{"paper_id":"47454680-0ae3-460c-bd93-03f62bce2edf","body_text":"[6]-Paradol Suppresses Proliferation and Metastases of Pancreatic Cancer by Decreasing EGFR and Inactivating PI3K/AKT Signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Primary research [6]-Paradol Suppresses Proliferation and Metastases of Pancreatic Cancer by Decreasing EGFR and Inactivating PI3K/AKT Signaling Xueyi Jiang, Jie Wang, Peng Chen, Zhiwei He, Jian Xu, Yankun Chen, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-506985/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Aug, 2021 Read the published version in Cancer Cell International → Version 1 posted 5 You are reading this latest preprint version Abstract Background: The underlying mechanism behind the tumorigenesis and progression of pancreatic cancer is not clear, and treatment failure is generally caused by early metastasis, recurrence, drug resistance and vascular invasion. Exploring novel therapeutic regimens is necessary to overcome drug resistance and improve patients outcomes. Methods: Functional assays were performed to investigated the role of 6-Paradol in proliferation and metastasis in vitro and vivo. The interaction between EGFR and 6-P was tested by KEGG enrichment analysis and molecular docking analysis. qRT-PCR was performed to detected the mRNA expression of EGFR in 6-P treated groups. Involvement of the PI3K/AKT pathway was measured by western blotting. Results: 6-P significantly suppressed pancreatic cancer cell proliferation and metastasis. KEGG enrichment analysis and molecular docking analysis suggested that there was an interaction between EGFR and 6-P. In addition, 6-P obviously decreased EGFR protein expression levels but did not change the mRNA of EGFR. 6-P could induce degradation of EGFR through decreasing the protein stability of EGFR and enhancing the ubiquitin-mediated proteasome-dependent degradation,6-P-mediated EGFR degradation led to inactivating PI3K/AKT signaling pathway. However, Ectopic expression of EGFR protein resulted in resistance to 6-P-mediated inactivity of PI3K/AKT signaling and inhibition of malignant phenotype. Inversely, erlotinib could enhance the 6-P-mediated anticancer activity. Conclusion: Our data indicated that 6-P/EGFR/PI3K/AKT signaling axis might become one of the supplemental therapeutic strategies for pancreatic cancer. Cancer Biology [6]-Paradol pancreatic cancer proliferation metastasis EGFR Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Pancreatic cancer is the third highest in cancer-related deaths in the US and has one of the lowest 5-year survival rates (less than 10%), carrying an extremely poor survival conditions in digestive malignant cancer.[ 1 ] Although the laparoscopic pancreaticoduodenectomy is widely used in pancreatic surgery for reducing the recovery time and the modern chemotherapeutic regimens significantly improve the prognosis, the recurrence rate is still high and the available treatment options are limited, resulting in unsatisfied clinical outcomes.[ 2 ] Surgical resection offers the maximize opportunities for curing the pancreatic cancer, however, most of patients lose their surgical chances due to insidious onset and rapid progression in early stage.[ 3 ] Chemotherapy and radiotherapy are main supplemental therapeutic strategy in the advanced stage. The first-line chemotherapy gemcitabine combining with other chemotherapeutic agents, including albumin-bound paclitaxel or cisplatin, are often used to treat patients with pancreatic cancer. However, patients commonly develop drug resistance and metastasis in the later stage, resulting in treatment failure. Therefore, it is particularly necessary to develop new therapeutic regimens, including chemotherapy, radiotherapy, bio-targeted drugs and traditional Chinese medicine. In recent years, great progress has been made in the anti-tumor research of natural compounds and their derivatives. Ke et al. reported that the extracts of foeniculum vulgare seed could promote lung cancer cells apoptosis by suppressing the Bcl-2 expression.[ 4 ] ZM-32, one of muscone derivative, had been proved that exerted an inhibition function in breast tumor angiogenesis through effectively blocking the interaction between HuR and VEGF.[ 5 ] A typical flavonoid compound, baicalein, extracted from the root of Scutellaria baicalensis, inhibited lung cancer cell proliferation via inducing degradation of MAP4K3. The underlying molecular mechanism was that baicalensis could directly interact with MAP4K3 and decrease its protein stability and promote its ubiquitination modification.[ 6 ] Ginger (Zingiber officinale) is one of the most natural dietary ingredient, containing several pungent constituents, including ginerols, paradols, shogaols and gingerdiols.[ 7 ] In addition to being widely used as a flavoring ingredient, ginger roots are also applied in traditional Eastern herbal remedies for symptoms such as the common cold, digestive ailments, rheumatism, neuralgia, colic and motion sickness.[ 8 ] Recent researches indicate that the extracts of ginger exert multiple biologic functions such as anti-melanogenesis, anticancer, antioxidant and anti-inflammatory properties.[ 9 – 11 ] Previous study suggested that [ 6 ]-Shogaol (6-S) suppressed lung cancer cells proliferation through inhibiting the activity of AKT kinase and inducing cell cylce arrest at G1 or G2/M phase.[ 12 ] Another extract [ 6 ]-Gingerol (6-G) was reported to possess anti-proliferative and angiogenesis in colorectal cancer by decreasing the concnetration of VEGF.[ 13 ] Mariadoss et al. demonstrated that [ 6 ]-Paradol (6-P) effectively prevented mouse skin carcinogenesis process.[ 14 ] Additionally, the viability and proliferation of human promyelocytic leukemia could be inhibited by 6-P mediated cytotoxic activity.[ 15 ] In this study, we identified a ingredient of ginger, 6-P, as a potential candidate for the anti-tumor compound and therapy of pancreatic cancer. We discovered that 6-P exerted anti-pancreatic cancer activity by decreasing the expression of EGFR and inhibiting the activity of AKT signaling. Our data indicated that 6-P might become one of the supplemental therapeutic strategies for pancreatic cancer. Materials And Methods Experimental drugs, reagents and antibodies P (No. HY-14617), MG-132 (No.HY-13259) and erlotinib (No. HY-50896) were purchased from the MedChemExpress (MCE, USA). Cycloheximide (CHX, No. 66-81-9) were purchased from the Merck (USA). The Primer sequences, including EGFR, GAPDH were purchased from Ribobio (China). Flag-labeled EGFR overexpressed plasmid and HA-labeled ubiquitin plasmid were constructed and extracted from Genechem (China). Dulbecco's modified eagle medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (USA). Cell counting kit-8 (CCK-8) was purchased from Dojindo (Japan). Matrigel was purchased from BD Biosciences (USA). PCR Reagents used include TRIzol (Invitrogen, USA), HiScript® III 1st Strand cDNA Synthesis Kit (+ gDNA wiper) (Vazyme, China), ChamQ Universal SYBR qPCR Master Mix (Vazyme), Lipofectamine 3000 (ThermoFisher, USA). Western blot Reagents used include BCA protein assay kit (Boster, China); enhanced chemiluminescent Kit (ABclonal Technology, China) Antibodies used include EGFR, AKT, PI3K, GAPDH rabbit antibody (Proteintech, China); p-AKT, p-PI3K rabbit antibody (CST, USA). HRP-labeled goat anti-rabbit IgG (Boster, China). Cell culture and transfection Human pancreatic cancer cell lines MIA PaCa-2 and SW1990 were purchased from American Type Culture Collection. The two pancreatic cancer cells were cultured in DMEM with supplementary 10% FBS. The plasmids were respectively transferred into adherd pancreatic cancer cells with Lipofectamine 3000 Transfection Reagent. After 6 h of incubation, wash with PBS and change the medium. The transfected effectiveness was evaluated by PCR analysis. CCK-8 Cell viability was measured using CCK-8, and approximate 2 × 10 2 MIA PaCa-2 and SW1990 cells were respectively seeded into 96-well plates. Different concentrations of 6-P were prepared in advance, including 0 µM, 20 µM, 40 µM, 80 µM, and respectively added into 96-well plates. After regular time points (0 h, 24 h, 48 h, 72h) of incubation, 10 µl CCK-8 solution was respectively added into 96-well plates for another 3 h. Then, the absorbance at 450 nm was identified to evaluate the relative cell proliferation by a microplate reader. Plate colony formation The ability of pancreatic cancer cells on colony formation was measured using plate colony formation assay. Approximate 1 × 10 3 MIA PaCa-2 and SW1990 cells were respectively seeded into 6-well plates. Different concentrations of 6-P were prepared in advance, including 0 µM, 20 µM, 40 µM, 80 µM, and respectively added into 6-well plates for 7 days co-incubation. Then the 6-well plates needed be washed with PBS, fixed with 4% paraformaldehyde, stained with 1% crystal violet. Lastly, the stained 6-well plates were imaged and recorded with an HD Camera. Wound healing assay The migrated ability of pancreatic cancer cells was measured by wound healing assay. Approximate 5 × 10 5 MIA PaCa-2 and SW1990 cells were respectively seeded into 6-well plates until cells covered with the whole plates. Using 200 µl pipette tip drew a vertical line in 6-well plate and the wound was washed with PBS. The different concentrations of 6-P were respectively added into 6-well plate to co-incubate for 48 h. The wound healing images were captured using microscope. Transwell assay The migrated and invasive ability of pancreatic cancer cells were measured by transwell assay. Approximate 200 µl suspension containing 1 × 10 4 MIA PaCa-2 or SW1990 cells were respectively seeded into the upper chambers which were covered with Matrigel. Approximate 600 µl DMEM with 20% FBS was added into the lower chambers. After 24 h of incubation, the cells on upper chambers were washed and removed, the cells on lower chambers were fixed with 4% paraformaldehyde and stained with 1% crystal violet. the stained lower chambers were imaged and recorded under a microscope. PCR analysis The total RNA was extracted from pancreatic cancer cells with Trizol Reagent, the RNA was reverse transcribed into cDNA using HiScript® III 1st Strand cDNA Synthesis Kit. Then the target genes were quantified according to their specific primer sequences via Bio-Rad RT-PCR System using ChamQ Universal SYBR qPCR Master Mix. GAPDH acted as an internal reference.The primer sequences as bellow: GAPDH, Forward: GGAGCGAGATCCCTCCAAAAT; Reverse: GGCTGTTGTCATACTTCTCATGG. EGFR, Forward: CCCACTCATGCTCTACAACCC; Reverse: TCGCACTTCTTACACTTGCGG. Western blot Total proteins were extracted from cells using RIPA Lysis buffer and the concentration was measured using BCA method. The equal amount of protein (40 µg) was loaded and separated by SDS-polyacrylamide gel electrophoresis. After electrophoresis, the protein were transferred to PVDF membrane. Then, the membrane was blocked using defatted milk for 2 h. Subsequently, the specific primary antibody was added into a box to incubate with the membrane at 4℃ overnight. Then the membrane was washed with TBST and incubated with the secondary antibody at room temperature for 2 h. After washing with TBST, the protein band were evaluated and visualized using ECL reagents via Bio-Rad System. Xenograft tumor-formation assay and treatment Ten female BALB/c mude mice (13-15g) with 6 weeks of age were purchased from Huafukang Biotechnology Co., Ltd (China). SW1990 cells were prepared into cell suspension with germfree PBS. Approximately 200 PBS suspension containing 5 × 10 6 cells was injected subcutaneously into the armpit of mice. After one week of inoculation, mice were randomly divided into two groups, one for 6-P treatment (n = 5), another for equal volume saline treatment (n = 5). Intragastrically administered 6-P (20mg/kg) or saline every day and the tumor volumes were measured by caliper every week. After feeding for 5 weeks, mice were sacrificed and tumors were stripped out. The wight of stripped tumors was measured using a electronic balance. Subsequently, the tumors were made into wax blocks for immunohistochemical analysis. Statistical analysis All data were expressed as mean ± standard deviation. SPSS 21.0 statistical software and Graphpad prism 8.0 were used to analyze data. Statistical significance was analyzed using the Student’s t test, one-way analysis of variance (ANOVA). Statistical significance was considered at a P value less than 0.05. Results Inhibition of 6-P on proliferation of pancreatic cancer cells The chemical structure of 6-P and its derivatives 6-G and 6-S was displayed in Fig. 1. To investigate the effect of 6-P on proliferation of pancreatic cancer, pancreatic cancer cell lines MIA PaCa-2 and SW1990 were were treated with different concentrations of 6-P for 48 h (0, 20, 40, 80µM) or the same concentration of 6-P for different time frames (0, 24, 48, 72 h). First, CCK-8 assay was performed to evaluate the effect of 6-P on pancreatic cancer cell viability. The results suggested that cell viability significantly decreased with increasing 6-P concentration in MIA PaCa-2 and SW1990 (Fig. 2A,B). In addition, cell colony formation assay indicated the same results that the number of cell colonies was obviously inhibited by culturing with different concentrations of 6-P and the 80µM concentration showed a highest inhibited effect on cell colonies (Fig. 2C,D). To further evaluate the cytotoxicity and anti-poliferation of 6-P, we used a phase contrast microscope to observe and capture the morphological changes of pancreatic cancer MIA PaCa-2 and SW1990 treated with 6-P. The results covered that 6-P caused adherent pancreatic cells to become round, shrink, wiredrawing and separate from the bottom of the culture plates, indicating a significant apoptosis state, especially in concentration of 80µM or treating with 72 h (Fig. 2E,F). Inhibition of 6-P on migration and invasion of pancreatic cancer cells To further validate whether 6-P had the inhibition effect on migration and invasion of MIA PaCa-2 and SW1990, transwell assay and wound healing assay were performed to evaluate to migrate and invasive ability. The migration and invasion significantly decreased in the concentration of 40 and 80µM compared with 0µM, revealing that 6-P could also partly suppress the metastasis of pancreatic cancer cells (Fig. 3A-G). In addition, we tested the epithelial-mesenchymal transition (EMT) using western blot assay to detect the protein levels of E-cadherin, N-cadherin and Vimentin. The results demonstrated that the expression of E-cadherin gradually rose with the increasing concentration of 6-P. Conversely, the expression of N-cadherin and Vimentin gradually reduced with the increasing concentration of 6-P (Fig. 3H,I). The results suggested a inhibited function of 6-P on EMT of pancreatic cancer cells. 6-P interacts with EGFR to exert suppression functions on proliferation and metastasis of pancreatic cancer cells In order to explore the potential binding target of 6-P, bioinformatics methods were performed to predict the underlying protein site. First, we downloaded the 3-dimensional structure file of the compound 6-P from PubChem Compound Search database ( https://pubchem.ncbi.nlm.nih.gov/ ). Then, we transeferred the data to SwissTargerPrediction software for predictive analysis and obtained the target protein of the compound 6-P. Subsequently, KEGG pathway enrichment analysis was performed to figure out the involved signaling pathway of these underlying target protein by DAVID database ( https://david.ncifcrf.gov/ ). Finally, We set the standard for judging significant enrichment of pathways with a P value less than 0.05, and the top 12 signal pathways with enrichment number were visualized using R language with clusterProfilerKEGG package. The results of KEGG pathway enrichment analysis indicated that 6-P was significantly correlated with PI3K-AKT signaling pathway and epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor resistance (Fig. 4A). Interestingly, molecular docking analysis with 6-P on the 3-dimensional structure of EGFR suggested there was an interaction between 6-P and EGFR (Fig. 4B). Combined with KEGG results, we hypothesized that 6-P might occupy key sites of EGFR molecular structure to exert biological regulation functions. Subsequently, western blot assay was performed to detect EGFR expression of pancreatic cancer cells treated with 6-P. The results confirmed that 6-P could decrease expression of EGFR and the inhibition of 6-P on EGFR expression could be partly rescued with supplementary EGFR (Fig. 4C,D). In addition, we further evaluated the proliferation and metastasis of pancreatic cancer cells treated with 6-P after adding EGFR plasmid to upregulate EGFR expression. The results suggested that the cell proliferation, migration and invasion could also be partly rescued with supplementary EGFR (Fig. 4E-G). And western blot results revealed upregulation of EGFR could reverse 6-P mediated-inhibition of EMT process (Fig. 4H,I). 6-P-mediated ubiquitination degradation of EGFR leads to inactivate PI3K/AKT signaling pathway To further investigate the underlying molecular mechanism of 6-P on EGFR, we firstly evaluated the mRNA expression levels of EGFR in pancreatic cancer cells treated with 6-P. The results indicated that there were no significant difference in MIA PaCa-2 or SW1990 cells (Fig. 5A). However, our data suggested 6-P downregulated the protein expression of EGFR. To figure out the reason why 6-P changed the protein expression, not the mRNA expression, 293T cells were treated with CHX and 6-P for 1 h, 2h to evaluate the protein stability. The results demonstrated that the de novo synthesis of EGFR in 6-P treatment group reduced more rapidly compared to 6-P non-treatment group, suggesting 6-P decreased the protein stability of EGFR (Fig. 5B,C). Subsequently, we suspected that downregulated EGFR protein expression is the result of 6-P-involved a proteasome-dependent degradation mechanism. To validate the suspicion, a proteasome inhibitor, MG-132 (5 µM), was used to evaluate whether 6-P was involved in EGFR degradation by proteasome-dependent route. The results confirmed that MG132 inhibited EGFR degradation (Fig. 5D). Then HA-labeled ubiquitin and Flag-labeled EGFR plasmids were co-transferred into the 293T cells and 6-P was added to treat the cells. Co-immunoprecipitation and SDS-gel electrophoresis were performed to evaluate the levels of EGFR ubiquitination. Interestingly, the treatment of 6-P significantly enhanced EGFR ubiquitination, indicating 6-P promoted proteasome-dependent degradation of EGFR via ubiquitin modification pathway (Fig. 5E). Subsequently, we detected the PI3K/AKT signaling pathway which was one of downstream pathways of EGFR to further validate the results of KEGG pathway enrichment analysis. The results suggested that EGFR could activate PI3K/AKT while the activity of PI3K/AKT signaling could be reversed by treating with 6-P, indicating 6-P negatively activate PI3K/AKT signaling pathway (Fig. 5F,G). Immunofluorescence staining was used to analysis the expression and localization of p-AKT .MIA PaCa-2 and SW1990 cells treated with 6-Paradol showed a obvious decrease of p-AKT in comparison with the NC groups(Fig. 5H). EGFR inhibitor enhanced 6-P mediated-inhibition effect on PI3K/AKT signaling activity To further confirm that 6-P mediated-EGFR degradation was involved in inhibition effect on PI3K/AKT signaling, we respectively used EGFR overexpression plasmid and (or) EGFR inhibitor Erlotinib (2nM) to regulate EGFR expression. The results verified that Erlotinib promoted 6-P mediated degradation of EGFR and inactivity of PI3K/AKT signaling, however, upregulation of EGFR expression could rescue the activity of PI3K/AKT signaling and the expression of EGFR (Fig. 6A,B). Subsequently, gain- or lose-functional experiments were performed to evaluate the interaction between 6-P and EGFR on proliferation and metastasis of pancreatic cancer cells. The results revealed Erlotinib and 6-P had synergistic effects to exert inhibition on proliferation and metastasis of pancreatic cancer cells, which could be rescued by upregulation of EGFR expression (Fig. 6C-F). Meanwhile, Erlotinib combined with 6-P significantly inhibited EMT process and overexpressed EGFR removed the inhibitory effect on EMT process (Fig. 6G,H). 6-P significantly suppressed tumor growth in vivo To explore whether 6-P suppressed tumor growth in vivo, we constructed a subcutaneous tumorigenesis model in nude mice which was intraperitoneally injected with 6-P (20mg/kg/d). The results suggested the size of tumor was obviously smaller in 6-P treatment group compared with control groups, indicating a inhibitory function of 6-P on tumor growth (Fig. 7A). The tumor volume was smaller in 6-P treatment groups and the tumor weight was also lighter in 6-P treatment groups (Fig. 7B,C). Subsequently, IHC analysis was performed to detect relative expression of Ki67, PCNA, N-cadherin, E-cadherin, Vimentin, EGFR, phosphorylated-AKT and phosphorylated-PI3K. The results demonstrated E-cadherin expression was upregulated in 6-P treatment group and the rest of indexes were all downregulated, which were consistent with our previous in vitro (Fig. 7D,E). Discussion The EGFR, a transmembrane protein receptor and an important member of tyrosine kinase receptors, is commonly elevated in cancers, engaging multiple malignant functions such as aberrant activation of signaling, uncontrolled cell proliferation, vascular invasion and metastasis of the tumors.[ 16 ] Accumulating evidence indicates that EGFR expression is significantly correlated with pancreatic cancer, high expression of EGFR frequently suggests a poor prognosis.[ 17 ] Although many EGFR antibodies and inhibitors, including cetuximab, afatinib, osimertinib, erlotinib and gefitinib, have been applied to cancer treatment. However, the anticancer efficacy of them have negligible effects on patients with pancreatic cancer, especially in KRAS mutant pancreatic ductal adenocarcinoma.[ 18 ] Therefore, it’s urgent to carry out new drugs or novel combination therapy regimens to control pancreatic cancer process. Recently, chemoprevention substances naturally existing in diets and medicinal plants have attracted widespread attentions.[ 19 ] 6-P, a phenolic compound in the rhizome of ginger, was reported that 6-P had potent anti-inflammatory activity, which exerted huge anticancer functions.[ 20 ] Previous study suggested 6-P and its derivative 6-G had the ability to reduce the viability of HL-60 cell and induce cell apoptosis.[ 15 ] By decreasing STAT3 and inactivating NF-κB signaling, 6-P significantly reduced survival of prostate cancer cells.[ 21 ] In addition, 6-P could induce cell apoptosis in oral squamous carcinoma in a dose-dependent manner.[ 8 ] In our data, we first proposed that 6-P might be correlated with pancreatic cancer. Subsequently, we constructed tumor proliferation and metastasis model in vitro and in vivo, attempting to uncover the underlying molecular mechanism how 6-P affected pancreatic cancer procession. First, we evaluated the effect of 6-P on proliferation and metastasis of pancreatic cancer cells in different concentrations or in a same concentration for different application time. The results suggested 6-P inhibited pancreatic cancer cell proliferation and metastasis both in a time-dependent manner and a dose-dependent manner. Furthermore, tumor growth was obviously inhibited with 6-P treatment in vivo. Then, we discovered 6-P could reducing the protein expression of EGFR while did not change the mRNA expression of EGFR, suggesting 6-P had less effect at the transcriptional level of EGFR. Therefore, we further explored whether 6-P promoted EGFR degradation via proteasome-dependent degradation. The results suggested 6-P mediated post-translational modifications of EGFR via promoting EGFR ubiquitination, resulting in EGFR degradation. Additionally, we found 6-P reduced the activity of PI3K/AKT signaling via downregulation of EGFR, leading to decreasing abilities of cell proliferation and metastasis. Ubiquitination plays an important role in protein localization, metabolism, function, regulation and degradation.[ 22 ] At the same time, it is also involved in the regulation of cell cycle, proliferation, apoptosis, differentiation, metastasis, gene expression, transcriptional regulation, signal transduction, injury repair, inflammation and immunity, and almost all life activities.[ 23 ] Zhang et al found Ginsenoside compound K inhibited the proliferation of liver cancer via promoting the degradation of HIF-1α ubiquitination.[ 24 ] Liu et al suggested that Honokiol had an anticancer function via directly interacting with keratin 18 protein in melanoma cells. The interaction between keratin 18 and Honokiol led to the degradation of keratin 18 by ubiquitination.[ 25 ] Another compound from ginger, 6-G, was also related with ubiquitination. The study indicated 6-G decreased the expression of USP14, which was a ubiquitin-specific peptidase mainly exerting inhibitory effect on ubiquitnation. Decreasing USP14 elevated the autophagosomes and reduced the survival of lung cancer cell.[ 26 ] In our data, 6-P mediated EGFR degradation though enhancing EGFR ubiquitination, resulting in inactivity of PI3K/AKT signaling. Numerous investigations suggest hyperactivity PI3K/AKT signaling is associated with malignant phenotype of cancer and can accelerate cancer procession.[ 27 ] Totiger et al found Urolithin A exerted anticancer effect in pancreatic cancer via downregulating phosphorylation of AKT.[ 28 ] Additionally, Amcp, one novel derivative of valepotriate significantly inhibited the PI3K/AKT signaling, suppressing the cell viability and Mcl-1 expression in pancreatic cancer cells.[ 29 ] In this study, we confirmed 6-P negatively regulated activity of PI3K/AKT signaling via decreasing EGFR. In conclusion, our data demonstrate that 6-P exerts anticancer effect though suppressing pancreatic cancer cell growth, viability, invasion and migration. Mechanistically, the inhibitory effect of 6-P mainly based on decreasing the expression of EGFR and inactivity of PI3K/AKT signaling via ubiquitination degradation of EGFR(Fig. 8). Therefore, 6-P might become a supplementary durgs for pancreatic cancer treatment. Declarations Acknowledgments Our research group is very grateful to the Tongji Hospital affiliated to Huazhong University of Science and Technology for providing an experimental platform for us to carry out the experiment smoothly. Authors ′ contributions Jianxin Jiang designed the study. Xueyi Jiang and Peng Chen performed experimental studies.Jie Wang wrote the manuscript.Zhiwei He and Xinyuan Liu prepared, edited and reviewed the manuscript.Jian Xu and Yankun Chen gave comments and reviewed the manuscript. All authors read and approved the final manuscript. Funding The study was supported by The National Natural Science Foundation of China (No. 81871965） Availability of data and materials All data generated and analysed during this study are included in this published article are available on request. Ethics approval and consent to participate This study was approved by the Ethics Committee of Renmin Hospital of Wuhan University. The animal experiments were approved by the Animal Research Ethics Committees at Renmin Hospital of Wuhan University. Consent for publication All authors have declared that they agree publication. Competing interests The authors declare that they have no fnancial conficts of interest. References Miller KD , Nogueira L , Mariotto AB , Rowland JH , Yabroff KR , Alfano CM , Jemal A , Kramer JL , Siegel RL : Cancer treatment and survivorship statistics , 2019 . CA Cancer J Clin 2019 , 69 ( 5 ): 363–385 . Zhu H , Li T , Du Y , Li M : Pancreatic cancer : challenges and opportunities . BMC MED 2018 , 16 ( 1 ): 214 . Kenkel JA , Tseng WW , Davidson MG , Tolentino LL , Choi O , Bhattacharya N , Seeley ES , Winer DA , Reticker-Flynn NE , Engleman EG : An Immunosuppressive Dendritic Cell Subset Accumulates at Secondary Sites and Promotes Metastasis in Pancreatic Cancer . CANCER RES 2017 , 77 ( 15 ): 4158–4170 . Ke W , Zhao X , Lu Z : Foeniculum vulgare seed extract induces apoptosis in lung cancer cells partly through the down-regulation of Bcl-2 . BIOMED PHARMACOTHER 2021 , 135 : 111213 . Yang LQ , Yu SP , Yang YT , Zhao YS , Wang FY , Chen Y , Li QH , Tian P , Zhu YY , Zhang JG et al: Muscone derivative ZM-32 inhibits breast tumor angiogenesis by suppressing HuR-mediated VEGF and MMP9 expression . BIOMED PHARMACOTHER 2021 , 136 : 111265 . Li J , Yan L , Luo J , Tong L , Gao Y , Feng W , Wang F , Cui W , Li S , Sun Z : Baicalein suppresses growth of non-small cell lung carcinoma by targeting MAP4K3 . BIOMED PHARMACOTHER 2021 , 133 : 110965 . Shukla Y , Singh M : Cancer preventive properties of ginger : a brief review . FOOD CHEM TOXICOL 2007 , 45 ( 5 ): 683–690 . Keum YS , Kim J , Lee KH , Park KK , Surh YJ , Lee JM , Lee SS , Yoon JH , Joo SY , Cha IH et al: Induction of apoptosis and caspase-3 activation by chemopreventive [6]-paradol and structurally related compounds in KB cells . CANCER LETT 2002 , 177 ( 1 ): 41–47 . Pournaderi PS , Yaghmaei P , Khodaei H , Noormohammadi Z , Hejazi SH : The effects of 6-Gingerol on reproductive improvement , liver functioning and Cyclooxygenase-2 gene expression in estradiol valerate - Induced polycystic ovary syndrome in Wistar rats . Biochem Biophys Res Commun 2017 , 484 ( 2 ): 461–466 . Baliga MS , Haniadka R , Pereira MM , D'Souza JJ , Pallaty PL , Bhat HP , Popuri S : Update on the chemopreventive effects of ginger and its phytochemicals . Crit Rev Food Sci Nutr 2011 , 51 ( 6 ): 499–523 . Bernard MM , McConnery JR , Hoskin DW : [10]-Gingerol , a major phenolic constituent of ginger root , induces cell cycle arrest and apoptosis in triple-negative breast cancer cells . EXP MOL PATHOL 2017 , 102 ( 2 ): 370–376 . Kim MO , Lee MH , Oi N , Kim SH , Bae KB , Huang Z , Kim DJ , Reddy K , Lee SY , Park SJ et al: [6]-shogaol inhibits growth and induces apoptosis of non-small cell lung cancer cells by directly regulating Akt1/2. CARCINOGENESIS 2014 , 35(3):683–691. Farombi EO , Ajayi BO , Adedara IA : 6-Gingerol delays tumorigenesis in benzo[a]pyrene and dextran sulphate sodium-induced colorectal cancer in mice . FOOD CHEM TOXICOL 2020 , 142 : 111483 . Mariadoss AV , Kathiresan S , Muthusamy R , Kathiresan S : Protective effects of [6]-paradol on histological lesions and immunohistochemical gene expression in DMBA induced hamster buccal pouch carcinogenesis . Asian Pac J Cancer Prev 2013 , 14 ( 5 ): 3123–3129 . Lee E , Surh YJ : Induction of apoptosis in HL-60 cells by pungent vanilloids , [6]-gingerol and [6]-paradol . CANCER LETT 1998 , 134 ( 2 ): 163–168 . Hong SY , Kao YR , Lee TC , Wu CW : Upregulation of E3 Ubiquitin Ligase CBLC Enhances EGFR Dysregulation and Signaling in Lung Adenocarcinoma . CANCER RES 2018 , 78 ( 17 ): 4984–4996 . Assi M , Achouri Y , Loriot A , Dauguet N , Dahou H , Baldan J , Libert M , Fain JS , Guerra C , Bouwens L et al: Dynamic regulation of expression of KRAS and its effectors determines the ability to initiate tumorigenesis in pancreatic acinar cells . CANCER RES 2021 . Kim D , Lee S , Na K : Immune Stimulating Antibody-Photosensitizer Conjugates via Fc-Mediated Dendritic Cell Phagocytosis and Phototriggered Immunogenic Cell Death for KRAS-Mutated Pancreatic Cancer Treatment . SMALL 2021 : e2006650 . Hermawan A , Putri H , Utomo RY : Functional network analysis reveals potential repurposing of beta-blocker atenolol for pancreatic cancer therapy . DARU 2020 , 28 ( 2 ): 685–699 . Chung WY , Jung YJ , Surh YJ , Lee SS , Park KK : Antioxidative and antitumor promoting effects of [6]-paradol and its homologs . Mutat Res 2001 , 496 ( 1–2 ): 199–206 . Saha A , Blando J , Silver E , Beltran L , Sessler J , DiGiovanni J : 6-Shogaol from dried ginger inhibits growth of prostate cancer cells both in vitro and in vivo through inhibition of STAT3 and NF-kappaB signaling . Cancer Prev Res (Phila) 2014 , 7 ( 6 ): 627–638 . Hundley FV , Sanvisens DN , Marin HC , Carr KL , Tian R , Toczyski DP : A comprehensive phenotypic CRISPR-Cas9 screen of the ubiquitin pathway uncovers roles of ubiquitin ligases in mitosis . MOL CELL 2021 . Wu K , Huynh KQ , Lu I , Moustakim M , Miao H , Yu C , Haeusgen MJ , Hopkins BD , Huang L , Zheng N et al: Inhibitors of cullin-RING E3 ubiquitin ligase 4 with antitumor potential . Proc Natl Acad Sci U S A 2021 , 118 ( 8 ). Zhang S , Zhang M , Chen J , Zhao J , Su J , Zhang X : Ginsenoside Compound K Regulates HIF-1alpha-Mediated Glycolysis Through Bclaf1 to Inhibit the Proliferation of Human Liver Cancer Cells . FRONT PHARMACOL 2020 , 11 : 583334 . Liu T , Liu H , Wang P , Hu Y , Yang R , Liu F , Kim HG , Dong Z , Liu K : Honokiol Inhibits Melanoma Growth by Targeting Keratin 18 in vitro and in vivo . Front Cell Dev Biol 2020 , 8 : 603472 . Tsai Y , Xia C , Sun Z : The Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro . FRONT PHARMACOL 2020 , 11 : 598555 . Tambe Y , Terado T , Kim CJ , Mukaisho KI , Yoshida S , Sugihara H , Tanaka H , Chida J , Kido H , Yamaji K et al: Antitumor activity of potent pyruvate dehydrogenase kinase 4 inhibitors from plants in pancreatic cancer . Mol Carcinog 2019 , 58 ( 10 ): 1726–1737 . Totiger TM , Srinivasan S , Jala VR , Lamichhane P , Dosch AR , Gaidarski AR , Joshi C , Rangappa S , Castellanos J , Vemula PK et al: Urolithin A , a Novel Natural Compound to Target PI3K/AKT/mTOR Pathway in Pancreatic Cancer . MOL CANCER THER 2019 , 18 ( 2 ): 301–311 . Yan YY , Shi KY , Teng F , Chen J , Che JX , Dong XW , Lin NM , Zhang B : A novel derivative of valepotriate inhibits the PI3K/AKT pathway and causes Noxa-dependent apoptosis in human pancreatic cancer cells . ACTA PHARMACOL SIN 2020 , 41 ( 6 ): 835–842 . Cite Share Download PDF Status: Published Journal Publication published 10 Aug, 2021 Read the published version in Cancer Cell International → Version 1 posted Editorial decision: Revise Before Review 13 May, 2021 Editor assigned by journal 12 May, 2021 Submission checks completed at journal 11 May, 2021 Editor invited by journal 11 May, 2021 First submitted to journal 08 May, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-506985\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Primary research\",\"associatedPublications\":[],\"authors\":[{\"id\":26890264,\"identity\":\"daeb5f36-6840-449a-bf3c-bf6f35490ae2\",\"order_by\":0,\"name\":\"Xueyi Jiang\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-5429-1865\",\"institution\":\"Wuhan University Renmin Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xueyi\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"},{\"id\":26890265,\"identity\":\"8e27ac61-2fa4-4541-9f41-42806618b191\",\"order_by\":1,\"name\":\"Jie Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wuhan University Renmin Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jie\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":26890266,\"identity\":\"21ecdd22-cef0-4b0f-b010-41b186cef3ac\",\"order_by\":2,\"name\":\"Peng Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Guizhou Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Peng\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":26890267,\"identity\":\"8c5efb71-d1a4-420e-86d2-23632598336e\",\"order_by\":3,\"name\":\"Zhiwei He\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Guizhou Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhiwei\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":26890268,\"identity\":\"19fb3031-ce2a-431b-8022-4c0d27bc7880\",\"order_by\":4,\"name\":\"Jian Xu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Renmin Hospital of Wuhan University: Wuhan University Renmin Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jian\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":26890269,\"identity\":\"aefe9471-3c76-44af-b6f9-875a79d16305\",\"order_by\":5,\"name\":\"Yankun Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Guizhou Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yankun\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":26890270,\"identity\":\"08b2ed0a-4cb8-442a-bd10-3e418541f197\",\"order_by\":6,\"name\":\"Xinyuan Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Guizhou Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xinyuan\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":26890271,\"identity\":\"fc52d2dc-1151-4985-81a8-c58ae59b57d4\",\"order_by\":7,\"name\":\"Jianxin Jiang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYFACxoYDHyr+y/Ez8IB4zMRoYT74cMYZZmPJBuK1sCUb87YxJ244QKwW82lnzCR429gSN9/IPSbBUGGd2MB+9gBeLTK3c8wkJM7xGG+7kZcmwXAmPbGBJy8BrxYJaaAWgzIJ2W0gvYxthxMbJHgMCGtJYDNg3DwbpOUfUVrSkg0OtCUobgDpZWwgSkvywYcNZw4YS9x/Y2yRcCzduI0nh5CWxIbDfyoOyPH3nDG88aHGWraf/Qx+LaggAYjZSFA/CkbBKBgFowAHAAB+wEQJ1QTRjAAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0001-7939-9082\",\"institution\":\"Wuhan University Renmin Hospital\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianxin\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-05-08 19:56:18\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-506985/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-506985/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12935-021-02118-0\",\"type\":\"published\",\"date\":\"2021-08-10T15:02:26+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":9344818,\"identity\":\"f4bb2c78-d07d-4ace-b729-b339b1f8e41d\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:13:30\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":33867,\"visible\":true,\"origin\":\"\",\"legend\":\"To investigate the effect of 6-P on proliferation of pancreatic cancer, pancreatic cancer cell lines MIA PaCa-2 and SW1990 were were treated with different concentrations of 6-P for 48 h (0, 20, 40, 80μM) or the same concentration of 6-P for different time frames (0, 24, 48, 72 h). First, CCK-8 assay was performed to evaluate the effect of 6-P on pancreatic cancer cell viability. The results suggested that cell viability significantly decreased with increasing 6-P concentration in MIA PaCa-2 and SW1990\",\"description\":\"\",\"filename\":\"OnlineF1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/a6d996a4718e2c980e7bc300.png\"},{\"id\":9345232,\"identity\":\"b048e820-af09-4db2-a5f8-7db1f1da8407\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:16:30\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":657203,\"visible\":true,\"origin\":\"\",\"legend\":\"In addition, cell colony formation assay indicated the same results that the number of cell colonies was obviously inhibited by culturing with different concentrations of 6-P and the 80μM concentration showed a highest inhibited effect on cell colonies. To further evaluate the cytotoxicity and anti-poliferation of 6-P, we used a phase contrast microscope to observe and capture the morphological changes of pancreatic cancer MIA PaCa-2 and SW1990 treated with 6-P. The results covered that 6-P caused adherent pancreatic cells to become round, shrink, wiredrawing and separate from the bottom of the culture plates, indicating a significant apoptosis state, especially in concentration of 80μM or treating with 72 h \",\"description\":\"\",\"filename\":\"OnlineF2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/603e8a123bf70e74e5f9a9ae.png\"},{\"id\":9344814,\"identity\":\"870b5088-452b-4370-b4c5-00192abea446\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:13:30\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":521558,\"visible\":true,\"origin\":\"\",\"legend\":\"To further validate whether 6-P had the inhibition effect on migration and invasion of MIA PaCa-2 and SW1990, transwell assay and wound healing assay were performed to evaluate to migrate and invasive ability. The migration and invasion significantly decreased in the concentration of 40 and 80μM compared with 0μM, revealing that 6-P could also partly suppress the metastasis of pancreatic cancer cells \",\"description\":\"\",\"filename\":\"OnlineF3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/db31ef6dbd620c318a2a720e.png\"},{\"id\":9345234,\"identity\":\"75d1de9e-7462-4ab5-b393-a5c52d86eb59\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:16:30\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":400724,\"visible\":true,\"origin\":\"\",\"legend\":\"The results of KEGG pathway enrichment analysis indicated that 6-P was significantly correlated with PI3K-AKT signaling pathway and epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor resistance \",\"description\":\"\",\"filename\":\"OnlineF4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/1b892e85d2dc250b07feee03.png\"},{\"id\":9344811,\"identity\":\"afb60ac0-4c05-4971-9d51-60282a074581\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:13:30\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":200578,\"visible\":true,\"origin\":\"\",\"legend\":\"To further investigate the underlying molecular mechanism of 6-P on EGFR, we firstly evaluated the mRNA expression levels of EGFR in pancreatic cancer cells treated with 6-P. The results indicated that there were no significant difference in MIA PaCa-2 or SW1990 cells\",\"description\":\"\",\"filename\":\"OnlineF5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/7244b430dbf7a907e33a3f4b.png\"},{\"id\":9345556,\"identity\":\"cbe4db7d-1dbf-41cd-a104-2a0cf0c0a179\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:19:30\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":433155,\"visible\":true,\"origin\":\"\",\"legend\":\"To further confirm that 6-P mediated-EGFR degradation was involved in inhibition effect on PI3K/AKT signaling, we respectively used EGFR overexpression plasmid and (or) EGFR inhibitor Erlotinib (2nM) to regulate EGFR expression. The results verified that Erlotinib promoted 6-P mediated degradation of EGFR and inactivity of PI3K/AKT signaling, however, upregulation of EGFR expression could rescue the activity of PI3K/AKT signaling and the expression of EGFR \",\"description\":\"\",\"filename\":\"OnlineF6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/5a3f47f8709a630ed0f87aba.png\"},{\"id\":9345559,\"identity\":\"19f49b20-d9aa-4581-9e33-da4b659c479d\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:19:30\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":902140,\"visible\":true,\"origin\":\"\",\"legend\":\"The results suggested the size of tumor was obviously smaller in 6-P treatment group compared with control groups, indicating a inhibitory function of 6-P on tumor growth \",\"description\":\"\",\"filename\":\"OnlineF7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/c468a9cdf2a26621a0da31f3.png\"},{\"id\":9345236,\"identity\":\"076dc5a3-92fe-4596-8323-3afe68f2975f\",\"added_by\":\"auto\",\"created_at\":\"2021-05-19 15:16:30\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":36829,\"visible\":true,\"origin\":\"\",\"legend\":\"In conclusion, our data demonstrate that 6-P exerts anticancer effect though suppressing pancreatic cancer cell growth, viability, invasion and migration. Mechanistically, the inhibitory effect of 6-P mainly based on decreasing the expression of EGFR and inactivity of PI3K/AKT signaling via ubiquitination degradation of EGFR\",\"description\":\"\",\"filename\":\"OnlineF8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/972ed8fa922d296669c5191d.png\"},{\"id\":13693773,\"identity\":\"2b1fcc5c-c039-47db-83ce-8fb11ec2b43c\",\"added_by\":\"auto\",\"created_at\":\"2021-09-17 12:49:45\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3805534,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-506985/v1/d7a283a1-b768-430d-8a66-1410ef86db7c.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"\\u003cp\\u003e[6]-Paradol Suppresses Proliferation and Metastases of Pancreatic Cancer by Decreasing EGFR and Inactivating PI3K/AKT Signaling\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\" \\u003cp\\u003ePancreatic cancer is the third highest in cancer-related deaths in the US and has one of the lowest 5-year survival rates (less than 10%), carrying an extremely poor survival conditions in digestive malignant cancer.[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e] Although the laparoscopic pancreaticoduodenectomy is widely used in pancreatic surgery for reducing the recovery time and the modern chemotherapeutic regimens significantly improve the prognosis, the recurrence rate is still high and the available treatment options are limited, resulting in unsatisfied clinical outcomes.[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e] Surgical resection offers the maximize opportunities for curing the pancreatic cancer, however, most of patients lose their surgical chances due to insidious onset and rapid progression in early stage.[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e] Chemotherapy and radiotherapy are main supplemental therapeutic strategy in the advanced stage. The first-line chemotherapy gemcitabine combining with other chemotherapeutic agents, including albumin-bound paclitaxel or cisplatin, are often used to treat patients with pancreatic cancer. However, patients commonly develop drug resistance and metastasis in the later stage, resulting in treatment failure. Therefore, it is particularly necessary to develop new therapeutic regimens, including chemotherapy, radiotherapy, bio-targeted drugs and traditional Chinese medicine.\\u003c/p\\u003e \\u003cp\\u003eIn recent years, great progress has been made in the anti-tumor research of natural compounds and their derivatives. Ke et al. reported that the extracts of foeniculum vulgare seed could promote lung cancer cells apoptosis by suppressing the Bcl-2 expression.[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e] ZM-32, one of muscone derivative, had been proved that exerted an inhibition function in breast tumor angiogenesis through effectively blocking the interaction between HuR and VEGF.[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e] A typical flavonoid compound, baicalein, extracted from the root of Scutellaria baicalensis, inhibited lung cancer cell proliferation via inducing degradation of MAP4K3. The underlying molecular mechanism was that baicalensis could directly interact with MAP4K3 and decrease its protein stability and promote its ubiquitination modification.[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/p\\u003e \\u003cp\\u003eGinger (Zingiber officinale) is one of the most natural dietary ingredient, containing several pungent constituents, including ginerols, paradols, shogaols and gingerdiols.[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e] In addition to being widely used as a flavoring ingredient, ginger roots are also applied in traditional Eastern herbal remedies for symptoms such as the common cold, digestive ailments, rheumatism, neuralgia, colic and motion sickness.[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e] Recent researches indicate that the extracts of ginger exert multiple biologic functions such as anti-melanogenesis, anticancer, antioxidant and anti-inflammatory properties.[\\u003cspan additionalcitationids=\\\"CR10\\\" citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e] Previous study suggested that [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]-Shogaol (6-S) suppressed lung cancer cells proliferation through inhibiting the activity of AKT kinase and inducing cell cylce arrest at G1 or G2/M phase.[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e] Another extract [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]-Gingerol (6-G) was reported to possess anti-proliferative and angiogenesis in colorectal cancer by decreasing the concnetration of VEGF.[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e] Mariadoss et al. demonstrated that [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]-Paradol (6-P) effectively prevented mouse skin carcinogenesis process.[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e] Additionally, the viability and proliferation of human promyelocytic leukemia could be inhibited by 6-P mediated cytotoxic activity.[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/p\\u003e \\u003cp\\u003eIn this study, we identified a ingredient of ginger, 6-P, as a potential candidate for the anti-tumor compound and therapy of pancreatic cancer. We discovered that 6-P exerted anti-pancreatic cancer activity by decreasing the expression of EGFR and inhibiting the activity of AKT signaling. Our data indicated that 6-P might become one of the supplemental therapeutic strategies for pancreatic cancer.\\u003c/p\\u003e \"},{\"header\":\"Materials And Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eExperimental drugs, reagents and antibodies\\u003c/h2\\u003e\\n\\u003cp\\u003eP (No. HY-14617), MG-132 (No.HY-13259) and erlotinib (No. HY-50896) were purchased from the MedChemExpress (MCE, USA). Cycloheximide (CHX, No. 66-81-9) were purchased from the Merck (USA). The Primer sequences, including EGFR, GAPDH were purchased from Ribobio (China). Flag-labeled EGFR overexpressed plasmid and HA-labeled ubiquitin plasmid were constructed and extracted from Genechem (China). Dulbecco's modified eagle medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (USA). Cell counting kit-8 (CCK-8) was purchased from Dojindo (Japan). Matrigel was purchased from BD Biosciences (USA). PCR Reagents used include TRIzol (Invitrogen, USA), HiScript\\u0026reg; III 1st Strand cDNA Synthesis Kit (+\\u0026thinsp;gDNA wiper) (Vazyme, China), ChamQ Universal SYBR qPCR Master Mix (Vazyme), Lipofectamine 3000 (ThermoFisher, USA). Western blot Reagents used include BCA protein assay kit (Boster, China); enhanced chemiluminescent Kit (ABclonal Technology, China) Antibodies used include EGFR, AKT, PI3K, GAPDH rabbit antibody (Proteintech, China); p-AKT, p-PI3K rabbit antibody (CST, USA). HRP-labeled goat anti-rabbit IgG (Boster, China).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eCell culture and transfection\\u003c/h2\\u003e\\n\\u003cp\\u003eHuman pancreatic cancer cell lines MIA PaCa-2 and SW1990 were purchased from American Type Culture Collection. The two pancreatic cancer cells were cultured in DMEM with supplementary 10% FBS. The plasmids were respectively transferred into adherd pancreatic cancer cells with Lipofectamine 3000 Transfection Reagent. After 6 h of incubation, wash with PBS and change the medium. The transfected effectiveness was evaluated by PCR analysis.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section3\\\"\\u003e\\n\\u003ch2\\u003eCCK-8\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eCell viability was measured using CCK-8, and approximate 2 \\u0026times; 10\\u003csup\\u003e2\\u003c/sup\\u003e MIA PaCa-2 and SW1990 cells were respectively seeded into 96-well plates. Different concentrations of 6-P were prepared in advance, including 0 \\u0026micro;M, 20 \\u0026micro;M, 40 \\u0026micro;M, 80 \\u0026micro;M, and respectively added into 96-well plates. After regular time points (0 h, 24 h, 48 h, 72h) of incubation, 10 \\u0026micro;l CCK-8 solution was respectively added into 96-well plates for another 3 h. Then, the absorbance at 450 nm was identified to evaluate the relative cell proliferation by a microplate reader.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003ePlate colony formation\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe ability of pancreatic cancer cells on colony formation was measured using plate colony formation assay. Approximate 1 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e MIA PaCa-2 and SW1990 cells were respectively seeded into 6-well plates. Different concentrations of 6-P were prepared in advance, including 0 \\u0026micro;M, 20 \\u0026micro;M, 40 \\u0026micro;M, 80 \\u0026micro;M, and respectively added into 6-well plates for 7 days co-incubation. Then the 6-well plates needed be washed with PBS, fixed with 4% paraformaldehyde, stained with 1% crystal violet. Lastly, the stained 6-well plates were imaged and recorded with an HD Camera.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eWound healing assay\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe migrated ability of pancreatic cancer cells was measured by wound healing assay. Approximate 5 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e MIA PaCa-2 and SW1990 cells were respectively seeded into 6-well plates until cells covered with the whole plates. Using 200 \\u0026micro;l pipette tip drew a vertical line in 6-well plate and the wound was washed with PBS. The different concentrations of 6-P were respectively added into 6-well plate to co-incubate for 48 h. The wound healing images were captured using microscope.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eTranswell assay\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe migrated and invasive ability of pancreatic cancer cells were measured by transwell assay. Approximate 200 \\u0026micro;l suspension containing 1 \\u0026times; 10\\u003csup\\u003e4\\u003c/sup\\u003e MIA PaCa-2 or SW1990 cells were respectively seeded into the upper chambers which were covered with Matrigel. Approximate 600 \\u0026micro;l DMEM with 20% FBS was added into the lower chambers. After 24 h of incubation, the cells on upper chambers were washed and removed, the cells on lower chambers were fixed with 4% paraformaldehyde and stained with 1% crystal violet. the stained lower chambers were imaged and recorded under a microscope.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003ePCR analysis\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe total RNA was extracted from pancreatic cancer cells with Trizol Reagent, the RNA was reverse transcribed into cDNA using HiScript\\u0026reg; III 1st Strand cDNA Synthesis Kit. Then the target genes were quantified according to their specific primer sequences via Bio-Rad RT-PCR System using ChamQ Universal SYBR qPCR Master Mix. GAPDH acted as an internal reference.The primer sequences as bellow: GAPDH, Forward: GGAGCGAGATCCCTCCAAAAT; Reverse: GGCTGTTGTCATACTTCTCATGG. EGFR, Forward: CCCACTCATGCTCTACAACCC; Reverse: TCGCACTTCTTACACTTGCGG.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eWestern blot\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTotal proteins were extracted from cells using RIPA Lysis buffer and the concentration was measured using BCA method. The equal amount of protein (40 \\u0026micro;g) was loaded and separated by SDS-polyacrylamide gel electrophoresis. After electrophoresis, the protein were transferred to PVDF membrane. Then, the membrane was blocked using defatted milk for 2 h. Subsequently, the specific primary antibody was added into a box to incubate with the membrane at 4℃ overnight. Then the membrane was washed with TBST and incubated with the secondary antibody at room temperature for 2 h. After washing with TBST, the protein band were evaluated and visualized using ECL reagents via Bio-Rad System.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eXenograft tumor-formation assay and treatment\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTen female BALB/c mude mice (13-15g) with 6 weeks of age were purchased from Huafukang Biotechnology Co., Ltd (China). SW1990 cells were prepared into cell suspension with germfree PBS. Approximately 200 PBS suspension containing 5 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e cells was injected subcutaneously into the armpit of mice. After one week of inoculation, mice were randomly divided into two groups, one for 6-P treatment (n\\u0026thinsp;=\\u0026thinsp;5), another for equal volume saline treatment (n\\u0026thinsp;=\\u0026thinsp;5). Intragastrically administered 6-P (20mg/kg) or saline every day and the tumor volumes were measured by caliper every week. After feeding for 5 weeks, mice were sacrificed and tumors were stripped out. The wight of stripped tumors was measured using a electronic balance. Subsequently, the tumors were made into wax blocks for immunohistochemical analysis.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eAll data were expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. SPSS 21.0 statistical software and Graphpad prism 8.0 were used to analyze data. Statistical significance was analyzed using the Student\\u0026rsquo;s t test, one-way analysis of variance (ANOVA). Statistical significance was considered at a P value less than 0.05.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eInhibition of 6-P on proliferation of pancreatic cancer cells\\u003c/h2\\u003e\\n\\u003cp\\u003eThe chemical structure of 6-P and its derivatives 6-G and 6-S was displayed in Fig.\\u0026nbsp;1. To investigate the effect of 6-P on proliferation of pancreatic cancer, pancreatic cancer cell lines MIA PaCa-2 and SW1990 were were treated with different concentrations of 6-P for 48 h (0, 20, 40, 80\\u0026micro;M) or the same concentration of 6-P for different time frames (0, 24, 48, 72 h). First, CCK-8 assay was performed to evaluate the effect of 6-P on pancreatic cancer cell viability. The results suggested that cell viability significantly decreased with increasing 6-P concentration in MIA PaCa-2 and SW1990 (Fig.\\u0026nbsp;2A,B). In addition, cell colony formation assay indicated the same results that the number of cell colonies was obviously inhibited by culturing with different concentrations of 6-P and the 80\\u0026micro;M concentration showed a highest inhibited effect on cell colonies (Fig.\\u0026nbsp;2C,D). To further evaluate the cytotoxicity and anti-poliferation of 6-P, we used a phase contrast microscope to observe and capture the morphological changes of pancreatic cancer MIA PaCa-2 and SW1990 treated with 6-P. The results covered that 6-P caused adherent pancreatic cells to become round, shrink, wiredrawing and separate from the bottom of the culture plates, indicating a significant apoptosis state, especially in concentration of 80\\u0026micro;M or treating with 72 h (Fig.\\u0026nbsp;2E,F).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eInhibition of 6-P on migration and invasion of pancreatic cancer cells\\u003c/h2\\u003e\\n\\u003cp\\u003eTo further validate whether 6-P had the inhibition effect on migration and invasion of MIA PaCa-2 and SW1990, transwell assay and wound healing assay were performed to evaluate to migrate and invasive ability. The migration and invasion significantly decreased in the concentration of 40 and 80\\u0026micro;M compared with 0\\u0026micro;M, revealing that 6-P could also partly suppress the metastasis of pancreatic cancer cells (Fig.\\u0026nbsp;3A-G). In addition, we tested the epithelial-mesenchymal transition (EMT) using western blot assay to detect the protein levels of E-cadherin, N-cadherin and Vimentin. The results demonstrated that the expression of E-cadherin gradually rose with the increasing concentration of 6-P. Conversely, the expression of N-cadherin and Vimentin gradually reduced with the increasing concentration of 6-P (Fig.\\u0026nbsp;3H,I). The results suggested a inhibited function of 6-P on EMT of pancreatic cancer cells.\\u003c/p\\u003e\\n\\u003ch2\\u003e\\u003cstrong\\u003e6-P interacts with EGFR to exert suppression functions on proliferation and metastasis of pancreatic cancer cells\\u003c/strong\\u003e\\u003c/h2\\u003e\\n\\u003cp\\u003eIn order to explore the potential binding target of 6-P, bioinformatics methods were performed to predict the underlying protein site. First, we downloaded the 3-dimensional structure file of the compound 6-P from PubChem Compound Search database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://pubchem.ncbi.nlm.nih.gov/\\u003c/span\\u003e\\u003c/span\\u003e). Then, we transeferred the data to SwissTargerPrediction software for predictive analysis and obtained the target protein of the compound 6-P. Subsequently, KEGG pathway enrichment analysis was performed to figure out the involved signaling pathway of these underlying target protein by DAVID database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://david.ncifcrf.gov/\\u003c/span\\u003e\\u003c/span\\u003e). Finally, We set the standard for judging significant enrichment of pathways with a P value less than 0.05, and the top 12 signal pathways with enrichment number were visualized using R language with clusterProfilerKEGG package. The results of KEGG pathway enrichment analysis indicated that 6-P was significantly correlated with PI3K-AKT signaling pathway and epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor resistance (Fig.\\u0026nbsp;4A). Interestingly, molecular docking analysis with 6-P on the 3-dimensional structure of EGFR suggested there was an interaction between 6-P and EGFR (Fig.\\u0026nbsp;4B). Combined with KEGG results, we hypothesized that 6-P might occupy key sites of EGFR molecular structure to exert biological regulation functions. Subsequently, western blot assay was performed to detect EGFR expression of pancreatic cancer cells treated with 6-P. The results confirmed that 6-P could decrease expression of EGFR and the inhibition of 6-P on EGFR expression could be partly rescued with supplementary EGFR (Fig.\\u0026nbsp;4C,D). In addition, we further evaluated the proliferation and metastasis of pancreatic cancer cells treated with 6-P after adding EGFR plasmid to upregulate EGFR expression. The results suggested that the cell proliferation, migration and invasion could also be partly rescued with supplementary EGFR (Fig.\\u0026nbsp;4E-G). And western blot results revealed upregulation of EGFR could reverse 6-P mediated-inhibition of EMT process (Fig.\\u0026nbsp;4H,I).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003e6-P-mediated ubiquitination degradation of EGFR leads to inactivate PI3K/AKT signaling pathway\\u003c/h2\\u003e\\n\\u003cp\\u003eTo further investigate the underlying molecular mechanism of 6-P on EGFR, we firstly evaluated the mRNA expression levels of EGFR in pancreatic cancer cells treated with 6-P. The results indicated that there were no significant difference in MIA PaCa-2 or SW1990 cells (Fig.\\u0026nbsp;5A). However, our data suggested 6-P downregulated the protein expression of EGFR. To figure out the reason why 6-P changed the protein expression, not the mRNA expression, 293T cells were treated with CHX and 6-P for 1 h, 2h to evaluate the protein stability. The results demonstrated that the de novo synthesis of EGFR in 6-P treatment group reduced more rapidly compared to 6-P non-treatment group, suggesting 6-P decreased the protein stability of EGFR (Fig.\\u0026nbsp;5B,C). Subsequently, we suspected that downregulated EGFR protein expression is the result of 6-P-involved a proteasome-dependent degradation mechanism. To validate the suspicion, a proteasome inhibitor, MG-132 (5 \\u0026micro;M), was used to evaluate whether 6-P was involved in EGFR degradation by proteasome-dependent route. The results confirmed that MG132 inhibited EGFR degradation (Fig.\\u0026nbsp;5D). Then HA-labeled ubiquitin and Flag-labeled EGFR plasmids were co-transferred into the 293T cells and 6-P was added to treat the cells. Co-immunoprecipitation and SDS-gel electrophoresis were performed to evaluate the levels of EGFR ubiquitination. Interestingly, the treatment of 6-P significantly enhanced EGFR ubiquitination, indicating 6-P promoted proteasome-dependent degradation of EGFR via ubiquitin modification pathway (Fig.\\u0026nbsp;5E). Subsequently, we detected the PI3K/AKT signaling pathway which was one of downstream pathways of EGFR to further validate the results of KEGG pathway enrichment analysis. The results suggested that EGFR could activate PI3K/AKT while the activity of PI3K/AKT signaling could be reversed by treating with 6-P, indicating 6-P negatively activate PI3K/AKT signaling pathway (Fig.\\u0026nbsp;5F,G). Immunofluorescence staining was used to analysis the expression and localization of p-AKT .MIA PaCa-2 and SW1990 cells treated with 6-Paradol showed a obvious decrease of p-AKT in comparison with the NC groups(Fig.\\u0026nbsp;5H).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eEGFR inhibitor enhanced 6-P mediated-inhibition effect on PI3K/AKT signaling activity\\u003c/h2\\u003e\\n\\u003cp\\u003eTo further confirm that 6-P mediated-EGFR degradation was involved in inhibition effect on PI3K/AKT signaling, we respectively used EGFR overexpression plasmid and (or) EGFR inhibitor Erlotinib (2nM) to regulate EGFR expression. The results verified that Erlotinib promoted 6-P mediated degradation of EGFR and inactivity of PI3K/AKT signaling, however, upregulation of EGFR expression could rescue the activity of PI3K/AKT signaling and the expression of EGFR (Fig.\\u0026nbsp;6A,B). Subsequently, gain- or lose-functional experiments were performed to evaluate the interaction between 6-P and EGFR on proliferation and metastasis of pancreatic cancer cells. The results revealed Erlotinib and 6-P had synergistic effects to exert inhibition on proliferation and metastasis of pancreatic cancer cells, which could be rescued by upregulation of EGFR expression (Fig.\\u0026nbsp;6C-F). Meanwhile, Erlotinib combined with 6-P significantly inhibited EMT process and overexpressed EGFR removed the inhibitory effect on EMT process (Fig.\\u0026nbsp;6G,H).\\u003c/p\\u003e\\n\\u003ch2\\u003e\\u003cstrong\\u003e6-P significantly suppressed tumor growth\\u003c/strong\\u003e \\u003cspan class=\\\"BoldItalic\\\"\\u003ein vivo\\u003c/span\\u003e\\u003c/h2\\u003e\\n\\u003cp\\u003eTo explore whether 6-P suppressed tumor growth in vivo, we constructed a subcutaneous tumorigenesis model in nude mice which was intraperitoneally injected with 6-P (20mg/kg/d). The results suggested the size of tumor was obviously smaller in 6-P treatment group compared with control groups, indicating a inhibitory function of 6-P on tumor growth (Fig.\\u0026nbsp;7A). The tumor volume was smaller in 6-P treatment groups and the tumor weight was also lighter in 6-P treatment groups (Fig.\\u0026nbsp;7B,C). Subsequently, IHC analysis was performed to detect relative expression of Ki67, PCNA, N-cadherin, E-cadherin, Vimentin, EGFR, phosphorylated-AKT and phosphorylated-PI3K. The results demonstrated E-cadherin expression was upregulated in 6-P treatment group and the rest of indexes were all downregulated, which were consistent with our previous in vitro (Fig.\\u0026nbsp;7D,E).\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe EGFR, a transmembrane protein receptor and an important member of tyrosine kinase receptors, is commonly elevated in cancers, engaging multiple malignant functions such as aberrant activation of signaling, uncontrolled cell proliferation, vascular invasion and metastasis of the tumors.[\\u003cspan class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e] Accumulating evidence indicates that EGFR expression is significantly correlated with pancreatic cancer, high expression of EGFR frequently suggests a poor prognosis.[\\u003cspan class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e] Although many EGFR antibodies and inhibitors, including cetuximab, afatinib, osimertinib, erlotinib and gefitinib, have been applied to cancer treatment. However, the anticancer efficacy of them have negligible effects on patients with pancreatic cancer, especially in KRAS mutant pancreatic ductal adenocarcinoma.[\\u003cspan class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e] Therefore, it\\u0026rsquo;s urgent to carry out new drugs or novel combination therapy regimens to control pancreatic cancer process.\\u003c/p\\u003e\\n\\u003cp\\u003eRecently, chemoprevention substances naturally existing in diets and medicinal plants have attracted widespread attentions.[\\u003cspan class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e] 6-P, a phenolic compound in the rhizome of ginger, was reported that 6-P had potent anti-inflammatory activity, which exerted huge anticancer functions.[\\u003cspan class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e] Previous study suggested 6-P and its derivative 6-G had the ability to reduce the viability of HL-60 cell and induce cell apoptosis.[\\u003cspan class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e] By decreasing STAT3 and inactivating NF-\\u0026kappa;B signaling, 6-P significantly reduced survival of prostate cancer cells.[\\u003cspan class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e] In addition, 6-P could induce cell apoptosis in oral squamous carcinoma in a dose-dependent manner.[\\u003cspan class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e] In our data, we first proposed that 6-P might be correlated with pancreatic cancer. Subsequently, we constructed tumor proliferation and metastasis model in vitro and in vivo, attempting to uncover the underlying molecular mechanism how 6-P affected pancreatic cancer procession. First, we evaluated the effect of 6-P on proliferation and metastasis of pancreatic cancer cells in different concentrations or in a same concentration for different application time. The results suggested 6-P inhibited pancreatic cancer cell proliferation and metastasis both in a time-dependent manner and a dose-dependent manner. Furthermore, tumor growth was obviously inhibited with 6-P treatment in vivo. Then, we discovered 6-P could reducing the protein expression of EGFR while did not change the mRNA expression of EGFR, suggesting 6-P had less effect at the transcriptional level of EGFR. Therefore, we further explored whether 6-P promoted EGFR degradation via proteasome-dependent degradation. The results suggested 6-P mediated post-translational modifications of EGFR via promoting EGFR ubiquitination, resulting in EGFR degradation. Additionally, we found 6-P reduced the activity of PI3K/AKT signaling via downregulation of EGFR, leading to decreasing abilities of cell proliferation and metastasis.\\u003c/p\\u003e\\n\\u003cp\\u003eUbiquitination plays an important role in protein localization, metabolism, function, regulation and degradation.[\\u003cspan class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e] At the same time, it is also involved in the regulation of cell cycle, proliferation, apoptosis, differentiation, metastasis, gene expression, transcriptional regulation, signal transduction, injury repair, inflammation and immunity, and almost all life activities.[\\u003cspan class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e] Zhang et al found Ginsenoside compound K inhibited the proliferation of liver cancer via promoting the degradation of HIF-1\\u0026alpha; ubiquitination.[\\u003cspan class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e] Liu et al suggested that Honokiol had an anticancer function via directly interacting with keratin 18 protein in melanoma cells. The interaction between keratin 18 and Honokiol led to the degradation of keratin 18 by ubiquitination.[\\u003cspan class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e] Another compound from ginger, 6-G, was also related with ubiquitination. The study indicated 6-G decreased the expression of USP14, which was a ubiquitin-specific peptidase mainly exerting inhibitory effect on ubiquitnation. Decreasing USP14 elevated the autophagosomes and reduced the survival of lung cancer cell.[\\u003cspan class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e] In our data, 6-P mediated EGFR degradation though enhancing EGFR ubiquitination, resulting in inactivity of PI3K/AKT signaling.\\u003c/p\\u003e\\n\\u003cp\\u003eNumerous investigations suggest hyperactivity PI3K/AKT signaling is associated with malignant phenotype of cancer and can accelerate cancer procession.[\\u003cspan class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e] Totiger et al found Urolithin A exerted anticancer effect in pancreatic cancer via downregulating phosphorylation of AKT.[\\u003cspan class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e] Additionally, Amcp, one novel derivative of valepotriate significantly inhibited the PI3K/AKT signaling, suppressing the cell viability and Mcl-1 expression in pancreatic cancer cells.[\\u003cspan class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e] In this study, we confirmed 6-P negatively regulated activity of PI3K/AKT signaling via decreasing EGFR.\\u003c/p\\u003e\\n\\u003cp\\u003eIn conclusion, our data demonstrate that 6-P exerts anticancer effect though suppressing pancreatic cancer cell growth, viability, invasion and migration. Mechanistically, the inhibitory effect of 6-P mainly based on decreasing the expression of EGFR and inactivity of PI3K/AKT signaling via ubiquitination degradation of EGFR(Fig.\\u0026nbsp;8). Therefore, 6-P might become a supplementary durgs for pancreatic cancer treatment.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eOur research group is very grateful to the Tongji Hospital affiliated to Huazhong University of Science and Technology for providing an experimental platform for us to carry out the experiment smoothly.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026prime;\\u003c/strong\\u003e\\u003cstrong\\u003econtributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJianxin Jiang designed the study. Xueyi Jiang and Peng Chen performed experimental studies.Jie Wang wrote the manuscript.Zhiwei He and Xinyuan Liu prepared, edited and reviewed the manuscript.Jian Xu and Yankun Chen gave comments and reviewed the manuscript. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was supported by The National Natural Science Foundation of China (No. 81871965）\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated and analysed during this study are included in this published article are available on request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was approved by the Ethics Committee of Renmin Hospital of\\u003c/p\\u003e\\n\\u003cp\\u003eWuhan University. The animal experiments were approved by the Animal\\u003c/p\\u003e\\n\\u003cp\\u003eResearch Ethics Committees at Renmin Hospital of Wuhan University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have declared that they agree publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no fnancial conficts of interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eMiller KD\\u003c/em\\u003e, \\u003cem\\u003eNogueira L\\u003c/em\\u003e, \\u003cem\\u003eMariotto AB\\u003c/em\\u003e, \\u003cem\\u003eRowland JH\\u003c/em\\u003e, \\u003cem\\u003eYabroff KR\\u003c/em\\u003e, \\u003cem\\u003eAlfano CM\\u003c/em\\u003e, \\u003cem\\u003eJemal A\\u003c/em\\u003e, \\u003cem\\u003eKramer JL\\u003c/em\\u003e, \\u003cem\\u003eSiegel RL\\u003c/em\\u003e: \\u003cem\\u003eCancer treatment and survivorship statistics\\u003c/em\\u003e, \\u003cem\\u003e2019\\u003c/em\\u003e. \\u003cem\\u003eCA Cancer J Clin 2019\\u003c/em\\u003e, \\u003cem\\u003e69\\u003c/em\\u003e(\\u003cem\\u003e5\\u003c/em\\u003e):\\u003cem\\u003e363\\u0026ndash;385\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eZhu H\\u003c/em\\u003e, \\u003cem\\u003eLi T\\u003c/em\\u003e, \\u003cem\\u003eDu Y\\u003c/em\\u003e, \\u003cem\\u003eLi M\\u003c/em\\u003e: \\u003cem\\u003ePancreatic cancer\\u003c/em\\u003e: \\u003cem\\u003echallenges and opportunities\\u003c/em\\u003e. \\u003cem\\u003eBMC MED 2018\\u003c/em\\u003e, \\u003cem\\u003e16\\u003c/em\\u003e(\\u003cem\\u003e1\\u003c/em\\u003e):\\u003cem\\u003e214\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eKenkel JA\\u003c/em\\u003e, \\u003cem\\u003eTseng WW\\u003c/em\\u003e, \\u003cem\\u003eDavidson MG\\u003c/em\\u003e, \\u003cem\\u003eTolentino LL\\u003c/em\\u003e, \\u003cem\\u003eChoi O\\u003c/em\\u003e, \\u003cem\\u003eBhattacharya N\\u003c/em\\u003e, \\u003cem\\u003eSeeley ES\\u003c/em\\u003e, \\u003cem\\u003eWiner DA\\u003c/em\\u003e, \\u003cem\\u003eReticker-Flynn NE\\u003c/em\\u003e, \\u003cem\\u003eEngleman EG\\u003c/em\\u003e: \\u003cem\\u003eAn Immunosuppressive Dendritic Cell Subset Accumulates at Secondary Sites and Promotes Metastasis in Pancreatic Cancer\\u003c/em\\u003e. \\u003cem\\u003eCANCER RES 2017\\u003c/em\\u003e, \\u003cem\\u003e77\\u003c/em\\u003e(\\u003cem\\u003e15\\u003c/em\\u003e):\\u003cem\\u003e4158\\u0026ndash;4170\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eKe W\\u003c/em\\u003e, \\u003cem\\u003eZhao X\\u003c/em\\u003e, \\u003cem\\u003eLu Z\\u003c/em\\u003e: \\u003cem\\u003eFoeniculum vulgare seed extract induces apoptosis in lung cancer cells partly through the down-regulation of Bcl-2\\u003c/em\\u003e. \\u003cem\\u003eBIOMED PHARMACOTHER 2021\\u003c/em\\u003e, \\u003cem\\u003e135\\u003c/em\\u003e:\\u003cem\\u003e111213\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eYang LQ\\u003c/em\\u003e, \\u003cem\\u003eYu SP\\u003c/em\\u003e, \\u003cem\\u003eYang YT\\u003c/em\\u003e, \\u003cem\\u003eZhao YS\\u003c/em\\u003e, \\u003cem\\u003eWang FY\\u003c/em\\u003e, \\u003cem\\u003eChen Y\\u003c/em\\u003e, \\u003cem\\u003eLi QH\\u003c/em\\u003e, \\u003cem\\u003eTian P\\u003c/em\\u003e, \\u003cem\\u003eZhu YY\\u003c/em\\u003e, \\u003cem\\u003eZhang JG\\u003c/em\\u003e et al: \\u003cem\\u003eMuscone derivative ZM-32 inhibits breast tumor angiogenesis by suppressing HuR-mediated VEGF and MMP9 expression\\u003c/em\\u003e. \\u003cem\\u003eBIOMED PHARMACOTHER 2021\\u003c/em\\u003e, \\u003cem\\u003e136\\u003c/em\\u003e:\\u003cem\\u003e111265\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eLi J\\u003c/em\\u003e, \\u003cem\\u003eYan L\\u003c/em\\u003e, \\u003cem\\u003eLuo J\\u003c/em\\u003e, \\u003cem\\u003eTong L\\u003c/em\\u003e, \\u003cem\\u003eGao Y\\u003c/em\\u003e, \\u003cem\\u003eFeng W\\u003c/em\\u003e, \\u003cem\\u003eWang F\\u003c/em\\u003e, \\u003cem\\u003eCui W\\u003c/em\\u003e, \\u003cem\\u003eLi S\\u003c/em\\u003e, \\u003cem\\u003eSun Z\\u003c/em\\u003e: \\u003cem\\u003eBaicalein suppresses growth of non-small cell lung carcinoma by targeting MAP4K3\\u003c/em\\u003e. \\u003cem\\u003eBIOMED PHARMACOTHER 2021\\u003c/em\\u003e, \\u003cem\\u003e133\\u003c/em\\u003e:\\u003cem\\u003e110965\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eShukla Y\\u003c/em\\u003e, \\u003cem\\u003eSingh M\\u003c/em\\u003e: \\u003cem\\u003eCancer preventive properties of ginger\\u003c/em\\u003e: \\u003cem\\u003ea brief review\\u003c/em\\u003e. \\u003cem\\u003eFOOD CHEM TOXICOL 2007\\u003c/em\\u003e, \\u003cem\\u003e45\\u003c/em\\u003e(\\u003cem\\u003e5\\u003c/em\\u003e):\\u003cem\\u003e683\\u0026ndash;690\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eKeum YS\\u003c/em\\u003e, \\u003cem\\u003eKim J\\u003c/em\\u003e, \\u003cem\\u003eLee KH\\u003c/em\\u003e, \\u003cem\\u003ePark KK\\u003c/em\\u003e, \\u003cem\\u003eSurh YJ\\u003c/em\\u003e, \\u003cem\\u003eLee JM\\u003c/em\\u003e, \\u003cem\\u003eLee SS\\u003c/em\\u003e, \\u003cem\\u003eYoon JH\\u003c/em\\u003e, \\u003cem\\u003eJoo SY\\u003c/em\\u003e, \\u003cem\\u003eCha IH\\u003c/em\\u003e et al: \\u003cem\\u003eInduction of apoptosis and caspase-3 activation by chemopreventive [6]-paradol and structurally related compounds in KB cells\\u003c/em\\u003e. \\u003cem\\u003eCANCER LETT 2002\\u003c/em\\u003e, \\u003cem\\u003e177\\u003c/em\\u003e(\\u003cem\\u003e1\\u003c/em\\u003e):\\u003cem\\u003e41\\u0026ndash;47\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003ePournaderi PS\\u003c/em\\u003e, \\u003cem\\u003eYaghmaei P\\u003c/em\\u003e, \\u003cem\\u003eKhodaei H\\u003c/em\\u003e, \\u003cem\\u003eNoormohammadi Z\\u003c/em\\u003e, \\u003cem\\u003eHejazi SH\\u003c/em\\u003e: \\u003cem\\u003eThe effects of 6-Gingerol on reproductive improvement\\u003c/em\\u003e, \\u003cem\\u003eliver functioning and Cyclooxygenase-2 gene expression in estradiol valerate - Induced polycystic ovary syndrome in Wistar rats\\u003c/em\\u003e. \\u003cem\\u003eBiochem Biophys Res Commun 2017\\u003c/em\\u003e, \\u003cem\\u003e484\\u003c/em\\u003e(\\u003cem\\u003e2\\u003c/em\\u003e):\\u003cem\\u003e461\\u0026ndash;466\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eBaliga MS\\u003c/em\\u003e, \\u003cem\\u003eHaniadka R\\u003c/em\\u003e, \\u003cem\\u003ePereira MM\\u003c/em\\u003e, \\u003cem\\u003eD'Souza JJ\\u003c/em\\u003e, \\u003cem\\u003ePallaty PL\\u003c/em\\u003e, \\u003cem\\u003eBhat HP\\u003c/em\\u003e, \\u003cem\\u003ePopuri S\\u003c/em\\u003e: \\u003cem\\u003eUpdate on the chemopreventive effects of ginger and its phytochemicals\\u003c/em\\u003e. \\u003cem\\u003eCrit Rev Food Sci Nutr 2011\\u003c/em\\u003e, \\u003cem\\u003e51\\u003c/em\\u003e(\\u003cem\\u003e6\\u003c/em\\u003e):\\u003cem\\u003e499\\u0026ndash;523\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eBernard MM\\u003c/em\\u003e, \\u003cem\\u003eMcConnery JR\\u003c/em\\u003e, \\u003cem\\u003eHoskin DW\\u003c/em\\u003e: \\u003cem\\u003e[10]-Gingerol\\u003c/em\\u003e, \\u003cem\\u003ea major phenolic constituent of ginger root\\u003c/em\\u003e, \\u003cem\\u003einduces cell cycle arrest and apoptosis in triple-negative breast cancer cells\\u003c/em\\u003e. \\u003cem\\u003eEXP MOL PATHOL 2017\\u003c/em\\u003e, \\u003cem\\u003e102\\u003c/em\\u003e(\\u003cem\\u003e2\\u003c/em\\u003e):\\u003cem\\u003e370\\u0026ndash;376\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eKim MO\\u003c/em\\u003e, \\u003cem\\u003eLee MH\\u003c/em\\u003e, \\u003cem\\u003eOi N\\u003c/em\\u003e, \\u003cem\\u003eKim SH\\u003c/em\\u003e, \\u003cem\\u003eBae KB\\u003c/em\\u003e, \\u003cem\\u003eHuang Z\\u003c/em\\u003e, \\u003cem\\u003eKim DJ\\u003c/em\\u003e, \\u003cem\\u003eReddy K\\u003c/em\\u003e, \\u003cem\\u003eLee SY\\u003c/em\\u003e, \\u003cem\\u003ePark SJ\\u003c/em\\u003e et al: [6]-shogaol inhibits growth and induces apoptosis of non-small cell lung cancer cells by directly regulating Akt1/2. CARCINOGENESIS \\u003cem\\u003e2014\\u003c/em\\u003e, 35(3):683\\u0026ndash;691.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eFarombi EO\\u003c/em\\u003e, \\u003cem\\u003eAjayi BO\\u003c/em\\u003e, \\u003cem\\u003eAdedara IA\\u003c/em\\u003e: \\u003cem\\u003e6-Gingerol delays tumorigenesis in benzo[a]pyrene and dextran sulphate sodium-induced colorectal cancer in mice\\u003c/em\\u003e. \\u003cem\\u003eFOOD CHEM TOXICOL 2020\\u003c/em\\u003e, \\u003cem\\u003e142\\u003c/em\\u003e:\\u003cem\\u003e111483\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eMariadoss AV\\u003c/em\\u003e, \\u003cem\\u003eKathiresan S\\u003c/em\\u003e, \\u003cem\\u003eMuthusamy R\\u003c/em\\u003e, \\u003cem\\u003eKathiresan S\\u003c/em\\u003e: \\u003cem\\u003eProtective effects of [6]-paradol on histological lesions and immunohistochemical gene expression in DMBA induced hamster buccal pouch carcinogenesis\\u003c/em\\u003e. \\u003cem\\u003eAsian Pac J Cancer Prev 2013\\u003c/em\\u003e, \\u003cem\\u003e14\\u003c/em\\u003e(\\u003cem\\u003e5\\u003c/em\\u003e):\\u003cem\\u003e3123\\u0026ndash;3129\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eLee E\\u003c/em\\u003e, \\u003cem\\u003eSurh YJ\\u003c/em\\u003e: \\u003cem\\u003eInduction of apoptosis in HL-60 cells by pungent vanilloids\\u003c/em\\u003e, \\u003cem\\u003e[6]-gingerol and [6]-paradol\\u003c/em\\u003e. \\u003cem\\u003eCANCER LETT 1998\\u003c/em\\u003e, \\u003cem\\u003e134\\u003c/em\\u003e(\\u003cem\\u003e2\\u003c/em\\u003e):\\u003cem\\u003e163\\u0026ndash;168\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eHong SY\\u003c/em\\u003e, \\u003cem\\u003eKao YR\\u003c/em\\u003e, \\u003cem\\u003eLee TC\\u003c/em\\u003e, \\u003cem\\u003eWu CW\\u003c/em\\u003e: \\u003cem\\u003eUpregulation of E3 Ubiquitin Ligase CBLC Enhances EGFR Dysregulation and Signaling in Lung Adenocarcinoma\\u003c/em\\u003e. \\u003cem\\u003eCANCER RES 2018\\u003c/em\\u003e, \\u003cem\\u003e78\\u003c/em\\u003e(\\u003cem\\u003e17\\u003c/em\\u003e):\\u003cem\\u003e4984\\u0026ndash;4996\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eAssi M\\u003c/em\\u003e, \\u003cem\\u003eAchouri Y\\u003c/em\\u003e, \\u003cem\\u003eLoriot A\\u003c/em\\u003e, \\u003cem\\u003eDauguet N\\u003c/em\\u003e, \\u003cem\\u003eDahou H\\u003c/em\\u003e, \\u003cem\\u003eBaldan J\\u003c/em\\u003e, \\u003cem\\u003eLibert M\\u003c/em\\u003e, \\u003cem\\u003eFain JS\\u003c/em\\u003e, \\u003cem\\u003eGuerra C\\u003c/em\\u003e, \\u003cem\\u003eBouwens L\\u003c/em\\u003e et al: \\u003cem\\u003eDynamic regulation of expression of KRAS and its effectors determines the ability to initiate tumorigenesis in pancreatic acinar cells\\u003c/em\\u003e. \\u003cem\\u003eCANCER RES 2021\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eKim D\\u003c/em\\u003e, \\u003cem\\u003eLee S\\u003c/em\\u003e, \\u003cem\\u003eNa K\\u003c/em\\u003e: \\u003cem\\u003eImmune Stimulating Antibody-Photosensitizer Conjugates via Fc-Mediated Dendritic Cell Phagocytosis and Phototriggered Immunogenic Cell Death for KRAS-Mutated Pancreatic Cancer Treatment\\u003c/em\\u003e. \\u003cem\\u003eSMALL 2021\\u003c/em\\u003e:\\u003cem\\u003ee2006650\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eHermawan A\\u003c/em\\u003e, \\u003cem\\u003ePutri H\\u003c/em\\u003e, \\u003cem\\u003eUtomo RY\\u003c/em\\u003e: \\u003cem\\u003eFunctional network analysis reveals potential repurposing of beta-blocker atenolol for pancreatic cancer therapy\\u003c/em\\u003e. \\u003cem\\u003eDARU 2020\\u003c/em\\u003e, \\u003cem\\u003e28\\u003c/em\\u003e(\\u003cem\\u003e2\\u003c/em\\u003e):\\u003cem\\u003e685\\u0026ndash;699\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eChung WY\\u003c/em\\u003e, \\u003cem\\u003eJung YJ\\u003c/em\\u003e, \\u003cem\\u003eSurh YJ\\u003c/em\\u003e, \\u003cem\\u003eLee SS\\u003c/em\\u003e, \\u003cem\\u003ePark KK\\u003c/em\\u003e: \\u003cem\\u003eAntioxidative and antitumor promoting effects of [6]-paradol and its homologs\\u003c/em\\u003e. \\u003cem\\u003eMutat Res 2001\\u003c/em\\u003e, \\u003cem\\u003e496\\u003c/em\\u003e(\\u003cem\\u003e1\\u0026ndash;2\\u003c/em\\u003e):\\u003cem\\u003e199\\u0026ndash;206\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eSaha A\\u003c/em\\u003e, \\u003cem\\u003eBlando J\\u003c/em\\u003e, \\u003cem\\u003eSilver E\\u003c/em\\u003e, \\u003cem\\u003eBeltran L\\u003c/em\\u003e, \\u003cem\\u003eSessler J\\u003c/em\\u003e, \\u003cem\\u003eDiGiovanni J\\u003c/em\\u003e: \\u003cem\\u003e6-Shogaol from dried ginger inhibits growth of prostate cancer cells both in vitro and in vivo through inhibition of STAT3 and NF-kappaB signaling\\u003c/em\\u003e. \\u003cem\\u003eCancer Prev Res (Phila) 2014\\u003c/em\\u003e, \\u003cem\\u003e7\\u003c/em\\u003e(\\u003cem\\u003e6\\u003c/em\\u003e):\\u003cem\\u003e627\\u0026ndash;638\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eHundley FV\\u003c/em\\u003e, \\u003cem\\u003eSanvisens DN\\u003c/em\\u003e, \\u003cem\\u003eMarin HC\\u003c/em\\u003e, \\u003cem\\u003eCarr KL\\u003c/em\\u003e, \\u003cem\\u003eTian R\\u003c/em\\u003e, \\u003cem\\u003eToczyski DP\\u003c/em\\u003e: \\u003cem\\u003eA comprehensive phenotypic CRISPR-Cas9 screen of the ubiquitin pathway uncovers roles of ubiquitin ligases in mitosis\\u003c/em\\u003e. \\u003cem\\u003eMOL CELL 2021\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eWu K\\u003c/em\\u003e, \\u003cem\\u003eHuynh KQ\\u003c/em\\u003e, \\u003cem\\u003eLu I\\u003c/em\\u003e, \\u003cem\\u003eMoustakim M\\u003c/em\\u003e, \\u003cem\\u003eMiao H\\u003c/em\\u003e, \\u003cem\\u003eYu C\\u003c/em\\u003e, \\u003cem\\u003eHaeusgen MJ\\u003c/em\\u003e, \\u003cem\\u003eHopkins BD\\u003c/em\\u003e, \\u003cem\\u003eHuang L\\u003c/em\\u003e, \\u003cem\\u003eZheng N\\u003c/em\\u003e et al: \\u003cem\\u003eInhibitors of cullin-RING E3 ubiquitin ligase 4 with antitumor potential\\u003c/em\\u003e. \\u003cem\\u003eProc Natl Acad Sci U S A 2021\\u003c/em\\u003e, \\u003cem\\u003e118\\u003c/em\\u003e(\\u003cem\\u003e8\\u003c/em\\u003e).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eZhang S\\u003c/em\\u003e, \\u003cem\\u003eZhang M\\u003c/em\\u003e, \\u003cem\\u003eChen J\\u003c/em\\u003e, \\u003cem\\u003eZhao J\\u003c/em\\u003e, \\u003cem\\u003eSu J\\u003c/em\\u003e, \\u003cem\\u003eZhang X\\u003c/em\\u003e: \\u003cem\\u003eGinsenoside Compound K Regulates HIF-1alpha-Mediated Glycolysis Through Bclaf1 to Inhibit the Proliferation of Human Liver Cancer Cells\\u003c/em\\u003e. \\u003cem\\u003eFRONT PHARMACOL 2020\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e:\\u003cem\\u003e583334\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eLiu T\\u003c/em\\u003e, \\u003cem\\u003eLiu H\\u003c/em\\u003e, \\u003cem\\u003eWang P\\u003c/em\\u003e, \\u003cem\\u003eHu Y\\u003c/em\\u003e, \\u003cem\\u003eYang R\\u003c/em\\u003e, \\u003cem\\u003eLiu F\\u003c/em\\u003e, \\u003cem\\u003eKim HG\\u003c/em\\u003e, \\u003cem\\u003eDong Z\\u003c/em\\u003e, \\u003cem\\u003eLiu K\\u003c/em\\u003e: \\u003cem\\u003eHonokiol Inhibits Melanoma Growth by Targeting Keratin 18 in vitro and in vivo\\u003c/em\\u003e. \\u003cem\\u003eFront Cell Dev Biol 2020\\u003c/em\\u003e, \\u003cem\\u003e8\\u003c/em\\u003e:\\u003cem\\u003e603472\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eTsai Y\\u003c/em\\u003e, \\u003cem\\u003eXia C\\u003c/em\\u003e, \\u003cem\\u003eSun Z\\u003c/em\\u003e: \\u003cem\\u003eThe Inhibitory Effect of 6-Gingerol on Ubiquitin-Specific Peptidase 14 Enhances Autophagy-Dependent Ferroptosis and Anti-Tumor in vivo and in vitro\\u003c/em\\u003e. \\u003cem\\u003eFRONT PHARMACOL 2020\\u003c/em\\u003e, \\u003cem\\u003e11\\u003c/em\\u003e:\\u003cem\\u003e598555\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eTambe Y\\u003c/em\\u003e, \\u003cem\\u003eTerado T\\u003c/em\\u003e, \\u003cem\\u003eKim CJ\\u003c/em\\u003e, \\u003cem\\u003eMukaisho KI\\u003c/em\\u003e, \\u003cem\\u003eYoshida S\\u003c/em\\u003e, \\u003cem\\u003eSugihara H\\u003c/em\\u003e, \\u003cem\\u003eTanaka H\\u003c/em\\u003e, \\u003cem\\u003eChida J\\u003c/em\\u003e, \\u003cem\\u003eKido H\\u003c/em\\u003e, \\u003cem\\u003eYamaji K\\u003c/em\\u003e et al: \\u003cem\\u003eAntitumor activity of potent pyruvate dehydrogenase kinase 4 inhibitors from plants in pancreatic cancer\\u003c/em\\u003e. \\u003cem\\u003eMol Carcinog 2019\\u003c/em\\u003e, \\u003cem\\u003e58\\u003c/em\\u003e(\\u003cem\\u003e10\\u003c/em\\u003e):\\u003cem\\u003e1726\\u0026ndash;1737\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eTotiger TM\\u003c/em\\u003e, \\u003cem\\u003eSrinivasan S\\u003c/em\\u003e, \\u003cem\\u003eJala VR\\u003c/em\\u003e, \\u003cem\\u003eLamichhane P\\u003c/em\\u003e, \\u003cem\\u003eDosch AR\\u003c/em\\u003e, \\u003cem\\u003eGaidarski AR\\u003c/em\\u003e, \\u003cem\\u003eJoshi C\\u003c/em\\u003e, \\u003cem\\u003eRangappa S\\u003c/em\\u003e, \\u003cem\\u003eCastellanos J\\u003c/em\\u003e, \\u003cem\\u003eVemula PK\\u003c/em\\u003e et al: \\u003cem\\u003eUrolithin A\\u003c/em\\u003e, \\u003cem\\u003ea Novel Natural Compound to Target PI3K/AKT/mTOR Pathway in Pancreatic Cancer\\u003c/em\\u003e. \\u003cem\\u003eMOL CANCER THER 2019\\u003c/em\\u003e, \\u003cem\\u003e18\\u003c/em\\u003e(\\u003cem\\u003e2\\u003c/em\\u003e):\\u003cem\\u003e301\\u0026ndash;311\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e\\u003cem\\u003eYan YY\\u003c/em\\u003e, \\u003cem\\u003eShi KY\\u003c/em\\u003e, \\u003cem\\u003eTeng F\\u003c/em\\u003e, \\u003cem\\u003eChen J\\u003c/em\\u003e, \\u003cem\\u003eChe JX\\u003c/em\\u003e, \\u003cem\\u003eDong XW\\u003c/em\\u003e, \\u003cem\\u003eLin NM\\u003c/em\\u003e, \\u003cem\\u003eZhang B\\u003c/em\\u003e: \\u003cem\\u003eA novel derivative of valepotriate inhibits the PI3K/AKT pathway and causes Noxa-dependent apoptosis in human pancreatic cancer cells\\u003c/em\\u003e. \\u003cem\\u003eACTA PHARMACOL SIN 2020\\u003c/em\\u003e, \\u003cem\\u003e41\\u003c/em\\u003e(\\u003cem\\u003e6\\u003c/em\\u003e):\\u003cem\\u003e835\\u0026ndash;842\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":true,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cancer-cell-international\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ccin\",\"sideBox\":\"Learn more about [Cancer Cell International](http://cancerci.biomedcentral.com/)\",\"snPcode\":\"12935\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12935/3\",\"title\":\"Cancer Cell International\",\"twitterHandle\":\"@OncoBioMed\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"[6]-Paradol, pancreatic cancer, proliferation, metastasis, EGFR\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-506985/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-506985/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground: \\u003c/strong\\u003eThe underlying mechanism behind the tumorigenesis and progression of pancreatic cancer is not clear, and treatment failure is generally caused by early metastasis, recurrence, drug resistance and vascular invasion. Exploring novel therapeutic regimens is necessary to overcome drug resistance and improve patients outcomes.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eMethods: \\u003c/strong\\u003eFunctional assays were performed to investigated the role of 6-Paradol in proliferation and metastasis in vitro and vivo. The interaction between EGFR and 6-P was tested by KEGG enrichment analysis and molecular docking analysis. qRT-PCR was performed to detected the mRNA expression of EGFR in 6-P treated groups. Involvement of the PI3K/AKT pathway was measured by western blotting.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eResults: \\u003c/strong\\u003e6-P significantly suppressed pancreatic cancer cell proliferation and metastasis. KEGG enrichment analysis and molecular docking analysis suggested that there was an interaction between EGFR and 6-P. In addition, 6-P obviously decreased EGFR protein expression levels but did not change the mRNA of EGFR. 6-P could induce degradation of EGFR through decreasing the protein stability of EGFR and enhancing the ubiquitin-mediated proteasome-dependent degradation,6-P-mediated EGFR degradation led to inactivating PI3K/AKT signaling pathway. However, Ectopic expression of EGFR protein resulted in resistance to 6-P-mediated inactivity of PI3K/AKT signaling and inhibition of malignant phenotype. Inversely, erlotinib could enhance the 6-P-mediated anticancer activity. \\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eConclusion: \\u003c/strong\\u003eOur data indicated that 6-P/EGFR/PI3K/AKT signaling axis might become one of the supplemental therapeutic strategies for pancreatic cancer.\\u003c/p\\u003e\",\"manuscriptTitle\":\"[6]-Paradol Suppresses Proliferation and Metastases of Pancreatic Cancer by Decreasing EGFR and Inactivating PI3K/AKT Signaling\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-05-19 15:13:28\",\"doi\":\"10.21203/rs.3.rs-506985/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revise Before Review\",\"date\":\"2021-05-14T00:58:19+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2021-05-12T12:34:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2021-05-11T23:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2021-05-11T23:00:00+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Cancer Cell International\",\"date\":\"2021-05-08T08:19:04+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cancer-cell-international\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"ccin\",\"sideBox\":\"Learn more about [Cancer Cell International](http://cancerci.biomedcentral.com/)\",\"snPcode\":\"12935\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12935/3\",\"title\":\"Cancer Cell International\",\"twitterHandle\":\"@OncoBioMed\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"3ebd08ac-7f37-4d9a-95db-f4576cd12396\",\"owner\":[],\"postedDate\":\"May 19th, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":4415933,\"name\":\"Cancer Biology\"}],\"tags\":[],\"updatedAt\":\"2021-08-22T15:13:24+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-506985\",\"link\":\"https://doi.org/10.1186/s12935-021-02118-0\",\"journal\":{\"identity\":\"cancer-cell-international\",\"isVorOnly\":false,\"title\":\"Cancer Cell International\"},\"publishedOn\":\"2021-08-10 15:02:26\",\"publishedOnDateReadable\":\"August 10th, 2021\"},\"versionCreatedAt\":\"2021-05-19 15:13:28\",\"video\":\"\",\"vorDoi\":\"10.1186/s12935-021-02118-0\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12935-021-02118-0\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-506985\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-506985\",\"identity\":\"rs-506985\",\"version\":[\"v1\"]},\"buildId\":\"FbvkV6FR0MCFSLy54lSbu\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}