{"paper_id":"471d2343-db61-4db5-b481-36ed010c3bdf","body_text":"Endometriosis (EMS) remains one of the most common gynecological conditions, and is\ncharacterized by the implantation and growth of endometrial-like tissue outside of\nthe uterus. EMS is classified into extra-abdominal and abdominal lesions, ovarian\ncysts, and deep EMS lesions based on the location of the ectopic endometrium\ncolonization. 1  EMS affects about 10% to 15% of reproductive-age women, with\nmany suffering from severe pelvic pain, heavy periods, and infertility. 2 , 3  The standard diagnostic\napproach for EMS is laparoscopic surgery, in which the endometriotic lesion can be\nobtained for pathological examination. Because of the invasive nature of\nlaparoscopic surgery, many patients are reluctant to participate. As a result, a\nnon-invasive diagnostic method that can diagnose EMS and reduce pain in the patient\nis desired. 4 \nDespite the great efforts that have been made to identify sensitive biomarkers over\nthe past decades, there is still an urgent need to discover a definite diagnostic\nbiomarker for EMS.\nExosomes are small extracellular vesicles (EVs) with a diameter ranging in size from\n60 to 150 nm. They mediate cell–cell communication by carrying biological\ninformation, such as nucleic acids, proteins, lipids, and enzymes, between cells.\nExosomes are secreted by almost all types of cells and are widely distributed in\nvarious body fluids, including blood, urine, ascites, saliva, and sputum. 5 , 6  The involvement of exosomes in\ndifferent types of diseases has been extensively studied, with a particular interest\non the use of exosomes in diagnostic and therapeutic applications. In recent years,\nthe potential role of exosomal components as valuable non-invasive diagnostic and/or\nprognostic biomarkers has garnered more attention. Many studies have shown that\nserum exosomal microRNAs (miRNAs) are frequently upregulated in inflammatory\ndisorders and cancers. 7 – 9  A recent study\nreported that serum-derived exosomal miRNAs, such as miR-22-3p and miR-320a, are\nsignificantly upregulated in the sera of patients with EMS. These molecules may\ntherefore serve as potential diagnostic biomarkers for EMS. 10  However, the\nrole of exosomes, particularly exosomal miRNAs derived from vaginal discharge\n(leukorrhea), in patients with EMS has not been well studied.\nThe aim of our study was to investigate the potential utility of leukorrhea exosomal\nmiRNAs as diagnostic biomarkers for EMS. In this study, we used miRNA microarrays to\nexplore the differentially expressed exosomal miRNAs between exosomes derived from\nthe endometrial tissue of patients with EMS and those from individuals with other\ngynecological conditions and/or healthy women. We then assessed the aberrantly\nexpressed exosomal miRNAs in leukorrhea, which provided a rationale for using these\nmolecules as biomarkers for EMS diagnosis.\n\nAll samples were collected at Ningbo Women and Children’s Hospital from January\n2019 to January 2020. For the EMS group, ectopic endometrial tissue and\nleukorrhea samples were collected from patients diagnosed with EMS by\nlaparoscopy and histopathological examination. For the negative control group,\nnormal endometrial tissue and leukorrhea were obtained from normally cycling,\nreproductive-age women who underwent hysteroscopic submucosal myomectomy and\nwomen who had regular physical examinations (obtaining vaginal secretions only,\nexclusion of malignancy and EMS by vaginal ultrasound and abdominal ultrasound,\nruling out dysmenorrhea, dyspareunia, pelvic pain, or infertility). Inclusion\ncriteria: 1. No history of treatment with hormones or antibiotics within three\nmonths before laparoscopic surgery; 2. No hepatitis, tuberculosis, tumors, or\nother diseases. Exclusion criteria: 1. Treated with hormones or antibiotics\nrecently; 2. Has a serious disease; 3. Has any other gynecological disease, such\nas inflammation of the reproductive system or tumors. All subjects included were\nwomen who had regular menstrual cycles and no hormonal treatment for at least 3\nmonths before sample collection. All vaginal secretions were obtained by\nscraping with a cotton swab, then stored at −80°C. The study was approved by the\nethical committee of Ningbo Women and Children’s Hospital (approval no.\nEC2019-037). The patients who gave tissue samples provided written informed\nconsent and the participants who donated leukorrhea samples provided verbal\ninformed consent before specimen collection.\nPrimary ectopic and normal endometrial cells were isolated from endometrial\ntissues obtained from patients in the EMS and negative control groups. Briefly,\ntissues were minced and digested in DMEM/F12 (Thermo Fisher Scientific, Waltham,\nMA, USA) containing type IV collagenase and penicillin-streptomycin (Solarbio,\nBeijing, China) for 1 hour at 37°C in a shaking incubator. The cell suspension\nwas centrifuged for 10 minutes at 400 × g and 4°C, then resuspended in fresh\nDMEM/F12 supplemented with 10% fetal bovine serum (FBS, Thermo Fisher\nScientific). Cells were separated by filtering through 200-μm mesh, then\nresuspended and cultured in DMEM/F12 containing 10% FBS and 500 mg/mL\npenicillin-streptomycin in a humidified incubator at 37°C with 5%\nCO 2 .\nEndometrial cell-derived exosomes were isolated form the cell supernatants of\nnormal endometrial cells (NECs), ectopic endometrial cells (EECs), and\nleukorrhea by differential ultra-centrifugation, as previously\ndescribed. 11  The isolated exosome pellets were sent to Hibio\nTechnology Co., Ltd. (Hangzhou, China) for transmission electron microscope\n(TEM) observation, validation, and size distribution analysis.\nWestern blot analysis was performed to identify the exosomal markers CD63 and\nheat-shock protein 70 (HSP70). Briefly, exosomes isolated from endometrial\ntissue and leukorrhea were washed with phosphate-buffered saline (PBS), then\nlysed with RIPA buffer supplemented with proteinase inhibitor (Beyotime\nBiotechnology, Shanghai, China) and centrifuged at 14,000 × g for 10 minutes at\n4°C. The exosomal protein concentration was determined using a BCA protein assay\nkit (Thermo Fisher Scientific). Equal amounts of protein from each sample were\nseparated using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis\n(SDS-PAGE), then transferred onto polyvinyliene difluoride (PVDF) membranes. The\nblots were incubated with primary antibodies at 4°C overnight as follows:\nanti-CD63 (1:1000; Cell Signaling Technology (CST), Danvers, MA, USA),\nanti-HSP70 (1:1000; CST), and anti-GAPDH (1:3000; Bios, Shanghai, China). GAPDH\nwas used as a loading control. After incubation with horseradish\nperoxidase-conjugated secondary antibodies for 2 hours at room temperature, the\nprotein bands were visualized with chemiluminescence reagents (CST), followed by\nimaging on an electrophoresis gel imaging analysis system (D-Digital, Los\nAngeles, CA, USA).\nExtraction of exosomal miRNAs was performed using TRIzoI™ reagent (Life\nTechnologies, Carlsbad, CA, USA) following the manufacturer’s suggested\nprotocol. The concentration and quality of each RNA sample were determined by a\nNanodrop Spectrophotometer (Thermo Fisher Scientific). The extracted exosomal\nmiRNAs were sent for miRNA microarray profiling (Askomics Co., Shanghai,\nChina).\nThe isolated exosomal miRNAs were reverse transcribed using a miRNA cDNA\nsynthesis kit (CWBio, Beijing, China) according to the manufacturer’s\ninstructions. Forward primers for hsa-miR-202-3p (5′-AGAGGTATAGGGCATGGGAA-3′)\nand hsa-miR-202-5p (5′- TTCCTATGCATATACTTCTTTG -3′) were purchased from Sangon\nBiotech Co. (Shanghai, China), and quantitative reverse transcription polymerase\nchain reaction (RT-qPCR) analysis was performed using the SYBR Green PCR Kit\n(CWBio) on an Applied Biosystems 7500 Real-time PCR system and related software\n(Applied Biosystems, Waltham, MA, USA). U6 snRNA was used as an internal control\nto normalize miRNA expression levels. Forward U6 primer:\n5′-CGCTTCGGCAGCACATATAC-3′; Reverse U6 primer: 5′-TTCACGAATTTGCGTGTCAT-3′. All\nsamples were run in triplicate, with the average value used for fold change\nvalues.\nStatistical analysis was performed using GraphPad Prism 6.0 (GraphPad Software,\nSan Diego, CA, USA) and SPSS software (version 20.0; IBM Corp., Armonk, NY,\nUSA). Two-tailed Student’s t-tests were used to identify statistically\nsignificant differences among the EMS and control groups. All experiments were\nperformed in triplicate and the results are expressed as mean ± standard\ndeviation (SD). A  P -value <0.05 was considered statistically\nsignificant.\n\nOverall, 11 patients were included in the EMS group. Of the 11 women in the\nnegative control group, 6 underwent hysteroscopic submucosal myomectomy and 5\nhad regular physical examinations. Exosomes were isolated from patients’\nleukorrhea and EEC cell supernatants, which were previously cultured in media\nsupplemented with exosome-free FBS for 48 hours, by ultracentrifugation as\npreviously described. We used TEM, NanoSight analysis, and western blot analysis\nto validate exosome purification. Representative TEM images show that the\nmajority of isolated exosomes were round-shaped and membrane-bound ( Figure 1a ). Particle size\nanalysis demonstrated that the diameter distribution of the exosomes ranged from\n60 to 150 nm, with an average of 95.5 nm ( Figure 1b ). Through western blotting, we\nexamined protein expression of CD63 and HSP70 to confirm the presence of these\nspecific exosomal markers ( Figure 1c ).\nCharacterization of endometrial cells and leukorrhea-derived exosomes.\n(a) Transmission electron microscope (TEM) images of exosomes isolated\nform endometrial cells. Scale bar = 20 nm by DLS and (b) Size\ndistribution analysis of isolated exosomes and (c) Western blot analysis\nof exosome-specific markers CD63 and HSP70. Exosome depleted supernatant\n(EDS) was included as a control.\nTo identify differentially expressed miRNAs in the exosomes derived from\nindividuals with and without EMS, we extracted miRNAs from the exosomes of both\ngroups and performed a miRNA microarray assay. Overall, 217 differentially\nexpressed miRNAs were identified from the microarray profiling ( Figure 2a–b ). We\nvalidated the results of the microarray analysis by examining the expression\nlevels of 11 identified miRNAs in exosomes from EMS patients (n = 6) and\nnegative controls (n = 5) through RT-qPCR assays. The data show that\nhsa-miR-202-3p/-5p expression levels were significantly higher in exosomes from\nEMS patients compared with those from the controls ( P  = 0.0194\n(miR-202-3p),  P  = 0.004 (miR-202-5p),  Figure 2c ). However, there was no\nsignificant differences in the expression levels of the other exosomal miRNAs\nbetween the EMS and negative control groups.\nExosomal microRNA (miRNA) microarray profiling and validation of\ndifferentially expressed exosomal miRNAs. (a) Heatmap of differential\nmiRNAs in tissue-derived exosomes. (b) Volcano map of differential miRNA\ngenes in tissue-derived exosomes with 133 upregulated and 54\ndownregulated differential miRNAs and (c) Hsa-miR-202-3p/5p expression\nlevels were significantly increased in tissue exosomes with ectopic\nendometrial tissue.\nWe aimed to determine if the exosomal miRNAs detected in endometrial cells could\nalso be identified in patients’ leukorrhea. This would suggest that they could\nbe used as non-invasive biomarkers for diagnosing EMS. Thus, we extracted\nexosomal miRNAs from leukorrhea in patients with EMS (n = 11) and negative\ncontrols (n = 11), then used RT-qPCR assays to examine the expression levels of\nthe 11 validated miRNAs. The data suggest that exosomal hsa-miR-202 expression\nlevels were significantly higher in leukorrhea from EMS patients than in that\nfrom the negative control group ( P  = 0.0126 (miR-202-3p),\n P  = 0.0238 (miR-202-5p),  Figure 3 ).\nExosomal hsa-miR-202-3p/5p expression is significantly higher in\nleukorrhea from patients with endometriosis.\n\nEMS remains one of the most common gynecological disorders, yet a non-invasive and\nspecific diagnostic biomarker is still urgently needed to improve early detection\nand treatment. Exosomes can be detected in almost all types of body fluids,\nincluding blood, urine, and leukorrhea, which has provided new opportunities to\ndevelop less invasive diagnostic approaches for various diseases. Recent studies\nhave shown that exosomal contents, including miRNAs, can be detected in serum,\ndemonstrating their potential for use as less invasive biomarkers for disease\ndiagnosis. 12\nMiRNAs, small non-coding RNAs that are about 22 to 24 nucleotides long, are highly\nconserved across species and can regulate protein expression levels by targeting\nspecific mRNAs. 13  MiRNAs are involved in various biological processes, such as\ncell proliferation, differentiation, and apoptosis. 14  These molecules can be highly\nenriched in exosomes and associated with different biological effects. 15  A previous\nstudy reported the role of exosomal miRNAs in relation to EMS\npathogenesis. 16  Numerous dysregulated and mutated miRNAs have been\nidentified in EMS, which can potentially control the aggressiveness and angiogenesis\nassociated with the disease. 17  Moreover, a recent study\nreported different expression profiles of exosomal miRNAs in serum from patients\nwith EMS, suggesting their potential role as biomarkers. 10  However, exosomes and\nexosomal miRNAs in leukorrhea from patients with EMS have not been well\ncharacterized. Our data suggest that miRNAs derived from leukorrhea are more\nrepresentative of the microenvironmental conditions inside the uterus and adnexa\nthan those derived from circulating exosomes.\nIn the current study, we isolated and identified exosomes from both endometrial cells\nand vaginal discharge (leukorrhea) from individuals with and without EMS. We first\nanalyzed the endometrial cell-derived exosomal miRNA expression profiles of the EMS\nand negative control groups using miRNA microarray. The results revealed that 217\nexosomal miRNAs were differentially expressed. We further validated the expression\nlevels of 11 exosomal miRNAs by performing RT-qPCR analysis, finding that\nhsa-miR-202-3p and hsa-miR-202-5p were significantly upregulated in exosomes derived\nfrom patients with EMS compared with negative controls. Next, we observed that both\nhsa-miR-202-3p and hsa-miR-202-5p were also significantly upregulated in leukorrhea\nexosomes from patients with EMS. Taken together, these observations suggest that\nleukorrhea exosomal hsa-miR-202-3p and hsa-miR-202-5p may serve as potential\nnon-invasive diagnostic biomarkers for EMS.\nAberrant expression patterns of hsa-miR-202-3p and hsa-miR-202-5p can reportedly\ncontribute to the progression of different types of diseases, including cancers,\nmetabolic disorders, and cardiovascular disease. For example, hsa-miR202-3p was\nreported to be involved in suppression of tumor cell proliferation, migration, and\ninvasion in gastric cancer. 18 , 19  Additionally, another study showed that high expression of\nhsa-miR-202-5p inhibited the tumorigenic potential of colorectal carcinoma cells by\ndownregulating oncogenic SMARCC1. 20  However, another study stated\nthat higher blood miR-202-3p expression levels were associated with an increased\nrisk of essential hypertension. 21  Furthermore, in EMS, a study\non differentially expressed miRNAs in eutopic and ectopic endometria showed that\nboth hsa-miR-202-3p and hsa-miR-202-5p expression levels were upregulated in ectopic\nendometrium. 22\nHere, we assessed and compared differentially expressed exosomal miRNA levels in\nnormal and ectopic endometrial cells and further identified their expression in\nleukorrhea-derived exosomes. Overall, our study demonstrates the possibility of\nusing leukorrhea-derived exosomal hsa-miR-202 as a biomarker for the non-invasive\ndiagnosis of EMS. However, because the number of patients and healthy subjects\nincluded in this study was low, the expression profiles of exosomal miRNAs in\nendometrial cells and leukorrhea need further verification by analyzing a larger\ncohort. Furthermore, the implication of exosomal miR-202 in EMS, specifically the\nmechanism underlying the pathogenesis of EMS mediated by exosomal miR-202, requires\nfurther exploration. In addition, the diagnostic value of miR-202, along with any\ncorrelations between exosomal miR-202 and clinicopathological features of EMS\npatients, should be further investigated in a subsequent study.\n\nThe identification and characterization of leukorrhea-derived exosomes and exosomal\nmiRNAs could provide a basis for the future development of less/non-invasive\nbiomarkers for diagnosing EMS. However, future studies are needed to validate the\nroles of such miRNAs in the development of EMS.","source_license":"CC0","license_restricted":false}