{"paper_id":"46c1d36c-ad1b-4b03-9ee2-2564b844f550","body_text":"Advancing reef restoration with thermal preconditioning interventions: species- and colony-specific responses of Montastraea cavernosa and Orbicella faveolata | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Advancing reef restoration with thermal preconditioning interventions: species- and colony-specific responses of Montastraea cavernosa and Orbicella faveolata Macarena Blanco-Pimentel, Serena Hackerott, Malique R. Bowen, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9372487/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Thermal stress is a dominant driver of coral reef degradation, challenging traditional restoration approaches and motivating interventions to enhance coral heat tolerance. Thermal preconditioning, which involves exposing corals to sublethal warming to induce physiological responses, has been proposed as one such strategy, but its effectiveness in scleractinian corals remains uncertain. Here, we evaluated whether short-term thermal preconditioning enhances physiological tolerance to acute heat stress in two Caribbean reef-building corals, Montastraea cavernosa and Orbicella faveolata , within a restoration-relevant framework. Eighteen colonies were exposed to a sublethal warming event, allowed to recover under ambient conditions, and then subjected to an acute heat stress assay. Stress responses were quantified using photochemical efficiency and pixel intensity-based color retention, alongside symbiont community composition. Additional preconditioned and control fragments were outplanted and monitored for one year to assess post-outplant pigmentation under non-stress field conditions. Thermal preconditioning did not consistently enhance tolerance. Responses differed markedly between species and among colonies, indicating strong intraspecific heterogeneity. Symbiont communities differed between species but remained stable across treatments and colonies, suggesting that responses were not driven by shifts in dominant symbionts. No differences in pigmentation trajectories were detected between preconditioned and control outplants under non-bleaching conditions. Together, these results indicate that thermal preconditioning is not a universally effective intervention and that its outcomes may depend on coral species, colony identity, and experimental context. This variability underscores the need for evidence-based and locally tailored application of preconditioning within coral restoration strategies. heat stress reef restoration coral bleaching Symbiodiniaceae symbiont community composition Caribbean reefs reef resilience colony-level variability Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Increasing frequency and intensity of coral bleaching events, primarily driven by climate change-induced marine heat waves, represent one of the most critical threats to the persistence of coral reef ecosystems globally (Oliver et al. 2019 ; Smith et al. 2025 ). Coral bleaching compromises reef functions and services by disrupting the coral-algal symbiosis, leading to reduced energy acquisition, enhanced vulnerability to additional stressors, and increased mortality risk (Baker et al. 2008 ). In the Caribbean, coral bleaching has worsened since the massive bleaching event of 1998, when over 50% of reefs were affected (Wilkinson 2000 ), followed by major regional events in 2005, 2010, and 2015, impacting up to 80% of reefs (Eakin et al. 2010 ; Alemu and Clement 2014 ; Eakin et al. 2026 ). Most recently, the 2023–2024 marine heatwave represented the most severe bleaching event recorded to date in the region, with unprecedented temperatures threatening the long-term resilience of Caribbean coral ecosystems (Wicquart et al. 2025 ; Spady et al. 2026 ). Securing the future of coral reefs requires addressing political and societal dimensions to mitigate greenhouse gas emissions and associated global threats, such as ocean warming and acidification, while simultaneously reducing local stressors (Ateweberhan et al. 2013 ; Duarte et al. 2020 ). Within this broader context, the potential of active restoration interventions in conserving reef functions and ecosystem services is increasingly recognized (National Academies of Sciences, Engineering, and Medicine 2019; Vinton et al. 2025 ). Traditional reef restoration efforts primarily rely on outplanting nursery-grown corals to degraded reefs; however, their long-term success remains constrained by ongoing thermal stress and recurrent bleaching events, among other threats (Boström-Einarsson et al. 2020 ). Consequently, restoration practices must continue to evolve by integrating scientific evidence while accounting for local environmental and socio-political contexts (Cortés-Useche et al. 2021 ; Hein et al. 2021 ; Bruce et al. 2025). Ecological evidence from reef environments characterized by high-frequency temperature variability suggests that corals can naturally acclimatize to thermal stress through physiological and molecular adjustments (Mayfield et al. 2013 ; Palumbi et al. 2014 ; Thomas et al. 2018 ; Schoepf et al. 2020 ). Similarly, some coral populations exhibit reduced susceptibility to successive bleaching events, consistent with short-term acclimatization or stress memory (Maynard et al., 2008 ; Ainsworth et al. 2016 ; Grottoli et al. 2014 ). These responses may reflect host-level plasticity, changes in symbiont physiology, or differences in symbiont community composition, including the dominance of thermally tolerant symbiont genera (Palumbi et al. 2014 ; Suggett et al. 2017 ). In pursuit of science-based restoration interventions to promote coral resilience to climate change, these natural patterns have motivated experimental approaches to induce similar protective responses through thermal preconditioning. Thermal preconditioning involves exposing the coral holobiont to moderate, sublethal thermal stress (“priming”) to induce physiological responses that may enhance tolerance to subsequent heat exposure (Hackerott 2021; van Oppen et al. 2015 ). Although sublethal temperature exposure may entail short-term physiological costs, these can be outweighed by increased tolerance to later thermal stress events (Hilker et al. 2016 ; Drury et al. 2022 ; Martell 2023 ; DeMerlis et al. 2025). Reported costs include reduced growth in corals hosting heat-tolerant symbionts (Jones and Berkelmans 2010 ) and metabolic shifts associated with short-term acclimatization (Gibbin et al. 2018 ). In contrast, benefits may include reduced bleaching severity, improved recovery capacity, and enhanced thermotolerance during acute heat stress (Middlebrook et al. 2008 ; Majerova et al. 2021; Majerova and Drury 2022). However, the magnitude and consistency of these benefits may vary across species, genotypes, and environmental conditions (Edmunds 2014 ; Drury et al. 2022 ; DeMerlis et al. 2025), and comparative assessments of preconditioning outcomes across these contexts remain limited, particularly under standardized, restoration-relevant experimental frameworks. To date, thermal preconditioning has been evaluated in both ex situ aquaria and in situ nursery settings by comparing the stress responses of preconditioned (previously exposed) and naive (non-exposed) corals during controlled heat exposure (Dilworth et al. 2021; Hackerott et al. 2021 ). A growing body of evidence has shown that prior exposure to sublethal temperatures can enhance coral thermotolerance during acute heat stress events (Middlebrook et al. 2008 ; Bellantuono et al. 2012 ; DeMerlis et al. 2022 ; 2025; Middlebrook et al. 2012; Silverstein et al. 2015 ; Majerova et al. 2021; Ferrara et al. 2025 ). However, outcomes remain highly sensitive to experimental design, including temperature profiles, exposure duration, heating rates, and the coral species and genotypes involved (Dilworth et al. 2021; Drury et al. 2022 ; Martell 2023 ; Sahin et al. 2023 ; Ferrara et al. 2025 ). Enhanced tolerance is thought to result from stress memory within the coral holobiont, involving genetic and epigenetic regulation, transcriptional modulation, and shifts in symbiont and microbial communities (Hackerott et al. 2021 ; Drury 2020 ; Drury et al. 2022 ; Martell 2023 ; DeMerlis et al. 2025). Together, these mechanisms suggest that controlled sublethal stress can induce physiological states associated with increased thermal tolerance, providing a clear rationale for thermal preconditioning as an applied intervention. In a restoration context, thermal preconditioning has therefore been proposed as a strategy to enhance the resilience of nursery-reared corals before outplanting (Martell 2023 ). However, key uncertainties remain regarding species and colony-level variability, potential trade-offs affecting other fitness-related traits, and the extent to which short-term experimental benefits translate into longer-term fitness and performance following outplanting (Peixoto et al. 2025 ; Hulver et al. 2025). In this study, we evaluated the effectiveness and practical relevance of short-term thermal preconditioning under controlled conditions within a local restoration context. Using two key Caribbean reef-building species, Montastraea cavernosa (Linnaeus 1767) and Orbicella faveolata (Ellis and Solander 1786), we compared physiological stress responses of preconditioned and naive coral fragments to test whether short-term priming enhances thermotolerance during acute heat stress. Additionally, we assessed response variability among colonies within each species to examine the roles of colony-level heterogeneity and phenotypic plasticity in shaping thermotolerance outcomes. We compared these responses with those of the symbiont community to explore potential host-symbiont contributions to the observed patterns. Following the experimental phase, a one-year post-outplant field monitoring period was incorporated to assess changes in pigmentation (quantified as image-derived pixel intensity and color retention) of control and preconditioned fragments as an indicator of post-restoration physiological performance under natural, non-bleaching conditions. Together, this integrative approach provides insight into the potential and limitations of short-term thermal preconditioning as a tool for coral restoration under warming conditions. MATERIALS AND METHODS Coral collection and experimental design Colonies of Montastraea caveronsa (n = 9) and Orbicella faveolata (n = 9) were collected in August 2024 from five reef sites in the southeastern Dominican Republic at a mean depth of 9.9 ± 2.3 m (Fig. S1 ; Table S1 ). All colonies were selected based on being sufficiently large (i.e., able to provide the required number of fragments without exceeding approximately 10% removal of colony tissue) and visually healthy, and were spaced at least 5 m apart to minimize clonal sampling. Coral fragments were collected from colony edges using a hammer and chisel, labeled, and transported in individual seawater-filled plastic bags to Iberostar’s Coral Lab (Fig. S2). Upon arrival, fragments were transferred to four experimental tanks operating as an open-flow seawater system equipped with a locally designed temperature control system (Blanco-Pimentel et al. 2025). Lighting was provided by LED aquarium fixtures (Hydra 32HD, AquaIllumination, USA) set to ~ 250 µmol photons m − ² s − ¹ on a 12:12 h light-dark cycle, including a 3-h ramp-up and ramp-down period to simulate sunrise and sunset. Water temperature was recorded every five minutes using HOBO Pendant temperature/light loggers (UA-001-64; Onset Computer Corporation, USA) (Fig. S3). Corals were fragmented the following morning, and each colony was subdivided into 18 fragments of different sizes: eight medium fragments (~ 4–8 cm²), six small fragments (~ 2–4 cm²), and four microfragments (~ 0.5-2 cm²), resulting in 18 replicates per colony (Fig. 1 ). Fragment sizes were selected to optimize tissue allocation for different experimental purposes: medium fragments were designated for outplanting, small fragments for the short-term heating assay, and microfragments for symbiont genetic analyses. The experimental design consisted of four sequential phases: (1) Acclimation, (2) Priming (thermal preconditioning), (3) Recovery, and (4) Short-term Heating (Fig. 1 ). During Acclimation and Priming, naive fragments (all size classes) were distributed across two tanks, while preconditioned fragments were maintained in the remaining two tanks. Prior to the Short-term Heating, fragments were reassigned by size and experimental purpose: medium fragments were retained under control tanks for subsequent outplanting, and small fragments (both naive and preconditioned) were used in the Short-term Heating. Acclimation and Recovery each lasted one week and were conducted at 28°C, which reflects ambient, non-peak summer temperatures in the study area. Long-term temperature records from one of the collection sites (Coco Reef) indicate a mean temperature of 27.6 ± 0.7°C between December and May (2018–2024) (Fig. S4), while the regional Maximum Monthly Mean (MMM) temperature is 28.5°C (NOAA Coral Reef Watch database). The Priming phase lasted one week and consisted of a gradual temperature increase from 28°C to 31°C over three days (1°C/day), after which fragments were maintained at 31°C for approximately 3.5 days. Temperatures were then gradually returned to control levels during the final six hours of day fourteen. This priming temperature and ramping protocol were consistent with previous thermal preconditioning studies conducted on Caribbean reef corals and were designed to simulate ecologically relevant, sublethal warming while minimizing acute thermal shock (Middlebrook et al. 2008 ; Bellantuono et al. 2012 ; Silverstein et al. 2015 ; Dilworth et al. 2021; Majerova et al. 2021; DeMerlis et al. 2025). Following the Recovery phase (7 days at 28°C), which allows corals to stabilize physiologically and potentially retain the effects of thermal priming (Silverstein et al. 2015 ), a short-term heat-stress assay (“Short-term Heating”) was conducted to compare responses between preconditioned and naive fragments. The Short-term Heating followed a standardized acute thermal exposure profile commonly used in short-term stress frameworks (Voolstra et al. 2020 ; Cunning et al. 2024 ). Here, the temperature was increased to 36°C over three hours, maintained at 36°C for three hours, and then ramped down to the control temperature over the subsequent hour. This temperature corresponded to the bleaching threshold previously identified for M. cavernosa in the study area and slightly exceeded that of O. faveolata (~ 35.5°C; Blanco-Pimentel et al. 2025). A single maximum temperature was used to ensure direct comparability of thermal responses and to maintain consistency with standardized short-term stress protocols. To assess potential changes in the symbiont community associated with thermal priming and recovery, microfragments were sampled immediately after the Priming phase and again after the Recovery phase (Table S2). Thermal stress response metrics Thermal stress responses were assessed using two complementary physiological metrics: photochemical efficiency ( F v /F m ) and tissue pigmentation derived from photographic pixel intensity. Photochemical efficiency ( F v /F m ) was measured using pulse amplitude modulation (PAM) chlorophyll a fluorometry (Junior-PAM, Walz) on coral fragments that were dark-acclimated for 30 minutes (Kitajima and Butler 1975; Maxwell and Johnson 2000). F v /F m was recorded after the Priming phase, the Recovery phase, and the Short-term Heating, to assess both short-term responses and the persistence of priming effects. Fluorometer settings were kept constant across all measurements (measuring light intensity = 6; gain = 2; saturation pulse intensity = 8; width = 0.6). Changes in tissue pigmentation were quantified through photographic analysis of red-channel pixel intensity as a proxy for bleaching-related loss of symbionts and/or chlorophyll pigments (Winters et al. 2009). Photographs were taken following the Short-term Heating, approximately 6.5 hours after the control temperature was reached. Images were acquired under standardized conditions and calibrated using a grayscale reference (Kodak Color Separation Guide and Gray Scale Q-13). Image processing and analysis followed established approaches, with red-channel pixel intensity used as an indicator of tissue paling associated with thermal stress (Winters et al. 2009; Voolstra et al. 2020 ). F v /F m reflected acute effects on symbiont photochemistry and pixel intensity captured integrated bleaching outcomes following thermal exposure. Symbiont community composition Coral tissue was sampled by gentle scraping with a sterile needle and syringe. Collected tissue was transferred to individual sample tubes, briefly centrifuged, and preserved in dimethyl sulfoxide preservation buffer (DMSO) prior to storage at -20°C. Preserved samples were subsequently shipped to the University of Delaware for DNA extraction and downstream analyses. Genomic DNA was extracted from preserved coral tissue using the Zymo Quick-DNA™ MiniPrep Kit (Zymo Research, USA) following the manufacturer’s protocol, with minor modifications to the homogenization step. DNA quantity and quality were assessed using fluorometry (Qubit™ 4 Fluorometer, dsDNA Broad Range Assay; Thermo Fisher Scientific) and spectrophotometry (NanoDrop™ 2000c, Thermo Fisher Scientific), and integrity was verified by agarose gel electrophoresis. DNA was normalized to 10 ng/µL prior to downstream symbiont analyses, with undiluted extracts used for low-concentration samples. Symbiont community composition analysis (qPCR) Symbiont community composition was assessed using quantitative PCR (qPCR) to assess the relative abundance of algal genera, specifically Symbiodinium , Breviolum , Cladocopium , and Durusdinium . Genus-specific primers were developed by McGinley ( 2012 ) and analysed using the thermal profiles described in Gantt et al. (2023). Primer sequences are provided in Table 1 . Standard curves were generated from DNA extracted from 10 6 cells of pure cultures of each symbiont genus and serially diluted (1:5) to produce a 10-point standard curve. Standard curves and no-template controls (NTCs) were included on every qPCR run. qPCR reactions were performed using PowerUp SYBR Green Master Mix (Applied Biosystems, Location, USA) in a total reaction volume of 10 µL, consisting of 5 µL of 2 x master mix, 1 µL of forward primer, 1 µL of reverse primer, 2 µL of molecular-grade water, and 1 µL of standardized template DNA. Final primer concentrations were 900 nM for Symbiodinium , Breviolum , and Cladocopium , while the forward primer concentration for Durusdinium was reduced to 300 nM. Reactions were run on a Mx5005P thermocycler using the MxPro software in 96-well plates. Thermal cycling conditions consisted of an initial hold at 50°C for 2 min, followed by 95°C for 10 min, and 40 amplification cycles of 95°C for 15 s (denaturation), annealing at 66°C for Symbiodinium and Breviolum or 61°C for Cladocopium and Durusdinium , and 72°C for 34 s (extension). Genus-specific assays were performed in technical duplicate, and cycle threshold (Ct) values were averaged across replicates. Genus-specific gene copy numbers were calculated using thermocycler software based on genus-specific standard curves included on each plate. Standard curves were generated from serial dilutions of samples with known cell abundances, and Ct values were used to estimate gene copy numbers in unknown samples through linear regression. Gene copy quantities were converted to estimated cell abundances by accounting for clade-specific variation in actin gene copy number, as the primers target the actin gene rather than the ITS regions. Genus-specific values were then normalized within each sample to obtain relative proportions. Table 1 Symbiodiniaceae genus-specific qPCR primers. Genus Forward Primer (3′-5′) Reverse Primer (5′-3′) Symbiodinium CCGCGACGTCAAGGAGAAGC GCAGACTGCGGATGAACCTGTTCCA Breviolum TCCCTGTAAACCCTGTCATTCGTAGT CCCGGAATTTGTGCAAGCTTCGT Cladocopium TTGGTGGTGTTCAGCAGTAAGA TGATCCCCGGCCAAAAATG Durusdinium GGAGTGCCGTATTGTGGAAGC CGGCGTGTAAAGCGTCAAGAGA Outplanting and field monitoring The medium-sized coral fragments of both taxa were outplanted to a local restoration site at approximately 10 m depth (Fig. S2). Post-outplant pixel intensity measurements were collected over 1 year to characterize relative changes in the color of control and preconditioned coral under natural field conditions. While no natural bleaching occurred during the outplant period, temporal variation in pixel intensity reflects changes in symbiont density and/or chlorophyll content, providing insight into physiological dynamics following outplanting. Fragments were attached to the reef using custom-made cement dome structures with perforations designed to accommodate individual coral cement plugs (Fig. S5). Each dome contained replicate fragments originating from the same parent colony to promote fusion among conspecific fragments. Separate dome structures were assigned to control and preconditioned fragments. Domes were subsequently secured to the reef substrate using the same locally prepared cement mixture. Coral fragments were photographed at seven time points (including an initial pre-outplant baseline in August 2024, followed by October 2024, November 2024, January 2025, April 2025, July 2025, and August 2025) using an Olympus TG-6 underwater camera, with each image including a laminated grayscale reference (Kodak Color Separation Guide and Gray Scale Q-13) for standardized image calibration. Photographs were used to assess color intensity, with pigmentation quantified by analyzing red-channel pixel intensities using the same image-based approach described for experimental measurements. Data analyses Statistical analyses and graphics were performed using R version 4.2.1 (R Core Team, 2022) within RStudio version 1.4.1106 (RStudio Team, Boston, MA, USA), using the packages lme4 (Bates et al. 2015 ) and lmerTest (Kuznetsova et al. 2017 ) for linear mixed-effects modelling; emmeans (Lenth 2020 ) with Tukey adjustment for post-hoc comparisons; vegan (Oksanen et al. 2022 ) for permutational multivariate analysis of variance (PERMANOVA); and tidyverse (Wickham et al. 2019 ), including dplyr, tidyr, and ggplot2, for data manipulation and visualization. Treatment and species effects were evaluated using linear mixed-effects models (LMMs) with species ( Montastraea cavernosa , Orbicella faveolata ) and treatment (naive, preconditioned) as fixed effects and colony as a random intercept to account for colony-level variability. Model structures followed the general structure: response ~ species × treatment + (1 | colony) For F v /F m , models were fitted independently for measurements obtained after the Priming phase, after the Recovery phase, and following the Short-term Heating. Measurements obtained after Priming and Recovery were used to assess whether thermal priming induced immediate changes in photochemical efficiency and whether such effects persisted prior to acute heat exposure. After Short-term Heating analyses of F v /F m , control fragments were excluded from statistical models and retained only for visual reference, as the primary comparison of interest was between naive and preconditioned corals under acute thermal stress. For pixel intensity, data were expressed as retention values (%), calculated by dividing the mean colony-specific control pixel intensity measured under Short-term Heating conditions by the pixel intensity of each heated fragment, and multiplying by 100. As pixel intensity increases with tissue paling, a higher percent retention equates to greater symbiont and/or chlorophyll retention (i.e., reduced bleaching). This approach was used because pixel intensity lacks a standardized stress scale, and baseline coloration can vary substantially among colonies. Retention values were log-transformed prior to analysis to meet model assumptions. To evaluate the influence of individual colonies on treatment-level patterns, leave-one-out (LOO) resampling (Stone 1974 ) was conducted using colony-level mean values measured at the end of the Short-term Heating. For each response metric, the corresponding treatment-level model described above was iteratively refitted after excluding each colony in turn. The influence of each colony on model performance was assessed using root mean square error (RMSE), which quantifies the difference between the observed response of the excluded colony and the values predicted by the model fitted to the remaining colonies. Per-colony treatment deltas (Δ) were calculated after the Short-term Heating for both metrics as the difference between the mean preconditioned and mean naive values within each colony, providing a concise visual summary of the magnitude and direction of colony-specific responses. Symbiont community composition was analysed at the sample level using PERMANOVA, based on Bray-Curtis dissimilarities of genus-level relative abundances. The effects of species, treatment, and timepoint (i.e., tissue collection time), and their interactions, were tested using permutations constrained at the colony level. Pixel intensity of outplanted fragments was expressed as fragment-specific retention (%) relative to August 2024 measurements (defined as time 0 after priming). Changes in retention were analysed using a linear mixed-effects model including treatment, time, and species as fixed effects, and colony identity and fragment identity as random effects to account for non-independence among fragments from the same colony and repeated measurements through time. RESULTS Photochemical efficiency following Priming and Recovery Across both species, F v /F m values remained high, with values consistent with minimal photoinhibition (after Priming: > 0.48; after Recovery: > 0.44; Fig. 2 ) (Warner et al. 1999 ). When comparing treatments, F v /F m was slightly but significantly lower in preconditioned fragments than in naive controls ( F ₁,₉₁.₅₁₆ = 8.17, p = 0.0053), whereas the species × treatment interaction was not significant. After the Priming phase, F v /F m differed significantly between species ( F ₁,₉₁.₁₂₆ = 99.10, p ≤ 0.001; Fig. 2 ), with O. faveolata showing higher values than M. cavernosa . After the Recovery phase, this species-level difference persisted ( F ₁,₉₈ = 73.05, p ≤ 0.001; Fig. 2 B). In contrast to the Priming endpoint, neither treatment nor the species × treatment interactions was significant after Recovery. Physiological responses to Short-term Heating: treatment and species effects Thermal preconditioning did not significantly influence physiological responses to Short-term Heating, and this effect did not differ between species. Across species, preconditioning was not associated with significant changes in either photochemical efficiency (Fig. 3 A) or coral color (Fig. 3 B). Similarly, the species × treatment interaction was not significant for either metric. In contrast, interspecific differences were observed in both physiological responses. Species identity had a pronounced effect on F v /F m (F₁,₉₁.₀₉ = 219.17, p ≤ 0.001), with O. faveolata maintaining significantly higher photochemical efficiency than M. cavernosa under heat stress. Montastraea cavernosa exhibited a marked reduction in F v /F m relative to controls, whereas O. faveolata showed a comparatively smaller decline. Species identity also had a significant effect on log-transformed pixel intensity retention ( F ₁,₉₁.₀₃₅ = 90.56, p ≤ 0.001). Montastraea cavernosa showed higher retention values than O. faveolata , indicating greater relative maintenance of symbiont-associated pigmentation under heat stress. Colony-level variability and associated symbiont community patterns Heterogeneity in physiological responses to thermal stress Colony-level variability was examined to evaluate whether individual colonies disproportionately influenced treatment-level responses after the Short-term Heating. Although predictive error varied among colonies, exclusion of any single colony did not materially alter treatment-level effect sizes or overall model performance for either physiological metric. Predictive error (RMSE) varied among colonies, with generally low values for F v /F m and greater dispersion for pixel intensity retention (Fig. S6). Despite this variation, treatment-level effect size estimates remained stable across model iterations for both response metrics, with only minor variation in model fit. Colony-specific responses (Δ = preconditioned - naive) varied in both magnitude and direction across species and metrics (Fig. 4 ). Δ F v /F m values were generally small and centered near zero, whereas pixel intensity retention showed greater variability among colonies, with both positive and negative responses observed across species. Symbiont community composition across colonies and species Orbicella faveolata was predominantly associated with Durusdinium , whereas M. cavernosa was mainly associated with Cladocopium (Fig. 5 ). This species-specific dominance of symbionts was consistent across colonies and remained stable throughout the experimental phases. No significant differences in symbiont composition were detected between treatments or experimental phases, and Symbiodinium and Breviolum were present only at low relative abundances. PERMANOVA revealed a significant effect of species on symbiont community composition (F₁,₁₀₂ =27.23, R² = 0.211, p ≤ 0.001), whereas no significant effects of treatment, timepoint, or their interactions were detected. These results indicate that symbiont composition was primarily structured by host species and remained stable across experimental conditions. Post-outplant color dynamics under natural field conditions Outplant color retention had significant effects of treatment (F₁,₃₂.₂ = 12.48, p ≤ 0.00), time (F₅,₁₃₄.₉ = 16.63, p ≤ 0.001), and species (F₁,₂₃.₅ = 7.36, p = 0.012) (Fig. 6 ). No significant interactions among them were observed. Overall, significant differences between treatments were observed primarily in M. cavernosa , where preconditioned fragments showed lower retention than controls at specific time points, as indicated by post hoc comparisons (Fig. 6 ; Table S3), whereas no significant differences between treatments were detected in O. faveolata . Species-specific differences were detected under control conditions, with M. cavernosa exhibiting higher retention than O. faveolata at multiple timepoints (Fig. 6 ; Table S3). In contrast, no significant differences between species were detected within the preconditioned treatment. Retention values changed over time across both species and treatments, consistent with the significant temporal effect. DISCUSSION Species-specific responses dominated physiological patterns Species identity appeared to be the main factor structuring physiological responses across experimental phases. Differences between Montastraea cavernosa and Orbicella faveolata were consistently observed in photochemical efficiency ( F v /F m ) regardless of preconditioning treatment (Figs. 2 , 3 ). Under the applied short-term heat stress, responses further differed between species and physiological metrics, with contrasting patterns in both F v /F m and pigmentation responses (Fig. 3 ). Photochemical efficiency declined more markedly in M. cavernosa , whereas O. faveolata showed comparatively lower pigmentation retention. These contrasting responses may indicate that different aspects of coral physiology responded to thermal stress in each species, rather than reflecting overall differences in performance. Symbiont community composition provided additional context for these patterns. O. faveolata was predominantly associated with Durusdinium , while M. cavernosa was mainly associated with Cladocopium (Fig. 5 ), and these associations remained stable across treatments and experimental phases. These patterns are consistent with observations from the same and nearby reefs of the southeastern Dominican Republic, where O. faveolata populations have been shown to associate with both genera (O’Donnell et al. 2025 ). Moreover, the dominance of Durusdinium in O. faveolata is consistent with previous studies linking this genus to enhanced thermal tolerance and bleaching resistance (Berkelmans and van Oppen 2006 ; Manzello et al. 2019 ). Together, these results suggest that intrinsic species-level traits, including stable host-symbiont associations, played a stronger role in shaping physiological responses than short-term thermal preconditioning. Limited and context-dependent effects of short-term thermal preconditioning Thermal preconditioning did not lead to a clear improvement in thermal tolerance, with similar responses observed between treatments across both F v /F m and pigmentation metrics in the two species (Fig. 3 ). Although preconditioned fragments showed a small reduction in F v /F m immediately following the priming phase, this difference did not persist after recovery, and both treatments entered the acute heat stress assay with comparable baseline photochemical efficiency, within ranges typically associated with healthy physiological function (Fig. 2 ; Warner et al. 1999 ; Evensen et al. 2022 ). This suggests that the initial decline reflects a transient physiological adjustment to sublethal thermal exposure, rather than a lasting impairment of baseline function (Bellantuono et al. 2012 ; Putnam and Gates 2015 ). The absence of a detectable priming effect likely reflects the interaction between the applied thermal profile and species-specific physiological responses. Experimental evidence increasingly shows that the magnitude and temporal structure of thermal exposure strongly influence whether priming responses emerge. For example, variable temperature regimes have been found to enhance thermotolerance compared with sustained exposures, while improvements are often associated with intermediate levels of thermal variability; both low and highly variable regimes tend to result in inconsistent outcomes (Brown et al. 2024 ; DeMerlis et al. 2025). In addition, heating rate and cumulative stress exposure can further modulate physiological responses, even under comparable thermal regimes, highlighting that not only the magnitude of temperature but also how it is applied over time can shape coral stress responses (Martell and Zimmerman 2021 ; Klepac and Barshis 2022 ). Although F v /F m and pigmentation were assessed at commonly used timepoints in acute heat stress assays (Voolstra et al. 2020 ; Evensen et al. 2022 ; Klepac and Barshis 2022 ), priming effects may have occurred outside the sampling window and therefore remained undetected. Additionally, the physiological response to thermal stress can be strongly influenced by prior environmental exposure. In this study, colonies were collected from reefs that had experienced relatively elevated temperatures in the months preceding collection (Fig. S4; Smith et al. 2025 ; Spady et al. 2026 ), which may have already induced some degree of acclimatization and reduced the contrast between treatments. Similar patterns have been reported where recent sublethal thermal exposure can limit the expression of priming responses (Sahin et al. 2023 ; Ferrara et al. 2025 ). These findings are consistent with studies showing that species-specific physiological responses can dominate over treatment effects, particularly under acute stress conditions (Sweet et al. 2021 ; Sahin et al. 2023 ). Together, they support the idea that short-term thermal preconditioning does not uniformly enhance coral thermal tolerance, but instead produces context-dependent outcomes that may not be detectable under all experimental scenarios. Colony-level variability and its limited influence on treatment outcomes Although treatment-level effects were not detected, responses to thermal stress were not uniform across colonies. Colony-level variability was more pronounced for pigmentation metrics than for photochemical efficiency, suggesting that pigmentation dynamics may be more sensitive to colony-specific characteristics (Fig. 4 ). However, leave-one-out analyses indicated that no single colony disproportionately influenced treatment-level estimates, and overall model performance remained stable across model iterations. This suggests that, while intraspecific variability exists, it did not obscure a strong treatment signal in this study. Colony-level variation in stress responses has been reported in other coral studies, where genotype-specific differences can influence bleaching and recovery dynamics (Ladd et al. 2017 ; Manzello et al. 2019 ). In the present study, the observed variability reinforces that responses to thermal stress can differ among colonies, even when treatment-level effects are not apparent. Post-outplant pigmentation dynamics under natural field conditions Thermal preconditioning did not improve pigmentation retention after outplanting under natural field conditions. Instead, treatment-level differences were observed primarily in M. cavernosa , where preconditioned fragments showed lower retention than controls at specific timepoints (Fig. 6 ). Temporal trajectories were broadly similar across treatments, suggesting that responses were driven by the transition from laboratory to field conditions, with early changes in pigmentation likely reflecting photoacclimation to the new light environment. Although both treatments experienced similar light conditions after outplanting, differences in their physiological state at the time of transplantation may have led to different photoacclimation responses, contributing to the observed divergence during the initial monitoring period. Photoacclimation is well documented in reef-building corals, where changes in light can lead to rapid adjustments in symbiont density and pigmentation (Enríquez et al. 2005 ; Scheufen et al. 2017 ). Similar shifts have been observed after transplantation, even in the absence of thermal stress, as corals adjust to new light conditions (Brown et al. 2015 ; Wangpraseurt et al. 2014 ). No bleaching events or extreme thermal anomalies occurred during the field phase. Therefore, this phase did not test resistance to acute thermal stress, but rather the persistence of treatment effects under ambient conditions. Although some studies suggest that corals can retain acclimatized traits after environmental change (Brown et al. 2015 ), evidence for long-term physiological “memory” remains limited and context-dependent. These results suggest that short-term priming did not confer a clear advantage under non-stressful field conditions, and that observed differences in pigmentation were more likely driven by environmental acclimation following outplanting than by enhanced thermal resilience. Implications for restoration and future directions Overall, species identity and stable symbiont associations were more likely stronger drivers of physiological responses than short-term thermal preconditioning. While priming did not produce detectable improvements in thermal tolerance or consistent benefits after outplanting, this does not rule out its potential use as a valuable restoration tool. Instead, these findings highlight that thermal preconditioning is likely to be context-dependent, with outcomes influenced by species traits, colony-level variability, and environmental history. From a practical perspective, this suggests that priming approaches should be tailored to specific species and environmental conditions rather than applied uniformly. Future work should focus on refining priming protocols, including the magnitude and duration of thermal exposure, and on evaluating their effectiveness under natural thermal stress events. Integrating controlled experiments with long-term field monitoring will be essential to determine whether preconditioning can enhance coral performance under real-world conditions, particularly during periods of elevated thermal stress. Declarations Author Contribution M.B.P. and S.H. designed the study in collaboration with S.E.T.v.d.M. and M.E.W. M.B.P., S.H., F.A.S.-V., G.P., and S.M. conducted the experimental work. All authors contributed to data analysis and interpretation. M.B.P. wrote the first draft of the manuscript, and all authors contributed to writing, provided critical revisions, and approved the final version. Acknowledgement This work was supported by the Iberostar Group through the Wave of Change Innovation Hub, the University of Groningen, and the University of Delaware. We thank all staff and collaborators involved in coral husbandry, experimental setup, molecular laboratory analyses, and logistical and technical support. We are grateful to the Ministry of Environment and Natural Resources of the Dominican Republic for granting the research and export permits required for this study. We also thank Dressel Divers for their support with scuba diving during sample collection, outplanting, and field monitoring. Data Availability The datasets generated and analysed during the current study will be made publicly available in a suitable repository upon acceptance. References Ainsworth TD, Heron SF, Ortiz JC, Mumby PJ, Grech A, Ogawa D, Eakin CM, Leggat W (2016) Climate change disables coral bleaching protection on the Great Barrier Reef. Science 352:338–342. https://10.1126/science.aac7125 Alemu IJB, Clement Y (2014) Mass coral bleaching in 2010 in the southern Caribbean. PLoS One 9:e83829. https://doi.org/10.1371/journal.pone.0092542 Ateweberhan M, Feary DA, Keshavmurthy S, Chen A, Schleyer MH, Sheppard CRC (2013) Climate change impacts on coral reefs: synergies with local effects, possibilities for acclimation, and management implications. Mar Pollut Bull 74:526–539. https://doi.org/10.1016/j.marpolbul.2013.06.011 Baker AC, Glynn PW, Riegl B (2008) Climate change and coral reef bleaching: an ecological assessment of long-term impacts, recovery trends and future outlook. Estuar Coast Shelf Sci 80:435–471. https://doi.org/10.1016/j.ecss.2008.09.003 Bates D, Mächler M, Bolker B, Walker S (2015) Fitting linear mixed-effects models using lme4. J Stat Softw 67:1–48. https://doi.org/10.18637/jss.v067.i01 Bellantuono AJ, Granados-Cifuentes C, Miller DJ, Hoegh-Guldberg O, Rodriguez-Lanetty M (2012) Coral thermal tolerance: tuning gene expression to resist thermal stress. PLoS One 7:e50685. https://doi.org/10.1371/journal.pone.0050685 Berkelmans R, van Oppen MJH (2006) The role of zooxanthellae in the thermal tolerance of corals: a ‘nugget of hope’ for coral reefs in an era of climate change. Proc Biol Sci 273:2305–2312. https://doi.org/10.1098/rspb.2006.3567 Boström-Einarsson L, Babcock RC, Bayraktarov E, Ceccarelli D, Cook N, Ferse SCA, Hancock B, Harrison P, Hein M, Shaver E, Smith A, Suggett DJ, Stewart-Sinclair PJ, Vardi T, McLeod IM (2020) Coral restoration - A systematic review of current methods, successes, failures and future directions. PLoS One 15:e0226631. https://doi.org/10.1371/journal.pone.0226631 Brown BE, Dunne RP, Edwards AJ, Sweet MJ, Phongsuwan N (2015) Decadal environmental ‘memory’ in a reef coral? Mar Biol 162:479–483. https://doi.org/10.1007/s00227-014-2596-2 Brown KT, Martynek MP, Barott KL (2024) Local habitat heterogeneity rivals regional differences in coral thermal tolerance. Coral Reefs 43:571–585. https://doi.org/10.1007/s00338-024-02484-x Bruce Evan Goldstein, Caribbean Restoration Interventions Forum (2025) Advancing coral reef interventions in the Caribbean: overcoming barriers and enabling action. Coral Restoration Consortium . m. https://doi.org/10.5281/zenodo.17603166 Cortés-Useche C, Hernández-Delgado EA, Calle-Triviño J, Blasco RS, Galván V, Arias-González JE (2021) Conservation actions and ecological context: optimizing coral reef local management in the Dominican Republic. PeerJ 9:e10925. https://10.7717/peerj.10925 Cunning R, Matsuda SB, Bartels E, D’Alessandro M, Detmer AR, Harnay P, Levy J, Lirman D, Moeller HV, Muller EM, Nedimyer K (2024) On the use of rapid acute heat tolerance assays to resolve ecologically relevant differences among corals. Coral Reefs 43:1793–1801. https://doi.org/10.1007/s00338-024-02577-7 DeMerlis A, Kirkland A, Kaufman ML, Mayfield AB, Formel N, Kolodziej G, Manzello DP, Lirman D, Traylor-Knowles N, Enochs IC (2022) Pre-exposure to a variable temperature treatment improves the response of Acropora cervicornis to acute thermal stress. Coral Reefs 41:435–445. https://doi.org/10.1007/s00338-022-02232-z Drury C (2020) Resilience in reef-building corals: the ecological and evolutionary importance of the host response to thermal stress. Mol Ecol 29:448–465. https://doi.org/10.1111/mec.15337 Drury C, Dilworth J, Majerová E, Caruso C, Greer JB (2022) Expression plasticity regulates intraspecific variation in the acclimatization potential of a reef-building coral. Nat Commun 13:4790. https://doi.org/10.1038/s41467-022-32452-4 Duarte CM, Agustí S, Barbier E, Britten GL, Castilla JC, Gattuso JP, Fulweiler RW, Hughes TP, Knowlton N, Lovelock CE, Lotze HK, Predragovic M, Poloczanska ES, Roberts C, Worm B (2020) Rebuilding marine life. Nature 580:39–51. https://doi.org/10.1038/s41586-020-2146-7 Eakin CM, Heron SF, Connolly SR, Devotta DA, Liu G, Geiger EF, De La Cour JL, Gomez AM, Skirving WJ, Baird AH, Cantin NE (2026) Severe and widespread coral reef damage during the 2014–2017 Global Coral Bleaching Event. Nat Commun 17(1):1318. https://doi.org/10.1038/s41467-025-67506-w Eakin CM, Morgan JA, Heron SF, Smith TB, Liu G, Alvarez-Filip L, Baca B, Bartels E, Bastidas C, Bouchon C, Brandt M (2010) Caribbean corals in crisis: record thermal stress, bleaching, and mortality in 2005. PLoS One 5:e13969. https://doi.org/10.1371/journal.pone.0013969 Edmunds PJ (2014) Is acclimation beneficial to scleractinian corals, Porites spp.? Mar Biol 161:1531–1542. https://doi.org/10.1007/s00227-014-2438-2 Enríquez S, Méndez ER, Iglesias-Prieto R (2005) Multiple scattering on coral skeletons enhances light absorption by symbiotic algae. Limnol Oceanogr 50:1025–1032. https://doi.org/10.4319/lo.2005.50.4.1025 Evensen NR, Voolstra CR, Fine M, Perna G, Buitrago-López C, Cárdenas A, Banc-Prandi G, Rowe K, Barshis DJ (2022) Empirically derived thermal thresholds of four coral species along the Red Sea using a portable and standardized experimental approach. Coral Reefs 41:239–252. https://doi.org/10.1007/s00338-022-02233-y Ferrara EF, Roik A, Wöhrmann-Zipf F, Ziegler M (2025) Ex situ thermal preconditioning modulates coral physiology and enhances heat tolerance: a multispecies perspective for active restoration. Environ Sci Technol 59:8527–8540. https://doi.org/10.1021/acs.est.4c08640 Gibbin EM, Krueger T, Putnam HM, Barott KL, Bodin J, Gates RD, Meibom A (2018) Short-term thermal acclimation modifies the metabolic condition of the coral holobiont. Front Mar Sci 5:10. https://doi.org/10.3389/fmars.2018.00010 Grottoli AG, Warner ME, Levas SJ, Aschaffenburg MD, Schoepf V, McGinley M, Baumann J, Matsui Y (2014) The cumulative impact of annual coral bleaching can turn some coral species winners into losers. Glob Change Biol 20:3823–3833. https://doi.org/10.1111/gcb.12658 Hackerott S, Martell HA, Eirin-Lopez JM (2021) Coral environmental memory: causes, mechanisms, and consequences for future reefs. Trends Ecol Evol 36:1011–1023. https://doi.org/10.1016/j.tree.2021.06.014 Hein MY, Vardi T, Shaver EC, Pioch S, Boström-Einarsson L, Ahmed M, Grimsditch G, McLeod IM (2021) Perspectives on the use of coral reef restoration as a strategy to support and improve reef ecosystem services. Front Mar Sci 8:618303. https://doi.org/10.3389/fmars.2021.618303 Hilker M, Schwachtje J, Baier M, Balazadeh S, Bäurle I, Geiselhardt S, Hincha DK, Kunze R, Mueller-Roeber B, Rillig MC, Rolff J (2016) Priming and memory of stress responses in organisms lacking a nervous system. Biol Rev 91:1118–1133. https://doi.org/10.1111/brv.12215 Digital Object Identifier (DOI) Jones A, Berkelmans R (2010) Potential costs of acclimatization to a warmer climate: growth of a reef coral with heat tolerant versus sensitive symbiont types. PLoS One 5:e10437. https://doi.org/10.1371/journal.pone.0010437 Klepac CN, Barshis DJ (2022) High-resolution in situ thermal metrics coupled with acute heat stress experiments reveal differential coral bleaching susceptibility. Coral Reefs 41(4):1045–57. https://doi.org/10.1007/s00338-022-02276-1 Kuznetsova A, Brockhoff PB, Christensen RH (2017) lmerTest package: tests in linear mixed effects models. J Stat Soft 82:1–26. https://doi.org/10.18637/jss.v082.i13 Ladd MC, Shantz AA, Bartels E, Burkepile DE (2017) Thermal stress reveals a genotype-specific tradeoff between growth and tissue loss in restored Acropora cervicornis . Mar Ecol Prog Ser 572:129–139. https://doi.org/10.3354/meps Lenth RV (2020) Estimated marginal means, aka least-squares means. J Stat Softw 95(1):1–33. https://doi.org/10.18637/jss.v069.i01 Loya Y, Sakai K, Yamazato K, Nakano Y, Sambali H, Van Woesik R (2001) Coral bleaching: the winners and the losers. Ecol Lett 4:122–131. https://doi.org/10.1046/j.1461-0248.2001.00203.x Majerová E, Carey FC, Drury C, Gates RD (2021) Preconditioning improves bleaching tolerance in the reef-building coral Pocillopora acuta through modulations in the programmed cell death pathways. Mol Ecol 30:3560–3574. https://doi.org/10.1111/mec.15988 Majerová E, Drury C (2022) Thermal preconditioning in a reef-building coral alleviates oxidative damage through a BI-1-mediated antioxidant response. Front Mar Sci 9:971332. https://doi.org/10.3389/fmars.2022.971332 Martell HA (2023) Thermal priming and bleaching hormesis in the staghorn coral Acropora cervicornis (Lamarck 1816). J Exp Mar Biol Ecol 560:151820. https://doi.org/10.1016/j.jembe.2022.151820 Martell HA, Zimmerman RC (2021) Heating rate modulates the metabolic response of the staghorn coral Acropora cervicornis (Lamarck, 1816). Mar Biol 168(6):83. https://doi.org/10.1007/s00227-021-03847-6 Manzello DP, Matz MV, Enochs IC, Valentino L, Carlton RD, Kolodziej G, Serrano X, Towle EK, Jankulak M (2019) Role of host genetics and heat-tolerant algal symbionts in sustaining populations of the endangered coral Orbicella faveolata in the Florida Keys with ocean warming. Glob Change Biol 25:1016–1031. https://doi.org/10.1111/gcb.14545 Mayfield AB, Fan T, Chen C (2013) Physiological acclimation to elevated temperature in a reef-building coral from an upwelling environment. Coral Reefs 32:909–921. https://doi.org/10.1007/s00338-013-1067-4 Maynard JA, Anthony KRN, Marshall PA, Masiri I (2008) Major bleaching events can lead to increased thermal tolerance in corals. Mar Biol 155:173–182. https://doi.org/10.1007/s00227-008-1015-y McGinley MP (2012) The impact of environmental stress on Symbiodinium spp.: A molecular and community-­ scale investigation [Dissertation Ph.D. thesis, University of Delaware] pp 165 Middlebrook R, Anthony KRN, Hoegh-Guldberg O (2008) Thermal priming affects symbiont photosynthesis but does not alter bleaching thresholds in Acropora millepora . J Exp Mar Biol Ecol 357:48–55. https://doi.org/10.1016/j.jembe.2012.07.005 National Academies of Sciences, Engineering, and Medicine (2019) A research review of interventions to increase the persistence and resilience of coral reefs. National Academies Press, Washington DC. https://doi.org/10.17226/25279 O’Donnell SE, Ruggeri M, Blanco-Pimentel M, Morikawa MK, Harms E, Calle-Triviño J, Flanagan BA, Carlson HK, Kenkel CD, Million WC (2025) Species-specific patterns of population genetic structure differ on a microgeographic scale. Coral Reefs 44:353–358. https://doi.org/10.1007/s00338-024-02598-2 Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin PR, O’Hara RB, Simpson GL, Solymos P, Stevens MHH, Szoecs E, Wagner H (2022) vegan: Community Ecology Package . R package version 2.6–4 Oliver ECJ, Burrows MT, Donat MG, Sen Gupta A, Alexander LV, Perkins-Kirkpatrick SE, Benthuysen JA, Hobday AJ, Holbrook NJ, Moore PJ, Thomsen MS, Wernberg T, Smale DA (2019) Projected marine heatwaves in the 21st century and the potential for ecological impact. Front Mar Sci 6:734. https://doi.org/10.3389/fmars.2019.00734 Palumbi SR, Barshis DJ, Traylor-Knowles N, Bay RA (2014) Mechanisms of reef coral resistance to future climate change. Science 344:895–898. https://doi.org/10.1126/science.1251336 Peixoto RS, Voolstra CR, Staab S, Ribeiro B, Duarte G, Suggett DJ (2025) Building coral reef resilience through assisted restoration. In: Coral reef microbiome. Springer Nature Switzerland, Cham, pp 235–243. https://doi.org/10.1007/978-3-031-76692-3_16 Putnam HM, Gates RD (2015) Preconditioning in the reef-building coral Pocillopora damicornis and the potential for trans-generational acclimatization in coral larvae under future climate change conditions. J Exp Biol 218:2365–2372. https://doi.org/10.1242/jeb.123018 Sahin D, Schoepf V, Filbee-Dexter K, Thomson DP, Radford B, Wernberg T (2023) Heating rate explains species-specific coral bleaching severity during a simulated marine heatwave. Mar Ecol Prog Ser 706:33–46. https://doi.org/10.3354/meps Scheufen T, Iglesias-Prieto R, Enríquez S (2017) Changes in the number of symbionts and Symbiodinium cell pigmentation modulate differentially coral light absorption and photosynthetic performance. Front Mar Sci 4:309. https://doi.org/10.3389/fmars.2017.00309 Schoepf V, Jung MU, McCulloch MT, White NE, Stat M, Thomas L (2020) Thermally variable, macrotidal reef habitats promote rapid recovery from mass coral bleaching. Front Mar Sci 7:245. https://doi.org/10.3389/fmars.2020.00245 Silverstein RN, Cunning R, Baker AC (2015) Change in algal symbiont communities after bleaching, not prior heat exposure, increases heat tolerance of reef corals. Glob Change Biol 21:236–249. https://doi.org/10.1111/gcb.12706 Smith KE, Sen Gupta A, Burrows MT, Filbee-Dexter K, Hobday AJ, Holbrook NJ, Malan N, Moore PJ, Oliver ECJ, Thomsen MS, Wernberg T, Zhao Z, Smale DA (2025) Ocean extremes as a stress test for marine ecosystems and society. Nat Clim Chang 15:231–235. https://doi.org/10.1038/s41558-025-02269-2 Spady BL, Skirving WJ, De La Cour JL, Geiger EF, Liu G, Hoegh-Guldberg O, Norrie A, Heron SF, Pomeroy MW, Kolodziej G, Brown KT (2026) The 4th global coral bleaching event: ushering in an era of near-annual bleaching. Coral Reefs 1–16 . https://doi.org/10.1007/s00338-025-02810-x Stone M (1974) Cross-validatory choice and assessment of statistical predictions. J R Stat Soc Ser B 36:111–147. https://doi.org/10.1111/j.2517-6161.1974.tb00994.x Suggett DJ, Warner ME, Leggat W (2017) Symbiotic dinoflagellate functional diversity mediates coral survival under ecological crisis. Trends Ecol Evol 32:735–745. https://doi.org/10.1016/j.tree.2017.07.013 Sweet M, Bulling M, Varshavi D, Lloyd GR, Jankevics A, Najdekr L, Weber RJ, Viant MR, Craggs J (2021) Species-specific variations in the metabolomic profiles of Acropora hyacinthus and Acropora millepora mask acute temperature stress effects in adult coral colonies. Front Mar Sci 8:574292. https://doi.org/10.3389/fmars.2021.574292 Thomas L, Rose NH, Bay RA, López EH, Morikawa MK, Ruiz-Jones L, Palumbi SR (2018) Mechanisms of thermal tolerance in reef-building corals across a fine-grained environmental mosaic: lessons from Ofu, American Samoa. Front Mar Sci 4:434. https://doi.org/10.3389/fmars.2017.00434 Van Oppen MJH, Oliver JK, Putnam HM, Gates RD (2015) Building coral reef resilience through assisted evolution. Proc Nat Acad Sci U S A 112:2307–2313. https://doi.org/10.1073/pnas.1422301112 Vinton A, Arvai J, Zheng D, Kenkel C, Marcos A (2025) Genetic Preservation Emerges as Top Priority: Coral Experts Redefine Conservation Under Climate Change. Authorea. 10.22541/au.175217038.86609064/v3 Voolstra CR, Buitrago-López C, Perna G, Cárdenas A, Hume BC, Rädecker N, Barshis DJ (2020) Standardized short-term acute heat stress assays resolve historical differences in coral thermotolerance across microhabitats. Glob Change Biol 26:4328–4343. https://doi.org/10.1111/gcb.15148 Wangpraseurt D, Polerecky L, Larkum AWD, Ralph PJ, Nielsen DA, Pernice M, Kühl M (2014) The in situ light microenvironment of corals. Limnol Oceanogr 59:917–926. https://doi.org/10.4319/lo.2014.59.3.0917 Warner ME, Fitt WK, Schmidt GW (1999) Damage to photosystem II in symbiotic dinoflagellates: a determinant of coral bleaching. Proc Nat Acad Sci U S A 96:8007–8012. https://doi.org/10.1073/pnas.96.14.8007 Wickham H, Averick M, Bryan J, Chang W, McGowan LD, François R, Grolemund G, Hayes A, Henry L, Hester J, Kuhn M (2019) Welcome to the Tidyverse. J Open Source Softw 4(43):1686. https://doi.org/10.21105/joss.01686 Wicquart J, Mathon L, Petit A, Rivera-Sosa A, McField M (eds) (2025) Status and trends of Caribbean coral reefs: 1970–2024. Global Coral Reef Monitoring Network (GCRMN) and International Coral Reef Initiative (ICRI). https://doi.org/10.59387/BDHF9180 Wilkinson CR (2000) Status of coral reefs of the world: 2000. Australian Institute of Marine Science, Townsville Additional Declarations No competing interests reported. Supplementary Files BlancoPimenteletal.SupplementaryCoralReefsApr26.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers invited by journal 23 Apr, 2026 Editor assigned by journal 14 Apr, 2026 Submission checks completed at journal 11 Apr, 2026 First submitted to journal 09 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9372487\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":633688747,\"identity\":\"1c5e4efb-7c4a-4d68-b74a-2d130fd1a4cb\",\"order_by\":0,\"name\":\"Macarena Blanco-Pimentel\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYFACHsYDEAZjA5jiY4fQMni0MCBrMWBg4zkAFSesBQyAWiQS8GvRbeA9cODnDjs5Bunm1g0fd/yRY5N8+0zyC8MdnFrMDvAlHOw9k2zMIHOw7ebMMwbGbNLpZtIyDM/waOExOMDbdiCxQSKx7TZvm0Fim3Qam7QEw2G8Wg7+hWn522ZQ3yZ5jLCWw3BbGNsMEtgk2NgkP+DTcpgv4bBsW7IxG8gvvW3Ghm08aczWDAZ4tBzvPfjwbZudHL90+7MbP9vk5PnZjzHe/FFxWA6XFgZmKM0mgSzIY4BTAxJA1sL4gxgdo2AUjIJRMFIAAF15UnJE6s76AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Wave of Change, Iberostar Group\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Macarena\",\"middleName\":\"\",\"lastName\":\"Blanco-Pimentel\",\"suffix\":\"\"},{\"id\":633688748,\"identity\":\"61b6e6cb-fc0c-425c-9db1-38f392bbd68d\",\"order_by\":1,\"name\":\"Serena Hackerott\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Delaware\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Serena\",\"middleName\":\"\",\"lastName\":\"Hackerott\",\"suffix\":\"\"},{\"id\":633688749,\"identity\":\"df7e70ea-e1d0-4a25-afa1-76ebc5e6b05a\",\"order_by\":2,\"name\":\"Malique R. Bowen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Delaware\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Malique\",\"middleName\":\"R.\",\"lastName\":\"Bowen\",\"suffix\":\"\"},{\"id\":633688750,\"identity\":\"6be0a0a8-1bef-4d37-8c08-2c4bc89708cc\",\"order_by\":3,\"name\":\"Frida Abril Sánchez-Valle\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University Autonomous of Mexico (UNAM)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Frida\",\"middleName\":\"Abril\",\"lastName\":\"Sánchez-Valle\",\"suffix\":\"\"},{\"id\":633688751,\"identity\":\"eccaf296-2629-49ba-adf7-555ee54af3e3\",\"order_by\":4,\"name\":\"Gregory Pelose\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of the Virgin Islands\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gregory\",\"middleName\":\"\",\"lastName\":\"Pelose\",\"suffix\":\"\"},{\"id\":633688752,\"identity\":\"e0de1b58-f47b-4be3-be7e-bf71c03732d1\",\"order_by\":5,\"name\":\"Samantha Mercado\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wave of Change, Iberostar Group\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Samantha\",\"middleName\":\"\",\"lastName\":\"Mercado\",\"suffix\":\"\"},{\"id\":633688753,\"identity\":\"3b67e0c7-f8a8-4ee1-b1fe-dd0ca5d61f86\",\"order_by\":6,\"name\":\"Johanna Calle-Trivño\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wave of Change, Iberostar Group\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Johanna\",\"middleName\":\"\",\"lastName\":\"Calle-Trivño\",\"suffix\":\"\"},{\"id\":633688754,\"identity\":\"3f6644ba-c48c-4af9-b6d2-07c0bf4503a2\",\"order_by\":7,\"name\":\"Victor Galván\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wave of Change, Iberostar Group\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Victor\",\"middleName\":\"\",\"lastName\":\"Galván\",\"suffix\":\"\"},{\"id\":633688755,\"identity\":\"f2ff14e6-2097-48f1-b453-25cfdd2c6b86\",\"order_by\":8,\"name\":\"Erika Harms\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wave of Change, Iberostar Group\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Erika\",\"middleName\":\"\",\"lastName\":\"Harms\",\"suffix\":\"\"},{\"id\":633688756,\"identity\":\"dc4984ed-f707-48b2-8706-a3430b1e532f\",\"order_by\":9,\"name\":\"Mark E. Warner\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Delaware\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mark\",\"middleName\":\"E.\",\"lastName\":\"Warner\",\"suffix\":\"\"},{\"id\":633688757,\"identity\":\"15fd1ab9-cfc2-4b46-826a-bec95bfecd76\",\"order_by\":10,\"name\":\"Sancia E.T. Meij\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Groningen\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sancia\",\"middleName\":\"E.T.\",\"lastName\":\"Meij\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-04-09 21:23:31\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9372487/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9372487/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":108804341,\"identity\":\"2c99468e-9982-4045-83f9-043c3bde987d\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:19:28\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1066327,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExperimental design and fragment distribution for \\u003cem\\u003eMontastraea\\u003c/em\\u003e \\u003cem\\u003ecavernosa\\u003c/em\\u003e and \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e, based on 9 colonies per species, each fragmented into 18 replicates (8 medium, 6 small, and 4 microfragments). The figure shows fragment allocation across tanks and treatments, and their assignment to outplanting, acute heat-stress assay, and symbiont analyses. The four experimental phases (Acclimation, Priming, Recovery, and Short-term Heating) and their associated temperature profiles are presented,along with the timing of physiological measurements (pulse-amplitude modulated fluorescence and red-channel pixel intensity analyses) and tissue sampling for symbiont community analyses.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/294eecd88f7b8dd6765aecdb.png\"},{\"id\":108803829,\"identity\":\"29c1e0ed-b147-48d0-8b50-214b6ea2272d\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:08:48\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5674,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhotochemical efficiency (\\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e) of naive and preconditioned fragments (grouped by experimental colony) following the Priming and Recovery phases.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/c787d3408d503363036ad604.png\"},{\"id\":108492867,\"identity\":\"fd00e2b5-7dff-467f-add5-ef591798cb0a\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 09:58:49\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6528,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhysiological responses to thermal stress after the Short-term Heating in control, naive, and preconditioned fragments. (A) Photochemical efficiency (\\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e); (B) Pixel intensity retention calculated relative to colony-specific controls, where values \\u0026gt;100% indicate darker tissue relative to baseline and values \\u0026lt;100% indicate tissue paling.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/e66e63d909d200b9902e3696.png\"},{\"id\":108493791,\"identity\":\"6ba2d4a9-e93b-4da6-a5cd-bb5b97568fde\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 10:01:42\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":62797,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eColony-level deltas (Δ = preconditioned - naive) in physiological responses following the Short-term Heating. Bars show Δ values for photochemical efficiency (\\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e) and pixel intensity retention (%) for each colony, faceted by metric and species. Horizontal dashed lines indicate Δ = 0, with positive and negative values representing higher or lower responses in preconditioned fragments relative to naive fragments, respectively. Each metric is displayed on its original scale.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/b651d6df4267e45e106cd126.png\"},{\"id\":108492896,\"identity\":\"b9e8f59b-b6b6-44cf-9660-f5d8c912891d\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 09:58:55\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":115652,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMean relative symbiont composition (%) across colonies for each coral species. Bars represent genus-level proportions averaged by colony (± SD). \\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e was consistently dominated by \\u003cem\\u003eCladocopium\\u003c/em\\u003e, whereas \\u003cem\\u003eO. faveolata\\u003c/em\\u003e was dominated by \\u003cem\\u003eDurusdinium\\u003c/em\\u003e, with minor contributions from \\u003cem\\u003eSymbiodinium \\u003c/em\\u003eand\\u003cem\\u003eBreviolum\\u003c/em\\u003e across colonies.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/16d9dbcae3bdd1a0880dff16.png\"},{\"id\":108448168,\"identity\":\"fc8b01bb-d248-4395-8e5a-5da7375a0a7f\",\"added_by\":\"auto\",\"created_at\":\"2026-05-04 18:35:59\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":326016,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTemporal variation in pixel intensity retention (%) of outplanted coral fragments. Retention values are expressed relative to pre-outplanting measurements (August 2024), used as fragment-specific baselines. Thin lines represent individual fragments tracked over time, while thick lines and points indicate mean values per monitoring time point (± SD).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/e063fe0a812acd3e4935ea95.png\"},{\"id\":108809270,\"identity\":\"32957ffb-1083-4820-94f8-2a5b4d82d53c\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:51:32\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1652631,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/40b87eba-2737-4c44-a8ae-a83afc24f537.pdf\"},{\"id\":108448162,\"identity\":\"fb200cb7-336d-4a89-be1c-89e032607294\",\"added_by\":\"auto\",\"created_at\":\"2026-05-04 18:35:59\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":3099858,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"BlancoPimenteletal.SupplementaryCoralReefsApr26.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9372487/v1/2b1f612da6bed61917f73b8a.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Advancing reef restoration with thermal preconditioning interventions: species- and colony-specific responses of Montastraea cavernosa and Orbicella faveolata\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eIncreasing frequency and intensity of coral bleaching events, primarily driven by climate change-induced marine heat waves, represent one of the most critical threats to the persistence of coral reef ecosystems globally (Oliver et al. \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e; Smith et al. \\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e). Coral bleaching compromises reef functions and services by disrupting the coral-algal symbiosis, leading to reduced energy acquisition, enhanced vulnerability to additional stressors, and increased mortality risk (Baker et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e). In the Caribbean, coral bleaching has worsened since the massive bleaching event of 1998, when over 50% of reefs were affected (Wilkinson \\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e), followed by major regional events in 2005, 2010, and 2015, impacting up to 80% of reefs (Eakin et al. \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e; Alemu and Clement \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Eakin et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e). Most recently, the 2023\\u0026ndash;2024 marine heatwave represented the most severe bleaching event recorded to date in the region, with unprecedented temperatures threatening the long-term resilience of Caribbean coral ecosystems (Wicquart et al. \\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e; Spady et al. \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eSecuring the future of coral reefs requires addressing political and societal dimensions to mitigate greenhouse gas emissions and associated global threats, such as ocean warming and acidification, while simultaneously reducing local stressors (Ateweberhan et al. \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Duarte et al. \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Within this broader context, the potential of active restoration interventions in conserving reef functions and ecosystem services is increasingly recognized (National Academies of Sciences, Engineering, and Medicine 2019; Vinton et al. \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e). Traditional reef restoration efforts primarily rely on outplanting nursery-grown corals to degraded reefs; however, their long-term success remains constrained by ongoing thermal stress and recurrent bleaching events, among other threats (Bostr\\u0026ouml;m-Einarsson et al. \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Consequently, restoration practices must continue to evolve by integrating scientific evidence while accounting for local environmental and socio-political contexts (Cort\\u0026eacute;s-Useche et al. \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Hein et al. \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Bruce et al. 2025).\\u003c/p\\u003e \\u003cp\\u003eEcological evidence from reef environments characterized by high-frequency temperature variability suggests that corals can naturally acclimatize to thermal stress through physiological and molecular adjustments (Mayfield et al. \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Palumbi et al. \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Thomas et al. \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e; Schoepf et al. \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Similarly, some coral populations exhibit reduced susceptibility to successive bleaching events, consistent with short-term acclimatization or stress memory (Maynard et al., \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Ainsworth et al. \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Grottoli et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). These responses may reflect host-level plasticity, changes in symbiont physiology, or differences in symbiont community composition, including the dominance of thermally tolerant symbiont genera (Palumbi et al. \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Suggett et al. \\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). In pursuit of science-based restoration interventions to promote coral resilience to climate change, these natural patterns have motivated experimental approaches to induce similar protective responses through thermal preconditioning. Thermal preconditioning involves exposing the coral holobiont to moderate, sublethal thermal stress (\\u0026ldquo;priming\\u0026rdquo;) to induce physiological responses that may enhance tolerance to subsequent heat exposure (Hackerott 2021; van Oppen et al. \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). Although sublethal temperature exposure may entail short-term physiological costs, these can be outweighed by increased tolerance to later thermal stress events (Hilker et al. \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Drury et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Martell \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; DeMerlis et al. 2025). Reported costs include reduced growth in corals hosting heat-tolerant symbionts (Jones and Berkelmans \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) and metabolic shifts associated with short-term acclimatization (Gibbin et al. \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). In contrast, benefits may include reduced bleaching severity, improved recovery capacity, and enhanced thermotolerance during acute heat stress (Middlebrook et al. \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Majerova et al. 2021; Majerova and Drury 2022). However, the magnitude and consistency of these benefits may vary across species, genotypes, and environmental conditions (Edmunds \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Drury et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; DeMerlis et al. 2025), and comparative assessments of preconditioning outcomes across these contexts remain limited, particularly under standardized, restoration-relevant experimental frameworks.\\u003c/p\\u003e \\u003cp\\u003eTo date, thermal preconditioning has been evaluated in both ex situ aquaria and in situ nursery settings by comparing the stress responses of preconditioned (previously exposed) and naive (non-exposed) corals during controlled heat exposure (Dilworth et al. 2021; Hackerott et al. \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). A growing body of evidence has shown that prior exposure to sublethal temperatures can enhance coral thermotolerance during acute heat stress events (Middlebrook et al. \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Bellantuono et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e; DeMerlis et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; 2025; Middlebrook et al. 2012; Silverstein et al. \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Majerova et al. 2021; Ferrara et al. \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e). However, outcomes remain highly sensitive to experimental design, including temperature profiles, exposure duration, heating rates, and the coral species and genotypes involved (Dilworth et al. 2021; Drury et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Martell \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Sahin et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Ferrara et al. \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e). Enhanced tolerance is thought to result from stress memory within the coral holobiont, involving genetic and epigenetic regulation, transcriptional modulation, and shifts in symbiont and microbial communities (Hackerott et al. \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Drury \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Drury et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Martell \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; DeMerlis et al. 2025). Together, these mechanisms suggest that controlled sublethal stress can induce physiological states associated with increased thermal tolerance, providing a clear rationale for thermal preconditioning as an applied intervention. In a restoration context, thermal preconditioning has therefore been proposed as a strategy to enhance the resilience of nursery-reared corals before outplanting (Martell \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). However, key uncertainties remain regarding species and colony-level variability, potential trade-offs affecting other fitness-related traits, and the extent to which short-term experimental benefits translate into longer-term fitness and performance following outplanting (Peixoto et al. \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e; Hulver et al. 2025).\\u003c/p\\u003e \\u003cp\\u003eIn this study, we evaluated the effectiveness and practical relevance of short-term thermal preconditioning under controlled conditions within a local restoration context. Using two key Caribbean reef-building species, \\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e (Linnaeus 1767) and \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e (Ellis and Solander 1786), we compared physiological stress responses of preconditioned and naive coral fragments to test whether short-term priming enhances thermotolerance during acute heat stress. Additionally, we assessed response variability among colonies within each species to examine the roles of colony-level heterogeneity and phenotypic plasticity in shaping thermotolerance outcomes. We compared these responses with those of the symbiont community to explore potential host-symbiont contributions to the observed patterns. Following the experimental phase, a one-year post-outplant field monitoring period was incorporated to assess changes in pigmentation (quantified as image-derived pixel intensity and color retention) of control and preconditioned fragments as an indicator of post-restoration physiological performance under natural, non-bleaching conditions. Together, this integrative approach provides insight into the potential and limitations of short-term thermal preconditioning as a tool for coral restoration under warming conditions.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCoral collection and experimental design\\u003c/h2\\u003e \\u003cp\\u003eColonies of \\u003cem\\u003eMontastraea caveronsa\\u003c/em\\u003e (n\\u0026thinsp;=\\u0026thinsp;9) and \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e (n\\u0026thinsp;=\\u0026thinsp;9) were collected in August 2024 from five reef sites in the southeastern Dominican Republic at a mean depth of 9.9\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.3 m (Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e; Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). All colonies were selected based on being sufficiently large (i.e., able to provide the required number of fragments without exceeding approximately 10% removal of colony tissue) and visually healthy, and were spaced at least 5 m apart to minimize clonal sampling. Coral fragments were collected from colony edges using a hammer and chisel, labeled, and transported in individual seawater-filled plastic bags to Iberostar\\u0026rsquo;s Coral Lab (Fig. S2). Upon arrival, fragments were transferred to four experimental tanks operating as an open-flow seawater system equipped with a locally designed temperature control system (Blanco-Pimentel et al. 2025). Lighting was provided by LED aquarium fixtures (Hydra 32HD, AquaIllumination, USA) set to ~\\u0026thinsp;250 \\u0026micro;mol photons m\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e\\u0026sup2; s\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e\\u0026sup1; on a 12:12 h light-dark cycle, including a 3-h ramp-up and ramp-down period to simulate sunrise and sunset. Water temperature was recorded every five minutes using HOBO Pendant temperature/light loggers (UA-001-64; Onset Computer Corporation, USA) (Fig. S3).\\u003c/p\\u003e \\u003cp\\u003eCorals were fragmented the following morning, and each colony was subdivided into 18 fragments of different sizes: eight medium fragments (~\\u0026thinsp;4\\u0026ndash;8 cm\\u0026sup2;), six small fragments (~\\u0026thinsp;2\\u0026ndash;4 cm\\u0026sup2;), and four microfragments (~\\u0026thinsp;0.5-2 cm\\u0026sup2;), resulting in 18 replicates per colony (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Fragment sizes were selected to optimize tissue allocation for different experimental purposes: medium fragments were designated for outplanting, small fragments for the short-term heating assay, and microfragments for symbiont genetic analyses.\\u003c/p\\u003e \\u003cp\\u003eThe experimental design consisted of four sequential phases: (1) Acclimation, (2) Priming (thermal preconditioning), (3) Recovery, and (4) Short-term Heating (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). During Acclimation and Priming, naive fragments (all size classes) were distributed across two tanks, while preconditioned fragments were maintained in the remaining two tanks. Prior to the Short-term Heating, fragments were reassigned by size and experimental purpose: medium fragments were retained under control tanks for subsequent outplanting, and small fragments (both naive and preconditioned) were used in the Short-term Heating. Acclimation and Recovery each lasted one week and were conducted at 28\\u0026deg;C, which reflects ambient, non-peak summer temperatures in the study area. Long-term temperature records from one of the collection sites (Coco Reef) indicate a mean temperature of 27.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.7\\u0026deg;C between December and May (2018\\u0026ndash;2024) (Fig. S4), while the regional Maximum Monthly Mean (MMM) temperature is 28.5\\u0026deg;C (NOAA Coral Reef Watch database). The Priming phase lasted one week and consisted of a gradual temperature increase from 28\\u0026deg;C to 31\\u0026deg;C over three days (1\\u0026deg;C/day), after which fragments were maintained at 31\\u0026deg;C for approximately 3.5 days. Temperatures were then gradually returned to control levels during the final six hours of day fourteen. This priming temperature and ramping protocol were consistent with previous thermal preconditioning studies conducted on Caribbean reef corals and were designed to simulate ecologically relevant, sublethal warming while minimizing acute thermal shock (Middlebrook et al. \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e; Bellantuono et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e; Silverstein et al. \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Dilworth et al. 2021; Majerova et al. 2021; DeMerlis et al. 2025). Following the Recovery phase (7 days at 28\\u0026deg;C), which allows corals to stabilize physiologically and potentially retain the effects of thermal priming (Silverstein et al. \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e), a short-term heat-stress assay (\\u0026ldquo;Short-term Heating\\u0026rdquo;) was conducted to compare responses between preconditioned and naive fragments. The Short-term Heating followed a standardized acute thermal exposure profile commonly used in short-term stress frameworks (Voolstra et al. \\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Cunning et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Here, the temperature was increased to 36\\u0026deg;C over three hours, maintained at 36\\u0026deg;C for three hours, and then ramped down to the control temperature over the subsequent hour. This temperature corresponded to the bleaching threshold previously identified for \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e in the study area and slightly exceeded that of \\u003cem\\u003eO. faveolata\\u003c/em\\u003e (~\\u0026thinsp;35.5\\u0026deg;C; Blanco-Pimentel et al. 2025). A single maximum temperature was used to ensure direct comparability of thermal responses and to maintain consistency with standardized short-term stress protocols.\\u003c/p\\u003e \\u003cp\\u003eTo assess potential changes in the symbiont community associated with thermal priming and recovery, microfragments were sampled immediately after the Priming phase and again after the Recovery phase (Table S2).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eThermal stress response metrics\\u003c/h3\\u003e\\n\\u003cp\\u003eThermal stress responses were assessed using two complementary physiological metrics: photochemical efficiency (\\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e) and tissue pigmentation derived from photographic pixel intensity. Photochemical efficiency (\\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e) was measured using pulse amplitude modulation (PAM) chlorophyll a fluorometry (Junior-PAM, Walz) on coral fragments that were dark-acclimated for 30 minutes (Kitajima and Butler 1975; Maxwell and Johnson 2000). \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e was recorded after the Priming phase, the Recovery phase, and the Short-term Heating, to assess both short-term responses and the persistence of priming effects. Fluorometer settings were kept constant across all measurements (measuring light intensity\\u0026thinsp;=\\u0026thinsp;6; gain\\u0026thinsp;=\\u0026thinsp;2; saturation pulse intensity\\u0026thinsp;=\\u0026thinsp;8; width\\u0026thinsp;=\\u0026thinsp;0.6).\\u003c/p\\u003e \\u003cp\\u003eChanges in tissue pigmentation were quantified through photographic analysis of red-channel pixel intensity as a proxy for bleaching-related loss of symbionts and/or chlorophyll pigments (Winters et al. 2009). Photographs were taken following the Short-term Heating, approximately 6.5 hours after the control temperature was reached. Images were acquired under standardized conditions and calibrated using a grayscale reference (Kodak Color Separation Guide and Gray Scale Q-13). Image processing and analysis followed established approaches, with red-channel pixel intensity used as an indicator of tissue paling associated with thermal stress (Winters et al. 2009; Voolstra et al. \\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e reflected acute effects on symbiont photochemistry and pixel intensity captured integrated bleaching outcomes following thermal exposure.\\u003c/p\\u003e\\n\\u003ch3\\u003eSymbiont community composition\\u003c/h3\\u003e\\n\\u003cp\\u003eCoral tissue was sampled by gentle scraping with a sterile needle and syringe. Collected tissue was transferred to individual sample tubes, briefly centrifuged, and preserved in dimethyl sulfoxide preservation buffer (DMSO) prior to storage at -20\\u0026deg;C. Preserved samples were subsequently shipped to the University of Delaware for DNA extraction and downstream analyses.\\u003c/p\\u003e \\u003cp\\u003eGenomic DNA was extracted from preserved coral tissue using the Zymo Quick-DNA\\u0026trade; MiniPrep Kit (Zymo Research, USA) following the manufacturer\\u0026rsquo;s protocol, with minor modifications to the homogenization step. DNA quantity and quality were assessed using fluorometry (Qubit\\u0026trade; 4 Fluorometer, dsDNA Broad Range Assay; Thermo Fisher Scientific) and spectrophotometry (NanoDrop\\u0026trade; 2000c, Thermo Fisher Scientific), and integrity was verified by agarose gel electrophoresis. DNA was normalized to 10 ng/\\u0026micro;L prior to downstream symbiont analyses, with undiluted extracts used for low-concentration samples.\\u003c/p\\u003e\\n\\u003ch3\\u003eSymbiont community composition analysis (qPCR)\\u003c/h3\\u003e\\n\\u003cp\\u003eSymbiont community composition was assessed using quantitative PCR (qPCR) to assess the relative abundance of algal genera, specifically \\u003cem\\u003eSymbiodinium\\u003c/em\\u003e, \\u003cem\\u003eBreviolum\\u003c/em\\u003e, \\u003cem\\u003eCladocopium\\u003c/em\\u003e, and \\u003cem\\u003eDurusdinium\\u003c/em\\u003e. Genus-specific primers were developed by McGinley (\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e) and analysed using the thermal profiles described in Gantt et al. (2023). Primer sequences are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. Standard curves were generated from DNA extracted from 10\\u003csup\\u003e6\\u003c/sup\\u003e cells of pure cultures of each symbiont genus and serially diluted (1:5) to produce a 10-point standard curve. Standard curves and no-template controls (NTCs) were included on every qPCR run. qPCR reactions were performed using PowerUp SYBR Green Master Mix (Applied Biosystems, Location, USA) in a total reaction volume of 10 \\u0026micro;L, consisting of 5 \\u0026micro;L of 2 x master mix, 1 \\u0026micro;L of forward primer, 1 \\u0026micro;L of reverse primer, 2 \\u0026micro;L of molecular-grade water, and 1 \\u0026micro;L of standardized template DNA. Final primer concentrations were 900 nM for \\u003cem\\u003eSymbiodinium\\u003c/em\\u003e, \\u003cem\\u003eBreviolum\\u003c/em\\u003e, and \\u003cem\\u003eCladocopium\\u003c/em\\u003e, while the forward primer concentration for \\u003cem\\u003eDurusdinium\\u003c/em\\u003e was reduced to 300 nM. Reactions were run on a Mx5005P thermocycler using the MxPro software in 96-well plates. Thermal cycling conditions consisted of an initial hold at 50\\u0026deg;C for 2 min, followed by 95\\u0026deg;C for 10 min, and 40 amplification cycles of 95\\u0026deg;C for 15 s (denaturation), annealing at 66\\u0026deg;C for \\u003cem\\u003eSymbiodinium\\u003c/em\\u003e and \\u003cem\\u003eBreviolum\\u003c/em\\u003e or 61\\u0026deg;C for \\u003cem\\u003eCladocopium\\u003c/em\\u003e and \\u003cem\\u003eDurusdinium\\u003c/em\\u003e, and 72\\u0026deg;C for 34 s (extension).\\u003c/p\\u003e \\u003cp\\u003eGenus-specific assays were performed in technical duplicate, and cycle threshold (Ct) values were averaged across replicates. Genus-specific gene copy numbers were calculated using thermocycler software based on genus-specific standard curves included on each plate. Standard curves were generated from serial dilutions of samples with known cell abundances, and Ct values were used to estimate gene copy numbers in unknown samples through linear regression. Gene copy quantities were converted to estimated cell abundances by accounting for clade-specific variation in actin gene copy number, as the primers target the actin gene rather than the ITS regions. Genus-specific values were then normalized within each sample to obtain relative proportions.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSymbiodiniaceae genus-specific qPCR primers.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGenus\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer (3\\u0026prime;-5\\u0026prime;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse Primer (5\\u0026prime;-3\\u0026prime;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eSymbiodinium\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGCGACGTCAAGGAGAAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCAGACTGCGGATGAACCTGTTCCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBreviolum\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCCCTGTAAACCCTGTCATTCGTAGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCCGGAATTTGTGCAAGCTTCGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eCladocopium\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTGGTGGTGTTCAGCAGTAAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGATCCCCGGCCAAAAATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eDurusdinium\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGAGTGCCGTATTGTGGAAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGGCGTGTAAAGCGTCAAGAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eOutplanting and field monitoring\\u003c/h3\\u003e\\n\\u003cp\\u003eThe medium-sized coral fragments of both taxa were outplanted to a local restoration site at approximately 10 m depth (Fig. S2). Post-outplant pixel intensity measurements were collected over 1 year to characterize relative changes in the color of control and preconditioned coral under natural field conditions. While no natural bleaching occurred during the outplant period, temporal variation in pixel intensity reflects changes in symbiont density and/or chlorophyll content, providing insight into physiological dynamics following outplanting. Fragments were attached to the reef using custom-made cement dome structures with perforations designed to accommodate individual coral cement plugs (Fig. S5). Each dome contained replicate fragments originating from the same parent colony to promote fusion among conspecific fragments. Separate dome structures were assigned to control and preconditioned fragments. Domes were subsequently secured to the reef substrate using the same locally prepared cement mixture. Coral fragments were photographed at seven time points (including an initial pre-outplant baseline in August 2024, followed by October 2024, November 2024, January 2025, April 2025, July 2025, and August 2025) using an Olympus TG-6 underwater camera, with each image including a laminated grayscale reference (Kodak Color Separation Guide and Gray Scale Q-13) for standardized image calibration. Photographs were used to assess color intensity, with pigmentation quantified by analyzing red-channel pixel intensities using the same image-based approach described for experimental measurements.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData analyses\\u003c/h2\\u003e \\u003cp\\u003eStatistical analyses and graphics were performed using R version 4.2.1 (R Core Team, 2022) within RStudio version 1.4.1106 (RStudio Team, Boston, MA, USA), using the packages lme4 (Bates et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e) and lmerTest (Kuznetsova et al. \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e) for linear mixed-effects modelling; emmeans (Lenth \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) with Tukey adjustment for post-hoc comparisons; vegan (Oksanen et al. \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e) for permutational multivariate analysis of variance (PERMANOVA); and tidyverse (Wickham et al. \\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e), including dplyr, tidyr, and ggplot2, for data manipulation and visualization.\\u003c/p\\u003e \\u003cp\\u003eTreatment and species effects were evaluated using linear mixed-effects models (LMMs) with species (\\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e, \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e) and treatment (naive, preconditioned) as fixed effects and colony as a random intercept to account for colony-level variability. Model structures followed the general structure:\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eresponse ~ species × treatment + (1 | colony)\\u003c/h3\\u003e\\n\\u003cp\\u003eFor \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e, models were fitted independently for measurements obtained after the Priming phase, after the Recovery phase, and following the Short-term Heating. Measurements obtained after Priming and Recovery were used to assess whether thermal priming induced immediate changes in photochemical efficiency and whether such effects persisted prior to acute heat exposure. After Short-term Heating analyses of \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e, control fragments were excluded from statistical models and retained only for visual reference, as the primary comparison of interest was between naive and preconditioned corals under acute thermal stress. For pixel intensity, data were expressed as retention values (%), calculated by dividing the mean colony-specific control pixel intensity measured under Short-term Heating conditions by the pixel intensity of each heated fragment, and multiplying by 100. As pixel intensity increases with tissue paling, a higher percent retention equates to greater symbiont and/or chlorophyll retention (i.e., reduced bleaching). This approach was used because pixel intensity lacks a standardized stress scale, and baseline coloration can vary substantially among colonies. Retention values were log-transformed prior to analysis to meet model assumptions.\\u003c/p\\u003e \\u003cp\\u003eTo evaluate the influence of individual colonies on treatment-level patterns, leave-one-out (LOO) resampling (Stone \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e1974\\u003c/span\\u003e) was conducted using colony-level mean values measured at the end of the Short-term Heating. For each response metric, the corresponding treatment-level model described above was iteratively refitted after excluding each colony in turn. The influence of each colony on model performance was assessed using root mean square error (RMSE), which quantifies the difference between the observed response of the excluded colony and the values predicted by the model fitted to the remaining colonies. Per-colony treatment deltas (Δ) were calculated after the Short-term Heating for both metrics as the difference between the mean preconditioned and mean naive values within each colony, providing a concise visual summary of the magnitude and direction of colony-specific responses.\\u003c/p\\u003e \\u003cp\\u003eSymbiont community composition was analysed at the sample level using PERMANOVA, based on Bray-Curtis dissimilarities of genus-level relative abundances. The effects of species, treatment, and timepoint (i.e., tissue collection time), and their interactions, were tested using permutations constrained at the colony level.\\u003c/p\\u003e \\u003cp\\u003ePixel intensity of outplanted fragments was expressed as fragment-specific retention (%) relative to August 2024 measurements (defined as time 0 after priming). Changes in retention were analysed using a linear mixed-effects model including treatment, time, and species as fixed effects, and colony identity and fragment identity as random effects to account for non-independence among fragments from the same colony and repeated measurements through time.\\u003c/p\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePhotochemical efficiency following Priming and Recovery\\u003c/h2\\u003e \\u003cp\\u003eAcross both species, \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e values remained high, with values consistent with minimal photoinhibition (after Priming: \\u0026gt; 0.48; after Recovery: \\u0026gt; 0.44; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e) (Warner et al. \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e). When comparing treatments, \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e was slightly but significantly lower in preconditioned fragments than in naive controls (\\u003cem\\u003eF\\u003c/em\\u003e₁,₉₁.₅₁₆ = 8.17, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0053), whereas the species \\u0026times; treatment interaction was not significant.\\u003c/p\\u003e \\u003cp\\u003eAfter the Priming phase, \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e differed significantly between species (\\u003cem\\u003eF\\u003c/em\\u003e₁,₉₁.₁₂₆ = 99.10, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e), with \\u003cem\\u003eO. faveolata\\u003c/em\\u003e showing higher values than \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e. After the Recovery phase, this species-level difference persisted (\\u003cem\\u003eF\\u003c/em\\u003e₁,₉₈ = 73.05, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). In contrast to the Priming endpoint, neither treatment nor the species \\u0026times; treatment interactions was significant after Recovery.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePhysiological responses to Short-term Heating: treatment and species effects\\u003c/h2\\u003e \\u003cp\\u003eThermal preconditioning did not significantly influence physiological responses to Short-term Heating, and this effect did not differ between species. Across species, preconditioning was not associated with significant changes in either photochemical efficiency (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA) or coral color (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Similarly, the species \\u0026times; treatment interaction was not significant for either metric. In contrast, interspecific differences were observed in both physiological responses. Species identity had a pronounced effect on \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e (F₁,₉₁.₀₉ = 219.17, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001), with \\u003cem\\u003eO. faveolata\\u003c/em\\u003e maintaining significantly higher photochemical efficiency than \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e under heat stress. \\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e exhibited a marked reduction in \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e relative to controls, whereas \\u003cem\\u003eO. faveolata\\u003c/em\\u003e showed a comparatively smaller decline.\\u003c/p\\u003e \\u003cp\\u003eSpecies identity also had a significant effect on log-transformed pixel intensity retention (\\u003cem\\u003eF\\u003c/em\\u003e₁,₉₁.₀₃₅ = 90.56, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001). \\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e showed higher retention values than \\u003cem\\u003eO. faveolata\\u003c/em\\u003e, indicating greater relative maintenance of symbiont-associated pigmentation under heat stress.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eColony-level variability and associated symbiont community patterns\\u003c/h2\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eHeterogeneity in physiological responses to thermal stress\\u003c/h2\\u003e \\u003cp\\u003eColony-level variability was examined to evaluate whether individual colonies disproportionately influenced treatment-level responses after the Short-term Heating. Although predictive error varied among colonies, exclusion of any single colony did not materially alter treatment-level effect sizes or overall model performance for either physiological metric.\\u003c/p\\u003e \\u003cp\\u003ePredictive error (RMSE) varied among colonies, with generally low values for \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e and greater dispersion for pixel intensity retention (Fig. S6). Despite this variation, treatment-level effect size estimates remained stable across model iterations for both response metrics, with only minor variation in model fit. Colony-specific responses (Δ\\u0026thinsp;=\\u0026thinsp;preconditioned - naive) varied in both magnitude and direction across species and metrics (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Δ \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e values were generally small and centered near zero, whereas pixel intensity retention showed greater variability among colonies, with both positive and negative responses observed across species.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSymbiont community composition across colonies and species\\u003c/h2\\u003e \\u003cp\\u003e \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e was predominantly associated with \\u003cem\\u003eDurusdinium\\u003c/em\\u003e, whereas \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e was mainly associated with \\u003cem\\u003eCladocopium\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). This species-specific dominance of symbionts was consistent across colonies and remained stable throughout the experimental phases. No significant differences in symbiont composition were detected between treatments or experimental phases, and \\u003cem\\u003eSymbiodinium\\u003c/em\\u003e and \\u003cem\\u003eBreviolum\\u003c/em\\u003e were present only at low relative abundances.\\u003c/p\\u003e \\u003cp\\u003ePERMANOVA revealed a significant effect of species on symbiont community composition (F₁,₁₀₂ =27.23, R\\u0026sup2; = 0.211, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001), whereas no significant effects of treatment, timepoint, or their interactions were detected. These results indicate that symbiont composition was primarily structured by host species and remained stable across experimental conditions.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePost-outplant color dynamics under natural field conditions\\u003c/h2\\u003e \\u003cp\\u003eOutplant color retention had significant effects of treatment (F₁,₃₂.₂ = 12.48, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.00), time (F₅,₁₃₄.₉ = 16.63, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026le;\\u0026thinsp;0.001), and species (F₁,₂₃.₅ = 7.36, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.012) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). No significant interactions among them were observed. Overall, significant differences between treatments were observed primarily in \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e, where preconditioned fragments showed lower retention than controls at specific time points, as indicated by post hoc comparisons (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e; Table S3), whereas no significant differences between treatments were detected in \\u003cem\\u003eO. faveolata\\u003c/em\\u003e. Species-specific differences were detected under control conditions, with \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e exhibiting higher retention than \\u003cem\\u003eO. faveolata\\u003c/em\\u003e at multiple timepoints (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e; Table S3). In contrast, no significant differences between species were detected within the preconditioned treatment. Retention values changed over time across both species and treatments, consistent with the significant temporal effect.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSpecies-specific responses dominated physiological patterns\\u003c/h2\\u003e \\u003cp\\u003eSpecies identity appeared to be the main factor structuring physiological responses across experimental phases. Differences between \\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e and \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e were consistently observed in photochemical efficiency (\\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e) regardless of preconditioning treatment (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Under the applied short-term heat stress, responses further differed between species and physiological metrics, with contrasting patterns in both \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e and pigmentation responses (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Photochemical efficiency declined more markedly in \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e, whereas \\u003cem\\u003eO. faveolata\\u003c/em\\u003e showed comparatively lower pigmentation retention. These contrasting responses may indicate that different aspects of coral physiology responded to thermal stress in each species, rather than reflecting overall differences in performance.\\u003c/p\\u003e \\u003cp\\u003eSymbiont community composition provided additional context for these patterns. \\u003cem\\u003eO. faveolata\\u003c/em\\u003e was predominantly associated with \\u003cem\\u003eDurusdinium\\u003c/em\\u003e, while \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e was mainly associated with \\u003cem\\u003eCladocopium\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e), and these associations remained stable across treatments and experimental phases. These patterns are consistent with observations from the same and nearby reefs of the southeastern Dominican Republic, where \\u003cem\\u003eO. faveolata\\u003c/em\\u003e populations have been shown to associate with both genera (O\\u0026rsquo;Donnell et al. \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e). Moreover, the dominance of \\u003cem\\u003eDurusdinium\\u003c/em\\u003e in \\u003cem\\u003eO. faveolata\\u003c/em\\u003e is consistent with previous studies linking this genus to enhanced thermal tolerance and bleaching resistance (Berkelmans and van Oppen \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e; Manzello et al. \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eTogether, these results suggest that intrinsic species-level traits, including stable host-symbiont associations, played a stronger role in shaping physiological responses than short-term thermal preconditioning.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLimited and context-dependent effects of short-term thermal preconditioning\\u003c/h2\\u003e \\u003cp\\u003eThermal preconditioning did not lead to a clear improvement in thermal tolerance, with similar responses observed between treatments across both \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e and pigmentation metrics in the two species (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Although preconditioned fragments showed a small reduction in \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e immediately following the priming phase, this difference did not persist after recovery, and both treatments entered the acute heat stress assay with comparable baseline photochemical efficiency, within ranges typically associated with healthy physiological function (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e; Warner et al. \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e; Evensen et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). This suggests that the initial decline reflects a transient physiological adjustment to sublethal thermal exposure, rather than a lasting impairment of baseline function (Bellantuono et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e; Putnam and Gates \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe absence of a detectable priming effect likely reflects the interaction between the applied thermal profile and species-specific physiological responses. Experimental evidence increasingly shows that the magnitude and temporal structure of thermal exposure strongly influence whether priming responses emerge. For example, variable temperature regimes have been found to enhance thermotolerance compared with sustained exposures, while improvements are often associated with intermediate levels of thermal variability; both low and highly variable regimes tend to result in inconsistent outcomes (Brown et al. \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e; DeMerlis et al. 2025). In addition, heating rate and cumulative stress exposure can further modulate physiological responses, even under comparable thermal regimes, highlighting that not only the magnitude of temperature but also how it is applied over time can shape coral stress responses (Martell and Zimmerman \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Klepac and Barshis \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Although \\u003cem\\u003eF\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e/F\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003em\\u003c/em\\u003e\\u003c/sub\\u003e and pigmentation were assessed at commonly used timepoints in acute heat stress assays (Voolstra et al. \\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Evensen et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Klepac and Barshis \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e), priming effects may have occurred outside the sampling window and therefore remained undetected.\\u003c/p\\u003e \\u003cp\\u003eAdditionally, the physiological response to thermal stress can be strongly influenced by prior environmental exposure. In this study, colonies were collected from reefs that had experienced relatively elevated temperatures in the months preceding collection (Fig. S4; Smith et al. \\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e; Spady et al. \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e), which may have already induced some degree of acclimatization and reduced the contrast between treatments. Similar patterns have been reported where recent sublethal thermal exposure can limit the expression of priming responses (Sahin et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Ferrara et al. \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2025\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThese findings are consistent with studies showing that species-specific physiological responses can dominate over treatment effects, particularly under acute stress conditions (Sweet et al. \\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Sahin et al. \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Together, they support the idea that short-term thermal preconditioning does not uniformly enhance coral thermal tolerance, but instead produces context-dependent outcomes that may not be detectable under all experimental scenarios.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eColony-level variability and its limited influence on treatment outcomes\\u003c/h2\\u003e \\u003cp\\u003eAlthough treatment-level effects were not detected, responses to thermal stress were not uniform across colonies. Colony-level variability was more pronounced for pigmentation metrics than for photochemical efficiency, suggesting that pigmentation dynamics may be more sensitive to colony-specific characteristics (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). However, leave-one-out analyses indicated that no single colony disproportionately influenced treatment-level estimates, and overall model performance remained stable across model iterations. This suggests that, while intraspecific variability exists, it did not obscure a strong treatment signal in this study. Colony-level variation in stress responses has been reported in other coral studies, where genotype-specific differences can influence bleaching and recovery dynamics (Ladd et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e; Manzello et al. \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). In the present study, the observed variability reinforces that responses to thermal stress can differ among colonies, even when treatment-level effects are not apparent.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePost-outplant pigmentation dynamics under natural field conditions\\u003c/h2\\u003e \\u003cp\\u003eThermal preconditioning did not improve pigmentation retention after outplanting under natural field conditions. Instead, treatment-level differences were observed primarily in \\u003cem\\u003eM. cavernosa\\u003c/em\\u003e, where preconditioned fragments showed lower retention than controls at specific timepoints (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Temporal trajectories were broadly similar across treatments, suggesting that responses were driven by the transition from laboratory to field conditions, with early changes in pigmentation likely reflecting photoacclimation to the new light environment. Although both treatments experienced similar light conditions after outplanting, differences in their physiological state at the time of transplantation may have led to different photoacclimation responses, contributing to the observed divergence during the initial monitoring period. Photoacclimation is well documented in reef-building corals, where changes in light can lead to rapid adjustments in symbiont density and pigmentation (Enr\\u0026iacute;quez et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Scheufen et al. \\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Similar shifts have been observed after transplantation, even in the absence of thermal stress, as corals adjust to new light conditions (Brown et al. \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Wangpraseurt et al. \\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eNo bleaching events or extreme thermal anomalies occurred during the field phase. Therefore, this phase did not test resistance to acute thermal stress, but rather the persistence of treatment effects under ambient conditions. Although some studies suggest that corals can retain acclimatized traits after environmental change (Brown et al. \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e), evidence for long-term physiological \\u0026ldquo;memory\\u0026rdquo; remains limited and context-dependent. These results suggest that short-term priming did not confer a clear advantage under non-stressful field conditions, and that observed differences in pigmentation were more likely driven by environmental acclimation following outplanting than by enhanced thermal resilience.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImplications for restoration and future directions\\u003c/h2\\u003e \\u003cp\\u003eOverall, species identity and stable symbiont associations were more likely stronger drivers of physiological responses than short-term thermal preconditioning. While priming did not produce detectable improvements in thermal tolerance or consistent benefits after outplanting, this does not rule out its potential use as a valuable restoration tool. Instead, these findings highlight that thermal preconditioning is likely to be context-dependent, with outcomes influenced by species traits, colony-level variability, and environmental history. From a practical perspective, this suggests that priming approaches should be tailored to specific species and environmental conditions rather than applied uniformly.\\u003c/p\\u003e \\u003cp\\u003eFuture work should focus on refining priming protocols, including the magnitude and duration of thermal exposure, and on evaluating their effectiveness under natural thermal stress events. Integrating controlled experiments with long-term field monitoring will be essential to determine whether preconditioning can enhance coral performance under real-world conditions, particularly during periods of elevated thermal stress.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eM.B.P. and S.H. designed the study in collaboration with S.E.T.v.d.M. and M.E.W. M.B.P., S.H., F.A.S.-V., G.P., and S.M. conducted the experimental work. All authors contributed to data analysis and interpretation. M.B.P. wrote the first draft of the manuscript, and all authors contributed to writing, provided critical revisions, and approved the final version.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\u003cp\\u003eThis work was supported by the Iberostar Group through the Wave of Change Innovation Hub, the University of Groningen, and the University of Delaware. We thank all staff and collaborators involved in coral husbandry, experimental setup, molecular laboratory analyses, and logistical and technical support. We are grateful to the Ministry of Environment and Natural Resources of the Dominican Republic for granting the research and export permits required for this study. We also thank Dressel Divers for their support with scuba diving during sample collection, outplanting, and field monitoring.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe datasets generated and analysed during the current study will be made publicly available in a suitable repository upon acceptance.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAinsworth TD, Heron SF, Ortiz JC, Mumby PJ, Grech A, Ogawa D, Eakin CM, Leggat W (2016) Climate change disables coral bleaching protection on the Great Barrier Reef. \\u003cem\\u003eScience\\u003c/em\\u003e 352:338\\u0026ndash;342. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://10.1126/science.aac7125\\u003c/span\\u003e\\u003cspan address=\\\"https://10.1126/science.aac7125\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlemu IJB, Clement Y (2014) Mass coral bleaching in 2010 in the southern Caribbean. \\u003cem\\u003ePLoS One\\u003c/em\\u003e 9:e83829. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0092542\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0092542\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAteweberhan M, Feary DA, Keshavmurthy S, Chen A, Schleyer MH, Sheppard CRC (2013) Climate change impacts on coral reefs: synergies with local effects, possibilities for acclimation, and management implications. \\u003cem\\u003eMar Pollut Bull\\u003c/em\\u003e 74:526\\u0026ndash;539. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.marpolbul.2013.06.011\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.marpolbul.2013.06.011\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBaker AC, Glynn PW, Riegl B (2008) Climate change and coral reef bleaching: an ecological assessment of long-term impacts, recovery trends and future outlook. \\u003cem\\u003eEstuar Coast Shelf Sci\\u003c/em\\u003e 80:435\\u0026ndash;471. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.ecss.2008.09.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.ecss.2008.09.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBates D, M\\u0026auml;chler M, Bolker B, Walker S (2015) Fitting linear mixed-effects models using lme4. \\u003cem\\u003eJ Stat Softw\\u003c/em\\u003e 67:1\\u0026ndash;48. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.18637/jss.v067.i01\\u003c/span\\u003e\\u003cspan address=\\\"10.18637/jss.v067.i01\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBellantuono AJ, Granados-Cifuentes C, Miller DJ, Hoegh-Guldberg O, Rodriguez-Lanetty M (2012) Coral thermal tolerance: tuning gene expression to resist thermal stress. \\u003cem\\u003ePLoS One\\u003c/em\\u003e 7:e50685. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0050685\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0050685\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBerkelmans R, van Oppen MJH (2006) The role of zooxanthellae in the thermal tolerance of corals: a \\u0026lsquo;nugget of hope\\u0026rsquo; for coral reefs in an era of climate change. \\u003cem\\u003eProc Biol Sci\\u003c/em\\u003e 273:2305\\u0026ndash;2312. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1098/rspb.2006.3567\\u003c/span\\u003e\\u003cspan address=\\\"10.1098/rspb.2006.3567\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBostr\\u0026ouml;m-Einarsson L, Babcock RC, Bayraktarov E, Ceccarelli D, Cook N, Ferse SCA, Hancock B, Harrison P, Hein M, Shaver E, Smith A, Suggett DJ, Stewart-Sinclair PJ, Vardi T, McLeod IM (2020) Coral restoration - A systematic review of current methods, successes, failures and future directions. \\u003cem\\u003ePLoS One\\u003c/em\\u003e 15:e0226631. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0226631\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0226631\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrown BE, Dunne RP, Edwards AJ, Sweet MJ, Phongsuwan N (2015) Decadal environmental \\u0026lsquo;memory\\u0026rsquo; in a reef coral? \\u003cem\\u003eMar Biol\\u003c/em\\u003e 162:479\\u0026ndash;483. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00227-014-2596-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-014-2596-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrown KT, Martynek MP, Barott KL (2024) Local habitat heterogeneity rivals regional differences in coral thermal tolerance. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 43:571\\u0026ndash;585. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-024-02484-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-024-02484-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBruce Evan Goldstein, Caribbean Restoration Interventions Forum (2025) Advancing coral reef interventions in the Caribbean: overcoming barriers and enabling action. \\u003cem\\u003eCoral Restoration Consortium\\u003c/em\\u003e. m. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.5281/zenodo.17603166\\u003c/span\\u003e\\u003cspan address=\\\"10.5281/zenodo.17603166\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCort\\u0026eacute;s-Useche C, Hern\\u0026aacute;ndez-Delgado EA, Calle-Trivi\\u0026ntilde;o J, Blasco RS, Galv\\u0026aacute;n V, Arias-Gonz\\u0026aacute;lez JE (2021) Conservation actions and ecological context: optimizing coral reef local management in the Dominican Republic. \\u003cem\\u003ePeerJ\\u003c/em\\u003e 9:e10925. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://10.7717/peerj.10925\\u003c/span\\u003e\\u003cspan address=\\\"https://10.7717/peerj.10925\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCunning R, Matsuda SB, Bartels E, D\\u0026rsquo;Alessandro M, Detmer AR, Harnay P, Levy J, Lirman D, Moeller HV, Muller EM, Nedimyer K (2024) On the use of rapid acute heat tolerance assays to resolve ecologically relevant differences among corals. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 43:1793\\u0026ndash;1801. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-024-02577-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-024-02577-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeMerlis A, Kirkland A, Kaufman ML, Mayfield AB, Formel N, Kolodziej G, Manzello DP, Lirman D, Traylor-Knowles N, Enochs IC (2022) Pre-exposure to a variable temperature treatment improves the response of \\u003cem\\u003eAcropora cervicornis\\u003c/em\\u003e to acute thermal stress. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 41:435\\u0026ndash;445. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-022-02232-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-022-02232-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDrury C (2020) Resilience in reef-building corals: the ecological and evolutionary importance of the host response to thermal stress. \\u003cem\\u003eMol Ecol\\u003c/em\\u003e 29:448\\u0026ndash;465. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/mec.15337\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/mec.15337\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDrury C, Dilworth J, Majerov\\u0026aacute; E, Caruso C, Greer JB (2022) Expression plasticity regulates intraspecific variation in the acclimatization potential of a reef-building coral. \\u003cem\\u003eNat Commun\\u003c/em\\u003e 13:4790. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41467-022-32452-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-022-32452-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDuarte CM, Agust\\u0026iacute; S, Barbier E, Britten GL, Castilla JC, Gattuso JP, Fulweiler RW, Hughes TP, Knowlton N, Lovelock CE, Lotze HK, Predragovic M, Poloczanska ES, Roberts C, Worm B (2020) Rebuilding marine life. \\u003cem\\u003eNature\\u003c/em\\u003e 580:39\\u0026ndash;51. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41586-020-2146-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41586-020-2146-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEakin CM, Heron SF, Connolly SR, Devotta DA, Liu G, Geiger EF, De La Cour JL, Gomez AM, Skirving WJ, Baird AH, Cantin NE (2026) Severe and widespread coral reef damage during the 2014\\u0026ndash;2017 Global Coral Bleaching Event. \\u003cem\\u003eNat Commun\\u003c/em\\u003e 17(1):1318. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41467-025-67506-w\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-025-67506-w\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEakin CM, Morgan JA, Heron SF, Smith TB, Liu G, Alvarez-Filip L, Baca B, Bartels E, Bastidas C, Bouchon C, Brandt M (2010) Caribbean corals in crisis: record thermal stress, bleaching, and mortality in 2005. \\u003cem\\u003ePLoS One\\u003c/em\\u003e 5:e13969. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0013969\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0013969\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEdmunds PJ (2014) Is acclimation beneficial to scleractinian corals, \\u003cem\\u003ePorites\\u003c/em\\u003e spp.? \\u003cem\\u003eMar Biol\\u003c/em\\u003e 161:1531\\u0026ndash;1542. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00227-014-2438-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-014-2438-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEnr\\u0026iacute;quez S, M\\u0026eacute;ndez ER, Iglesias-Prieto R (2005) Multiple scattering on coral skeletons enhances light absorption by symbiotic algae. \\u003cem\\u003eLimnol Oceanogr\\u003c/em\\u003e 50:1025\\u0026ndash;1032. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.4319/lo.2005.50.4.1025\\u003c/span\\u003e\\u003cspan address=\\\"10.4319/lo.2005.50.4.1025\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEvensen NR, Voolstra CR, Fine M, Perna G, Buitrago-L\\u0026oacute;pez C, C\\u0026aacute;rdenas A, Banc-Prandi G, Rowe K, Barshis DJ (2022) Empirically derived thermal thresholds of four coral species along the Red Sea using a portable and standardized experimental approach. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 41:239\\u0026ndash;252. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-022-02233-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-022-02233-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFerrara EF, Roik A, W\\u0026ouml;hrmann-Zipf F, Ziegler M (2025) Ex situ thermal preconditioning modulates coral physiology and enhances heat tolerance: a multispecies perspective for active restoration. \\u003cem\\u003eEnviron Sci Technol\\u003c/em\\u003e 59:8527\\u0026ndash;8540. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1021/acs.est.4c08640\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/acs.est.4c08640\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGibbin EM, Krueger T, Putnam HM, Barott KL, Bodin J, Gates RD, Meibom A (2018) Short-term thermal acclimation modifies the metabolic condition of the coral holobiont. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 5:10. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2018.00010\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2018.00010\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGrottoli AG, Warner ME, Levas SJ, Aschaffenburg MD, Schoepf V, McGinley M, Baumann J, Matsui Y (2014) The cumulative impact of annual coral bleaching can turn some coral species winners into losers. \\u003cem\\u003eGlob Change Biol\\u003c/em\\u003e 20:3823\\u0026ndash;3833. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/gcb.12658\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/gcb.12658\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHackerott S, Martell HA, Eirin-Lopez JM (2021) Coral environmental memory: causes, mechanisms, and consequences for future reefs. \\u003cem\\u003eTrends Ecol Evol\\u003c/em\\u003e 36:1011\\u0026ndash;1023. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.tree.2021.06.014\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.tree.2021.06.014\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHein MY, Vardi T, Shaver EC, Pioch S, Bostr\\u0026ouml;m-Einarsson L, Ahmed M, Grimsditch G, McLeod IM (2021) Perspectives on the use of coral reef restoration as a strategy to support and improve reef ecosystem services. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 8:618303. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2021.618303\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2021.618303\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHilker M, Schwachtje J, Baier M, Balazadeh S, B\\u0026auml;urle I, Geiselhardt S, Hincha DK, Kunze R, Mueller-Roeber B, Rillig MC, Rolff J (2016) Priming and memory of stress responses in organisms lacking a nervous system. \\u003cem\\u003eBiol Rev\\u003c/em\\u003e 91:1118\\u0026ndash;1133. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/brv.12215\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/brv.12215\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003eDigital Object Identifier (DOI)\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJones A, Berkelmans R (2010) Potential costs of acclimatization to a warmer climate: growth of a reef coral with heat tolerant versus sensitive symbiont types. \\u003cem\\u003ePLoS One\\u003c/em\\u003e 5:e10437. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1371/journal.pone.0010437\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pone.0010437\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKlepac CN, Barshis DJ (2022) High-resolution in situ thermal metrics coupled with acute heat stress experiments reveal differential coral bleaching susceptibility. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 41(4):1045\\u0026ndash;57. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-022-02276-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-022-02276-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKuznetsova A, Brockhoff PB, Christensen RH (2017) lmerTest package: tests in linear mixed effects models. \\u003cem\\u003eJ Stat Soft\\u003c/em\\u003e 82:1\\u0026ndash;26. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.18637/jss.v082.i13\\u003c/span\\u003e\\u003cspan address=\\\"10.18637/jss.v082.i13\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLadd MC, Shantz AA, Bartels E, Burkepile DE (2017) Thermal stress reveals a genotype-specific tradeoff between growth and tissue loss in restored \\u003cem\\u003eAcropora cervicornis\\u003c/em\\u003e. \\u003cem\\u003eMar Ecol Prog Ser\\u003c/em\\u003e 572:129\\u0026ndash;139. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3354/meps\\u003c/span\\u003e\\u003cspan address=\\\"10.3354/meps\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLenth RV (2020) Estimated marginal means, aka least-squares means. \\u003cem\\u003eJ Stat Softw\\u003c/em\\u003e 95(1):1\\u0026ndash;33. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.18637/jss.v069.i01\\u003c/span\\u003e\\u003cspan address=\\\"10.18637/jss.v069.i01\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoya Y, Sakai K, Yamazato K, Nakano Y, Sambali H, Van Woesik R (2001) Coral bleaching: the winners and the losers. \\u003cem\\u003eEcol Lett\\u003c/em\\u003e 4:122\\u0026ndash;131. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1046/j.1461-0248.2001.00203.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1046/j.1461-0248.2001.00203.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMajerov\\u0026aacute; E, Carey FC, Drury C, Gates RD (2021) Preconditioning improves bleaching tolerance in the reef-building coral \\u003cem\\u003ePocillopora acuta\\u003c/em\\u003e through modulations in the programmed cell death pathways. \\u003cem\\u003eMol Ecol\\u003c/em\\u003e 30:3560\\u0026ndash;3574. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/mec.15988\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/mec.15988\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMajerov\\u0026aacute; E, Drury C (2022) Thermal preconditioning in a reef-building coral alleviates oxidative damage through a BI-1-mediated antioxidant response. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 9:971332. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2022.971332\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2022.971332\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMartell HA (2023) Thermal priming and bleaching hormesis in the staghorn coral \\u003cem\\u003eAcropora cervicornis\\u003c/em\\u003e (Lamarck 1816). \\u003cem\\u003eJ Exp Mar Biol Ecol\\u003c/em\\u003e 560:151820. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.jembe.2022.151820\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jembe.2022.151820\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMartell HA, Zimmerman RC (2021) Heating rate modulates the metabolic response of the staghorn coral \\u003cem\\u003eAcropora cervicornis\\u003c/em\\u003e (Lamarck, 1816). \\u003cem\\u003eMar Biol\\u003c/em\\u003e 168(6):83. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00227-021-03847-6\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-021-03847-6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eManzello DP, Matz MV, Enochs IC, Valentino L, Carlton RD, Kolodziej G, Serrano X, Towle EK, Jankulak M (2019) Role of host genetics and heat-tolerant algal symbionts in sustaining populations of the endangered coral \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e in the Florida Keys with ocean warming. \\u003cem\\u003eGlob Change Biol\\u003c/em\\u003e 25:1016\\u0026ndash;1031. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/gcb.14545\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/gcb.14545\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMayfield AB, Fan T, Chen C (2013) Physiological acclimation to elevated temperature in a reef-building coral from an upwelling environment. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 32:909\\u0026ndash;921. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-013-1067-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-013-1067-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMaynard JA, Anthony KRN, Marshall PA, Masiri I (2008) Major bleaching events can lead to increased thermal tolerance in corals. \\u003cem\\u003eMar Biol\\u003c/em\\u003e 155:173\\u0026ndash;182. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00227-008-1015-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00227-008-1015-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMcGinley MP (2012) The impact of environmental stress on \\u003cem\\u003eSymbiodinium\\u003c/em\\u003e spp.: A molecular and community-\\u0026shy; scale investigation [Dissertation Ph.D. thesis, University of Delaware] pp 165\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiddlebrook R, Anthony KRN, Hoegh-Guldberg O (2008) Thermal priming affects symbiont photosynthesis but does not alter bleaching thresholds in \\u003cem\\u003eAcropora millepora\\u003c/em\\u003e. \\u003cem\\u003eJ Exp Mar Biol Ecol\\u003c/em\\u003e 357:48\\u0026ndash;55. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.jembe.2012.07.005\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jembe.2012.07.005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNational Academies of Sciences, Engineering, and Medicine (2019) A research review of interventions to increase the persistence and resilience of coral reefs. National Academies Press, Washington DC. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.17226/25279\\u003c/span\\u003e\\u003cspan address=\\\"10.17226/25279\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eO\\u0026rsquo;Donnell SE, Ruggeri M, Blanco-Pimentel M, Morikawa MK, Harms E, Calle-Trivi\\u0026ntilde;o J, Flanagan BA, Carlson HK, Kenkel CD, Million WC (2025) Species-specific patterns of population genetic structure differ on a microgeographic scale. \\u003cem\\u003eCoral Reefs\\u003c/em\\u003e 44:353\\u0026ndash;358. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-024-02598-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-024-02598-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin PR, O\\u0026rsquo;Hara RB, Simpson GL, Solymos P, Stevens MHH, Szoecs E, Wagner H (2022) \\u003cem\\u003evegan: Community Ecology Package\\u003c/em\\u003e. R package version 2.6\\u0026ndash;4\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOliver ECJ, Burrows MT, Donat MG, Sen Gupta A, Alexander LV, Perkins-Kirkpatrick SE, Benthuysen JA, Hobday AJ, Holbrook NJ, Moore PJ, Thomsen MS, Wernberg T, Smale DA (2019) Projected marine heatwaves in the 21st century and the potential for ecological impact. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 6:734. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2019.00734\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2019.00734\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePalumbi SR, Barshis DJ, Traylor-Knowles N, Bay RA (2014) Mechanisms of reef coral resistance to future climate change. \\u003cem\\u003eScience\\u003c/em\\u003e 344:895\\u0026ndash;898. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1126/science.1251336\\u003c/span\\u003e\\u003cspan address=\\\"10.1126/science.1251336\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeixoto RS, Voolstra CR, Staab S, Ribeiro B, Duarte G, Suggett DJ (2025) Building coral reef resilience through assisted restoration. In: Coral reef microbiome. Springer Nature Switzerland, Cham, pp 235\\u0026ndash;243. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/978-3-031-76692-3_16\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/978-3-031-76692-3_16\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePutnam HM, Gates RD (2015) Preconditioning in the reef-building coral \\u003cem\\u003ePocillopora damicornis\\u003c/em\\u003e and the potential for trans-generational acclimatization in coral larvae under future climate change conditions. \\u003cem\\u003eJ Exp Biol\\u003c/em\\u003e 218:2365\\u0026ndash;2372. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1242/jeb.123018\\u003c/span\\u003e\\u003cspan address=\\\"10.1242/jeb.123018\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSahin D, Schoepf V, Filbee-Dexter K, Thomson DP, Radford B, Wernberg T (2023) Heating rate explains species-specific coral bleaching severity during a simulated marine heatwave. \\u003cem\\u003eMar Ecol Prog Ser\\u003c/em\\u003e 706:33\\u0026ndash;46. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3354/meps\\u003c/span\\u003e\\u003cspan address=\\\"10.3354/meps\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eScheufen T, Iglesias-Prieto R, Enr\\u0026iacute;quez S (2017) Changes in the number of symbionts and Symbiodinium cell pigmentation modulate differentially coral light absorption and photosynthetic performance. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 4:309. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2017.00309\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2017.00309\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchoepf V, Jung MU, McCulloch MT, White NE, Stat M, Thomas L (2020) Thermally variable, macrotidal reef habitats promote rapid recovery from mass coral bleaching. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 7:245. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2020.00245\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2020.00245\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSilverstein RN, Cunning R, Baker AC (2015) Change in algal symbiont communities after bleaching, not prior heat exposure, increases heat tolerance of reef corals. \\u003cem\\u003eGlob Change Biol\\u003c/em\\u003e 21:236\\u0026ndash;249. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/gcb.12706\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/gcb.12706\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSmith KE, Sen Gupta A, Burrows MT, Filbee-Dexter K, Hobday AJ, Holbrook NJ, Malan N, Moore PJ, Oliver ECJ, Thomsen MS, Wernberg T, Zhao Z, Smale DA (2025) Ocean extremes as a stress test for marine ecosystems and society. \\u003cem\\u003eNat Clim Chang\\u003c/em\\u003e 15:231\\u0026ndash;235. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41558-025-02269-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41558-025-02269-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSpady BL, Skirving WJ, De La Cour JL, Geiger EF, Liu G, Hoegh-Guldberg O, Norrie A, Heron SF, Pomeroy MW, Kolodziej G, Brown KT (2026) The 4th global coral bleaching event: ushering in an era of near-annual bleaching. \\u003cem\\u003eCoral Reefs 1\\u0026ndash;16\\u003c/em\\u003e. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s00338-025-02810-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00338-025-02810-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStone M (1974) Cross-validatory choice and assessment of statistical predictions. \\u003cem\\u003eJ R Stat Soc Ser B\\u003c/em\\u003e 36:111\\u0026ndash;147. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/j.2517-6161.1974.tb00994.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.2517-6161.1974.tb00994.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSuggett DJ, Warner ME, Leggat W (2017) Symbiotic dinoflagellate functional diversity mediates coral survival under ecological crisis. \\u003cem\\u003eTrends Ecol Evol\\u003c/em\\u003e 32:735\\u0026ndash;745. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.tree.2017.07.013\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.tree.2017.07.013\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSweet M, Bulling M, Varshavi D, Lloyd GR, Jankevics A, Najdekr L, Weber RJ, Viant MR, Craggs J (2021) Species-specific variations in the metabolomic profiles of \\u003cem\\u003eAcropora hyacinthus\\u003c/em\\u003e and \\u003cem\\u003eAcropora millepora\\u003c/em\\u003e mask acute temperature stress effects in adult coral colonies. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 8:574292. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2021.574292\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2021.574292\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThomas L, Rose NH, Bay RA, L\\u0026oacute;pez EH, Morikawa MK, Ruiz-Jones L, Palumbi SR (2018) Mechanisms of thermal tolerance in reef-building corals across a fine-grained environmental mosaic: lessons from Ofu, American Samoa. \\u003cem\\u003eFront Mar Sci\\u003c/em\\u003e 4:434. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmars.2017.00434\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmars.2017.00434\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVan Oppen MJH, Oliver JK, Putnam HM, Gates RD (2015) Building coral reef resilience through assisted evolution. \\u003cem\\u003eProc Nat Acad Sci U S A\\u003c/em\\u003e 112:2307\\u0026ndash;2313. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1073/pnas.1422301112\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.1422301112\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVinton A, Arvai J, Zheng D, Kenkel C, Marcos A (2025) Genetic Preservation Emerges as Top Priority: Coral Experts Redefine Conservation Under Climate Change. \\u003cem\\u003eAuthorea.\\u003c/em\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.22541/au.175217038.86609064/v3\\u003c/span\\u003e\\u003cspan address=\\\"10.22541/au.175217038.86609064/v3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVoolstra CR, Buitrago-L\\u0026oacute;pez C, Perna G, C\\u0026aacute;rdenas A, Hume BC, R\\u0026auml;decker N, Barshis DJ (2020) Standardized short-term acute heat stress assays resolve historical differences in coral thermotolerance across microhabitats. \\u003cem\\u003eGlob Change Biol\\u003c/em\\u003e 26:4328\\u0026ndash;4343. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/gcb.15148\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/gcb.15148\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWangpraseurt D, Polerecky L, Larkum AWD, Ralph PJ, Nielsen DA, Pernice M, K\\u0026uuml;hl M (2014) The in situ light microenvironment of corals. \\u003cem\\u003eLimnol Oceanogr\\u003c/em\\u003e 59:917\\u0026ndash;926. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.4319/lo.2014.59.3.0917\\u003c/span\\u003e\\u003cspan address=\\\"10.4319/lo.2014.59.3.0917\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWarner ME, Fitt WK, Schmidt GW (1999) Damage to photosystem II in symbiotic dinoflagellates: a determinant of coral bleaching. \\u003cem\\u003eProc Nat Acad Sci U S A\\u003c/em\\u003e 96:8007\\u0026ndash;8012. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1073/pnas.96.14.8007\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.96.14.8007\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWickham H, Averick M, Bryan J, Chang W, McGowan LD, Fran\\u0026ccedil;ois R, Grolemund G, Hayes A, Henry L, Hester J, Kuhn M (2019) Welcome to the Tidyverse. \\u003cem\\u003eJ Open Source Softw\\u003c/em\\u003e 4(43):1686. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.21105/joss.01686\\u003c/span\\u003e\\u003cspan address=\\\"10.21105/joss.01686\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWicquart J, Mathon L, Petit A, Rivera-Sosa A, McField M (eds) (2025) Status and trends of Caribbean coral reefs: 1970\\u0026ndash;2024. Global Coral Reef Monitoring Network (GCRMN) and International Coral Reef Initiative (ICRI). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.59387/BDHF9180\\u003c/span\\u003e\\u003cspan address=\\\"10.59387/BDHF9180\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilkinson CR (2000) Status of coral reefs of the world: 2000. Australian Institute of Marine Science, Townsville\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"coral-reefs\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"core\",\"sideBox\":\"Learn more about [Coral Reefs](http://link.springer.com/journal/338)\",\"snPcode\":\"338\",\"submissionUrl\":\"https://submission.nature.com/new-submission/338/3\",\"title\":\"Coral Reefs\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"heat stress, reef restoration, coral bleaching, Symbiodiniaceae, symbiont community composition, Caribbean reefs, reef resilience, colony-level variability\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9372487/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9372487/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThermal stress is a dominant driver of coral reef degradation, challenging traditional restoration approaches and motivating interventions to enhance coral heat tolerance. Thermal preconditioning, which involves exposing corals to sublethal warming to induce physiological responses, has been proposed as one such strategy, but its effectiveness in scleractinian corals remains uncertain. Here, we evaluated whether short-term thermal preconditioning enhances physiological tolerance to acute heat stress in two Caribbean reef-building corals, \\u003cem\\u003eMontastraea cavernosa\\u003c/em\\u003e and \\u003cem\\u003eOrbicella faveolata\\u003c/em\\u003e, within a restoration-relevant framework. Eighteen colonies were exposed to a sublethal warming event, allowed to recover under ambient conditions, and then subjected to an acute heat stress assay. Stress responses were quantified using photochemical efficiency and pixel intensity-based color retention, alongside symbiont community composition. Additional preconditioned and control fragments were outplanted and monitored for one year to assess post-outplant pigmentation under non-stress field conditions.\\u003c/p\\u003e \\u003cp\\u003eThermal preconditioning did not consistently enhance tolerance. Responses differed markedly between species and among colonies, indicating strong intraspecific heterogeneity. Symbiont communities differed between species but remained stable across treatments and colonies, suggesting that responses were not driven by shifts in dominant symbionts. No differences in pigmentation trajectories were detected between preconditioned and control outplants under non-bleaching conditions. Together, these results indicate that thermal preconditioning is not a universally effective intervention and that its outcomes may depend on coral species, colony identity, and experimental context. This variability underscores the need for evidence-based and locally tailored application of preconditioning within coral restoration strategies.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Advancing reef restoration with thermal preconditioning interventions: species- and colony-specific responses of Montastraea cavernosa and Orbicella faveolata\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-05-04 18:35:54\",\"doi\":\"10.21203/rs.3.rs-9372487/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-23T17:45:51+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-04-14T22:46:27+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-04-11T12:28:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Coral Reefs\",\"date\":\"2026-04-09T21:18:12+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"coral-reefs\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"core\",\"sideBox\":\"Learn more about [Coral Reefs](http://link.springer.com/journal/338)\",\"snPcode\":\"338\",\"submissionUrl\":\"https://submission.nature.com/new-submission/338/3\",\"title\":\"Coral Reefs\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"83a6595b-4cd1-4685-b63d-2c03dc22157c\",\"owner\":[],\"postedDate\":\"May 4th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-05-04T18:35:54+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-05-04 18:35:54\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9372487\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9372487\",\"identity\":\"rs-9372487\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}