3.1 Patient characteristics and clinical correlates of CK-MB > CK abnormalities A total of 1,651 cancer patients presenting with CK-MB > CK abnormalities were retrospectively enrolled between 2019 and 2022. Most patients were aged between 40 and 79 years (Fig. 2 A). Based on ICD codes (S1 Table), colorectal cancer (291 cases, 17.6%), lung cancer (265 cases, 16.1%), and female reproductive system tumors (214 cases, 13.0%) were the top three cancer types represented (Fig. 2 B). To correct for differences in overall hospitalization frequencies across cancer types, we normalized CK-MB > CK occurrence against the total number of patients per cancer type. This revealed that colorectal cancer exhibited the highest enrichment and abnormality rate, indicating a strong association with CK-MB > CK anomalies. In contrast, the high absolute case count in lung cancer likely reflected its high population prevalence rather than specific enrichment (Fig. 2 C). To further explore the clinical relevance of these abnormalities, we focused on colorectal and lung cancer patients. In colorectal cancer (n = 291), the majority of patients with CK-MB > CK anomalies were aged between 40–80 years (Fig. 2 D) and stage IV (89.4%) (Fig. 2 E). A significantly higher CK-MB/CK ratio was observed in stage IV compared to stage III patients (P = 0.023, Fig. 2 G), suggesting a potential link with tumor progression. However, no significant associations were found between CK-MB/CK ratio and treatment modality or adjuvant therapy status (Figs. 2 H– 1 I). Multivariate regression confirmed that age, sex, stage, and therapy were not independently associated with CK-MB/CK ratio levels (S2 Table). Similarly, in the lung cancer cohort (n = 265), patients also tended to be older (Fig. 2 D), with a male predominance (74.7%) and high proportion of advanced-stage disease (88.6% stage IV, Fig. 2 F). No significant associations were observed between CK-MB/CK ratio and tumor stage, adjuvant therapy, or treatment modality (Figs. 2 J– 1 L), and multivariate analysis again showed no independent clinical predictors of CK-MB/CK ratio elevation (S2 Table), suggesting that additional factors may be involved in explaining the observed CK-MB > CK abnormalities. 3.2. Creatine kinase isoenzyme profile analysis in colorectal and lung cancer patients Isoenzyme electrophoresis was performed prospectively on 92 serum samples (62 colorectal, 30 lung cancer patients) exhibiting CK-MB > CK abnormalities (Fig. 3 A). All patients were stage III/IV (Fig. 3 B), consistent with the retrospective cohort, further suggesting that CK-MB > CK abnormalities were closely associated with enhanced tumor aggressiveness. Electrophoretic analysis revealed consistent abnormal bands across samples, predominantly involving elevated CK-BB and CKII isoenzymes, with most patients displaying a bimodal peak pattern (Fig. 3 C). Further comparison between colorectal and lung cancer patients showed that CKII elevation predominated in colorectal cancer, whereas both CKII and CK-BB elevations were observed in lung cancer (Fig. 3 D). PCA showed that colorectal cancer samples clustered along Dim1, associated with increased CKII expression, whereas lung cancer samples clustered along Dim2, associated with CK-BB elevation (PERMANOVA, P = 0.001) (Figs. 3 E– 2 F). Comparative analysis confirmed that lung cancer patients had significantly higher CK-BB levels (P = 1.3e-5) and lower CKII levels (P = 0.031) compared to colorectal cancer patients (Figs. 3 G– 2 H), suggesting cancer type-specific CK isoenzyme heterogeneity. 3.3. Clinical relevance of CK isoenzyme alterations in colorectal and lung cancer To investigate the clinical implications of serum CK isoenzyme abnormalities in cancer patients with CK-MB > CK patterns, we conducted a stratified analysis of colorectal cancer (n = 62) and lung cancer (n = 30) patients who underwent isoenzyme electrophoresis. In colorectal cancer patients, linear regression analysis revealed a mild positive linear relationship between CK-Sub (CK-Sub = CK-BB + CKII + CKI) levels and CK-MB/CK ratio (R² = 0.098), although the explanatory power was limited, suggesting that variations in CK-Sub alone may be insufficient to effectively predict CK-MB/CK ratio abnormalities (Fig. 4 A). We found that stage IV patients exhibited significantly higher CKII (P = 0.023) and CK-Sub (P = 0.022) levels compared with stage III patients (Figs. 4 C– 3 D), indicating that specific isoenzyme upregulation may be linked to tumor progression. In contrast, no significant differences were found in CK-BB expression (P = 0.41) or CK-MB/CK ratio (P = 0.86) between stages (S1 Fig), suggesting that the CK-MB/CK ratio alone may not sensitively reflect tumor advancement. Kaplan-Meier survival analysis revealed that patients with high CKII expression had significantly shorter overall survival (Fig. 4 F). Similarly, elevated CK-Sub levels were associated with worse survival outcomes (HR, 0.17; 95%CI, 0.0421–0.688; P = 0.0049) (Fig. 4 G). Although the overall variation in CK-MB/CK ratio was limited, alterations in individual isoenzyme components, particularly CKII, or the total CK-Sub, may serve as potential biomarkers for tumor progression in advanced-stage colorectal cancer. Unlike the mild positive linear trend observed in colorectal cancer patients, linear regression analysis in lung cancer patients revealed no significant linear relationship between CK-Sub levels and CK-MB/CK ratio (Fig. 4 B). In the comparison across tumor stages, CK-BB levels were higher in stage IV patients; however, the difference did not reach statistical significance (P = 0.44) (Fig. 4 E), possibly due to the limited sample size. Similarly, no significant differences were observed in CKII, CK-Sub levels, or CK-MB/CK ratio between different tumor stages (S1 Fig). Regarding survival outcomes, although CK-BB levels did not significantly predict overall survival (P = 0.23) (Fig. 4 H), a general trend toward poorer survival in the high-expression group was noted. Notably, patients with high CK-Sub levels had significantly shorter overall survival (P = 0.012) (Fig. 4 I). These findings suggest that tumor progression in lung cancer may involve abnormal activation of multiple CK isoenzyme subtypes. Although individual isoenzyme markers may not independently predict prognosis due to sample size limitations, the overall increase in total CK isoenzyme activity (CK-Sub) appears to be closely associated with poorer clinical outcomes. 3.4 Association between platelet parameters and CK isoenzymes To investigate whether platelets are involved in the aberrant expression patterns of CK isoenzymes observed in cancer patients, we first assessed the correlations between routine platelet-related hematological parameters (including PLT, MPV, and PDW) and serum CK isoenzyme indices (CK-Sub, CK-BB, and CKII) in patients with colorectal and lung cancers. After adjusting for potential confounding variables such as cancer type, tumor stage, age, and sex using multiple linear regression, we found a significant inverse association between PLT and serum CK-BB levels (β = − 0.038, p = 0.034). Variance inflation factor (VIF) analysis confirmed the absence of multicollinearity among covariates (all VIFs < 2.5), supporting the robustness of the model (Table 1 ). These findings suggest that reduced PLT may be closely linked to elevated serum CK-BB levels. Notably, upon inclusion of an interaction term (PLT × Cancer) in the regression model, the interaction between PLT and lung cancer approached statistical significance (β = − 0.055, p = 0.053), indicating a potentially stronger inverse association between PLT and CK-BB expression specifically in lung cancer patients. Table 1 Multiple Linear Regression Analysis with VIF of Serum CK-BB Expression and Platelet Parameters. Variable Estimate Std. Error t value p value Significance VIF (Intercept) 60.525 78.161 0.774 0.441 — PLT -0.038 0.018 -2.155 0.034 * 1.72 MPV -0.782 1.300 -0.602 0.549 1.98 PDW -2.295 5.046 -0.455 0.650 2.23 Cancer(Lung vs CRC) 22.319 3.230 6.910 8.74E-10 *** 1.14 Stage (IV vs others) 2.659 4.714 0.564 0.574 1.16 Age -0.099 0.124 -0.798 0.427 1.09 Sex (male vs female) 1.314 3.037 0.432 0.667 1.02 Note : Model fit: R² = 0.419;Adjusted R² = 0.370༛F(7, 84) = 8.64༛p < 0.0001. VIFs derived from the multivariable model to assess multicollinearity. VIF < 5 indicates acceptable level of collinearity. Abbreviations: VIF, Variance inflation factor. 3.5 Quantitative RT-PCR detection of CK family genes in serum and platelets Furthermore, we performed qRT-PCR analysis to quantify the mRNA expression levels of three creatine kinase genes—CKB, CKMT1, and CKMT2—in paired serum and platelet samples collected from cancer patients. The expression profiles in serum closely mirrored the protein isoenzyme patterns observed in previous electrophoretic analyses, exhibiting marked cancer-type specificity: mitochondrial isoenzyme CKMT1 was predominantly expressed in colorectal cancer, whereas CKB expression was markedly elevated in lung cancer (Figs. 5 A– 4 B). All three CK isoenzyme transcripts were detectable in the paired platelet samples, indicating active transcription of CK genes in platelets. Notably, platelet-derived CKB mRNA expression was significantly higher in lung cancer patients compared to those with colorectal cancer (p = 5.4 × 10⁻⁶; Fig. 5 C), suggesting potential cancer-type-specific upregulation in the lung cancer context. Paired sample analysis further revealed that, in the majority of cases, platelet CKB mRNA levels exceeded the corresponding serum expression levels (p = 0.03, Wilcoxon signed-rank test; Fig. 5 D). Additionally, correlation analysis demonstrated a significant positive association between serum and platelet CKB expression levels (R² = 0.33, p = 2.9 × 10⁻⁵; Fig. 5 E). Collectively, these findings suggest that platelets may serve as a critical source of serum CKB in cancer patients—particularly in lung cancer—potentially contributing to the observed CK-MB > CK isoenzyme elevation phenotype. 3.6 Potential role of platelet CKB in distant metastasis of lung cancer To further validate whether CKB is upregulated in the platelets of lung cancer patients, we analyzed RNA sequencing data from the tumor-educated platelet (TEP) dataset GSE89843. The results showed that CKB mRNA expression was significantly elevated in the platelets of lung cancer patients compared to healthy individuals (P = 7.7 × 10⁻¹¹, Fig. 6 A). Using the single-cell RNA sequencing dataset GSE123902, we assessed the expression of CKB mRNA within the tumor microenvironment. Notably, tumor cells from distant metastatic lesions in stage IV lung cancer patients exhibited markedly higher CKB expression, whereas no elevation was observed in primary tumor lesions (Figs. 6 D– 5 G). This finding is consistent with TCGA data, which demonstrated that while CKB expression is generally low in primary lung tumor tissues, patients with relatively higher tumor CKB expression had significantly worse survival outcomes (Figs. 6 C, 5 H). These results collectively suggest that elevated CKB expression may serve as a potential promoter of distant metastasis. To explore the origin of elevated circulating CKB, we used GSE74639 data to analyze CKB mRNA levels in circulating tumor cells (CTCs) and peripheral blood leukocytes. Both cell populations showed markedly lower CKB expression than primary tumors (Fig. 6 B). Taken together with the high expression of CKB mRNA observed in peripheral platelets from stage IV patients, we speculated that platelets may represent an external source driving CKB accumulation in metastatic lung cancer cells. To further explore the potential mechanisms by which platelet-derived CKB contributes to lung cancer metastasis, we performed an integrative analysis of CKB-associated differentially expressed genes (DEGs) in lung tumor tissues and platelet RNA profiles. A total of 25 overlapping DEGs were identified. Gene Ontology (GO) and KEGG pathway enrichment analysis revealed that these genes were significantly enriched in pathways related to metabolic processes, oxidative stress responses, immune regulation, and intercellular signaling (Fig. 6 I). These findings provide preliminary mechanistic insights, suggesting that platelet-derived CKB may play a functional role in shaping the metastatic tumor microenvironment and promoting distant dissemination in lung cancer. 4. Discussion In this study, we comprehensively analyzed the clinical, biochemical, and transcriptomic landscape of cancer patients exhibiting the paradoxical CK-MB > CK abnormality. By integrating large-scale retrospective data, serum isoenzyme profiling, qRT-PCR analysis of platelet and serum mRNA, and bioinformatics, we uncovered that elevated CKB mRNA levels in platelets correlated with metastatic features, suggesting a possible involvement of platelet-associated CKB in lung cancer progression. Our results showed that colorectal and lung cancers as the most frequently associated malignancies with CK-MB > CK abnormalities, particularly at advanced stages. Contrary to classical myocardial injury interpretations, electrophoresis and mRNA profiling revealed that these anomalies were primarily driven by aberrant activation of non-cardiac CK isoenzymes—namely, brain-type CK (CK-BB) and mitochondrial CK isoenzymes (CKII and CKI). To better capture these atypical patterns, we developed a composite index termed CK-Sub, defined as the sum of CK-BB, CKII, and CKI activity. This index demonstrated prognostic relevance, particularly in colorectal cancer, where elevated CK-Sub levels were significantly associated with stage IV disease and shorter overall survival. Importantly, cancer-type–specific CK expression patterns emerged: CKII was the predominant isoenzyme in CRC, while CK-BB was selectively enriched in lung cancer patients[ 41 ]. Previous studies have indicated that CK-BB promotes extracellular ATP production under hypoxic conditions, thereby supporting tumor cell survival, migration, and metastasis[ 17 , 42 , 43 ]. Our findings are consistent with these biological roles, confirming the presence of high CK-BB levels in patients with advanced-stage lung cancer[ 44 ]. Notably, our study observed the important contribution of CKII to CK-MB > CK discrepancies, especially in colorectal cancer[ 3 , 45 ]. This highlights the potential role of mitochondrial metabolic reprogramming in tumor progression[ 42 , 46 – 54 ] The extracellular presence of CK-BB and mitochondrial CK may not only serve as passive markers of tumor burden but may also actively contribute to establishing a metabolically supportive microenvironment that promotes tumor survival and metastasis[ 55 , 56 ]. Notably, although the CK-MB/CK ratio itself exhibited limited sensitivity in predicting tumor stage or prognosis, the underlying isoenzyme signatures—particularly the elevations in CKII—showed significant correlations with disease stage. By integrating signals from multiple non-traditional CK isoenzymes, CK-Sub demonstrated significant prognostic value in both colorectal and lung cancer patients, with elevated levels indicating worse survival outcomes. These findings suggest that analyzing CK isoenzyme patterns can provide deeper biological and clinical insights compared to traditional CK-MB/CK ratio analysis[ 13 , 19 , 40 ], and that the cumulative activity of CK isoenzymes beyond CK-MB and CK-MM may more effectively reflect tumor aggressiveness[ 52 ]. A key and novel insight from our study is the identification of platelets as a non-canonical source of circulating CKB. qRT-PCR analysis revealed that CKB mRNA expression was significantly higher in the platelets of lung cancer patients than in colorectal cancer patients. Paired sample analysis confirmed that platelet CKB levels exceeded those in serum, and a significant positive correlation was observed between the two, indicating that platelets may actively contribute to the pool of circulating CK-BB. This hypothesis was further substantiated by analysis of the GSE89843 TEPs RNA-seq dataset, which confirmed that CKB was significantly upregulated in platelets of lung cancer patients. Additional exploration using the GSE123902 single-cell RNA-seq dataset revealed that CKB expression was specifically enriched in tumor cells within distant metastatic lesions, but not in primary tumors. These observations, combined with TCGA survival analysis linking high tumor CKB expression to poor prognosis. Functional enrichment analysis revealed that 25 shared differentially expressed genes associated with TEPs and CKB tumor related genes in lung cancer were enriched in oxidative stress response, immune regulation, and metabolic reprogramming. All evidences suggest that CKB may serve as a functional facilitator of lung cancer metastasis. Taken together, our findings highlight a previously underexplored role of platelets as potential metabolic enablers of tumor dissemination. The discovery of elevated CKB mRNA levels in TEPs, particularly in lung cancer patients, and their correlation with distant metastasis raises the possibility that platelets may help shape the metastatic phenotype through metabolic crosstalk. We propose a mechanistic model (Fig. 7 ) in which platelet-associated CKB supports the survival and adaptability of CTCs during hematogenous transit, potentially by enhancing ATP production in energy-stressed environments. Although our study does not provide direct evidence for the transfer or translation of platelet CKB in vivo, the convergence of clinical, biochemical, and transcriptomic findings provides a compelling rationale for further investigation. This study also proposed that platelets may represent an important source of abnormally elevated serum CKB in cancer patients, especially in lung cancer. This not only complements the mechanistic basis for the clinical findings (CK-MB > CK), but also offers a theoretical framework for future studies on how platelets contribute to the release, transport, and systemic dissemination of tumor-associated metabolic factors such as CKB. Future studies incorporating co-culture systems, metabolic tracing, and in vivo metastasis assays are warranted to elucidate the precise functional contributions of platelet CKB in lung cancer progression. This may provide new clues for blocking platelet-assisted hematogenous metastasis. 5. Conclusions This study suggests that in lung cancer patients with serum CK-MB > CK abnormalities, the atypical CK pattern is driven by CK-BB specificity. Among them, platelet CKB is significantly elevated and closely related to distant metastasis and poor prognosis. Platelet CKB may be a potential participant in hematogenous dissemination of lung cancer, and its mechanism deserves further investigation. Abbreviations ATP Adenosine Triphosphate CK Creatine Kinase CK-MB Creatine Kinase-MB Isoenzymes CK-BB Creatine Kinase Brain-Type Isoenzymes CK-MM Creatine Kinase Muscle-Type Isoenzymes MtCK Mitochondrial Creatine Kinase CKII Mitochondrial Creatine Kinase Isoenzyme II (dimer form) CKI Mitochondrial Creatine Kinase Isoenzyme I (monomer form) RC Colorectal cancer PCA Principal Component Analysis PERMANOVA Permutational Multivariate Analysis of Variance HR Hazard Ratio CI Confidence Interval OS Overall Survival CTC Circulating tumor cell TEP Tumor-educated platelet PET Platelet-educated tumor cell PLT Platelet count MPV Mean platelet volume PDW Platelet distribution width PRP Pplatelet-rich plasma NSCLC Non-small cell lung cancer ROC Receiver operating characteristic VIF Variance inflation factor DEG Differential gene expression WBC White blood cell Declarations Funding: This research was funded by the Natural Science Foundation of Sichuan Province [Grant numbers 2024NSFSC1880] and the National Natural Science Foundation of China [Grant numbers 82302993]. The funding was essential for data analysis and the publication of this study. Conflicts of Interest: The authors have no relevant financial or non-financial interests to disclose. Author Contributions: All authors contributed to the study conception and design. Conceptualization, Lubei Rao and Dongsheng Wang; methodology, Chao Hu; software, Luibei Rao; in-vestigation, Yan Yue and Bo Ye; resources, Yue Liang; data curation, Yajun Luo; writing—original draft preparation, Lubei Rao; writing—review and editing, Lubei Rao and Guiji Zhang; visualization, Lubei Rao; supervision, Dongsheng Wang; project administration, Lubie Rao; funding acquisition, Lubei Rao and Yajun Luo. All authors have read and agreed to the published version of the manuscript. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data Availability: The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Ethics approval: The research related to human use has complied with all the relevant national regulations, institutional policies and follows the tenets of the Helsinki Declaration, and has been approved by the Institutional Ethics Committee of The Sichuan Cancer Hospital (IRB No. SCCHEC-02-2022-017). Consent to participate: The study was exempted from informed consent (IRB No. SCCHEC-02-2022-017). Consent to publish ： Not applicable. Acknowledgments During the preparation of this work, the authors used ChatGPT (OpenAI, GPT-4 version) for the purpose of assisting in refining the English language expressions. All scientific content, analyses, interpretations, and conclusions were independently developed by the authors. After using this tool, the authors have carefully reviewed and edited all outputs and take full responsibility for the content and interpretation presented in this publication. References Walters J, Gailani G: Serum creatine kinase: requesting and interpreting results. Pract Neurol 2025. Soroida Y, Ohkawa R, Nakagawa H, Satoh Y, Yoshida H, Kinoshita H, Tateishi R, Masuzaki R, Enooku K, Shiina S et al: Increased activity of serum mitochondrial isoenzyme of creatine kinase in hepatocellular carcinoma patients predominantly with recurrence. J Hepatol 2012, 57(2):330–336. Schlattner U, Kay L, Tokarska-Schlattner M: Mitochondrial Proteolipid Complexes of Creatine Kinase. Subcell Biochem 2018, 87:365–408. Kanemitsu F, Okigaki T: Characterization of human creatine kinase BB and MB isoforms by means of isoelectric focusing. Clin Chim Acta 1994, 231(1):1–9. Zhang L, Han F, Liu X, Xie C, Tian K, Bi Q, Hao M, Mu X: Macro creatine kinase in an asymptomatic patient: a case report. Clin Chem Lab Med 2020, 59(2):e61-e64. Schlattner U, Tokarska-Schlattner M, Wallimann T: Mitochondrial creatine kinase in human health and disease. Biochim Biophys Acta 2006, 1762(2):164–180. Collinson P, Suvisaari J, Aakre KM, Baum H, Duff CJ, Gruson D, Hammerer-Lercher A, Pulkki K, Stankovic S, Langlois MR et al: How Well Do Laboratories Adhere to Recommended Guidelines for Cardiac Biomarkers Management in Europe? The CArdiac MARker Guideline Uptake in Europe (CAMARGUE) Study of the European Federation of Laboratory Medicine Task Group on Cardiac Markers. Clin Chem 2021, 67(8):1144–1152. Alvin MD, Jaffe AS, Ziegelstein RC, Trost JC: Eliminating Creatine Kinase-Myocardial Band Testing in Suspected Acute Coronary Syndrome: A Value-Based Quality Improvement. JAMA Intern Med 2017, 177(10):1508–1512. Grela-Wojewoda A, Püsküllüoğlu M, Sas-Korczyńska B, Zemełka T, Pacholczak-Madej R, Wysocki WM, Wojewoda T, Adamczyk A, Lompart J, Korman M et al: Biomarkers of Trastuzumab-Induced Cardiac Toxicity in HER2- Positive Breast Cancer Patient Population. Cancers (Basel) 2022, 14(14). Kanemitsu F, Okigaki T: Creatine kinase MB isoforms for early diagnosis and monitoring of acute myocardial infarction. Clin Chim Acta 1992, 206(3):191–199. Panteghini M, Cuccia C, Malchiodi A, Calarco M, Pagnoni N: Isoforms of creatine kinase MM and MB in acute myocardial infarction: a clinical evaluation. Clin Chim Acta 1986, 155(1):1–9. Neumeier D, Prellwitz W, Würzburg U, Brundobler M, Olbermann M, Just HJ, Knedel M, Lang H: Determination of creatine kinase isoenzyme MB activity in serum using immunological inhibition of creatine kinase M subunit activity. Activity kinetics and diagnostic significance in myocardial infarction. Clin Chim Acta 1976, 73(3):445–451. Kovar FM, Aldrian S, Endler G, Vécsei V, Hajdu S, Heinz T, Wagner OF: CK/CK-MB ratio as an indirect predictor for survival in polytraumatized patients. Wien Klin Wochenschr 2012, 124(7–8):245–250. Ota T, Hasegawa Y, Murata E, Tanaka N, Fukuoka M: False-Positive Elevation of CK-MB Levels with Chest Pain in Lung Adenocarcinoma. Case Rep Oncol 2020, 13(1):100–104. Eidizadeh A, von Ahsen N, Friedewald S, Binder L: Macro-CK type 2 in metastatic prostate cancer. Diagnosis (Berl) 2019, 6(3):307–309. Annesley TM, McKenna BJ: Ectopic creatine kinase MB production in metastatic cancer. Am J Clin Pathol 1983, 79(2):255–259. Loo JM, Scherl A, Nguyen A, Man FY, Weinberg E, Zeng Z, Saltz L, Paty PB, Tavazoie SF: Extracellular metabolic energetics can promote cancer progression. Cell 2015, 160(3):393–406. Demir M, Koepping L, Li Y, Fujimoto L, Bobkov A, Zhao J, Hitosugi T, Sergienko E: Structural basis for substrate binding, catalysis, and inhibition of cancer target mitochondrial creatine kinase by a covalent inhibitor. Structure 2025, 33(4):786–797.e783. Chang CC, Liou CB, Su MJ, Lee YC, Liang CT, Ho JL, Tsai HW, Yen TH, Chu FY: Creatine Kinase (CK)-MB-to-Total-CK Ratio: a Laboratory Indicator for Primary Cancer Screening. Asian Pac J Cancer Prev 2015, 16(15):6599–6603. Uranbileg B, Enooku K, Soroida Y, Ohkawa R, Kudo Y, Nakagawa H, Tateishi R, Yoshida H, Shinzawa S, Moriya K et al: High ubiquitous mitochondrial creatine kinase expression in hepatocellular carcinoma denotes a poor prognosis with highly malignant potential. Int J Cancer 2014, 134(9):2189–2198. Qian XL, Li YQ, Gu F, Liu FF, Li WD, Zhang XM, Fu L: Overexpression of ubiquitous mitochondrial creatine kinase (uMtCK) accelerates tumor growth by inhibiting apoptosis of breast cancer cells and is associated with a poor prognosis in breast cancer patients. Biochem Biophys Res Commun 2012, 427(1):60–66. Lin YC, Chen SC, Huang CM, Hu YF, Chen YY, Chang SL, Lo LW, Lin YJ, Chen SA: Clinical features and diagnosis of new malignancy in patients with acute pulmonary embolism and without a history of cancer. J Chin Med Assoc 2020, 83(3):245–250. Stein W, Bohner J: Influence of autoantibodies to creatine kinase-BB on assays for MB isoenzyme. Clin Chem 1985, 31(7):1189–1192. Wong SS, Wu AH, Fritsche HA: Reassessment of creatine kinase BB as a marker for cancer of the prostate, breast, and lung. Clin Chem 1987, 33(6):809–811. Huddleston HG, Wong KK, Welch WR, Berkowitz RS, Mok SC: Clinical applications of microarray technology: creatine kinase B is an up-regulated gene in epithelial ovarian cancer and shows promise as a serum marker. Gynecol Oncol 2005, 96(1):77–83. Wang HC, Lu JY, Ting YM: Elevated serum CK-MB and CK-BB isoenzymes in a patient with small cell lung cancer: a case report. Zhonghua Yi Xue Za Zhi (Taipei) 1995, 55(3):270–273. Li Y, Chen Y, Shao B, Liu J, Hu R, Zhao F, Cui X, Zhao X, Wang Y: Evaluation of creatine kinase (CK)-MB to total CK ratio as a diagnostic biomarker for primary tumors and metastasis screening. Pract Lab Med 2023, 37:e00336. Wada Y, Tanigawa J, Ishizaka N: Macro-CK and CK-BB Contributing to Sham CK-MB Elevation. Intern Med 2017, 56(11):1449–1450. Lee KN, Csako G, Bernhardt P, Elin RJ: Relevance of macro creatine kinase type 1 and type 2 isoenzymes to laboratory and clinical data. Clin Chem 1994, 40(7 Pt 1):1278–1283. Labelle M, Hynes RO: The initial hours of metastasis: the importance of cooperative host-tumor cell interactions during hematogenous dissemination. Cancer Discov 2012, 2(12):1091–1099. Gil-Bernabé AM, Lucotti S, Muschel RJ: Coagulation and metastasis: what does the experimental literature tell us? Br J Haematol 2013, 162(4):433–441. Coupland LA, Chong BH, Parish CR: Platelets and P-selectin control tumor cell metastasis in an organ-specific manner and independently of NK cells. Cancer Res 2012, 72(18):4662–4671. Schlesinger M: Role of platelets and platelet receptors in cancer metastasis. J Hematol Oncol 2018, 11(1):125. Erpenbeck L, Schön MP: Deadly allies: the fatal interplay between platelets and metastasizing cancer cells. Blood 2010, 115(17):3427–3436. Martins Castanheira N, Spanhofer AK, Wiener S, Bobe S, Schillers H: Uptake of platelets by cancer cells and recycling of the platelet protein CD42a. J Thromb Haemost 2022, 20(1):170–181. Placke T, Örgel M, Schaller M, Jung G, Rammensee HG, Kopp HG, Salih HR: Platelet-derived MHC class I confers a pseudonormal phenotype to cancer cells that subverts the antitumor reactivity of natural killer immune cells. Cancer Res 2012, 72(2):440–448. Placke T, Salih HR, Kopp HG: GITR ligand provided by thrombopoietic cells inhibits NK cell antitumor activity. J Immunol 2012, 189(1):154–160. Clar KL, Hinterleitner C, Schneider P, Salih HR, Maurer S: Inhibition of NK Reactivity Against Solid Tumors by Platelet-Derived RANKL. Cancers (Basel) 2019, 11(3). Stoiber D, Assinger A: Platelet-Leukocyte Interplay in Cancer Development and Progression. Cells 2020, 9(4). Rao L, Xu P, Zhang G, Zu R, Luo Y, Zhang K, Yang Y, Wang D, He S, Luo H et al: Prognostic value of creatine kinase (CK)-MB to total-CK ratio in colorectal cancer patients after curative resection. BMC Cancer 2024, 24(1):543. Usui A, Fujita K, Imaizumi M, Abe T, Inoue K, Matumoto S, Kato K: Determination of creatine kinase isozymes in sera and tissues of patients with various lung carcinomas. Clin Chim Acta 1987, 164(1):47–53. Ben-Sahra I, Puissant A: HER2 Signaling Hijacks the Creatine Shuttle to Fuel Breast Cancer Cell Growth. Cell Metab 2018, 28(6):805–807. Krutilina RI, Playa H, Brooks DL, Schwab LP, Parke DN, Oluwalana D, Layman DR, Fan M, Johnson DL, Yue J et al: HIF-Dependent CKB Expression Promotes Breast Cancer Metastasis, Whereas Cyclocreatine Therapy Impairs Cellular Invasion and Improves Chemotherapy Efficacy. Cancers (Basel) 2021, 14(1). Zarghami N, Giai M, Yu H, Roagna R, Ponzone R, Katsaros D, Sismondi P, Diamandis EP: Creatine kinase BB isoenzyme levels in tumour cytosols and survival of breast cancer patients. Br J Cancer 1996, 73(3):386–390. Lee K, Csako G, Bernhardt P, Elin RJCc: Relevance of macro creatine kinase type 1 and type 2 isoenzymes to laboratory and clinical data. 1994, 40:1278–1283. Bera S, Ray M: The transcriptional cascade associated with creatine kinase down-regulation and mitochondrial biogenesis in mice sarcoma. Cell Mol Biol Lett 2009, 14(3):481–496. Zhang Y, Sun M, Chen Y, Li B: MiR-519b-3p Inhibits the Proliferation and Invasion in Colorectal Cancer via Modulating the uMtCK/Wnt Signaling Pathway. Frontiers in pharmacology 2019, 10:741. Heinz JW, O'Donnell NJ, Lott JA: Apparent mitochondrial creatine kinase in the serum of a patient with metastatic cancer to the liver. Clin Chem 1980, 26(13):1908–1911. Wang Z, Wu H, Chang X, Song Y, Chen Y, Yan Z, Gu L, Pang R, Xia T, He Z et al: CKMT1 deficiency contributes to mitochondrial dysfunction and promotes intestinal epithelial cell apoptosis via reverse electron transfer-derived ROS in colitis. Cell Death Dis 2025, 16(1):177. Kita M, Fujiwara-Tani R, Kishi S, Mori S, Ohmori H, Nakashima C, Goto K, Sasaki T, Fujii K, Kawahara I et al: Role of creatine shuttle in colorectal cancer cells. Oncotarget 2023, 14:485–501. Zhang H, To KKW: Serum creatine kinase elevation following tyrosine kinase inhibitor treatment in cancer patients: Symptoms, mechanism, and clinical management. Clin Transl Sci 2024, 17(11):e70053. Joseph J, Cardesa A, Carreras J: Creatine kinase activity and isoenzymes in lung, colon and liver carcinomas. Br J Cancer 1997, 76(5):600–605. Li M, Liu H, Li J, Guo S, Lv YJRr: Mitochondrial creatine kinase 1 in non-small cell lung cancer progression and hypoxia adaptation. 2021, 22(1):190. Soroida Y, Ohkawa R, Nakagawa H, Satoh Y, Yoshida H, Kinoshita H, Tateishi R, Masuzaki R, Enooku K, Shiina S et al: Increased activity of serum mitochondrial isoenzyme of creatine kinase in hepatocellular carcinoma patients predominantly with recurrence. 2012, 57(2):330–336. Cai S, Xia Q, Duan D, Fu J, Wu Z, Yang Z, Yu C: Creatine kinase mitochondrial 2 promotes the growth and progression of colorectal cancer via enhancing Warburg effect through lactate dehydrogenase B. PeerJ 2024, 12:e17672. Amamoto R, Uchiumi T, Yagi M, Monji K, Song Y, Oda Y, Shiota M, Yokomizo A, Naito S, Kang DJJoC: The Expression of Ubiquitous Mitochondrial Creatine Kinase Is Downregulated as Prostate Cancer Progression. 2016, 7(1):50–59. Additional Declarations No competing interests reported. Supplementary Files Supportinginformation.docx Cite Share Download PDF Status: Published Journal Publication published 11 Nov, 2025 Read the published version in Clinical and Experimental Medicine → Version 1 posted Editorial decision: Revision requested 02 Sep, 2025 Reviews received at journal 01 Sep, 2025 Reviewers agreed at journal 16 Aug, 2025 Reviewers invited by journal 16 Jul, 2025 Editor assigned by journal 15 Jul, 2025 Submission checks completed at journal 15 Jul, 2025 First submitted to journal 13 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7113855\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":486532226,\"identity\":\"a9de6eb4-8065-49ed-bbd4-4dea38f882f6\",\"order_by\":0,\"name\":\"Lubei Rao\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYHACxgOMDQw8/MzMBx8QrQesRbKdLdmAJC0MBud5zASIUm7efvjAYd4dNjLGhxnMGBhqbKIJapE5k5ZwmPdMGo/ZYYa0BwzH0nIbCGmRYMgxOMzbdhik5bgBY8NhIrTwvwFp+c9j3MzYJkGcFgmwLQd4DJiZ2YjV8izh4NwzyTwSh9mYDRKI8gt/8sEHb3fY2fP3n//44EONDWEtqCCBNOWjYBSMglEwCnABAM4dPEQk9aJSAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Sichuan Cancer Hospital \\u0026 Institute, University of Electronic Science and Technology of China\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Lubei\",\"middleName\":\"\",\"lastName\":\"Rao\",\"suffix\":\"\"},{\"id\":486532227,\"identity\":\"e9f5fe0e-1328-4f20-9bd3-e3bf2bbb0f43\",\"order_by\":1,\"name\":\"Chao Hu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chengdu University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chao\",\"middleName\":\"\",\"lastName\":\"Hu\",\"suffix\":\"\"},{\"id\":486532228,\"identity\":\"c7eb3b1c-0912-4390-9c2b-2ab41dc5171b\",\"order_by\":2,\"name\":\"Yan Yue\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sichuan Cancer Hospital \\u0026 Institute, University of Electronic Science and Technology of China\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Yue\",\"suffix\":\"\"},{\"id\":486532229,\"identity\":\"4884d1bd-8e46-4253-8772-a37d2ecfa7e8\",\"order_by\":3,\"name\":\"Yajun Luo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sichuan Cancer Hospital \\u0026 Institute, University of Electronic Science and Technology of China\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yajun\",\"middleName\":\"\",\"lastName\":\"Luo\",\"suffix\":\"\"},{\"id\":486532230,\"identity\":\"3b985b39-b109-4ff8-9cba-6c6a94466778\",\"order_by\":4,\"name\":\"Bo Ye\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sichuan Cancer Hospital \\u0026 Institute, University of Electronic Science and Technology of China\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bo\",\"middleName\":\"\",\"lastName\":\"Ye\",\"suffix\":\"\"},{\"id\":486532231,\"identity\":\"379c9daf-a6d8-428b-8f40-d5d8561d1376\",\"order_by\":5,\"name\":\"Yue Liang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sichuan Cancer Hospital \\u0026 Instituter, University of Electronic Science and Technology of China\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yue\",\"middleName\":\"\",\"lastName\":\"Liang\",\"suffix\":\"\"},{\"id\":486532232,\"identity\":\"4e6bd282-2b1a-42da-9287-5f1a4579d322\",\"order_by\":6,\"name\":\"Guanbin Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chengdu University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guanbin\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":486532233,\"identity\":\"774e9397-aa0a-4804-b94c-65ee8febaf07\",\"order_by\":7,\"name\":\"Dongsheng Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sichuan Cancer Hospital \\u0026 Institute, University of Electronic Science and Technology of China\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dongsheng\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-13 14:23:18\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7113855/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7113855/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s10238-025-01912-8\",\"type\":\"published\",\"date\":\"2025-11-11T15:58:44+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":87362189,\"identity\":\"f1f6c579-1ac7-409a-a8fb-879087280cf2\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 05:55:06\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":240293,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eStudy workflow and key findings.\\u003c/strong\\u003e Background: In cancer patients, the clinical association between serum CK-MB \\u0026gt; CK abnormality and tumors is unclear. Methods: First, a large cancer cohort was screened to characterize the epidemiological distribution of CK-MB \\u0026gt; CK abnormality. Then, isozyme analysis and qRT-PCR were used to identify cancer type-specific expression of CK isozymes in serum and platelets. Further, the expression of platelet CK was validated using a public TEP dataset (GSE89843), and single-cell RNA sequencing data (GSE123902) were analyzed to explore the role of CKB in lung cancer metastasis. Results: CKB was identified as a platelet-derived transcript enriched in lung cancer patients with elevated serum CK-BB levels. Platelet CKB expression was associated with distant metastasis and poor prognosis, suggesting its potential functional role in shaping the metastatic tumor microenvironment. Abbreviations: CK-MB, creatine kinase-MB isoenzyme; CK, creatine kinase; CRC, colorectal cancer; CK-BB, creatine kinase brain-type isoenzyme; CKII, mitochondrial creatine kinase isoenzyme II; PLT, platelet count; TEPs, tumor-enhanced platelets.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/28a6b86aff354cb378b04e50.png\"},{\"id\":87362190,\"identity\":\"cf6ad5dd-ee0e-41bf-b910-96ff6dd3f42c\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 05:55:06\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":204868,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePatient characteristics and clinical correlates of CK-MB \\u0026gt; CK abnormalities.\\u003c/strong\\u003e (\\u003cstrong\\u003eA\\u003c/strong\\u003e) Age and sex distribution of patients with CK-MB \\u0026gt; CK abnormality from 2019 to 2022. (\\u003cstrong\\u003eB\\u003c/strong\\u003e) Top 10 malignant tumor types among patients with CK-MB \\u0026gt; CK abnormality, based on patient counts. (\\u003cstrong\\u003eC\\u003c/strong\\u003e) Adjusted distribution of tumor types after normalizing by total visits during the same period. Statistical methods: (\\u003cstrong\\u003eD\\u003c/strong\\u003e) Age and sex distribution of colorectal and lung cancer patients with CK-MB \\u0026gt; CK abnormality. (\\u003cstrong\\u003eE\\u003c/strong\\u003e) Clinical characteristics (age group, sex, and tumor stage) of colorectal cancer patients. (\\u003cstrong\\u003eF\\u003c/strong\\u003e) Clinical characteristics (age group, sex, and tumor stage) of lung cancer patients. (\\u003cstrong\\u003eG–I\\u003c/strong\\u003e) CK-MB/CK ratio comparisons across tumor stages, adjuvant therapy status, and different treatment types in colorectal cancer patients. (\\u003cstrong\\u003eJ–L\\u003c/strong\\u003e) CK-MB/CK ratio comparisons across tumor stages, adjuvant therapy status, and different treatment types in lung cancer patients. Enrichment ratio was calculated as the proportion of each cancer type among CK-MB \\u0026gt; CK abnormal cases divided by the proportion of that cancer type in the overall cancer patient cohort. Abnormality rate was calculated as the proportion of CK-MB \\u0026gt; CK abnormal cases within each cancer type divided by the total number of patients diagnosed with that cancer type. Statistical methods: Pairwise comparisons of CK-MB/CK ratio between groups were conducted using the Wilcoxon rank-sum test. Abbreviations: CK-MB, creatine kinase-MB isoenzyme; CK, creatine kinase; chemo, chemotherapy; radio, radiotherapy; targeted, targeted therapy; immuno, immunotherapy.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/125b8447ecff77616d28cc4a.png\"},{\"id\":87363215,\"identity\":\"cd860bfd-77b3-45d1-997e-ecfbe22e4256\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 06:03:08\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1809657,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eIsoenzyme profile analysis in colorectal and lung cancer patients with CK-MB \\u0026gt; CK abnormality.\\u003c/strong\\u003e (\\u003cstrong\\u003eA\\u003c/strong\\u003e) Age and sex distribution of colorectal and lung cancer patients included in the isoenzyme electrophoresis analysis. (\\u003cstrong\\u003eB\\u003c/strong\\u003e) Clinical characteristics of colorectal and lung cancer patients. (\\u003cstrong\\u003eC\\u003c/strong\\u003e) Stacked bar plot of CK isozyme composition for each patient. (\\u003cstrong\\u003eD\\u003c/strong\\u003e) Overall isoenzyme composition by cancer type. (\\u003cstrong\\u003eE\\u003c/strong\\u003e) Principal component analysis (PCA) showing separation of colorectal and lung cancer patients based on isoenzyme expression profiles. (\\u003cstrong\\u003eF\\u003c/strong\\u003e) PCA loading plot indicating the contribution of different CK isoenzymes (CK-BB, CKII, CK-MB, CK-MM, CKI) to the variance. (\\u003cstrong\\u003eG-H\\u003c/strong\\u003e) Comparison of CK-BB and CKII expression between lung cancer and colorectal cancer patients. Statistical methods: Pairwise comparisons were conducted using the Wilcoxon rank-sum test. Abbreviations: CK, creatine kinase; CK-MB, creatine kinase-MB isoenzyme; CK-BB, creatine kinase brain-type isoenzyme; CK-MM, creatine kinase muscle-type isoenzyme; CKII, mitochondrial creatine kinase isoenzyme II; CKI, mitochondrial creatine kinase isoenzyme I; PCA, principal component analysis.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/7aaafe73540b32f699bbca0a.jpeg\"},{\"id\":87363207,\"identity\":\"e037b06d-44a3-4bf2-901e-24285d2c8c6e\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 06:03:06\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1923996,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSerum CK isoenzyme alterations and clinical relevance in colorectal and lung cancer patients with CK-MB \\u0026gt; CK abnormality. \\u003c/strong\\u003e(\\u003cstrong\\u003eA\\u003c/strong\\u003e) Linear regression analysis between CK-Sub levels and CK-MB/CK ratio in colorectal cancer patients. (\\u003cstrong\\u003eB\\u003c/strong\\u003e) Linear regression analysis between CK-Sub levels and CK-MB/CK ratio in lung cancer patients. (\\u003cstrong\\u003eC-D\\u003c/strong\\u003e) Comparison of CKII, and CK-Sub between stage III and stage IV colorectal cancer patients. (\\u003cstrong\\u003eE\\u003c/strong\\u003e) Comparison of CK-BB expression between stage III and stage IV lung cancer patients. (\\u003cstrong\\u003eF–G\\u003c/strong\\u003e) Kaplan-Meier survival analyses of overall survival according to CKII and CK-Sub levels in colorectal cancer patients. (\\u003cstrong\\u003eH–I\\u003c/strong\\u003e) Kaplan-Meier survival analyses of overall survival according to CK-BB and CK-Sub expression levels in lung cancer patients. Statistical methods: Linear regression analysis was used to assess the association between CK-MB/CK ratio and CK-Sub levels. R² value represents the proportion of variance in CK-Sub explained by CK-MB/CK ratio. Group comparisons were performed using the Wilcoxon rank-sum test. Overall survival was analyzed by Kaplan-Meier curves, and differences between groups were assessed with the log-rank test. Abbreviations: CK-MB, creatine kinase-MB isoenzyme; CK, creatine kinase; CKII, mitochondrial creatine kinase isoenzyme II; CK-BB, creatine kinase brain-type isoenzyme; CK-Sub, total CK isoenzyme activity (CK-BB + CKII + CKI); CRC, colorectal.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/97c2f6d8d874bb43abf239d4.jpeg\"},{\"id\":87364581,\"identity\":\"5e9d324f-aaa0-4c25-b795-6dd1b4a12587\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 06:19:06\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":159358,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDifferential expression and correlation of CK genes in serum and platelets.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e Expression of CKB, CKMT1, and CKMT2 mRNA in serum samples from lung and colorectal cancer patients. \\u003cstrong\\u003e(B)\\u003c/strong\\u003eZ-score heatmap displaying CK genes expression patterns in serum stratified by cancer type. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e Comparison of platelet CK genes expression between colorectal and lung cancer patients.\\u003cstrong\\u003e (D)\\u003c/strong\\u003e Paired expression analysis of CK genes in platelet versus serum from the same patients. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e Correlation analysis between serum and platelet CK genes expression. Statistical methods: Wilcoxon rank-sum test was used for comparisons between colorectal and lung cancer groups in panels. Paired Wilcoxon signed-rank test was used for within-patient comparisons between serum and platelet expression. Pearson correlation analysis was used to evaluate association between serum and platelet mRNA expression levels. Expression values were log₂-transformed prior to analysis. Abbreviations: CK, creatine kinase.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/7743936c96e36bf2ac3300b4.png\"},{\"id\":87362195,\"identity\":\"9deb1147-141b-46b8-9c1a-f46d149e0701\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 05:55:06\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":312738,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePlatelet CKB expression and its potential association with lung cancer metastasis. \\u003c/strong\\u003e(\\u003cstrong\\u003eA\\u003c/strong\\u003e) CKB mRNA is significantly upregulated in platelets from lung cancer patients (GSE89843); (\\u003cstrong\\u003eB\\u003c/strong\\u003e) CKB mRNA expression is lower in circulating tumor cells (CTCs) and peripheral blood leukocytes (WBCs) compared to primary tumor cells (GSE74639); (\\u003cstrong\\u003eC\\u003c/strong\\u003e) CKB mRNA is expressed at low levels in primary lung tumor tissues (TCGA dataset); (\\u003cstrong\\u003eD, F\\u003c/strong\\u003e) Tumor cells from distant metastatic lesions in stage IV lung cancer patients exhibit high CKB mRNA expression (GSE123902); (\\u003cstrong\\u003eE, G\\u003c/strong\\u003e) Tumor cells from primary lesions in stage IV lung cancer exhibit low CKB mRNA expression (GSE123904); (\\u003cstrong\\u003eH\\u003c/strong\\u003e) Lung cancer patients with high tumor CKB expression show poorer overall survival (TCGA data); (\\u003cstrong\\u003eI\\u003c/strong\\u003e) Functional enrichment and interaction analysis of CKB-associated genes in platelets. Statistical methods: Expression comparisons were performed using Wilcoxon rank-sum tests; Survival analysis was conducted using Kaplan–Meier curves and log-rank tests; Differentially expressed genes were identified using |log₂FC| \\u0026gt; 1 and FDR \\u0026lt; 0.05 as thresholds; Functional enrichment was assessed using clusterProfiler with GO Biological Process and KEGG pathway databases. Abbreviations: CKB, brain-type creatine kinase; NSCLC, non-small cell lung cancer; LUSC, Lung Squamous Cell Carcinoma; LUAD, Lung Adenocarcinoma; TEP, tumor-educated platelet; CTC, circulating tumor cell; WBC, White Blood Cell; GO, Gene Ontology; TCGA, The Cancer Genome Atlas.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Onlinefloatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/ba95c96143f8642b11f99f52.png\"},{\"id\":87364094,\"identity\":\"b1969dad-5b41-48d8-add4-421af438858a\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 06:11:06\",\"extension\":\"jpeg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2025564,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eProposed mechanism of platelet CKB in promoting hematogenous metastasis of lung cancer. \\u003c/strong\\u003eUpon vascular invasion, circulating tumor cells (CTCs) rapidly interact with platelets. In response to tumor-derived signals, platelets become tumor-educated platelets (TEPs), characterized by increased CKB mRNA expression. Through intercellular exchange, tumor cells may acquire of exogenous CKB, which facilitates the generation of phosphocreatine (PCr) from creatine (Cr), maintaining ATP supply under hypoxic or shear stress conditions. This metabolic support may enhance CTC survival in circulation and promote distant organ colonization. CKB expression is elevated in metastatic tumor lesions but not in primary tumors, suggesting a potential role in metastasis initiation. PETs: platelet-educated tumor cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/c90ee18a718d1177d276a5b9.jpeg\"},{\"id\":96105288,\"identity\":\"481c8e18-af3a-4713-bdfc-bd6bb4d931e7\",\"added_by\":\"auto\",\"created_at\":\"2025-11-17 16:10:55\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5362076,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/fff2f678-1269-4200-8173-873361101505.pdf\"},{\"id\":87362188,\"identity\":\"52fb4d2d-5477-45a8-a26f-a9866a63d285\",\"added_by\":\"auto\",\"created_at\":\"2025-07-23 05:55:06\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":993516,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supportinginformation.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7113855/v1/54c0d7c93c120acf3963cc79.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Platelet CKB as a potential contributor to serum creatine kinase abnormalities and metastasis in cancer patients\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eCreatine kinase (CK) is a central regulator of cellular energy homeostasis[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. It catalyzes the reversible transfer of a phosphate group from adenosine triphosphate (ATP) to creatine, forming phosphocreatine and adenosine di-phosphate (ADP) [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Through this reaction, CK plays a vital role in tissues with high energy demands, such as skeletal muscle, heart, and brain. CK is encoded by multiple genes, forming tissue-specific isoenzyme subtypes. Among them, CKB encodes the creatine kinase brain-type isoenzyme (CK-BB); CKM encodes the creatine kinase muscle-type isoenzyme (CK-MM); and the hybrid creatine kinase-MB isoenzyme (CK-MB) is a heterodimer composed of CKB and CKM gene products. These isoforms are predominantly cytoplasmic[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. In addition, mitochondrial creatine kinase (MtCK), encoded by the CKMT1 and CKMT2 genes, is predominantly located within mitochondria, and exists in the form of mito-chondrial creatine kinase isoenzyme II (CKII, dimeric form) and mitochondrial creatine kinase isoenzyme I (CKI, monomeric form) [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e], playing a key role in ATP buffering in oxidative tissues.\\u003c/p\\u003e\\u003cp\\u003eIn healthy individuals, the serum CK pool is predominantly composed of CK-MM, with negligible amounts of other isoenzymes. During myocardial injury, CK-MB is released into the circulation, and serum CK-MB activity measurement is widely used for the diagnosis of myocardial infarction[\\u003cspan additionalcitationids=\\\"CR8 CR9 CR10\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. However, serum CK-MB activity de-tected by the immunoinhibition assay[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e] may be influenced by the presence of non-CK-MB isoenzymes[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. In particular, elevated levels of CK-BB[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e] and mitochondrial CK isoenzymes (CKII)[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]in the serum may cause a falsely elevated CK-MB activity even in the absence of myocardial injury[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eStudies have shown that when tumor cells enter the blood circulation and face hypoxia, CKB can be released from the cell into the extracellular space and catalyze the production of extracellular creatine phosphate, increase ATP content, maintain the energy required for tumor cell survival, and thus promote metastasis[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR18 CR19 CR20 CR21\\\" citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Ele-vated circulating CKB can also interfere with CK-MB and CK activity assays, potentially explaining paradoxical CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK patterns observed in cancer patients[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. While sporadic case reports have documented such anomalies, the biological origin and clinical relevance remain poorly characterized[\\u003cspan additionalcitationids=\\\"CR25 CR26\\\" citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Our institution, the largest can-cer-specialized hospital in Southwest China, frequently observes this abnormal pattern in cancer patients. However, it remains unclear whether this is primarily driven by elevated CKB or other isoforms[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eCurrently, the regulatory mechanisms underlying hematogenous metastasis of tumor cells remain poorly un-derstood. This process is highly inefficient\\u0026mdash;fewer than 0.1% of tumor cells that enter the bloodstream ultimately succeed in forming metastatic colonies, largely due to environmental shifts and stressors such as hypoxia[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. As the bloodstream serves as the primary route for cancer cells to disseminate from the primary site to distant organs, understanding how tumor cells interact with cellular and acellular components in the circulation may offer novel strategies for identifying or intercepting metastasis[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Recent studies underscore the importance of platelet\\u0026ndash;tumor cell interactions in this process[\\u003cspan additionalcitationids=\\\"CR32 CR33\\\" citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Circulating tumor cells (CTCs) can bind to and internalize platelet compo-nents, co-opting the platelet transcriptome and proteome to gain metastatic advantage [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Tumor-educated platelets (TEPs)\\u0026mdash;platelets reprogrammed by the tumor microenvironment\\u0026mdash;may facilitate tumor metastasis by secreting or transferring bioactive molecules[\\u003cspan additionalcitationids=\\\"CR37 CR38\\\" citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. As the second most abundant cell population in the blood-stream, it remains unclear whether platelets can promote tumor hematogenous metastasis through factors such as CKB.\\u003c/p\\u003e\\u003cp\\u003eOur previous preliminary research indicated that colorectal cancer patients who developed CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK ab-normalities after curative resection exhibited significantly poorer prognoses compared to contemporaneous patients without such anomalies, characterized by shorter overall survival and a higher risk of recurrence and metastasis[\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. A deeper investigation into the factors contributing to the CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormality, and the role played by tu-mor-educated platelets in this process, may offer new insights into the mechanisms of hematogenous tumor me-tastasis.\\u003c/p\\u003e\\u003cp\\u003eIn this study, we conducted a comprehensive investigation integrating retrospective cohort analysis, serum CK isoenzyme electrophoresis, and transcriptomic profiling of paired serum and platelet samples. In addition, we lev-eraged public RNA sequencing datasets to validate the involvement of platelet-associated CKB in lung cancer and to explore its potential role in metastatic dissemination. Our goal was to elucidate the cellular source and clinical im-plications of CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities, with a particular focus on the interplay between CK isoenzyme dysregu-lation, platelet biology, and the metastatic phenotype in cancer.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.1. Patient enrollment and data collection\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eThis study combined retrospective data analysis with prospective sample collection, both of which were approved by the Institutional Ethics Committee of Sichuan Cancer Hospital and exempted from informed consent (IRB No. SCCHEC-02-2022-017).\\u003c/p\\u003e\\u003cp\\u003eFor the retrospective component, patients diagnosed with malignant tumors and hospitalized at our institution between January 1, 2019, and December 31, 2022, were reviewed. For the prospective component, fresh serum and platelet samples were collected from a subset of colorectal and lung cancer patients admitted between April 1, 2022, and May 31, 2023. Inclusion criteria required that patients had undergone serum CK-MB and total CK activity testing and exhibited CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities. The following exclusion criteria were applied: (1) presence of severe skeletal muscle injury or major cardiovascular diseases (e.g., acute myocardial infarction, myocarditis); (2) serum samples showing hemolysis or severe lipemia; (3) age younger than 18 or older than 100 years; (4) incomplete clinical data. Clinical information including sex, age, diagnosis, TNM stage, laboratory indices (CK-MB and total CK activity, platelet-related test results), treatment modalities (chemotherapy, radiotherapy, immunotherapy, targeted therapy), metastasis status, and survival outcomes was extracted from the electronic medical record system. Overall survival (OS) was defined as the time from the date of diagnosis to the date of death or the last follow-up. All data were anonymized prior to analysis, and no personally identifiable information was accessible to the researchers.\\u003c/p\\u003e\\u003cp\\u003e This study was conducted in accordance with the Declaration of Helsinki and complied with institutional and international ethical guidelines for human research. All data were independently reviewed and verified by two researchers.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.2. Serum sample collection and laboratory testing\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003ePeripheral venous blood samples were collected using BD Vacutainer tubes with clot activator and gel separator (BD, USA). Samples were centrifuged at 4,000 rpm for 8 minutes, and the supernatant serum was carefully transferred into RNase-free Eppendorf tubes and immediately stored at -80\\u0026deg;C. Hemolytic, icteric, or lipemic samples were excluded from the analysis.\\u003c/p\\u003e\\u003cp\\u003eSerum total CK and CK-MB activities were measured using the phosphocreatine substrate method and immunoinhibition assay, respectively, on a Mindray BS-2000M automated biochemical analyzer (Mindray, China). The reference range for CK-MB was \\u0026le;\\u0026thinsp;25 U/L. The reference range for total CK was 24\\u0026ndash;194 U/L in males and 24\\u0026ndash;170 U/L in females. An abnormal result was defined as a CK-MB/CK ratio greater than 1.\\u003c/p\\u003e\\u003cp\\u003eQuantitative analysis of CK isoenzyme subtypes in serum samples was performed using the semi-automated HYDRASYS electrophoresis system and the HYDRAGEL ISO-CK kit (Sebia, France). Electrophoresis was conducted on an agarose gel in an alkaline buffer (pH 8.4). Densitometric analysis was performed after electrophoresis to obtain the relative quantification of each CK isoenzyme fraction.\\u003c/p\\u003e\\u003cp\\u003eIn this study, we defined a novel composite index termed CK-Sub, representing the sum of non-CK-MM and non-CK-MB isoenzymes detected by serum isoenzyme electrophoresis. Specifically, CK-Sub was calculated as the combined relative abundance of CK-BB, CKII, and CKI.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eCK-Sub\\u0026thinsp;=\\u0026thinsp;CK-BB\\u0026thinsp;+\\u0026thinsp;CKII\\u0026thinsp;+\\u0026thinsp;CKI\\u003c/em\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eThis composite measure was designed to reflect the overall contribution of non-cardiac, non-skeletal muscle CK isoenzymes, and to better capture the atypical CK isoenzyme activation patterns observed in cancer patients with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities (defined as CK-MB/CK ratio abnormalities).\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.3. Platelet testing, separation and purity verification\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eFirst, venous blood was collected using EDTA anticoagulation tubes (BD, USA), and platelet-related parameters, including platelet count (PLT), mean platelet volume (MPV), and platelet distribution width (PDW), were measured using BC-5390 and BC-6800 fully automatic hematology analyzers (Mindray, Shenzhen). The instrument was internally quality controlled daily and calibrated weekly, and all results met the acceptable standards.\\u003c/p\\u003e\\u003cp\\u003eThen, whole blood samples (1.5 mL), anticoagulated with EDTA, were transferred into 2 mL microcentrifuge tubes. To obtain platelet-rich plasma (PRP), samples were centrifuged at 120 \\u0026times; g for 20 minutes (Shuke Instruments, Sichuan, China), effectively separating platelets from nucleated cells. To reduce contamination from leukocytes and erythrocytes, only the upper 80% of the PRP layer was carefully aspirated for subsequent procedures. Platelets were then pelleted by a second centrifugation step at 360 \\u0026times; g for 20 minutes. All isolation steps were completed within 2 hours of venipuncture to prevent RNA degradation. Platelet purity was assessed using morphological examination and automated platelet counts, and samples were considered acceptable if leukocyte contamination was below 5 white blood cells per 1\\u0026nbsp;million platelets.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.4. Quantitative reverse transcription PCR\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003ePrimer sequences were designed and synthesized by Tsingke Biological Technology Co., Ltd. (Beijing, China). The relative gene expression was quantified using the ΔCT method, with GAPDH serving as the internal control. The primer sequences used in this study were as follows: GAPDH (forward: GGAGCGAGATCCCTCCAAAAT; reverse: GGCTGTTGTCATACTTCTCATGG), CKB (forward: GCTGCGACTTCAGAAGCGA; reverse: GGCATGAGGTCGTCGATGG), CKMT1 (forward: TTGATTGTGAACGGCGTCTG; reverse: ATGCTTGGTGTGGATGACAG), and CKMT2 (forward: AGGTGACACCCAACGGCTA; reverse: TGACGGGGTCAAAAAGGTCAG).\\u003c/p\\u003e\\u003cp\\u003eAll RT-qPCR amplification experiments were performed on a LightCycler 480 system (Roche Diagnostics). The reactions utilized the TB Green Premix Ex Taq II kit (TaKaRa, Dalian, China) according to the manufacturer\\u0026rsquo;s instructions. Each assay was carried out in triplicate for biological validation. Reactions were set up in a total volume of 20 \\u0026micro;L, consisting of 10 \\u0026micro;L of SYBR Green Master Mix, 0.8 \\u0026micro;L of each forward and reverse primer, 2 \\u0026micro;L of cDNA template, and 6.4 \\u0026micro;L of RNase-/DNase-free water. The thermal cycling conditions were: initial denaturation at 95\\u0026deg;C for 2 minutes and 30 seconds, followed by 40 cycles of denaturation at 95\\u0026deg;C for 5 seconds and annealing/extension at 60\\u0026deg;C for 30 seconds. Primer specificity was confirmed by observing a single peak in the melting curve analysis.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.5. Data acquisition from public repositories\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eTranscriptomic datasets were obtained from the Gene Expression Omnibus (GEO) database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ncbi.nlm.nih.gov/geo/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.ncbi.nlm.nih.gov/geo/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The dataset GSE89843 contains RNA-sequencing profiles of tumor-educated platelets (TEPs) from 402 non-small cell lung cancer (NSCLC) patients and 377 control individuals. The dataset GSE123902 includes single-cell RNA-seq data from clinical specimens across different disease stages: non-tumor-involved lung tissue (n\\u0026thinsp;=\\u0026thinsp;4), primary lung adenocarcinomas (n\\u0026thinsp;=\\u0026thinsp;8), and distant metastatic lesions located in the brain (n\\u0026thinsp;=\\u0026thinsp;3), bone (n\\u0026thinsp;=\\u0026thinsp;1), and adrenal gland (n\\u0026thinsp;=\\u0026thinsp;1). The GSE74639 dataset includes RNA-Seq data of primary lung tumor cells, circulating lung tumor cells, and peripheral blood leukocytes. Additionally, bulk RNA-seq data of primary lung tumors and corresponding clinical information were retrieved from The Cancer Genome Atlas (TCGA) via the Genomic Data Commons (GDC) portal (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://portal.gdc.cancer.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://portal.gdc.cancer.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to assess the clinical and prognostic relevance of CKB expression in tumor tissue.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.6. Statistical analysis\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eAll statistical analyses were performed using R software (version 4.3.1; R Foundation for Statistical Computing, Vienna, Austria. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.r-project.org\\u003c/span\\u003e\\u003cspan address=\\\"http://www.r-project.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e accessed on June 16, 2023). Continuous variables were presented as medians with interquartile ranges (IQRs), and categorical variables were summarized as counts and percentages. For group comparisons of continuous variables, the Wilcoxon rank-sum test was used due to non-normal data distributions.\\u003c/p\\u003e\\u003cp\\u003eEnrichment ratio was calculated as the proportion of each cancer type among CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormal cases divided by the proportion of that cancer type in the overall cancer patient cohort:\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Equa\\\" class=\\\"Equation\\\"\\u003e\\u003cdiv format=\\\"TEX\\\" class=\\\"mathdisplay\\\" id=\\\"FileID_Equa\\\" name=\\\"EquationSource\\\"\\u003e\\n$$\\\\:Enrichment\\\\:ratio=\\\\left(\\\\frac{N\\\\:abnormal/Total\\\\:abnormal\\\\:cases}{N\\\\:cancer/Total\\\\:cancer\\\\:patients}\\\\right)$$\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eAbnormality rate for each cancer type was calculated as:\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Equb\\\" class=\\\"Equation\\\"\\u003e\\u003cdiv format=\\\"TEX\\\" class=\\\"mathdisplay\\\" id=\\\"FileID_Equb\\\" name=\\\"EquationSource\\\"\\u003e\\n$$\\\\:Abnormality\\\\:rate\\\\:\\\\left(\\\\%\\\\right)=\\\\left(\\\\frac{N\\\\:abnormal\\\\:cases}{N\\\\:cancer\\\\:patients}\\\\right)\\\\times\\\\:100$$\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eMultivariate linear regression analysis was conducted to identify independent clinical predictors of CK-MB/CK ratio, with CK-MB/CK ratio as the dependent variable, and age, sex, tumor stage, and treatment status as covariates. Treatment status was categorized as yes or no based on whether patients received any form of adjuvant therapy. Principal component analysis (PCA) was performed to explore the overall patterns of CK isoenzyme expression profiles, and PERMANOVA (permutational multivariate analysis of variance) was used to assess statistical differences between groups. Linear regression analysis was performed to assess the association between CK-Sub levels and CK-MB/CK ratio. Patients were stratified into high and low expression groups based on the optimal cutoff determined by the Youden index from receiver operating characteristic (ROC) curve analysis. Survival analyses were conducted using Kaplan-Meier curves, and differences between survival distributions were compared using the log-rank test.\\u003c/p\\u003e\\u003cp\\u003eTo explore the potential involvement of platelets in the development of abnormal CK isoenzyme profiles, we evaluated the correlation between CK-Sub, CKBB, or CKII levels and platelet-related hematological indices, PLT, MPV, and PDW. Spearman correlation analysis was first performed to identify monotonic relationships between CK-Sub, CKBB, or CKII and each platelet parameter. Subsequently, multivariate linear regression models were constructed with CK-Sub, CKBB, or CKII as the dependent variable, adjusting for potential confounders such as tumor type, TNM stage, age, and sex. The variance inflation factor (VIF) was calculated to assess multicollinearity.\\u003c/p\\u003e\\u003cp\\u003eGene expression levels were quantified as ΔCT values, and relative expression was calculated using the 2^-ΔCT method. For paired samples (i.e., matched serum and platelet samples from the same patient), the Wilcoxon signed-rank test was used to compare gene expression between compartments. If the data met normality and homogeneity assumptions, a paired t-test was applied instead. For unpaired comparisons (e.g., platelet or serum expression between colorectal and lung cancer patients), the Mann\\u0026ndash;Whitney U test or independent-samples t-test was employed depending on the distribution of the data.\\u003c/p\\u003e\\u003cp\\u003eRaw gene expression matrices were retrieved and processed using the GEOquery package (v2.66.0) and limma (v3.56.2). Normalized CKB mRNA expression levels were extracted and, where necessary, transformed into log₂(TPM\\u0026thinsp;+\\u0026thinsp;1). Statistical comparisons between groups were conducted using the Wilcoxon rank-sum test or paired Wilcoxon signed-rank test, as appropriate.\\u003c/p\\u003e\\u003cp\\u003eTCGA-LUAD RNA sequencing data and corresponding clinical survival information were accessed via the UCSC Xena browser. Patients were stratified into high and low CKB expression groups based on the median CKB expression level. Kaplan-Meier survival curves were plotted, and log-rank tests were used to assess statistical significance. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated using Cox proportional hazards regression analysis.\\u003c/p\\u003e\\u003cp\\u003eFor differential gene expression (DEG) analysis of platelet RNA-seq data from lung cancer patients, the DESeq2 package (v1.36.0) was applied. Genes significantly correlated with platelet CKB expression (adjusted p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 and |log₂FC| \\u0026gt;1) were intersected with CKB-associated DEGs from tumor tissues. Functional enrichment analyses, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, were performed using the clusterProfiler package (v4.4.4). Data visualization, including expression distribution and group comparisons, was performed using ggplot2 (v3.4.2).\\u003c/p\\u003e\\u003cp\\u003eA two-tailed P-value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant for all analyses.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eAt first, patients with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK anomalies were retrospectively identified from a large-scale cancer cohort, and cancer types with high prevalence or enrichment were characterized. Then, CK isoenzyme profiles in serum were analyzed using electrophoresis and qRT-PCR to identify cancer-specific patterns. Next, correlations between platelet parameters and CK isoenzymes were explored, and the expression of CKB in paired serum and platelet samples was quantitatively validated. Finally, public transcriptomic datasets were utilized to confirm CKB overexpression in lung cancer platelets, investigate its metastatic relevance, and elucidate potential functional pathways. The overall workflow and key findings were illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.1 Patient characteristics and clinical correlates of CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eA total of 1,651 cancer patients presenting with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities were retrospectively enrolled between 2019 and 2022. Most patients were aged between 40 and 79 years (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). Based on ICD codes (S1 Table), colorectal cancer (291 cases, 17.6%), lung cancer (265 cases, 16.1%), and female reproductive system tumors (214 cases, 13.0%) were the top three cancer types represented (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). To correct for differences in overall hospitalization frequencies across cancer types, we normalized CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK occurrence against the total number of patients per cancer type. This revealed that colorectal cancer exhibited the highest enrichment and abnormality rate, indicating a strong association with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK anomalies. In contrast, the high absolute case count in lung cancer likely reflected its high population prevalence rather than specific enrichment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC).\\u003c/p\\u003e\\u003cp\\u003eTo further explore the clinical relevance of these abnormalities, we focused on colorectal and lung cancer patients. In colorectal cancer (n\\u0026thinsp;=\\u0026thinsp;291), the majority of patients with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK anomalies were aged between 40\\u0026ndash;80 years (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD) and stage IV (89.4%) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE). A significantly higher CK-MB/CK ratio was observed in stage IV compared to stage III patients (P\\u0026thinsp;=\\u0026thinsp;0.023, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG), suggesting a potential link with tumor progression. However, no significant associations were found between CK-MB/CK ratio and treatment modality or adjuvant therapy status (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH\\u0026ndash;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eI). Multivariate regression confirmed that age, sex, stage, and therapy were not independently associated with CK-MB/CK ratio levels (S2 Table).\\u003c/p\\u003e\\u003cp\\u003eSimilarly, in the lung cancer cohort (n\\u0026thinsp;=\\u0026thinsp;265), patients also tended to be older (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD), with a male predominance (74.7%) and high proportion of advanced-stage disease (88.6% stage IV, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF). No significant associations were observed between CK-MB/CK ratio and tumor stage, adjuvant therapy, or treatment modality (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eJ\\u0026ndash;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eL), and multivariate analysis again showed no independent clinical predictors of CK-MB/CK ratio elevation (S2 Table), suggesting that additional factors may be involved in explaining the observed CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.2. Creatine kinase isoenzyme profile analysis in colorectal and lung cancer patients\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eIsoenzyme electrophoresis was performed prospectively on 92 serum samples (62 colorectal, 30 lung cancer patients) exhibiting CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). All patients were stage III/IV (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB), consistent with the retrospective cohort, further suggesting that CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities were closely associated with enhanced tumor aggressiveness. Electrophoretic analysis revealed consistent abnormal bands across samples, predominantly involving elevated CK-BB and CKII isoenzymes, with most patients displaying a bimodal peak pattern (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Further comparison between colorectal and lung cancer patients showed that CKII elevation predominated in colorectal cancer, whereas both CKII and CK-BB elevations were observed in lung cancer (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD).\\u003c/p\\u003e\\u003cp\\u003ePCA showed that colorectal cancer samples clustered along Dim1, associated with increased CKII expression, whereas lung cancer samples clustered along Dim2, associated with CK-BB elevation (PERMANOVA, P\\u0026thinsp;=\\u0026thinsp;0.001) (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE\\u0026ndash;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF). Comparative analysis confirmed that lung cancer patients had significantly higher CK-BB levels (P\\u0026thinsp;=\\u0026thinsp;1.3e-5) and lower CKII levels (P\\u0026thinsp;=\\u0026thinsp;0.031) compared to colorectal cancer patients (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG\\u0026ndash;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH), suggesting cancer type-specific CK isoenzyme heterogeneity.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.3. Clinical relevance of CK isoenzyme alterations in colorectal and lung cancer\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eTo investigate the clinical implications of serum CK isoenzyme abnormalities in cancer patients with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK patterns, we conducted a stratified analysis of colorectal cancer (n\\u0026thinsp;=\\u0026thinsp;62) and lung cancer (n\\u0026thinsp;=\\u0026thinsp;30) patients who underwent isoenzyme electrophoresis.\\u003c/p\\u003e\\u003cp\\u003eIn colorectal cancer patients, linear regression analysis revealed a mild positive linear relationship between CK-Sub (CK-Sub\\u0026thinsp;=\\u0026thinsp;CK-BB\\u0026thinsp;+\\u0026thinsp;CKII\\u0026thinsp;+\\u0026thinsp;CKI) levels and CK-MB/CK ratio (R\\u0026sup2; = 0.098), although the explanatory power was limited, suggesting that variations in CK-Sub alone may be insufficient to effectively predict CK-MB/CK ratio abnormalities (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). We found that stage IV patients exhibited significantly higher CKII (P\\u0026thinsp;=\\u0026thinsp;0.023) and CK-Sub (P\\u0026thinsp;=\\u0026thinsp;0.022) levels compared with stage III patients (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC\\u0026ndash;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD), indicating that specific isoenzyme upregulation may be linked to tumor progression. In contrast, no significant differences were found in CK-BB expression (P\\u0026thinsp;=\\u0026thinsp;0.41) or CK-MB/CK ratio (P\\u0026thinsp;=\\u0026thinsp;0.86) between stages (S1 Fig), suggesting that the CK-MB/CK ratio alone may not sensitively reflect tumor advancement. Kaplan-Meier survival analysis revealed that patients with high CKII expression had significantly shorter overall survival (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF). Similarly, elevated CK-Sub levels were associated with worse survival outcomes (HR, 0.17; 95%CI, 0.0421\\u0026ndash;0.688; P\\u0026thinsp;=\\u0026thinsp;0.0049) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG). Although the overall variation in CK-MB/CK ratio was limited, alterations in individual isoenzyme components, particularly CKII, or the total CK-Sub, may serve as potential biomarkers for tumor progression in advanced-stage colorectal cancer.\\u003c/p\\u003e\\u003cp\\u003eUnlike the mild positive linear trend observed in colorectal cancer patients, linear regression analysis in lung cancer patients revealed no significant linear relationship between CK-Sub levels and CK-MB/CK ratio (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). In the comparison across tumor stages, CK-BB levels were higher in stage IV patients; however, the difference did not reach statistical significance (P\\u0026thinsp;=\\u0026thinsp;0.44) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE), possibly due to the limited sample size. Similarly, no significant differences were observed in CKII, CK-Sub levels, or CK-MB/CK ratio between different tumor stages (S1 Fig). Regarding survival outcomes, although CK-BB levels did not significantly predict overall survival (P\\u0026thinsp;=\\u0026thinsp;0.23) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eH), a general trend toward poorer survival in the high-expression group was noted. Notably, patients with high CK-Sub levels had significantly shorter overall survival (P\\u0026thinsp;=\\u0026thinsp;0.012) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eI). These findings suggest that tumor progression in lung cancer may involve abnormal activation of multiple CK isoenzyme subtypes. Although individual isoenzyme markers may not independently predict prognosis due to sample size limitations, the overall increase in total CK isoenzyme activity (CK-Sub) appears to be closely associated with poorer clinical outcomes.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.4 Association between platelet parameters and CK isoenzymes\\u003c/h2\\u003e\\u003cp\\u003eTo investigate whether platelets are involved in the aberrant expression patterns of CK isoenzymes observed in cancer patients, we first assessed the correlations between routine platelet-related hematological parameters (including PLT, MPV, and PDW) and serum CK isoenzyme indices (CK-Sub, CK-BB, and CKII) in patients with colorectal and lung cancers. After adjusting for potential confounding variables such as cancer type, tumor stage, age, and sex using multiple linear regression, we found a significant inverse association between PLT and serum CK-BB levels (β = \\u0026minus;\\u0026thinsp;0.038, p\\u0026thinsp;=\\u0026thinsp;0.034). Variance inflation factor (VIF) analysis confirmed the absence of multicollinearity among covariates (all VIFs\\u0026thinsp;\\u0026lt;\\u0026thinsp;2.5), supporting the robustness of the model (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). These findings suggest that reduced PLT may be closely linked to elevated serum CK-BB levels. Notably, upon inclusion of an interaction term (PLT \\u0026times; Cancer) in the regression model, the interaction between PLT and lung cancer approached statistical significance (β = \\u0026minus;\\u0026thinsp;0.055, p\\u0026thinsp;=\\u0026thinsp;0.053), indicating a potentially stronger inverse association between PLT and CK-BB expression specifically in lung cancer patients.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eMultiple Linear Regression Analysis with VIF of Serum CK-BB Expression and Platelet Parameters.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"7\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eVariable\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eEstimate\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eStd. Error\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003et value\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003ep value\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003eSignificance\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eVIF\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e(Intercept)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e60.525\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e78.161\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0.774\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.441\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e\\u0026mdash;\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003ePLT\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e-0.038\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0.018\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e-2.155\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.034\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e*\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e1.72\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eMPV\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e-0.782\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e1.300\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e-0.602\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.549\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e1.98\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003ePDW\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e-2.295\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e5.046\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e-0.455\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.650\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e2.23\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCancer(Lung vs CRC)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e22.319\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.230\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e6.910\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e8.74E-10\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e***\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e1.14\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eStage (IV vs others)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e2.659\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e4.714\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0.564\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.574\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e1.16\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAge\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e-0.099\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0.124\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e-0.798\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.427\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e1.09\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSex (male vs female)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e1.314\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e3.037\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0.432\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e0.667\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e1.02\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003ctfoot\\u003e\\u003ctr\\u003e\\u003ctd colspan=\\\"7\\\"\\u003e\\u003cb\\u003eNote\\u003c/b\\u003e: Model fit: R\\u0026sup2; = 0.419;Adjusted R\\u0026sup2; = 0.370༛F(7, 84)\\u0026thinsp;=\\u0026thinsp;8.64༛p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001. VIFs derived from the multivariable model to assess multicollinearity. VIF\\u0026thinsp;\\u0026lt;\\u0026thinsp;5 indicates acceptable level of collinearity. Abbreviations: VIF, Variance inflation factor.\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tfoot\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.5 Quantitative RT-PCR detection of CK family genes in serum and platelets\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eFurthermore, we performed qRT-PCR analysis to quantify the mRNA expression levels of three creatine kinase genes\\u0026mdash;CKB, CKMT1, and CKMT2\\u0026mdash;in paired serum and platelet samples collected from cancer patients. The expression profiles in serum closely mirrored the protein isoenzyme patterns observed in previous electrophoretic analyses, exhibiting marked cancer-type specificity: mitochondrial isoenzyme CKMT1 was predominantly expressed in colorectal cancer, whereas CKB expression was markedly elevated in lung cancer (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA\\u0026ndash;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). All three CK isoenzyme transcripts were detectable in the paired platelet samples, indicating active transcription of CK genes in platelets. Notably, platelet-derived CKB mRNA expression was significantly higher in lung cancer patients compared to those with colorectal cancer (p\\u0026thinsp;=\\u0026thinsp;5.4 \\u0026times; 10⁻⁶; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC), suggesting potential cancer-type-specific upregulation in the lung cancer context. Paired sample analysis further revealed that, in the majority of cases, platelet CKB mRNA levels exceeded the corresponding serum expression levels (p\\u0026thinsp;=\\u0026thinsp;0.03, Wilcoxon signed-rank test; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD). Additionally, correlation analysis demonstrated a significant positive association between serum and platelet CKB expression levels (R\\u0026sup2; = 0.33, p\\u0026thinsp;=\\u0026thinsp;2.9 \\u0026times; 10⁻⁵; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE). Collectively, these findings suggest that platelets may serve as a critical source of serum CKB in cancer patients\\u0026mdash;particularly in lung cancer\\u0026mdash;potentially contributing to the observed CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK isoenzyme elevation phenotype.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.6 Potential role of platelet CKB in distant metastasis of lung cancer\\u003c/h2\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eTo further validate whether CKB is upregulated in the platelets of lung cancer patients, we analyzed RNA sequencing data from the tumor-educated platelet (TEP) dataset GSE89843. The results showed that CKB mRNA expression was significantly elevated in the platelets of lung cancer patients compared to healthy individuals (P\\u0026thinsp;=\\u0026thinsp;7.7 \\u0026times; 10⁻\\u0026sup1;\\u0026sup1;, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Using the single-cell RNA sequencing dataset GSE123902, we assessed the expression of CKB mRNA within the tumor microenvironment. Notably, tumor cells from distant metastatic lesions in stage IV lung cancer patients exhibited markedly higher CKB expression, whereas no elevation was observed in primary tumor lesions (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD\\u0026ndash;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eG). This finding is consistent with TCGA data, which demonstrated that while CKB expression is generally low in primary lung tumor tissues, patients with relatively higher tumor CKB expression had significantly worse survival outcomes (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC, \\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eH). These results collectively suggest that elevated CKB expression may serve as a potential promoter of distant metastasis.\\u003c/p\\u003e\\u003cp\\u003eTo explore the origin of elevated circulating CKB, we used GSE74639 data to analyze CKB mRNA levels in circulating tumor cells (CTCs) and peripheral blood leukocytes. Both cell populations showed markedly lower CKB expression than primary tumors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). Taken together with the high expression of CKB mRNA observed in peripheral platelets from stage IV patients, we speculated that platelets may represent an external source driving CKB accumulation in metastatic lung cancer cells.\\u003c/p\\u003e\\u003cp\\u003eTo further explore the potential mechanisms by which platelet-derived CKB contributes to lung cancer metastasis, we performed an integrative analysis of CKB-associated differentially expressed genes (DEGs) in lung tumor tissues and platelet RNA profiles. A total of 25 overlapping DEGs were identified. Gene Ontology (GO) and KEGG pathway enrichment analysis revealed that these genes were significantly enriched in pathways related to metabolic processes, oxidative stress responses, immune regulation, and intercellular signaling (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eI). These findings provide preliminary mechanistic insights, suggesting that platelet-derived CKB may play a functional role in shaping the metastatic tumor microenvironment and promoting distant dissemination in lung cancer.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eIn this study, we comprehensively analyzed the clinical, biochemical, and transcriptomic landscape of cancer patients exhibiting the paradoxical CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormality. By integrating large-scale retrospective data, serum isoenzyme profiling, qRT-PCR analysis of platelet and serum mRNA, and bioinformatics, we uncovered that elevated CKB mRNA levels in platelets correlated with metastatic features, suggesting a possible involvement of platelet-associated CKB in lung cancer progression.\\u003c/p\\u003e\\u003cp\\u003eOur results showed that colorectal and lung cancers as the most frequently associated malignancies with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities, particularly at advanced stages. Contrary to classical myocardial injury interpretations, electrophoresis and mRNA profiling revealed that these anomalies were primarily driven by aberrant activation of non-cardiac CK isoenzymes\\u0026mdash;namely, brain-type CK (CK-BB) and mitochondrial CK isoenzymes (CKII and CKI). To better capture these atypical patterns, we developed a composite index termed CK-Sub, defined as the sum of CK-BB, CKII, and CKI activity. This index demonstrated prognostic relevance, particularly in colorectal cancer, where elevated CK-Sub levels were significantly associated with stage IV disease and shorter overall survival. Importantly, cancer-type\\u0026ndash;specific CK expression patterns emerged: CKII was the predominant isoenzyme in CRC, while CK-BB was selectively enriched in lung cancer patients[\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Previous studies have indicated that CK-BB promotes extracellular ATP production under hypoxic conditions, thereby supporting tumor cell survival, migration, and metastasis[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Our findings are consistent with these biological roles, confirming the presence of high CK-BB levels in patients with advanced-stage lung cancer[\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. Notably, our study observed the important contribution of CKII to CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK discrepancies, especially in colorectal cancer[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. This highlights the potential role of mitochondrial metabolic reprogramming in tumor progression[\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR47 CR48 CR49 CR50 CR51 CR52 CR53\\\" citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e]\\u003c/p\\u003e\\u003cp\\u003eThe extracellular presence of CK-BB and mitochondrial CK may not only serve as passive markers of tumor burden but may also actively contribute to establishing a metabolically supportive microenvironment that promotes tumor survival and metastasis[\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e]. Notably, although the CK-MB/CK ratio itself exhibited limited sensitivity in predicting tumor stage or prognosis, the underlying isoenzyme signatures\\u0026mdash;particularly the elevations in CKII\\u0026mdash;showed significant correlations with disease stage. By integrating signals from multiple non-traditional CK isoenzymes, CK-Sub demonstrated significant prognostic value in both colorectal and lung cancer patients, with elevated levels indicating worse survival outcomes. These findings suggest that analyzing CK isoenzyme patterns can provide deeper biological and clinical insights compared to traditional CK-MB/CK ratio analysis[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e], and that the cumulative activity of CK isoenzymes beyond CK-MB and CK-MM may more effectively reflect tumor aggressiveness[\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eA key and novel insight from our study is the identification of platelets as a non-canonical source of circulating CKB. qRT-PCR analysis revealed that CKB mRNA expression was significantly higher in the platelets of lung cancer patients than in colorectal cancer patients. Paired sample analysis confirmed that platelet CKB levels exceeded those in serum, and a significant positive correlation was observed between the two, indicating that platelets may actively contribute to the pool of circulating CK-BB. This hypothesis was further substantiated by analysis of the GSE89843 TEPs RNA-seq dataset, which confirmed that CKB was significantly upregulated in platelets of lung cancer patients. Additional exploration using the GSE123902 single-cell RNA-seq dataset revealed that CKB expression was specifically enriched in tumor cells within distant metastatic lesions, but not in primary tumors. These observations, combined with TCGA survival analysis linking high tumor CKB expression to poor prognosis. Functional enrichment analysis revealed that 25 shared differentially expressed genes associated with TEPs and CKB tumor related genes in lung cancer were enriched in oxidative stress response, immune regulation, and metabolic reprogramming. All evidences suggest that CKB may serve as a functional facilitator of lung cancer metastasis.\\u003c/p\\u003e\\u003cp\\u003eTaken together, our findings highlight a previously underexplored role of platelets as potential metabolic enablers of tumor dissemination. The discovery of elevated CKB mRNA levels in TEPs, particularly in lung cancer patients, and their correlation with distant metastasis raises the possibility that platelets may help shape the metastatic phenotype through metabolic crosstalk. We propose a mechanistic model (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e) in which platelet-associated CKB supports the survival and adaptability of CTCs during hematogenous transit, potentially by enhancing ATP production in energy-stressed environments. Although our study does not provide direct evidence for the transfer or translation of platelet CKB in vivo, the convergence of clinical, biochemical, and transcriptomic findings provides a compelling rationale for further investigation.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThis study also proposed that platelets may represent an important source of abnormally elevated serum CKB in cancer patients, especially in lung cancer. This not only complements the mechanistic basis for the clinical findings (CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK), but also offers a theoretical framework for future studies on how platelets contribute to the release, transport, and systemic dissemination of tumor-associated metabolic factors such as CKB. Future studies incorporating co-culture systems, metabolic tracing, and in vivo metastasis assays are warranted to elucidate the precise functional contributions of platelet CKB in lung cancer progression. This may provide new clues for blocking platelet-assisted hematogenous metastasis.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusions\",\"content\":\"\\u003cp\\u003e\\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003eThis study suggests that in lung cancer patients with serum CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities, the atypical CK pattern is driven by CK-BB specificity. Among them, platelet CKB is significantly elevated and closely related to distant metastasis and poor prognosis. Platelet CKB may be a potential participant in hematogenous dissemination of lung cancer, and its mechanism deserves further investigation.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eATP\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eAdenosine Triphosphate\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCK\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCreatine Kinase\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCK-MB\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCreatine Kinase-MB Isoenzymes\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCK-BB\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCreatine Kinase Brain-Type Isoenzymes\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCK-MM\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCreatine Kinase Muscle-Type Isoenzymes\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eMtCK\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eMitochondrial Creatine Kinase\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCKII\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eMitochondrial Creatine Kinase Isoenzyme II (dimer form)\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCKI\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eMitochondrial Creatine Kinase Isoenzyme I (monomer form)\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eRC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eColorectal cancer\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePCA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePrincipal Component Analysis\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePERMANOVA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePermutational Multivariate Analysis of Variance\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eHR\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eHazard Ratio\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCI\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eConfidence Interval\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eOS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eOverall Survival\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCTC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCirculating tumor cell\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eTEP\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eTumor-educated platelet\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePET\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePlatelet-educated tumor cell\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePLT\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePlatelet count\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eMPV\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eMean platelet volume\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePDW\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePlatelet distribution width\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePRP\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePplatelet-rich plasma\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eNSCLC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eNon-small cell lung cancer\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eROC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eReceiver operating characteristic\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eVIF\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eVariance inflation factor\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eDEG\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eDifferential gene expression\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eWBC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eWhite blood cell\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u003c/strong\\u003e This research was funded by the Natural Science Foundation of Sichuan Province [Grant numbers 2024NSFSC1880] and the National Natural Science Foundation of China [Grant numbers 82302993]. The funding was essential for data analysis and the publication of this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of Interest:\\u003c/strong\\u003e The authors have no relevant financial or non-financial interests to disclose.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions:\\u003c/strong\\u003e All authors contributed to the study conception and design. Conceptualization, Lubei Rao and Dongsheng Wang; methodology, Chao\\u0026nbsp;Hu; software, Luibei\\u0026nbsp;Rao; in-vestigation, Yan\\u0026nbsp;Yue and Bo\\u0026nbsp;Ye; resources, Yue\\u0026nbsp;Liang; data curation, Yajun\\u0026nbsp;Luo; writing\\u0026mdash;original draft preparation, Lubei\\u0026nbsp;Rao; writing\\u0026mdash;review and editing, Lubei\\u0026nbsp;Rao and Guiji\\u0026nbsp;Zhang; visualization, Lubei\\u0026nbsp;Rao; supervision, Dongsheng\\u0026nbsp;Wang; project administration, Lubie\\u0026nbsp;Rao; funding acquisition, Lubei\\u0026nbsp;Rao and Yajun\\u0026nbsp;Luo. All authors have read and agreed to the published version of the manuscript. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability:\\u003c/strong\\u003e The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval:\\u0026nbsp;\\u003c/strong\\u003eThe research related to human use has complied with all the relevant national regulations, institutional policies and follows the tenets of the Helsinki Declaration, and has been approved by the Institutional Ethics Committee of The Sichuan Cancer Hospital\\u0026nbsp;(IRB No. SCCHEC-02-2022-017).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to participate:\\u0026nbsp;\\u003c/strong\\u003eThe study was exempted from informed consent\\u0026nbsp;(IRB No. SCCHEC-02-2022-017).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to publish\\u003c/strong\\u003e\\u003cstrong\\u003e：\\u003c/strong\\u003eNot applicable.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDuring the preparation of this work, the authors used ChatGPT (OpenAI, GPT-4 version) for the purpose of assisting in refining the English language expressions. All scientific content, analyses, interpretations, and conclusions were independently developed by the authors. After using this tool, the authors have carefully reviewed and edited all outputs and take full responsibility for the content and interpretation presented in this publication.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eWalters J, Gailani G: Serum creatine kinase: requesting and interpreting results. Pract Neurol 2025.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSoroida Y, Ohkawa R, Nakagawa H, Satoh Y, Yoshida H, Kinoshita H, Tateishi R, Masuzaki R, Enooku K, Shiina S et al: Increased activity of serum mitochondrial isoenzyme of creatine kinase in hepatocellular carcinoma patients predominantly with recurrence. J Hepatol 2012, 57(2):330\\u0026ndash;336.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSchlattner U, Kay L, Tokarska-Schlattner M: Mitochondrial Proteolipid Complexes of Creatine Kinase. Subcell Biochem 2018, 87:365\\u0026ndash;408.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKanemitsu F, Okigaki T: Characterization of human creatine kinase BB and MB isoforms by means of isoelectric focusing. Clin Chim Acta 1994, 231(1):1\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang L, Han F, Liu X, Xie C, Tian K, Bi Q, Hao M, Mu X: Macro creatine kinase in an asymptomatic patient: a case report. Clin Chem Lab Med 2020, 59(2):e61-e64.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSchlattner U, Tokarska-Schlattner M, Wallimann T: Mitochondrial creatine kinase in human health and disease. Biochim Biophys Acta 2006, 1762(2):164\\u0026ndash;180.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCollinson P, Suvisaari J, Aakre KM, Baum H, Duff CJ, Gruson D, Hammerer-Lercher A, Pulkki K, Stankovic S, Langlois MR et al: How Well Do Laboratories Adhere to Recommended Guidelines for Cardiac Biomarkers Management in Europe? The CArdiac MARker Guideline Uptake in Europe (CAMARGUE) Study of the European Federation of Laboratory Medicine Task Group on Cardiac Markers. Clin Chem 2021, 67(8):1144\\u0026ndash;1152.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAlvin MD, Jaffe AS, Ziegelstein RC, Trost JC: Eliminating Creatine Kinase-Myocardial Band Testing in Suspected Acute Coronary Syndrome: A Value-Based Quality Improvement. JAMA Intern Med 2017, 177(10):1508\\u0026ndash;1512.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGrela-Wojewoda A, P\\u0026uuml;sk\\u0026uuml;ll\\u0026uuml;oğlu M, Sas-Korczyńska B, Zemełka T, Pacholczak-Madej R, Wysocki WM, Wojewoda T, Adamczyk A, Lompart J, Korman M et al: Biomarkers of Trastuzumab-Induced Cardiac Toxicity in HER2- Positive Breast Cancer Patient Population. Cancers (Basel) 2022, 14(14).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKanemitsu F, Okigaki T: Creatine kinase MB isoforms for early diagnosis and monitoring of acute myocardial infarction. Clin Chim Acta 1992, 206(3):191\\u0026ndash;199.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePanteghini M, Cuccia C, Malchiodi A, Calarco M, Pagnoni N: Isoforms of creatine kinase MM and MB in acute myocardial infarction: a clinical evaluation. Clin Chim Acta 1986, 155(1):1\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNeumeier D, Prellwitz W, W\\u0026uuml;rzburg U, Brundobler M, Olbermann M, Just HJ, Knedel M, Lang H: Determination of creatine kinase isoenzyme MB activity in serum using immunological inhibition of creatine kinase M subunit activity. Activity kinetics and diagnostic significance in myocardial infarction. Clin Chim Acta 1976, 73(3):445\\u0026ndash;451.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKovar FM, Aldrian S, Endler G, V\\u0026eacute;csei V, Hajdu S, Heinz T, Wagner OF: CK/CK-MB ratio as an indirect predictor for survival in polytraumatized patients. Wien Klin Wochenschr 2012, 124(7\\u0026ndash;8):245\\u0026ndash;250.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eOta T, Hasegawa Y, Murata E, Tanaka N, Fukuoka M: False-Positive Elevation of CK-MB Levels with Chest Pain in Lung Adenocarcinoma. Case Rep Oncol 2020, 13(1):100\\u0026ndash;104.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eEidizadeh A, von Ahsen N, Friedewald S, Binder L: Macro-CK type 2 in metastatic prostate cancer. Diagnosis (Berl) 2019, 6(3):307\\u0026ndash;309.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAnnesley TM, McKenna BJ: Ectopic creatine kinase MB production in metastatic cancer. Am J Clin Pathol 1983, 79(2):255\\u0026ndash;259.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLoo JM, Scherl A, Nguyen A, Man FY, Weinberg E, Zeng Z, Saltz L, Paty PB, Tavazoie SF: Extracellular metabolic energetics can promote cancer progression. Cell 2015, 160(3):393\\u0026ndash;406.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDemir M, Koepping L, Li Y, Fujimoto L, Bobkov A, Zhao J, Hitosugi T, Sergienko E: Structural basis for substrate binding, catalysis, and inhibition of cancer target mitochondrial creatine kinase by a covalent inhibitor. Structure 2025, 33(4):786\\u0026ndash;797.e783.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eChang CC, Liou CB, Su MJ, Lee YC, Liang CT, Ho JL, Tsai HW, Yen TH, Chu FY: Creatine Kinase (CK)-MB-to-Total-CK Ratio: a Laboratory Indicator for Primary Cancer Screening. Asian Pac J Cancer Prev 2015, 16(15):6599\\u0026ndash;6603.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eUranbileg B, Enooku K, Soroida Y, Ohkawa R, Kudo Y, Nakagawa H, Tateishi R, Yoshida H, Shinzawa S, Moriya K et al: High ubiquitous mitochondrial creatine kinase expression in hepatocellular carcinoma denotes a poor prognosis with highly malignant potential. Int J Cancer 2014, 134(9):2189\\u0026ndash;2198.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eQian XL, Li YQ, Gu F, Liu FF, Li WD, Zhang XM, Fu L: Overexpression of ubiquitous mitochondrial creatine kinase (uMtCK) accelerates tumor growth by inhibiting apoptosis of breast cancer cells and is associated with a poor prognosis in breast cancer patients. Biochem Biophys Res Commun 2012, 427(1):60\\u0026ndash;66.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLin YC, Chen SC, Huang CM, Hu YF, Chen YY, Chang SL, Lo LW, Lin YJ, Chen SA: Clinical features and diagnosis of new malignancy in patients with acute pulmonary embolism and without a history of cancer. J Chin Med Assoc 2020, 83(3):245\\u0026ndash;250.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eStein W, Bohner J: Influence of autoantibodies to creatine kinase-BB on assays for MB isoenzyme. Clin Chem 1985, 31(7):1189\\u0026ndash;1192.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWong SS, Wu AH, Fritsche HA: Reassessment of creatine kinase BB as a marker for cancer of the prostate, breast, and lung. Clin Chem 1987, 33(6):809\\u0026ndash;811.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHuddleston HG, Wong KK, Welch WR, Berkowitz RS, Mok SC: Clinical applications of microarray technology: creatine kinase B is an up-regulated gene in epithelial ovarian cancer and shows promise as a serum marker. Gynecol Oncol 2005, 96(1):77\\u0026ndash;83.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWang HC, Lu JY, Ting YM: Elevated serum CK-MB and CK-BB isoenzymes in a patient with small cell lung cancer: a case report. Zhonghua Yi Xue Za Zhi (Taipei) 1995, 55(3):270\\u0026ndash;273.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi Y, Chen Y, Shao B, Liu J, Hu R, Zhao F, Cui X, Zhao X, Wang Y: Evaluation of creatine kinase (CK)-MB to total CK ratio as a diagnostic biomarker for primary tumors and metastasis screening. Pract Lab Med 2023, 37:e00336.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWada Y, Tanigawa J, Ishizaka N: Macro-CK and CK-BB Contributing to Sham CK-MB Elevation. Intern Med 2017, 56(11):1449\\u0026ndash;1450.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLee KN, Csako G, Bernhardt P, Elin RJ: Relevance of macro creatine kinase type 1 and type 2 isoenzymes to laboratory and clinical data. Clin Chem 1994, 40(7 Pt 1):1278\\u0026ndash;1283.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLabelle M, Hynes RO: The initial hours of metastasis: the importance of cooperative host-tumor cell interactions during hematogenous dissemination. Cancer Discov 2012, 2(12):1091\\u0026ndash;1099.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGil-Bernab\\u0026eacute; AM, Lucotti S, Muschel RJ: Coagulation and metastasis: what does the experimental literature tell us? Br J Haematol 2013, 162(4):433\\u0026ndash;441.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCoupland LA, Chong BH, Parish CR: Platelets and P-selectin control tumor cell metastasis in an organ-specific manner and independently of NK cells. Cancer Res 2012, 72(18):4662\\u0026ndash;4671.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSchlesinger M: Role of platelets and platelet receptors in cancer metastasis. J Hematol Oncol 2018, 11(1):125.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eErpenbeck L, Sch\\u0026ouml;n MP: Deadly allies: the fatal interplay between platelets and metastasizing cancer cells. Blood 2010, 115(17):3427\\u0026ndash;3436.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMartins Castanheira N, Spanhofer AK, Wiener S, Bobe S, Schillers H: Uptake of platelets by cancer cells and recycling of the platelet protein CD42a. J Thromb Haemost 2022, 20(1):170\\u0026ndash;181.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePlacke T, \\u0026Ouml;rgel M, Schaller M, Jung G, Rammensee HG, Kopp HG, Salih HR: Platelet-derived MHC class I confers a pseudonormal phenotype to cancer cells that subverts the antitumor reactivity of natural killer immune cells. Cancer Res 2012, 72(2):440\\u0026ndash;448.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePlacke T, Salih HR, Kopp HG: GITR ligand provided by thrombopoietic cells inhibits NK cell antitumor activity. J Immunol 2012, 189(1):154\\u0026ndash;160.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eClar KL, Hinterleitner C, Schneider P, Salih HR, Maurer S: Inhibition of NK Reactivity Against Solid Tumors by Platelet-Derived RANKL. Cancers (Basel) 2019, 11(3).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eStoiber D, Assinger A: Platelet-Leukocyte Interplay in Cancer Development and Progression. Cells 2020, 9(4).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eRao L, Xu P, Zhang G, Zu R, Luo Y, Zhang K, Yang Y, Wang D, He S, Luo H et al: Prognostic value of creatine kinase (CK)-MB to total-CK ratio in colorectal cancer patients after curative resection. BMC Cancer 2024, 24(1):543.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eUsui A, Fujita K, Imaizumi M, Abe T, Inoue K, Matumoto S, Kato K: Determination of creatine kinase isozymes in sera and tissues of patients with various lung carcinomas. Clin Chim Acta 1987, 164(1):47\\u0026ndash;53.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBen-Sahra I, Puissant A: HER2 Signaling Hijacks the Creatine Shuttle to Fuel Breast Cancer Cell Growth. Cell Metab 2018, 28(6):805\\u0026ndash;807.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKrutilina RI, Playa H, Brooks DL, Schwab LP, Parke DN, Oluwalana D, Layman DR, Fan M, Johnson DL, Yue J et al: HIF-Dependent CKB Expression Promotes Breast Cancer Metastasis, Whereas Cyclocreatine Therapy Impairs Cellular Invasion and Improves Chemotherapy Efficacy. Cancers (Basel) 2021, 14(1).\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZarghami N, Giai M, Yu H, Roagna R, Ponzone R, Katsaros D, Sismondi P, Diamandis EP: Creatine kinase BB isoenzyme levels in tumour cytosols and survival of breast cancer patients. Br J Cancer 1996, 73(3):386\\u0026ndash;390.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLee K, Csako G, Bernhardt P, Elin RJCc: Relevance of macro creatine kinase type 1 and type 2 isoenzymes to laboratory and clinical data. 1994, 40:1278\\u0026ndash;1283.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBera S, Ray M: The transcriptional cascade associated with creatine kinase down-regulation and mitochondrial biogenesis in mice sarcoma. Cell Mol Biol Lett 2009, 14(3):481\\u0026ndash;496.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang Y, Sun M, Chen Y, Li B: MiR-519b-3p Inhibits the Proliferation and Invasion in Colorectal Cancer via Modulating the uMtCK/Wnt Signaling Pathway. Frontiers in pharmacology 2019, 10:741.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHeinz JW, O'Donnell NJ, Lott JA: Apparent mitochondrial creatine kinase in the serum of a patient with metastatic cancer to the liver. Clin Chem 1980, 26(13):1908\\u0026ndash;1911.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eWang Z, Wu H, Chang X, Song Y, Chen Y, Yan Z, Gu L, Pang R, Xia T, He Z et al: CKMT1 deficiency contributes to mitochondrial dysfunction and promotes intestinal epithelial cell apoptosis via reverse electron transfer-derived ROS in colitis. Cell Death Dis 2025, 16(1):177.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKita M, Fujiwara-Tani R, Kishi S, Mori S, Ohmori H, Nakashima C, Goto K, Sasaki T, Fujii K, Kawahara I et al: Role of creatine shuttle in colorectal cancer cells. Oncotarget 2023, 14:485\\u0026ndash;501.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang H, To KKW: Serum creatine kinase elevation following tyrosine kinase inhibitor treatment in cancer patients: Symptoms, mechanism, and clinical management. Clin Transl Sci 2024, 17(11):e70053.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eJoseph J, Cardesa A, Carreras J: Creatine kinase activity and isoenzymes in lung, colon and liver carcinomas. Br J Cancer 1997, 76(5):600\\u0026ndash;605.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi M, Liu H, Li J, Guo S, Lv YJRr: Mitochondrial creatine kinase 1 in non-small cell lung cancer progression and hypoxia adaptation. 2021, 22(1):190.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSoroida Y, Ohkawa R, Nakagawa H, Satoh Y, Yoshida H, Kinoshita H, Tateishi R, Masuzaki R, Enooku K, Shiina S et al: Increased activity of serum mitochondrial isoenzyme of creatine kinase in hepatocellular carcinoma patients predominantly with recurrence. 2012, 57(2):330\\u0026ndash;336.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCai S, Xia Q, Duan D, Fu J, Wu Z, Yang Z, Yu C: Creatine kinase mitochondrial 2 promotes the growth and progression of colorectal cancer via enhancing Warburg effect through lactate dehydrogenase B. PeerJ 2024, 12:e17672.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAmamoto R, Uchiumi T, Yagi M, Monji K, Song Y, Oda Y, Shiota M, Yokomizo A, Naito S, Kang DJJoC: The Expression of Ubiquitous Mitochondrial Creatine Kinase Is Downregulated as Prostate Cancer Progression. 2016, 7(1):50\\u0026ndash;59.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"clinical-and-experimental-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"clem\",\"sideBox\":\"Learn more about [Clinical and Experimental Medicine](https://www.springer.com/journal/10238)\",\"snPcode\":\"10238\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10238/3\",\"title\":\"Clinical and Experimental Medicine\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Cancer, Creatine kinase, Platelet, Biomarker, Metastasis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7113855/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7113855/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e\\u003cp\\u003eAn unusual clinical laboratory phenomenon\\u0026mdash;serum creatine kinase-MB (CK-MB) activity exceeding total creatine kinase (CK) activity (CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK)\\u0026mdash;is frequently observed in cancer patients, yet its molecular origin and relevance to tumor biology remain unclear.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e\\u003cp\\u003eWe conducted an integrated analysis combining a large retrospective cancer cohort (n\\u0026thinsp;=\\u0026thinsp;1,651), serum CK isoenzyme electrophoresis, and qRT-PCR analysis of paired serum and platelet samples. Public RNA sequencing datasets, including tumor-educated platelets (TEPs) and single-cell data from lung cancer metastases, were utilized to explore the molecular basis and clinical significance of CK isoenzyme alterations.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e\\u003cp\\u003eColorectal and lung cancers were the most frequently associated malignancies with CK-MB\\u0026thinsp;\\u0026gt;\\u0026thinsp;CK abnormalities, particularly in advanced stages. Electrophoresis and transcript profiling revealed that this paradoxical elevation was driven by aberrant increases in non-cardiac CK isoenzymes, especially brain-type creatine kinase (CK-BB) and mitochondrial CK. A composite index (CK-Sub), integrating CK-BB and mitochondrial CK isoforms, was developed and found to be associated with advanced disease and poor prognosis in colorectal cancer. Notably, CKB mRNA was significantly elevated in platelets from lung cancer patients and exceeded paired serum levels, with a strong positive correlation (R\\u0026sup2; = 0.33, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), suggesting that platelets may contribute to the circulating isoenzyme pool. This observation was supported by the TEPs RNA-seq data, which confirmed higher CKB expression in lung cancer patients (p\\u0026thinsp;=\\u0026thinsp;7.7 \\u0026times; 10⁻\\u0026sup1;\\u0026sup1;). Single-cell RNA-seq analysis further showed that CKB expression was enriched in metastatic tumor cells but not in primary lesions. Functional gene enrichment analysis revealed associated pathways involved in metabolism, oxidative stress, and intercellular signaling.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e\\u003cp\\u003eOur findings suggest that platelet-related CKB may be linked to metastatic potential in lung cancer and represent a previously underrecognized component in cancer associated biochemical alterations. This study provides novel insights into the non-canonical roles of platelets in cancer biology and highlights CK isoenzyme profiling as a clinically relevant tool for tumor characterization.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Platelet CKB as a potential contributor to serum creatine kinase abnormalities and metastasis in cancer patients\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-07-23 05:55:01\",\"doi\":\"10.21203/rs.3.rs-7113855/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-09-02T12:44:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-09-01T17:07:02+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"104065012179831252570450538653624357270\",\"date\":\"2025-08-16T17:07:30+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-07-16T09:56:31+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-07-15T14:39:06+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-07-15T14:38:08+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Clinical and Experimental Medicine\",\"date\":\"2025-07-13T14:21:15+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"clinical-and-experimental-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"clem\",\"sideBox\":\"Learn more about [Clinical and Experimental Medicine](https://www.springer.com/journal/10238)\",\"snPcode\":\"10238\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10238/3\",\"title\":\"Clinical and Experimental Medicine\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"3bed22a8-e26b-41cd-b6f1-e5d73daba0f2\",\"owner\":[],\"postedDate\":\"July 23rd, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-11-17T16:06:49+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-7113855\",\"link\":\"https://doi.org/10.1007/s10238-025-01912-8\",\"journal\":{\"identity\":\"clinical-and-experimental-medicine\",\"isVorOnly\":false,\"title\":\"Clinical and Experimental Medicine\"},\"publishedOn\":\"2025-11-11 15:58:44\",\"publishedOnDateReadable\":\"November 11th, 2025\"},\"versionCreatedAt\":\"2025-07-23 05:55:01\",\"video\":\"\",\"vorDoi\":\"10.1007/s10238-025-01912-8\",\"vorDoiUrl\":\"https://doi.org/10.1007/s10238-025-01912-8\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7113855\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7113855\",\"identity\":\"rs-7113855\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}