{"paper_id":"46bb5f05-3758-47a7-82ab-cb6bc44c3c88","body_text":"In vitro effect of Granulocyte-macrophage colony-stimulating factor (GM-CSF) on the expression of related genes to sperm motility and energy metabolism, and ICSI outcomes in obstructive azoospermic patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article In vitro effect of Granulocyte-macrophage colony-stimulating factor (GM-CSF) on the expression of related genes to sperm motility and energy metabolism, and ICSI outcomes in obstructive azoospermic patients fatemeh Tanhaye Kalate Sabz, Elham Hosseini, Fatemeh Sadat Amjadi, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3906456/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Granulocyte-macrophage colony-stimulating factor (GM-CSF) expressed in the human reproductive system, holds a pivotal role in the reproductive processes. This study investigates the in vitro effect of GM-CSF on the testicular sperm of obstructive azoospermia (OA) patients and assesses the effectiveness of GM-CSF‐supplemented sperm media in Intracytoplasmic sperm injection (ICSI) outcomes. Methods and Results Following testicular sperm extraction from 20 patients diagnosed with OA, each sample was divided into two parts: the experimental samples were incubated with the medium containing 2 ng/ml GM-CSF at 37°C for 60 min, and control samples were incubated with medium without GM-CSF. Subsequently, the oocytes retrieved from the partner were injected with sperms from treatment and the control groups. The sperm parameters ( motility, viability), the expression level of sperm motility-related genes ( PIK3R1 , PIK3CA , and AKT1 ), and sperm energy metabolism-related genes ( GLUT1 , GLUT3 , and GLUT14 ) were assessed. Furthermore, the fertilization and cleavage rates and embryo quality were evaluated. Supplemented testicular sperm with GM-CSF significantly increased motility parameters, the mRNA expression of PIK3R1 , AKT1 , and GLUT3 compared to the non-treated group (p < 0.05). However, no significant differences in mRNA expression of PIK3CA , GLUT1 , or GLUT14 were identified. Based on ICSI outcomes, the GM-CSF treatment group exhibited significantly higher fertilization rates (p = 0.027), cleavage rates (p = 0.001), and the proportion of good-quality embryos (p = 0.002) compared to the control group. Conclusions GM-CSF increased gene expression related to motility and energy metabolism pathway and effectively had a positive effect on the motility of testis-extracted spermatozoa and, consequently yielding positive clinical outcomes. GM-CSF Obstructive azoospermia Sperm motility Glucose Transporter Type 1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Azoospermia accounts for approximately 10 to 15 percent of male infertility, manifesting in two predominant forms: obstructive and non-obstructive. Obstructive azoospermia is due to obstruction in the male genital tract. Conversely, non-obstructive azoospermia, being the more prevalent form, arises from a failure of spermatogenesis within the testis [ 1 ]. Intracytoplasmic sperm injection (ICSI) following testicular sperm extraction (TESE) has become an effective treatment for men with azoospermia in assisted reproduction programs [ 2 ]. The absence of motile spermatozoa is a common observation in specimens obtained through epididymal sperm aspiration and testicular biopsy, adversely affecting ICSI outcome and fertilization rates [ 3 , 4 ]. Based on studies, testicular spermatozoa should be incubated in a sperm medium before ICSI [ 5 ]. The incubation of testicular spermatozoa for a duration of 1 to 2 hours before ICSI has been observed to induce motility. However, it is noteworthy that, in certain instances, spermatozoa may remain immotile even following the incubation period [ 6 ]. The application of certain compounds appears to enhance sperm parameters in vitro among individuals diagnosed with azoospermia. Subsequently, the ICSI success rate and fertilization rates could be increased [ 4 ]. Researchers have reported that Pentoxifylline (PTF) functions as a chemical motility enhancer, eliciting an increase in cyclic adenosine monophosphate (cAMP), glycolysis, and energy production within testicular sperm [ 7 ]. However, apprehensions exist regarding the safety profile of this chemical compound. PTF has toxic effects when incubated with sperm for a prolonged period [ 8 ]; It is imperative to substitute the natural compounds within the male reproductive system to ameliorate sperm quality in vitro. Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a crucial member of the cytokine family, primarily recognized for its role in the immune system where it governs the maturation and proliferation of granulocytes and macrophages [ 9 ]. GM-CSF promotes embryonic growth and development and regulates the implantation process and maternal immune response [ 10 ]. Studies have shown that GM-CSF supplementation to embryo culture media can increase the implantation rate and the number of live births [ 11 ]. The location and distribution of GM-CSF and its receptor alongside the male reproductive tract (epididymis and testis), seminal plasma and spermatozoa cells were previously proved [ 12 – 14 ]. Its receptor was expressed on the mid-piece and tail of mature spermatozoa [ 12 , 13 ]. According to studies, about 25% of the interstitial cells in the testis are macrophages [ 15 ]. Interestingly, macrophages in the testis produce more GM-CSF than macrophages in other body parts [ 16 ]. On the other hand, it was demonstrated that exogenous GM-CSF increases testosterone concentration in prostatic adenocarcinoma [ 17 ]. It has been shown that infertile men have lower levels of GM-CSF in seminal plasma than fertile one [ 18 ]. GM-CSF is known to act in seminiferous tubules and spermatozoa, but its role on sperm function is not well understood. However, GM-CSF seems to have a significant role in sperm physiology [ 13 ],for example, it has been shown that GM-CSF can be beneficial as a post-freeze additive and may improve sperm quality after post-thawing incubation.[ 19 ]. GM-CSF activates different signaling pathways in different cell types; one of them is the phosphoinositide-3-kinase/protein kinase B (PI3K/AKT) signaling pathway, which is involved in intracellular metabolic and anti-apoptotic processes; AKT indirectly promotes cell survival by regulating glucose-related metabolic processes [ 20 ]. It has been shown that GM-CSF stimulates glucose uptake by translocating glucose transporter 1 (GLUT1) via the PI3K/AKT pathway [ 21 ]. The PI3K/AKT pathway is a main pathway in regulating the motility and hyperactivation of spermatozoa [ 22 ]. GLUTs family are found in various tissues, including testes and spermatozoa, and help transport mono hexoses [ 23 , 24 ] in sperm; also, the energy is produced through metabolic pathways between sertoli cells and germ cells [ 25 ]. Through GLUTs, such as GLUT1, GLUT3, GLUT8, and GLUT9, glucose is transported from interstitial space into sertoli cells [ 26 ]. These transporters are located in the plasma membrane [ 27 ]. Studies showed that GM-CSF increased bovine and human sperm motility [ 12 , 28 ]. GM-CSF supplement improves sperm parameters and increases glucose transporter expression via the PI3K/AKT pathway in Oligoasthenoteratospermia (OAT) men [ 28 ]. Its effect on testicular biopsy in patients with obstructive azoospermia has not been evaluated yet. The present study assessed the in-vitro effect of GM-CSF on the gene expression of GLUT s, PIK3CA , PIK3R1 , AKT1 , and the motility and viability of sperm from testicular biopsies. In addition, the clinical outcomes of these sperm injections were assessed. Materials and Methods A total of twenty testicular samples were obtained from men with obstructive azoospermia treated for infertility. All patients who participated in the study underwent testicular biopsy as part of their treatment and provided written informed consent. The experimental protocol was approved by the ethical committee of Zanjan University of Medical Sciences, Zanjan, Iran, (IR.ZUMS.REC.1398.357). All patients were evaluated by semen analysis, hormone levels (serum FSH, LH and testosterone), and physical examination. In the present study, all male patients with infertility were diagnosed with azoospermia. Lack of spermatozoa in semen samples and the pellet after centrifugation (20 minutes at 3000 g), used as the diagnosis for azoospermia. Reconstructive surgical interventions were considered as a therapeutic modality to repair obstructive anomalies within the male reproductive tract. In instances where reconstructive procedures proved unfeasible, male patients proceeded to undergo diagnostic TESE as an alternative approach to perform intracytoplasmic sperm injection-embryo transfer. Male partner with non-obstructive azoospermia, including Y-chromosome deletions, spinal cord injuries, hypogonadotropic hypogonadism and Klinefelter syndrome were excluded from this study. Following TESE, individuals displaying a lack of spermatozoa in the biopsy specimens were subsequently excluded from the study cohort. Demographic information of the studied couples are shown in the Table 1 . Table 1 Demographic information of the studied couples Male partners Age (year) 37.7 ± 4.7 BMI 24.45 ± 3.9 FSH (mIU/ml) 5.4 ± 4.1 LH (mIU/ml) 4.3 ± 3.7 Testosterone (ng/ml) 5.16 ± 2.06 Testis volume in physical examinatio (ml) 18.36 ± 3.80 Testis length in physical examinatio (cm) 4.49 ± 0.88 Female partners Age (year) 31.4 ± 3.3 BMI (Kg/m 2 ) 24.51 ± 1.5 Infertility (year) 4.6 ± 2.9 AMH (ng/µl) 3.4 ± 1.7 TESE procedure, sperm extraction, and incubation The TESE procedure was carried out by skilled urologists. In brief, a transverse incision measuring 2 cm was meticulously made on the anterior scrotal skin and tunica albuginea, followed by the injection of lidocaine into the underlying tunica. Subsequently, small testicular parenchymal specimens were excised from the testis, placed in a Petri dish containing sperm wash medium, and meticulously separated using sterile needles. The dissected tissue fragments were subjected to microscopic scrutiny using an inverted microscope to ascertain the presence of spermatozoa. Following sperm observation, the homogenate underwent a wash procedure and centrifugation at 2000 rpm for 5 minutes. The resulting precipitated sample was then partitioned into control and treatment groups in cases where sperm retrieved through TESE exhibit poor motility. In the treatment group, the sample underwent incubation in an IVF medium (Cook, USA) enriched with 2 ng/ml granulocyte-macrophage colony-stimulating factor (GM-CSF) [ 28 ], Conversely, the control group's sample was incubated in the same medium without the inclusion of GM-CSF. Both groups were subjected to incubation for one hour at 37°C and 5% CO 2 (27). Ovarian stimulation and ICSI Ovarian stimulation was performed with long agonist protocol; stimulation began with the administration of Gonadotropin-releasing hormone (GnRH) agonist (triptorelin) at a dose of 0.1 mg on day 21 of the menstrual cycle. Subsequently, gonadotropin (Cinal-F or Gonal-F) was administered daily at a dose ranging from 150 to 225 IU, adjusted based on individualized female parameters, including anti-Müllerian hormone (AMH) levels, age, and antral follicle count (AFC). Continuous administration of both GnRH agonist and gonadotropin persisted until the visualization of at least two follicles measuring 16 to 18 mm in diameter on ultrasound. Upon achieving this criterion, the administration of gonadotrophin and GnRH agonists was halted and human chorionic gonadotrophin (hCG) was administered. Follicular aspiration was conducted 36–38 hours subsequent to hCG injection [ 29 ]. Subsequent to the oocyte retrieval procedure, cumulus cells enveloping the oocytes were isolated through mechanical pipetting and the application of hyaluronidase enzyme. Post-isolation, the oocytes underwent meticulous examination to assess both morphological characteristics and maturation stage. The Metaphase II oocytes were subsequently randomly divided into two groups, wherein one group received sperms treated with GM-CSF, and the other group received untreated sperms. The oocytes, following the injection procedure, were cultured in a one-step medium (ORIGIO). Fertilization status was assessed 16–18 hours post-insemination, and on day 3, both cleavage rate and embryo quality were evaluated. The embryo quality was evaluated based on the grading criteria previously described [ 28 ]. Sperm parameter assay Sperm parameters, including motility and viability, were evaluated after incubation time. The percentage of sperm with progressive and non-progressive motility was evaluated under a phase-contrast microscope (×40 magnification) (Olympus, Japan). The eosin-nigrosine staining technique was used to assess sperm viability; each slide was stained, then counted under the light microscope (×100 magnification) [ 30 ]. Real-time quantitative PCR Total RNA from about 50 mg of testicular biopsy was extracted using RiboX reagent (Gene ALL) according to the manufacturer's instructions. The concentration and quality of RNA were determined by using a spectrophotometer (Epoch Microplate, Biotech, USA); then, the extracted RNA was applied for the cDNA synthesis using the cDNA Reverse Transcription Kit (SMO-BIO) according to the instructions of the cDNA synthesis kit. Real-time PCR analysis was performed using the SYBR-Green master mix (AMPLIQON). Primers for the target genes PIK3R1 , PIK3CA , GLUT1, GLUT3, GLUT14, AKT1 , and the reference gene ( GAPDH ) were designed according to Gene Runner and BLAST. The specific primer pair sequences for individual genes are presented in Table 2 . The 2 −ΔΔCT process was used to calculate the relative expression levels of the target genes. All assays were performed in duplicate for two original amounts of total RNA. Table 2 Real-time PCR primers list details Gene names Forward sequence (5′→3′) Reverse sequence (3′→5′) Annealing temperature (°C) Size (bp) AKT1 ATGAGCGACGTGGCTATTGT TGAAGGTGCCATCATTCTTG 60 106 GLUT14 CTTGTGCTGTGGTCGCTTCT TTCTGTCTGTTGTCCATCTCTCTG 60 139 GLUT3 TAAGCAAATCCTCCAGCGGTT GAGCACAACGGAAATGATGATG 56 163 GLUT1 GGTATGTGGAGCAACTGTGTGG GGTGTCTTGTCTCTTTGGCTGG 60 169 PIK3CA GAGATGAAGTAGCCCAGATGTATTG TCCAAGCACCGAACAGCA 60 130 PIK3R1 CTGCTCTGTAGTGGTGGACG AGGGAGGTGTGTTGGTAATGTAG 60 135 GAPDH CATCAAGAAGGTGGTGAAGCAG GCGTCAAAGGTGGAGGAGTG 60 120 Statistical analysis Statistical analyses were performed utilizing the Statistical Package for the Social Sciences (SPSS 24.0, SPSS Inc., USA). The comparison between the two groups was executed through the t-test, assuming normal distribution of the variables, and significance was defined at a P value less than 0.05. The results are presented as mean ± standard deviation. Results Effect of GM-CSF treatment on sperm parameters The impact of granulocyte-macrophage colony-stimulating factor (GM-CSF) on sperm motility and viability was investigated following a one-hour incubation period at 37°C with 5% CO 2 . Comparative analysis revealed a statistically significant increase in progressive motility (12.81 ± 4.89 vs. 6/81 ± 2.63, respectively) and non-progressive motility (23.63 ± 9.26 vs. 14.27 ± 10.82, respectively) in the GM-CSF-supplemented group compared to the control group (p = 0.001 and p = 0.04, respectively). On the other hand, immotile sperm cells were significantly decreased in the GM-CSF-supplemented group compared to the control group (63.63 ± 11.89vs. 79.54 ± 11.99). Conversely, no significant difference in sperm viability was determined between the GM-CSF-treated and untreated groups (p > 0.05) (Figure. 1). Testicular GLUTs, PIK3R1, PIK3CA , and AKT1 genes mRNA expression In the present study, the GM-CSF treatment significantly increased the testicular mRNA expression of PIK3R1 and AKT1 compared to the control group. Also, among GLUTs, GM-CSF treatment significantly increased the testicular expression of GLUT3 compared to the control group. Unlikely, no significant differences in testicular mRNA expression of PIK3CA , GLUT1 , or GLUT14 were identified between the two groups (Fig. 2 ). Evaluation of ICSI outcomes in obstructive azoospermia patients The results of the clinical data are shown in Table 3 . Significant differences were observed between the control group and GM-CSF treatment in ICSI clinical results (fertilization rate and embryo quality). The fertilization rate in the GM-CSF treatment group (84.26%±11.14) showed a significant increase compared to the control group (75.52%±13.94) (p = 0.02). The percentage of high-quality embryos (Grade 1) in the treatment group (50.28% ± 28.07) showed a significant increase compared to the control group (32.88%±24.41) (p = 0.002). The percentage of poor-quality embryos (Grade 3) in the GM-CSF treatment group (12.19%±15.32) was decreased significantly compared to the control group (26.03%±27.14) (Fig. 3 , Table 3 ). The cleavage rate in the GM-CSF treatment group (80.50%±14.17) were significantly increased compared to the control group (66.47%±20.81) (P = 0.001). Table 3 The ICSI outcomes in the studied groups (Control and GM-CSF treatment). Parameters Control GM-CSF treatment P Value Fertilization rate (%) 75.52 ± 13.94 84.26 ± 11.14 0.027* Cleavage rate (%) 66.47 ± 20.81 80.50 ± 14.17 0.001* Grade 1 (%) 32.88 ± 24.41 50.28 ± 28.07 0.002* Grade 2 (%) 39.46 ± 21.42 34.95 ± 21.39 0.153 Grade 3 (%) 26.03 ± 27.14 12.19 ± 15.32 0.011* * significance at P < 0.05 Discussion The results of this study reveal a multifaceted impact of GM-CSF on both sperm functionality and testicular gene expression, with consequential effects on in vitro fertilization outcomes. Sperm extracted from testicular tissue has poor motility in azoospermia patients undergoing ART Procedure [ 8 ]. Various investigations have been undertaken to enhance the in vitro quality of testicular spermatozoa, encompassing interventions such as pentoxifylline (7), 2-deoxyadenosine (30), L-carnitine, and L-acetyl-carnitine. such as pentoxifylline [ 7 ], 2-deoxyadenosine[ 31 ], L-carnitine, and L-acetyl-carnitine [ 8 , 32 ]; these compounds could significantly improve sperm motility. However, Pentoxifylline and 2-deoxyadenosine can cause embryotoxic effects, as well as deplete the metabolic resources of sperm, which makes treated sperm permanently immotile [ 6 ]. To date, no studies have been conducted to assess the in vitro impact of GM-CSF on the quality of testicular spermatozoa. Our data elucidates that the supplementation of granulocyte-macrophage colony-stimulating factor (GM-CSF) in testicular sperm culture media results in a notable improvement in total motility. This observation aligns with the hypothesis that GM-CSF, as a cytokine secreted by the testis, plays an essential role in the process of sperm maturation [ 12 ]; In accordance with the investigation conducted by Vilanova et al., GM-CSF demonstrated a stimulatory effect on sperm motility in bovines [ 12 ]. Remarkably, the in vitro supplementation of GM-CSF demonstrated a beneficial impact on sperm parameters in individuals with OAT [ 28 ]. In the present investigation, the inclusion of GM-CSF in the testicular sperm medium resulted in an elevation of the total motility rate. Conversely, the proportion of viable testicular sperm exhibited comparability between the treatment and control groups, indicating that GM-CSF did not exert cytotoxic effects. Rodriguez et al. demonstrated that GM-CSF serves as a protective agent against cryoinjuries, preserving motility in ram spermatozoa during the freezing/thawing process [ 14 ]. Hence, according to these findings, granulocyte-macrophage colony-stimulating factor (GM-CSF) has the potential to enhance sperm motility during a one-hour incubation period and exhibits no cytotoxic properties or adverse effects on testicular spermatozoa. As per other research, GM-CSF is documented to instigate the activation of cellular metabolic signaling pathways. This activation, in turn, facilitates the uptake of glucose through the direct activation of GM-CSF receptors and interaction with glucose transporters [ 21 ]. Our previous investigation showed that GM-CSF supplement in culture medium improved sperm parameters via PI3K/AKT signaling pathway in OAT men and elevated GLUT1 and GLUT3 in spermatozoa [ 28 ]. This cytokine also increases the glucose and vitamin C uptake in the othe cell types including neutrophils, monocytes, and HEK 293 cells [ 21 ]. In the sperm cells [ 12 ], mouse embryos [ 33 ], and granulosa cells [ 34 ], GM-CSF facilitates hexose transporters, thereby promoting the uptake of glucose. Human testes tissue and spermatozoa cell express different hexose transporters; therefore spermatozoa demonstrate the capacity to transport fructose, glucose, and vitamin C facilitated by the activity of these specific hexose transporters [ 35 ]. However, GLUT3 exhibited the highest affinity among the glucose transporters. According to immunocytochemistry studies, GLUT3 is expressed in the human testes' sperm and seminiferous tubule [ 36 ]. In the present investigation, GM-CSF upregulated the expression of GLUT3 mRNA in the testicular tissue, potentially influencing glucose uptake. The proximity of GLUT3 to the mitochondria was observed, leading to an elevation in mitochondrial membrane potential (MMP) and metabolic activity [ 28 ]. Recent investigations, such as that conducted by Wessendarp et al., have substantiated novel roles of granulocyte-macrophage colony-stimulating factor (GM-CSF) in regulating metabolism and mitochondrial functions. These roles encompass a substantial increase in glycolysis, activation of the pentose phosphate pathway, enhanced amino acid synthesis, modulation of the tricarboxylic acid cycle, stimulation of oxidative phosphorylation, and augmented ATP production [ 37 ]. In the present investigation, the GM-CSF treatment group exhibited a substantial increase in the expression levels of key genes associated with the PI3K/AKT pathway, specifically PIK3R1 and AKT1, implying the activation of this signaling pathway within testicular cells. Furthermore, our prior findings have already demonstrated the activation of the PI3K/AKT pathway in spermatozoa of individuals with OAT following GM-CSF treatment, thereby aligning with the outcomes observed in this study. In addition to protein kinase B ( or AKT), other types of protein kinases including protein kinase G (PKG) and PKA and mitogen-activated protein kinases (MAPKs) have also been found in sperm cells which regulate the cell biology of sperm motility [ 22 , 38 , 39 ]. During the incubation period of spermatozoa cells in a culture medium enriched with energy substrates, there is a progressive reduction in motility. However, it appears that the phosphorylation status of PI3K/Akt serves to rescue sperm cells from this phenomenon, as illustrated in Fig. 4 . In other words, the disruption or inhibition of either PI3K or Akt leads to cellular descent into an apoptotic cascade marked by a substantial suppression of motility, the initiation of oxidative DNA damage, and ultimately, the activation of caspases [ 40 , 41 ]. Some growth factors/cytokines, identified as prosurvival factors by previous investigators, have been proposed to safeguard sperm cells from degenerative processes. Notably, prolactin, progesterone, and extrapancreatic insulin have been recognized for their involvement in the PI3K/Akt signaling pathway [ 22 , 40 , 42 ]. An in vitro study by Zhang et al. demonestrated that leucine supplementation also was able to activate PI3K/AKT pathway to enhance the motility of spermatozoa [ 39 ]. To date, investigations exploring the in vitro impact of GM-CSF on the quality of testicular sperm and subsequent ICSI outcomes are lacking. Nevertheless, in OAT patients, the addition of GM-CSF to sperm media demonstrated an enhancement in fertilization rates and improvements in embryo quality [ 28 ]. The present study confirms the previous findings and establishes that GM-CSF exerts a positive influence on ICSI outcomes in azoospermia patients. Aliabadi et al. similarly identified the beneficial impact of additional substances, such as L-carnitine and L-acetyl-carnitine, in enhancing testicular sperm motility [ 8 ]. Pentoxifylline can improve sperm motility; however, studies showed this compound has embryotoxic effects; based on research, Pentoxifylline significantly reduced fertilization rates and embryo development compared to controls [ 43 , 44 ]. In contrast to Pentoxifylline and 2-deoxyadenosine, the current study demonstrates that granulocyte-macrophage colony-stimulating factor (GM-CSF) augments intracytoplasmic sperm injection (ICSI) outcomes, including improvements in embryo quality, cleavage rate, and fertilization rate. As an alternative to Pentoxifylline, GM-CSF exhibits the potential to enhance testicular sperm motility preceding ICSI. Conclusion GM-CSF upregulated gene expression associated with motility and the energy metabolism pathway, including the PI3K/AKT pathway. Additionally, GM-CSF enhanced glucose uptake through GLUTs, culminating in a positive impact on the motility of spermatozoa extracted from the testis and subsequently influencing clinical outcomes. The supplementation of GM-CSF in sperm culture media holds the potential to improve sperm parameters in individuals diagnosed with obstructive azoospermia.. Abbreviations GM-CSF: Granulocyte-macrophage colony-stimulating factor ICSI: Intracytoplasmic sperm injection ART: assisted reproductive technology TESE: testicular sperm extraction PTF: Pentoxifylline GLUTs: glucose transporters GLUT1: glucose transporter 1 PI3K/AKT: phosphoinositide-3-kinase/protein kinase B OAT: Oligoasthenoteratospermia GnRH: Gonadotropin-releasing hormone hCG: human chorionic gonadotrophin Declarations Ethics approval and consent to participate The experimental protocol was approved by the ethical committee of Zanjan University of Medical Sciences, Zanjan, Iran, (IR.ZUMS.REC.1398.357). All participants signed informed consent to participate. Consent for publication Not applicable Availability of data and materials All data generated or analysed during this study are included in this published article Competing interests The authors declare that they have no conflict of interest. Funding This study was financially supported by a grant from the Zanjan University of Medical Sceiences (Grant number: A-11-1314-1). Authors' contributions FTKS: Original draft preparation. EH., FSA., ZZ., and MM: Conceptualization, and Methodology. EH., and FSA: Supervision. MA., and FM: patient recruitment. FTKS., and RK: Performing laboratory works, collecting the data and analysis. All authors read and approved the final manuscript. Acknowledgements Not applicable References Moein, M.R., et al., Evaluation of sperm retrieval rate with bilateral testicular sperm extraction in infertile patients with azoospermia. Iranian Journal of Reproductive Medicine, 2015. 13 (11): p. 711. Schill, T., et al., Clinical and endocrine follow-up of patients after testicular sperm extraction. Fertility and sterility, 2003. 79 (2): p. 281-286. Nagy, Z., et al., Andrology: The result of intracytoplasmic sperm injection is not related to any of the three basic sperm parameters. Human reproduction, 1995. 10 (5): p. 1123-1129. Ortega, C., et al., Absolute asthenozoospermia and ICSI: what are the options? Human reproduction update, 2011. 17 (5): p. 684-692. Stalf, T., et al., Influence of motility and vitality in intracytoplasmic sperm injection with ejaculated and testicular sperm. Andrologia, 2005. 37 (4): p. 125-130. Angelopoulos, T., et al., Enhancement or initiation of testicular sperm motility by in vitro culture of testicular tissue. Fertility and Sterility, 1999. 71 (2): p. 240-243. Kovačič, B., V. Vlaisavljević, and M. Reljič, Clinical use of pentoxifylline for activation of immotile testicular sperm before ICSI in patients with azoospermia. Journal of andrology, 2006. 27 (1): p. 45-52. Aliabadi, E., et al., Effects of L-carnitine and L-acetyl-carnitine on testicular sperm motility and chromatin quality. Iranian journal of reproductive medicine, 2012. 10 (2): p. 77. McLay, R.N., W.A. Banks, and A.J. Kastin, Granulocyte macrophage-colony stimulating factor crosses the blood-testis barrier in mice. Biol Reprod, 1997. 57 (4): p. 822-6. Ziebe, S., et al., A randomized clinical trial to evaluate the effect of granulocyte-macrophage colony-stimulating factor (GM-CSF) in embryo culture medium for in vitro fertilization. Fertility and sterility, 2013. 99 (6): p. 1600-1609. e2. Zhao, J.M., et al., [Clinical pathology and pathogenesis of severe acute respiratory syndrome]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 2003. 17 (3): p. 217-21. Vilanova, L.T., et al., Expression of granulocyte–macrophage colony stimulating factor (GM-CSF) in male germ cells: GM-CSF enhances sperm motility. Theriogenology, 2003. 60 (6): p. 1083-1095. Padilla, L., et al., Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs. Scientific reports, 2020. 10 (1): p. 1-12. Rodríguez-Gil, J., et al., Expression of the GM-CSF receptor in ovine spermatozoa: GM-CSF effect on sperm viability and motility of sperm subpopulations after the freezing–thawing process. Theriogenology, 2007. 67 (8): p. 1359-1370. Niemi, M., R. Sharpe, and W. Brown, Macrophages in the interstitial tissue of the rat testis. Cell and tissue research, 1986. 243 (2): p. 337-344. Kern, S., et al., Cytokine secretion by macrophages in the rat testis. Biology of reproduction, 1995. 53 (6): p. 1407-1416. Rubenstein, M., et al., GM-CSF restoration of a differentiated (growth factor-regulated) phenotype in an anaplastic tumor. Urological Research, 1991. 19 (5): p. 309-312. Ota, K., et al., Expression of a2 vacuolar ATPase in spermatozoa is associated with semen quality and chemokine-cytokine profiles in infertile men. PloS one, 2013. 8 (7): p. e70470. Hosseini, E., et al., Granulocyte-Macrophage Colony-Stimulating Factor Cytokine Addition After the Freeze–Thawing Process Improves Human Sperm Motility and Vitality in Asthenoteratozoospermia Patients. Biopreservation and Biobanking, 2023. Datta, S., Brunet A, and Greenberg ME. Cellular survival: a play in three Akts. Genes Dev, 1999. 13 : p. 2905-2927. Zambrano, A., et al., Cytokine stimulation promotes increased glucose uptake via translocation at the plasma membrane of GLUT1 in HEK293 cells. Journal of cellular biochemistry, 2010. 110 (6): p. 1471-1480. Sagare-Patil, V., et al., Progesterone utilizes the PI3K-AKT pathway in human spermatozoa to regulate motility and hyperactivation but not acrosome reaction. Molecular and cellular endocrinology, 2013. 374 (1-2): p. 82-91. Dias, T.R., et al., Sperm glucose transport and metabolism in diabetic individuals. Molecular and Cellular Endocrinology, 2014. 396 (1-2): p. 37-45. Navale, A.M. and A.N. Paranjape, Glucose transporters: physiological and pathological roles. Biophysical reviews, 2016. 8 (1): p. 5-9. Alves, M.G., et al., Diabetes, insulin-mediated glucose metabolism and Sertoli/blood-testis barrier function. Tissue barriers, 2013. 1 (2): p. e23992. Ahmed, A.A., et al., Gum Arabic improves the reproductive capacity through upregulation of testicular glucose transporters (GLUTs) mRNA expression in Alloxan induced diabetic rat. Bioactive Carbohydrates and Dietary Fibre, 2020. 22 : p. 100218. Kishimoto, A., et al., Immunohistochemical localization of GLUT3, MCT1, and MCT2 in the testes of mice and rats: the use of different energy sources in spermatogenesis. Biomedical Research, 2015. 36 (4): p. 225-234. Tanhaye Kalate Sabz, F., et al., GM–CSF (granulocyte‐macrophage colony‐stimulating factor) treatment improves sperm parameters in men with oligoasthenoteratospermia via PI3K/AKT pathway. Andrologia, 2022: p. e14427. Nikmard, F., et al., A comparative study on the results of agonist and antagonist protocols based on serum AMH levels in patients undergoing intracytoplasmic sperm injection. International Journal of Reproductive BioMedicine, 2016. 14 (12): p. 769. Edition, F., Examination and processing of human semen. World Health [Internet], 2010. Lacham-Kaplan, O. and A. Trounson, The effects of the sperm motility activators 2-deoxyadenosine and pentoxifylline used for sperm micro-injection on mouse and human embryo development. Human Reproduction, 1993. 8 (6): p. 945-952. Shi, J.-Z., et al., Expressions of sperm-specific genes in carnitine-cultured testis sperm of obstructive azoospermia patients. Zhonghua nan ke xue= National journal of andrology, 2010. 16 (6): p. 504-509. Robertson, S.A., et al., Granulocyte-macrophage colony-stimulating factor promotes glucose transport and blastomere viability in murine preimplantation embryos. Biology of Reproduction, 2001. 64 (4): p. 1206-1215. Peralta, O., et al., Tissue localization of GM-CSF receptor in bovine ovarian follicles and its role on glucose uptake by mural granulosa cells. Animal reproduction science, 2016. 170 : p. 157-169. Angulo, C., et al., Hexose transporter expression and function in mammalian spermatozoa: cellular localization and transport of hexoses and vitamin C. Journal of cellular biochemistry, 1998. 71 (2): p. 189-203. Burant, C. and N. Davidson, GLUT3 glucose transporter isoform in rat testis: localization, effect of diabetes mellitus, and comparison to human testis. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 1994. 267 (6): p. R1488-R1495. Wessendarp, M., et al., Role of GM-CSF in regulating metabolism and mitochondrial functions critical to macrophage proliferation. Mitochondrion, 2022. 62 : p. 85-101. Wang, Y.-Y., et al., Protein kinases regulate hyperactivated motility of human sperm. Chinese Medical Journal, 2021. 134 (20): p. 2412-2414. Zhang, J., et al., Leucine mediates autophagosome-lysosome fusion and improves sperm motility by activating the PI3K/Akt pathway. Oncotarget, 2017. 8 (67): p. 111807. Pujianto, D.A., B.J. Curry, and R.J. Aitken, Prolactin exerts a prosurvival effect on human spermatozoa via mechanisms that involve the stimulation of Akt phosphorylation and suppression of caspase activation and capacitation. Endocrinology, 2010. 151 (3): p. 1269-1279. Koppers, A.J., et al., Phosphoinositide 3-kinase signalling pathway involvement in a truncated apoptotic cascade associated with motility loss and oxidative DNA damage in human spermatozoa. Biochemical Journal, 2011. 436 (3): p. 687-698. Aitken, R.J., et al., Evidence that extrapancreatic insulin production is involved in the mediation of sperm survival. Molecular and cellular endocrinology, 2021. 526 : p. 111193. Imoedemhe, D.A., et al., The effect of caffeine on the ability of spermatozoa to fertilize mature human oocytes. Journal of assisted reproduction and genetics, 1992. 9 (2): p. 155-160. Takeda, N., et al., Clinical outcome of sorting and recovery of ultrasmall amounts of live sperm stimulated with pentoxifylline followed by intracytoplasmic sperm injection. Journal of Mammalian Ova Research, 2009. 26 (2): p. 79-85. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 05 Mar, 2024 Reviews received at journal 05 Mar, 2024 Reviewers agreed at journal 13 Feb, 2024 Reviewers invited by journal 29 Jan, 2024 Editor assigned by journal 29 Jan, 2024 Submission checks completed at journal 28 Jan, 2024 First submitted to journal 28 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3906456\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":269913267,\"identity\":\"38c82e54-deb8-4676-a7ed-27c7420ad171\",\"order_by\":0,\"name\":\"fatemeh Tanhaye Kalate Sabz\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Iran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"fatemeh\",\"middleName\":\"Tanhaye Kalate\",\"lastName\":\"Sabz\",\"suffix\":\"\"},{\"id\":269913268,\"identity\":\"39b7831d-e873-49e2-9131-63531ab180ff\",\"order_by\":1,\"name\":\"Elham Hosseini\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYDACdh4GBsYGEAtIJrDZgBiNB/BqYUbVkgZmEKsFBNgOgym8WviZeQ9+urnDxl6+vbntwYOy83Zr2w8DbamxicalRbKZL1k690xa4oYzB9sNEs7dTt52JhGo5VhabgMOLQaHeQykc9sOJxhIJLYB0e1kswNALYwNh3FqsT/MY/wbqMVefv5DkJZzyWbnH+LXYsDMYwayhbHhBiNIywE7sxsEbJE4zGNmndsG8gvQYQnnkhPMbgBtScDjF/72HuPbuW2gEDv+TPJHmZ292fn0hw8+1Njg1IIBEsEqE4hVDgL2pCgeBaNgFIyCkQEAjfxj4CTd9acAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Zanjan University of Medical Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Elham\",\"middleName\":\"\",\"lastName\":\"Hosseini\",\"suffix\":\"\"},{\"id\":269913269,\"identity\":\"c1439cc5-dfc8-4428-806e-e3f0113e71d1\",\"order_by\":2,\"name\":\"Fatemeh Sadat Amjadi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Iran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fatemeh\",\"middleName\":\"Sadat\",\"lastName\":\"Amjadi\",\"suffix\":\"\"},{\"id\":269913270,\"identity\":\"0562265b-45d4-4d20-911d-574600b370b4\",\"order_by\":3,\"name\":\"Masoud Mohammadian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zanjan University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Masoud\",\"middleName\":\"\",\"lastName\":\"Mohammadian\",\"suffix\":\"\"},{\"id\":269913271,\"identity\":\"bb88bd80-4092-47d2-951e-be4ca675f58c\",\"order_by\":4,\"name\":\"Zahra Zandieh\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Iran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zahra\",\"middleName\":\"\",\"lastName\":\"Zandieh\",\"suffix\":\"\"},{\"id\":269913272,\"identity\":\"2a8f40c9-5497-4704-8fcf-9205ee59d01e\",\"order_by\":5,\"name\":\"Farnaz Mohammadian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zanjan University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Farnaz\",\"middleName\":\"\",\"lastName\":\"Mohammadian\",\"suffix\":\"\"},{\"id\":269913273,\"identity\":\"d8ceb444-0526-4103-bc91-8555b3a76057\",\"order_by\":6,\"name\":\"Raheleh Kafaeinezhad\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Maragheh\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Raheleh\",\"middleName\":\"\",\"lastName\":\"Kafaeinezhad\",\"suffix\":\"\"},{\"id\":269913274,\"identity\":\"94d1c0d1-1f25-4740-b0f6-d548119ec983\",\"order_by\":7,\"name\":\"Mahnaz Ashrafi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"ACECR\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mahnaz\",\"middleName\":\"\",\"lastName\":\"Ashrafi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-01-28 17:34:14\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3906456/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3906456/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":50458138,\"identity\":\"f50c776c-2690-41b9-b1d5-6b7312931cee\",\"added_by\":\"auto\",\"created_at\":\"2024-01-31 20:07:00\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":98752,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA comparison of sperm parameters (a: motility and b: viability) in control and GM- CSF treatment groups in patients with obstructive azoospermia. Data are expressed as means ± standard deviation. ** P \\u0026lt;0.005 * P \\u0026lt;0.05\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3906456/v1/23c4811e1db16a08bcdf3a76.png\"},{\"id\":50458137,\"identity\":\"2543b222-f7e4-4275-a6f3-f353b1f326e4\",\"added_by\":\"auto\",\"created_at\":\"2024-01-31 20:07:00\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":97027,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAssessment of gene expression of GLUT1, GLUT3, GLUT14, PIK3R1, PIK3CA, and AKT1 in control and GM-CSF treatment groups. Results were presented as mean ± standard deviation. * P\\u0026lt;0.05, *** P\\u0026lt; 0.0005\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3906456/v1/b4431b11d4f2cc8f1cafd07d.png\"},{\"id\":50458140,\"identity\":\"b6b36176-2be7-409d-8052-b422c7bef0a4\",\"added_by\":\"auto\",\"created_at\":\"2024-01-31 20:07:01\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":183465,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFinal oocyte grade in two groups (Control and GM-CSF treatment)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3906456/v1/106d0bdf3fed60e258074fc3.png\"},{\"id\":50458139,\"identity\":\"c375add3-827a-4f27-85b4-6f5e19c58a0e\",\"added_by\":\"auto\",\"created_at\":\"2024-01-31 20:07:01\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":495519,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSchematic representation\\u003cstrong\\u003e \\u003c/strong\\u003eof regulatory mechanisms involved in sperm motility. Created with \\u003cem\\u003eBiorender.com\\u003c/em\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3906456/v1/de0446f5df5c8a01da667e64.png\"},{\"id\":50458552,\"identity\":\"47e66a04-3660-4e32-b00b-21491f05129c\",\"added_by\":\"auto\",\"created_at\":\"2024-01-31 20:15:01\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1225160,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3906456/v1/ca6732d0-3ca1-4da6-be6d-ad775f1cc24c.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"In vitro effect of Granulocyte-macrophage colony-stimulating factor (GM-CSF) on the expression of related genes to sperm motility and energy metabolism, and ICSI outcomes in obstructive azoospermic patients\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAzoospermia accounts for approximately 10 to 15 percent of male infertility, manifesting in two predominant forms: obstructive and non-obstructive. Obstructive azoospermia is due to obstruction in the male genital tract. Conversely, non-obstructive azoospermia, being the more prevalent form, arises from a failure of spermatogenesis within the testis [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Intracytoplasmic sperm injection (ICSI) following testicular sperm extraction (TESE) has become an effective treatment for men with azoospermia in assisted reproduction programs [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The absence of motile spermatozoa is a common observation in specimens obtained through epididymal sperm aspiration and testicular biopsy, adversely affecting ICSI outcome and fertilization rates [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Based on studies, testicular spermatozoa should be incubated in a sperm medium before ICSI [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. The incubation of testicular spermatozoa for a duration of 1 to 2 hours before ICSI has been observed to induce motility. However, it is noteworthy that, in certain instances, spermatozoa may remain immotile even following the incubation period [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. The application of certain compounds appears to enhance sperm parameters in vitro among individuals diagnosed with azoospermia. Subsequently, the ICSI success rate and fertilization rates could be increased [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Researchers have reported that Pentoxifylline (PTF) functions as a chemical motility enhancer, eliciting an increase in cyclic adenosine monophosphate (cAMP), glycolysis, and energy production within testicular sperm [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. However, apprehensions exist regarding the safety profile of this chemical compound. PTF has toxic effects when incubated with sperm for a prolonged period [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]; It is imperative to substitute the natural compounds within the male reproductive system to ameliorate sperm quality in vitro.\\u003c/p\\u003e \\u003cp\\u003eGranulocyte-macrophage colony-stimulating factor (GM-CSF) is a crucial member of the cytokine family, primarily recognized for its role in the immune system where it governs the maturation and proliferation of granulocytes and macrophages [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. GM-CSF promotes embryonic growth and development and regulates the implantation process and maternal immune response [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Studies have shown that GM-CSF supplementation to embryo culture media can increase the implantation rate and the number of live births [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. The location and distribution of GM-CSF and its receptor alongside the male reproductive tract (epididymis and testis), seminal plasma and spermatozoa cells were previously proved [\\u003cspan additionalcitationids=\\\"CR13\\\" citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Its receptor was expressed on the mid-piece and tail of mature spermatozoa [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. According to studies, about 25% of the interstitial cells in the testis are macrophages [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Interestingly, macrophages in the testis produce more GM-CSF than macrophages in other body parts [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. On the other hand, it was demonstrated that exogenous GM-CSF increases testosterone concentration in prostatic adenocarcinoma [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIt has been shown that infertile men have lower levels of GM-CSF in seminal plasma than fertile one [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. GM-CSF is known to act in seminiferous tubules and spermatozoa, but its role on sperm function is not well understood. However, GM-CSF seems to have a significant role in sperm physiology [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e],for example, it has been shown that GM-CSF can be beneficial as a post-freeze additive and may improve sperm quality after post-thawing incubation.[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eGM-CSF activates different signaling pathways in different cell types; one of them is the phosphoinositide-3-kinase/protein kinase B (PI3K/AKT) signaling pathway, which is involved in intracellular metabolic and anti-apoptotic processes; AKT indirectly promotes cell survival by regulating glucose-related metabolic processes [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIt has been shown that GM-CSF stimulates glucose uptake by translocating glucose transporter 1 (GLUT1) via the PI3K/AKT pathway [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. The PI3K/AKT pathway is a main pathway in regulating the motility and hyperactivation of spermatozoa [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. GLUTs family are found in various tissues, including testes and spermatozoa, and help transport mono hexoses [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e] in sperm; also, the energy is produced through metabolic pathways between sertoli cells and germ cells [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Through GLUTs, such as GLUT1, GLUT3, GLUT8, and GLUT9, glucose is transported from interstitial space into sertoli cells [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. These transporters are located in the plasma membrane [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Studies showed that GM-CSF increased bovine and human sperm motility [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. GM-CSF supplement improves sperm parameters and increases glucose transporter expression via the PI3K/AKT pathway in Oligoasthenoteratospermia (OAT) men [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Its effect on testicular biopsy in patients with obstructive azoospermia has not been evaluated yet. The present study assessed the in-vitro effect of GM-CSF on the gene expression of \\u003cem\\u003eGLUT\\u003c/em\\u003es, \\u003cem\\u003ePIK3CA\\u003c/em\\u003e, \\u003cem\\u003ePIK3R1\\u003c/em\\u003e, \\u003cem\\u003eAKT1\\u003c/em\\u003e, and the motility and viability of sperm from testicular biopsies. In addition, the clinical outcomes of these sperm injections were assessed.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003eA total of twenty testicular samples were obtained from men with obstructive azoospermia treated for infertility. All patients who participated in the study underwent testicular biopsy as part of their treatment and provided written informed consent. The experimental protocol was approved by the ethical committee of Zanjan University of Medical Sciences, Zanjan, Iran, (IR.ZUMS.REC.1398.357).\\u003c/p\\u003e \\u003cp\\u003eAll patients were evaluated by semen analysis, hormone levels (serum FSH, LH and testosterone), and physical examination. In the present study, all male patients with infertility were diagnosed with azoospermia. Lack of spermatozoa in semen samples and the pellet after centrifugation (20 minutes at 3000 g), used as the diagnosis for azoospermia. Reconstructive surgical interventions were considered as a therapeutic modality to repair obstructive anomalies within the male reproductive tract. In instances where reconstructive procedures proved unfeasible, male patients proceeded to undergo diagnostic TESE as an alternative approach to perform intracytoplasmic sperm injection-embryo transfer. Male partner with non-obstructive azoospermia, including Y-chromosome deletions, spinal cord injuries, hypogonadotropic hypogonadism and Klinefelter syndrome were excluded from this study. Following TESE, individuals displaying a lack of spermatozoa in the biopsy specimens were subsequently excluded from the study cohort. Demographic information of the studied couples are shown in the Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eDemographic information of the studied couples\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eMale partners\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge (year)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e37.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBMI\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e24.45\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFSH (mIU/ml)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLH (mIU/ml)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4.3\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTestosterone (ng/ml)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5.16\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.06\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTestis volume in physical examinatio (ml)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e18.36\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.80\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTestis length in physical examinatio (cm)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4.49\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.88\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eFemale partners\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAge (year)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e31.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBMI (Kg/m\\u003csup\\u003e2\\u003c/sup\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e24.51\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eInfertility (year)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e4.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eAMH (ng/\\u0026micro;l)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e3.4\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTESE procedure, sperm extraction, and incubation\\u003c/h2\\u003e \\u003cp\\u003eThe TESE procedure was carried out by skilled urologists. In brief, a transverse incision measuring 2 cm was meticulously made on the anterior scrotal skin and tunica albuginea, followed by the injection of lidocaine into the underlying tunica. Subsequently, small testicular parenchymal specimens were excised from the testis, placed in a Petri dish containing sperm wash medium, and meticulously separated using sterile needles. The dissected tissue fragments were subjected to microscopic scrutiny using an inverted microscope to ascertain the presence of spermatozoa.\\u003c/p\\u003e \\u003cp\\u003eFollowing sperm observation, the homogenate underwent a wash procedure and centrifugation at 2000 rpm for 5 minutes. The resulting precipitated sample was then partitioned into control and treatment groups in cases where sperm retrieved through TESE exhibit poor motility. In the treatment group, the sample underwent incubation in an IVF medium (Cook, USA) enriched with 2 ng/ml granulocyte-macrophage colony-stimulating factor (GM-CSF) [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e], Conversely, the control group's sample was incubated in the same medium without the inclusion of GM-CSF. Both groups were subjected to incubation for one hour at 37\\u0026deg;C and 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e (27).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eOvarian stimulation and ICSI\\u003c/h2\\u003e \\u003cp\\u003eOvarian stimulation was performed with long agonist protocol; stimulation began with the administration of Gonadotropin-releasing hormone (GnRH) agonist (triptorelin) at a dose of 0.1 mg on day 21 of the menstrual cycle. Subsequently, gonadotropin (Cinal-F or Gonal-F) was administered daily at a dose ranging from 150 to 225 IU, adjusted based on individualized female parameters, including anti-M\\u0026uuml;llerian hormone (AMH) levels, age, and antral follicle count (AFC). Continuous administration of both GnRH agonist and gonadotropin persisted until the visualization of at least two follicles measuring 16 to 18 mm in diameter on ultrasound. Upon achieving this criterion, the administration of gonadotrophin and GnRH agonists was halted and human chorionic gonadotrophin (hCG) was administered. Follicular aspiration was conducted 36\\u0026ndash;38 hours subsequent to hCG injection [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eSubsequent to the oocyte retrieval procedure, cumulus cells enveloping the oocytes were isolated through mechanical pipetting and the application of hyaluronidase enzyme. Post-isolation, the oocytes underwent meticulous examination to assess both morphological characteristics and maturation stage. The Metaphase II oocytes were subsequently randomly divided into two groups, wherein one group received sperms treated with GM-CSF, and the other group received untreated sperms. The oocytes, following the injection procedure, were cultured in a one-step medium (ORIGIO). Fertilization status was assessed 16\\u0026ndash;18 hours post-insemination, and on day 3, both cleavage rate and embryo quality were evaluated. The embryo quality was evaluated based on the grading criteria previously described [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSperm parameter assay\\u003c/h2\\u003e \\u003cp\\u003eSperm parameters, including motility and viability, were evaluated after incubation time. The percentage of sperm with progressive and non-progressive motility was evaluated under a phase-contrast microscope (\\u0026times;40 magnification) (Olympus, Japan). The eosin-nigrosine staining technique was used to assess sperm viability; each slide was stained, then counted under the light microscope (\\u0026times;100 magnification) [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eReal-time quantitative PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA from about 50 mg of testicular biopsy was extracted using RiboX reagent (Gene ALL) according to the manufacturer's instructions. The concentration and quality of RNA were determined by using a spectrophotometer (Epoch Microplate, Biotech, USA); then, the extracted RNA was applied for the cDNA synthesis using the cDNA Reverse Transcription Kit (SMO-BIO) according to the instructions of the cDNA synthesis kit. Real-time PCR analysis was performed using the SYBR-Green master mix (AMPLIQON). Primers for the target genes \\u003cem\\u003ePIK3R1\\u003c/em\\u003e, \\u003cem\\u003ePIK3CA\\u003c/em\\u003e, \\u003cem\\u003eGLUT1, GLUT3, GLUT14, AKT1\\u003c/em\\u003e, and the reference gene (\\u003cem\\u003eGAPDH\\u003c/em\\u003e) were designed according to Gene Runner and BLAST. The specific primer pair sequences for individual genes are presented in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. The 2\\u003csup\\u003e\\u0026minus;ΔΔCT\\u003c/sup\\u003e process was used to calculate the relative expression levels of the target genes. All assays were performed in duplicate for two original amounts of total RNA.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eReal-time PCR primers list details\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene names\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward sequence (5\\u0026prime;\\u0026rarr;3\\u0026prime;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse sequence (3\\u0026prime;\\u0026rarr;5\\u0026prime;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eAnnealing temperature (\\u0026deg;C)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eSize (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eAKT1\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGAGCGACGTGGCTATTGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGAAGGTGCCATCATTCTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e106\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eGLUT14\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTTGTGCTGTGGTCGCTTCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTCTGTCTGTTGTCCATCTCTCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e139\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eGLUT3\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTAAGCAAATCCTCCAGCGGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAGCACAACGGAAATGATGATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e163\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eGLUT1\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTATGTGGAGCAACTGTGTGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGTGTCTTGTCTCTTTGGCTGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e169\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ePIK3CA\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGAGATGAAGTAGCCCAGATGTATTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCCAAGCACCGAACAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e130\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003ePIK3R1\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTGCTCTGTAGTGGTGGACG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGGGAGGTGTGTTGGTAATGTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e135\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eGAPDH\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCATCAAGAAGGTGGTGAAGCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCGTCAAAGGTGGAGGAGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e120\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eStatistical analyses were performed utilizing the Statistical Package for the Social Sciences (SPSS 24.0, SPSS Inc., USA). The comparison between the two groups was executed through the t-test, assuming normal distribution of the variables, and significance was defined at a P value less than 0.05. The results are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEffect of GM-CSF treatment on sperm parameters\\u003c/h2\\u003e \\u003cp\\u003eThe impact of granulocyte-macrophage colony-stimulating factor (GM-CSF) on sperm motility and viability was investigated following a one-hour incubation period at 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. Comparative analysis revealed a statistically significant increase in progressive motility\\u003c/p\\u003e \\u003cp\\u003e(12.81\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.89 vs. 6/81\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.63, respectively) and non-progressive motility (23.63\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.26 vs. 14.27\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.82, respectively) in the GM-CSF-supplemented group compared to the control group (p\\u0026thinsp;=\\u0026thinsp;0.001 and p\\u0026thinsp;=\\u0026thinsp;0.04, respectively). On the other hand, immotile sperm cells were significantly decreased in the GM-CSF-supplemented group compared to the control group (63.63\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.89vs. 79.54\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.99). Conversely, no significant difference in sperm viability was determined between the GM-CSF-treated and untreated groups (p\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05) (Figure. 1).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTesticular\\u003c/b\\u003e \\u003cb\\u003eGLUTs, PIK3R1, PIK3CA\\u003c/b\\u003e, \\u003cb\\u003eand\\u003c/b\\u003e \\u003cb\\u003eAKT1\\u003c/b\\u003e \\u003cb\\u003egenes mRNA expression\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eIn the present study, the GM-CSF treatment significantly increased the testicular mRNA expression of \\u003cem\\u003ePIK3R1\\u003c/em\\u003e and \\u003cem\\u003eAKT1\\u003c/em\\u003e compared to the control group. Also, among \\u003cem\\u003eGLUTs, GM-CSF\\u003c/em\\u003e treatment significantly increased the testicular expression of \\u003cem\\u003eGLUT3\\u003c/em\\u003e compared to the control group. Unlikely, no significant differences in testicular mRNA expression of \\u003cem\\u003ePIK3CA\\u003c/em\\u003e, \\u003cem\\u003eGLUT1\\u003c/em\\u003e, or \\u003cem\\u003eGLUT14\\u003c/em\\u003e were identified between the two groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eEvaluation of ICSI outcomes in obstructive azoospermia patients\\u003c/h3\\u003e\\n\\u003cp\\u003eThe results of the clinical data are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. Significant differences were observed between the control group and GM-CSF treatment in ICSI clinical results (fertilization rate and embryo quality). The fertilization rate in the GM-CSF treatment group (84.26%\\u0026plusmn;11.14) showed a significant increase compared to the control group (75.52%\\u0026plusmn;13.94) (p\\u0026thinsp;=\\u0026thinsp;0.02). The percentage of high-quality embryos (Grade 1) in the treatment group (50.28% \\u0026plusmn; 28.07) showed a significant increase compared to the control group (32.88%\\u0026plusmn;24.41) (p\\u0026thinsp;=\\u0026thinsp;0.002). The percentage of poor-quality embryos (Grade 3) in the GM-CSF treatment group (12.19%\\u0026plusmn;15.32) was decreased significantly compared to the control group (26.03%\\u0026plusmn;27.14) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). The cleavage rate in the GM-CSF treatment group (80.50%\\u0026plusmn;14.17) were significantly increased compared to the control group (66.47%\\u0026plusmn;20.81) (P\\u0026thinsp;=\\u0026thinsp;0.001).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe ICSI outcomes in the studied groups (Control and GM-CSF treatment).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eParameters\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eControl\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGM-CSF treatment\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP\\u003c/em\\u003e Value\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFertilization rate (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e75.52\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;13.94\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e84.26\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;11.14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.027*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCleavage rate (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e66.47\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;20.81\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e80.50\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;14.17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.001*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGrade 1 (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e32.88\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;24.41\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e50.28\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;28.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.002*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGrade 2 (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e39.46\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;21.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e34.95\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;21.39\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.153\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGrade 3 (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e26.03\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;27.14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e12.19\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;15.32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.011*\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\" nameend=\\\"c4\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003e* significance at \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe results of this study reveal a multifaceted impact of GM-CSF on both sperm functionality and testicular gene expression, with consequential effects on in vitro fertilization outcomes. Sperm extracted from testicular tissue has poor motility in azoospermia patients undergoing ART Procedure [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Various investigations have been undertaken to enhance the in vitro quality of testicular spermatozoa, encompassing interventions such as pentoxifylline (7), 2-deoxyadenosine (30), L-carnitine, and L-acetyl-carnitine. such as pentoxifylline [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e], 2-deoxyadenosine[\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e], L-carnitine, and L-acetyl-carnitine [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]; these compounds could significantly improve sperm motility. However, Pentoxifylline and 2-deoxyadenosine can cause embryotoxic effects, as well as deplete the metabolic resources of sperm, which makes treated sperm permanently immotile [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eTo date, no studies have been conducted to assess the in vitro impact of GM-CSF on the quality of testicular spermatozoa. Our data elucidates that the supplementation of granulocyte-macrophage colony-stimulating factor (GM-CSF) in testicular sperm culture media results in a notable improvement in total motility. This observation aligns with the hypothesis that GM-CSF, as a cytokine secreted by the testis, plays an essential role in the process of sperm maturation [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]; In accordance with the investigation conducted by Vilanova et al., GM-CSF demonstrated a stimulatory effect on sperm motility in bovines [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Remarkably, the in vitro supplementation of GM-CSF demonstrated a beneficial impact on sperm parameters in individuals with OAT [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. In the present investigation, the inclusion of GM-CSF in the testicular sperm medium resulted in an elevation of the total motility rate. Conversely, the proportion of viable testicular sperm exhibited comparability between the treatment and control groups, indicating that GM-CSF did not exert cytotoxic effects. Rodriguez et al. demonstrated that GM-CSF serves as a protective agent against cryoinjuries, preserving motility in ram spermatozoa during the freezing/thawing process [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Hence, according to these findings, granulocyte-macrophage colony-stimulating factor (GM-CSF) has the potential to enhance sperm motility during a one-hour incubation period and exhibits no cytotoxic properties or adverse effects on testicular spermatozoa.\\u003c/p\\u003e \\u003cp\\u003eAs per other research, GM-CSF is documented to instigate the activation of cellular metabolic signaling pathways. This activation, in turn, facilitates the uptake of glucose through the direct activation of GM-CSF receptors and interaction with glucose transporters [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Our previous investigation showed that GM-CSF supplement in culture medium improved sperm parameters via PI3K/AKT signaling pathway in OAT men and elevated \\u003cem\\u003eGLUT1\\u003c/em\\u003e and \\u003cem\\u003eGLUT3\\u003c/em\\u003e in spermatozoa [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. This cytokine also increases the glucose and vitamin C uptake in the othe cell types including neutrophils, monocytes, and HEK 293 cells [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. In the sperm cells [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], mouse embryos [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e], and granulosa cells [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], GM-CSF facilitates hexose transporters, thereby promoting the uptake of glucose. Human testes tissue and spermatozoa cell express different hexose transporters; therefore spermatozoa demonstrate the capacity to transport fructose, glucose, and vitamin C facilitated by the activity of these specific hexose transporters [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. However, GLUT3 exhibited the highest affinity among the glucose transporters. According to immunocytochemistry studies, GLUT3 is expressed in the human testes' sperm and seminiferous tubule [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. In the present investigation, GM-CSF upregulated the expression of GLUT3 mRNA in the testicular tissue, potentially influencing glucose uptake. The proximity of GLUT3 to the mitochondria was observed, leading to an elevation in mitochondrial membrane potential (MMP) and metabolic activity [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Recent investigations, such as that conducted by Wessendarp et al., have substantiated novel roles of granulocyte-macrophage colony-stimulating factor (GM-CSF) in regulating metabolism and mitochondrial functions. These roles encompass a substantial increase in glycolysis, activation of the pentose phosphate pathway, enhanced amino acid synthesis, modulation of the tricarboxylic acid cycle, stimulation of oxidative phosphorylation, and augmented ATP production [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. In the present investigation, the GM-CSF treatment group exhibited a substantial increase in the expression levels of key genes associated with the PI3K/AKT pathway, specifically PIK3R1 and AKT1, implying the activation of this signaling pathway within testicular cells. Furthermore, our prior findings have already demonstrated the activation of the PI3K/AKT pathway in spermatozoa of individuals with OAT following GM-CSF treatment, thereby aligning with the outcomes observed in this study.\\u003c/p\\u003e \\u003cp\\u003eIn addition to protein kinase B ( or AKT), other types of protein kinases including protein kinase G (PKG) and PKA and mitogen-activated protein kinases (MAPKs) have also been found in sperm cells which regulate the cell biology of sperm motility [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. During the incubation period of spermatozoa cells in a culture medium enriched with energy substrates, there is a progressive reduction in motility. However, it appears that the phosphorylation status of PI3K/Akt serves to rescue sperm cells from this phenomenon, as illustrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e. In other words, the disruption or inhibition of either PI3K or Akt leads to cellular descent into an apoptotic cascade marked by a substantial suppression of motility, the initiation of oxidative DNA damage, and ultimately, the activation of caspases [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Some growth factors/cytokines, identified as prosurvival factors by previous investigators, have been proposed to safeguard sperm cells from degenerative processes. Notably, prolactin, progesterone, and extrapancreatic insulin have been recognized for their involvement in the PI3K/Akt signaling pathway [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. An in vitro study by Zhang et al. demonestrated that leucine supplementation also was able to activate PI3K/AKT pathway to enhance the motility of spermatozoa [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo date, investigations exploring the in vitro impact of GM-CSF on the quality of testicular sperm and subsequent ICSI outcomes are lacking. Nevertheless, in OAT patients, the addition of GM-CSF to sperm media demonstrated an enhancement in fertilization rates and improvements in embryo quality [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. The present study confirms the previous findings and establishes that GM-CSF exerts a positive influence on ICSI outcomes in azoospermia patients. Aliabadi et al. similarly identified the beneficial impact of additional substances, such as L-carnitine and L-acetyl-carnitine, in enhancing testicular sperm motility [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Pentoxifylline can improve sperm motility; however, studies showed this compound has embryotoxic effects; based on research, Pentoxifylline significantly reduced fertilization rates and embryo development compared to controls [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. In contrast to Pentoxifylline and 2-deoxyadenosine, the current study demonstrates that granulocyte-macrophage colony-stimulating factor (GM-CSF) augments intracytoplasmic sperm injection (ICSI) outcomes, including improvements in embryo quality, cleavage rate, and fertilization rate. As an alternative to Pentoxifylline, GM-CSF exhibits the potential to enhance testicular sperm motility preceding ICSI.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eGM-CSF upregulated gene expression associated with motility and the energy metabolism pathway, including the PI3K/AKT pathway. Additionally, GM-CSF enhanced glucose uptake through GLUTs, culminating in a positive impact on the motility of spermatozoa extracted from the testis and subsequently influencing clinical outcomes. The supplementation of GM-CSF in sperm culture media holds the potential to improve sperm parameters in individuals diagnosed with obstructive azoospermia..\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003eGM-CSF: Granulocyte-macrophage colony-stimulating factor\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eICSI: Intracytoplasmic sperm injection\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eART: assisted reproductive technology\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTESE: testicular sperm extraction\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePTF: Pentoxifylline\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eGLUTs: glucose transporters\\u003c/p\\u003e\\n\\u003cp\\u003eGLUT1: glucose transporter 1\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;PI3K/AKT:\\u0026nbsp;phosphoinositide-3-kinase/protein kinase B\\u003c/p\\u003e\\n\\u003cp\\u003eOAT: Oligoasthenoteratospermia\\u003c/p\\u003e\\n\\u003cp\\u003eGnRH: Gonadotropin-releasing hormone\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ehCG: human chorionic gonadotrophin\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe experimental protocol was approved by the ethical committee of Zanjan University of Medical Sciences, Zanjan, Iran, (IR.ZUMS.REC.1398.357).\\u0026nbsp;All participants signed informed consent to participate.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was financially supported by a grant from the Zanjan University of Medical Sceiences (Grant number: A-11-1314-1).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFTKS: Original draft preparation. EH., FSA., ZZ., and MM: Conceptualization, and Methodology. EH., and FSA: Supervision. MA., and FM: patient recruitment. FTKS., and RK: Performing laboratory works, collecting the data and analysis. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eMoein, M.R., et al., \\u003cem\\u003eEvaluation of sperm retrieval rate with bilateral testicular sperm extraction in infertile patients with azoospermia.\\u003c/em\\u003e Iranian Journal of Reproductive Medicine, 2015. \\u003cstrong\\u003e13\\u003c/strong\\u003e(11): p. 711.\\u003c/li\\u003e\\n\\u003cli\\u003eSchill, T., et al., \\u003cem\\u003eClinical and endocrine follow-up of patients after testicular sperm extraction.\\u003c/em\\u003e Fertility and sterility, 2003. \\u003cstrong\\u003e79\\u003c/strong\\u003e(2): p. 281-286.\\u003c/li\\u003e\\n\\u003cli\\u003eNagy, Z., et al., \\u003cem\\u003eAndrology: The result of intracytoplasmic sperm injection is not related to any of the three basic sperm parameters.\\u003c/em\\u003e Human reproduction, 1995. \\u003cstrong\\u003e10\\u003c/strong\\u003e(5): p. 1123-1129.\\u003c/li\\u003e\\n\\u003cli\\u003eOrtega, C., et al., \\u003cem\\u003eAbsolute asthenozoospermia and ICSI: what are the options?\\u003c/em\\u003e Human reproduction update, 2011. \\u003cstrong\\u003e17\\u003c/strong\\u003e(5): p. 684-692.\\u003c/li\\u003e\\n\\u003cli\\u003eStalf, T., et al., \\u003cem\\u003eInfluence of motility and vitality in intracytoplasmic sperm injection with ejaculated and testicular sperm.\\u003c/em\\u003e Andrologia, 2005. \\u003cstrong\\u003e37\\u003c/strong\\u003e(4): p. 125-130.\\u003c/li\\u003e\\n\\u003cli\\u003eAngelopoulos, T., et al., \\u003cem\\u003eEnhancement or initiation of testicular sperm motility by in vitro culture of testicular tissue.\\u003c/em\\u003e Fertility and Sterility, 1999. \\u003cstrong\\u003e71\\u003c/strong\\u003e(2): p. 240-243.\\u003c/li\\u003e\\n\\u003cli\\u003eKovačič, B., V. Vlaisavljević, and M. Reljič, \\u003cem\\u003eClinical use of pentoxifylline for activation of immotile testicular sperm before ICSI in patients with azoospermia.\\u003c/em\\u003e Journal of andrology, 2006. \\u003cstrong\\u003e27\\u003c/strong\\u003e(1): p. 45-52.\\u003c/li\\u003e\\n\\u003cli\\u003eAliabadi, E., et al., \\u003cem\\u003eEffects of L-carnitine and L-acetyl-carnitine on testicular sperm motility and chromatin quality.\\u003c/em\\u003e Iranian journal of reproductive medicine, 2012. \\u003cstrong\\u003e10\\u003c/strong\\u003e(2): p. 77.\\u003c/li\\u003e\\n\\u003cli\\u003eMcLay, R.N., W.A. Banks, and A.J. Kastin, \\u003cem\\u003eGranulocyte macrophage-colony stimulating factor crosses the blood-testis barrier in mice.\\u003c/em\\u003e Biol Reprod, 1997. \\u003cstrong\\u003e57\\u003c/strong\\u003e(4): p. 822-6.\\u003c/li\\u003e\\n\\u003cli\\u003eZiebe, S., et al., \\u003cem\\u003eA randomized clinical trial to evaluate the effect of granulocyte-macrophage colony-stimulating factor (GM-CSF) in embryo culture medium for in vitro fertilization.\\u003c/em\\u003e Fertility and sterility, 2013. \\u003cstrong\\u003e99\\u003c/strong\\u003e(6): p. 1600-1609. e2.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, J.M., et al., \\u003cem\\u003e[Clinical pathology and pathogenesis of severe acute respiratory syndrome].\\u003c/em\\u003e Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi, 2003. \\u003cstrong\\u003e17\\u003c/strong\\u003e(3): p. 217-21.\\u003c/li\\u003e\\n\\u003cli\\u003eVilanova, L.T., et al., \\u003cem\\u003eExpression of granulocyte\\u0026ndash;macrophage colony stimulating factor (GM-CSF) in male germ cells: GM-CSF enhances sperm motility.\\u003c/em\\u003e Theriogenology, 2003. \\u003cstrong\\u003e60\\u003c/strong\\u003e(6): p. 1083-1095.\\u003c/li\\u003e\\n\\u003cli\\u003ePadilla, L., et al., \\u003cem\\u003eGranulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs.\\u003c/em\\u003e Scientific reports, 2020. \\u003cstrong\\u003e10\\u003c/strong\\u003e(1): p. 1-12.\\u003c/li\\u003e\\n\\u003cli\\u003eRodr\\u0026iacute;guez-Gil, J., et al., \\u003cem\\u003eExpression of the GM-CSF receptor in ovine spermatozoa: GM-CSF effect on sperm viability and motility of sperm subpopulations after the freezing\\u0026ndash;thawing process.\\u003c/em\\u003e Theriogenology, 2007. \\u003cstrong\\u003e67\\u003c/strong\\u003e(8): p. 1359-1370.\\u003c/li\\u003e\\n\\u003cli\\u003eNiemi, M., R. Sharpe, and W. Brown, \\u003cem\\u003eMacrophages in the interstitial tissue of the rat testis.\\u003c/em\\u003e Cell and tissue research, 1986. \\u003cstrong\\u003e243\\u003c/strong\\u003e(2): p. 337-344.\\u003c/li\\u003e\\n\\u003cli\\u003eKern, S., et al., \\u003cem\\u003eCytokine secretion by macrophages in the rat testis.\\u003c/em\\u003e Biology of reproduction, 1995. \\u003cstrong\\u003e53\\u003c/strong\\u003e(6): p. 1407-1416.\\u003c/li\\u003e\\n\\u003cli\\u003eRubenstein, M., et al., \\u003cem\\u003eGM-CSF restoration of a differentiated (growth factor-regulated) phenotype in an anaplastic tumor.\\u003c/em\\u003e Urological Research, 1991. \\u003cstrong\\u003e19\\u003c/strong\\u003e(5): p. 309-312.\\u003c/li\\u003e\\n\\u003cli\\u003eOta, K., et al., \\u003cem\\u003eExpression of a2 vacuolar ATPase in spermatozoa is associated with semen quality and chemokine-cytokine profiles in infertile men.\\u003c/em\\u003e PloS one, 2013. \\u003cstrong\\u003e8\\u003c/strong\\u003e(7): p. e70470.\\u003c/li\\u003e\\n\\u003cli\\u003eHosseini, E., et al., \\u003cem\\u003eGranulocyte-Macrophage Colony-Stimulating Factor Cytokine Addition After the Freeze\\u0026ndash;Thawing Process Improves Human Sperm Motility and Vitality in Asthenoteratozoospermia Patients.\\u003c/em\\u003e Biopreservation and Biobanking, 2023.\\u003c/li\\u003e\\n\\u003cli\\u003eDatta, S., \\u003cem\\u003eBrunet A, and Greenberg ME.\\u003c/em\\u003e Cellular survival: a play in three Akts. Genes Dev, 1999. \\u003cstrong\\u003e13\\u003c/strong\\u003e: p. 2905-2927.\\u003c/li\\u003e\\n\\u003cli\\u003eZambrano, A., et al., \\u003cem\\u003eCytokine stimulation promotes increased glucose uptake via translocation at the plasma membrane of GLUT1 in HEK293 cells.\\u003c/em\\u003e Journal of cellular biochemistry, 2010. \\u003cstrong\\u003e110\\u003c/strong\\u003e(6): p. 1471-1480.\\u003c/li\\u003e\\n\\u003cli\\u003eSagare-Patil, V., et al., \\u003cem\\u003eProgesterone utilizes the PI3K-AKT pathway in human spermatozoa to regulate motility and hyperactivation but not acrosome reaction.\\u003c/em\\u003e Molecular and cellular endocrinology, 2013. \\u003cstrong\\u003e374\\u003c/strong\\u003e(1-2): p. 82-91.\\u003c/li\\u003e\\n\\u003cli\\u003eDias, T.R., et al., \\u003cem\\u003eSperm glucose transport and metabolism in diabetic individuals.\\u003c/em\\u003e Molecular and Cellular Endocrinology, 2014. \\u003cstrong\\u003e396\\u003c/strong\\u003e(1-2): p. 37-45.\\u003c/li\\u003e\\n\\u003cli\\u003eNavale, A.M. and A.N. Paranjape, \\u003cem\\u003eGlucose transporters: physiological and pathological roles.\\u003c/em\\u003e Biophysical reviews, 2016. \\u003cstrong\\u003e8\\u003c/strong\\u003e(1): p. 5-9.\\u003c/li\\u003e\\n\\u003cli\\u003eAlves, M.G., et al., \\u003cem\\u003eDiabetes, insulin-mediated glucose metabolism and Sertoli/blood-testis barrier function.\\u003c/em\\u003e Tissue barriers, 2013. \\u003cstrong\\u003e1\\u003c/strong\\u003e(2): p. e23992.\\u003c/li\\u003e\\n\\u003cli\\u003eAhmed, A.A., et al., \\u003cem\\u003eGum Arabic improves the reproductive capacity through upregulation of testicular glucose transporters (GLUTs) mRNA expression in Alloxan induced diabetic rat.\\u003c/em\\u003e Bioactive Carbohydrates and Dietary Fibre, 2020. \\u003cstrong\\u003e22\\u003c/strong\\u003e: p. 100218.\\u003c/li\\u003e\\n\\u003cli\\u003eKishimoto, A., et al., \\u003cem\\u003eImmunohistochemical localization of GLUT3, MCT1, and MCT2 in the testes of mice and rats: the use of different energy sources in spermatogenesis.\\u003c/em\\u003e Biomedical Research, 2015. \\u003cstrong\\u003e36\\u003c/strong\\u003e(4): p. 225-234.\\u003c/li\\u003e\\n\\u003cli\\u003eTanhaye Kalate Sabz, F., et al., \\u003cem\\u003eGM\\u0026ndash;CSF (granulocyte‐macrophage colony‐stimulating factor) treatment improves sperm parameters in men with oligoasthenoteratospermia via PI3K/AKT pathway.\\u003c/em\\u003e Andrologia, 2022: p. e14427.\\u003c/li\\u003e\\n\\u003cli\\u003eNikmard, F., et al., \\u003cem\\u003eA comparative study on the results of agonist and antagonist protocols based on serum AMH levels in patients undergoing intracytoplasmic sperm injection.\\u003c/em\\u003e International Journal of Reproductive BioMedicine, 2016. \\u003cstrong\\u003e14\\u003c/strong\\u003e(12): p. 769.\\u003c/li\\u003e\\n\\u003cli\\u003eEdition, F., \\u003cem\\u003eExamination and processing of human semen.\\u003c/em\\u003e World Health [Internet], 2010.\\u003c/li\\u003e\\n\\u003cli\\u003eLacham-Kaplan, O. and A. Trounson, \\u003cem\\u003eThe effects of the sperm motility activators 2-deoxyadenosine and pentoxifylline used for sperm micro-injection on mouse and human embryo development.\\u003c/em\\u003e Human Reproduction, 1993. \\u003cstrong\\u003e8\\u003c/strong\\u003e(6): p. 945-952.\\u003c/li\\u003e\\n\\u003cli\\u003eShi, J.-Z., et al., \\u003cem\\u003eExpressions of sperm-specific genes in carnitine-cultured testis sperm of obstructive azoospermia patients.\\u003c/em\\u003e Zhonghua nan ke xue= National journal of andrology, 2010. \\u003cstrong\\u003e16\\u003c/strong\\u003e(6): p. 504-509.\\u003c/li\\u003e\\n\\u003cli\\u003eRobertson, S.A., et al., \\u003cem\\u003eGranulocyte-macrophage colony-stimulating factor promotes glucose transport and blastomere viability in murine preimplantation embryos.\\u003c/em\\u003e Biology of Reproduction, 2001. \\u003cstrong\\u003e64\\u003c/strong\\u003e(4): p. 1206-1215.\\u003c/li\\u003e\\n\\u003cli\\u003ePeralta, O., et al., \\u003cem\\u003eTissue localization of GM-CSF receptor in bovine ovarian follicles and its role on glucose uptake by mural granulosa cells.\\u003c/em\\u003e Animal reproduction science, 2016. \\u003cstrong\\u003e170\\u003c/strong\\u003e: p. 157-169.\\u003c/li\\u003e\\n\\u003cli\\u003eAngulo, C., et al., \\u003cem\\u003eHexose transporter expression and function in mammalian spermatozoa: cellular localization and transport of hexoses and vitamin C.\\u003c/em\\u003e Journal of cellular biochemistry, 1998. \\u003cstrong\\u003e71\\u003c/strong\\u003e(2): p. 189-203.\\u003c/li\\u003e\\n\\u003cli\\u003eBurant, C. and N. Davidson, \\u003cem\\u003eGLUT3 glucose transporter isoform in rat testis: localization, effect of diabetes mellitus, and comparison to human testis.\\u003c/em\\u003e American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 1994. \\u003cstrong\\u003e267\\u003c/strong\\u003e(6): p. R1488-R1495.\\u003c/li\\u003e\\n\\u003cli\\u003eWessendarp, M., et al., \\u003cem\\u003eRole of GM-CSF in regulating metabolism and mitochondrial functions critical to macrophage proliferation.\\u003c/em\\u003e Mitochondrion, 2022. \\u003cstrong\\u003e62\\u003c/strong\\u003e: p. 85-101.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y.-Y., et al., \\u003cem\\u003eProtein kinases regulate hyperactivated motility of human sperm.\\u003c/em\\u003e Chinese Medical Journal, 2021. \\u003cstrong\\u003e134\\u003c/strong\\u003e(20): p. 2412-2414.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, J., et al., \\u003cem\\u003eLeucine mediates autophagosome-lysosome fusion and improves sperm motility by activating the PI3K/Akt pathway.\\u003c/em\\u003e Oncotarget, 2017. \\u003cstrong\\u003e8\\u003c/strong\\u003e(67): p. 111807.\\u003c/li\\u003e\\n\\u003cli\\u003ePujianto, D.A., B.J. Curry, and R.J. Aitken, \\u003cem\\u003eProlactin exerts a prosurvival effect on human spermatozoa via mechanisms that involve the stimulation of Akt phosphorylation and suppression of caspase activation and capacitation.\\u003c/em\\u003e Endocrinology, 2010. \\u003cstrong\\u003e151\\u003c/strong\\u003e(3): p. 1269-1279.\\u003c/li\\u003e\\n\\u003cli\\u003eKoppers, A.J., et al., \\u003cem\\u003ePhosphoinositide 3-kinase signalling pathway involvement in a truncated apoptotic cascade associated with motility loss and oxidative DNA damage in human spermatozoa.\\u003c/em\\u003e Biochemical Journal, 2011. \\u003cstrong\\u003e436\\u003c/strong\\u003e(3): p. 687-698.\\u003c/li\\u003e\\n\\u003cli\\u003eAitken, R.J., et al., \\u003cem\\u003eEvidence that extrapancreatic insulin production is involved in the mediation of sperm survival.\\u003c/em\\u003e Molecular and cellular endocrinology, 2021. \\u003cstrong\\u003e526\\u003c/strong\\u003e: p. 111193.\\u003c/li\\u003e\\n\\u003cli\\u003eImoedemhe, D.A., et al., \\u003cem\\u003eThe effect of caffeine on the ability of spermatozoa to fertilize mature human oocytes.\\u003c/em\\u003e Journal of assisted reproduction and genetics, 1992. \\u003cstrong\\u003e9\\u003c/strong\\u003e(2): p. 155-160.\\u003c/li\\u003e\\n\\u003cli\\u003eTakeda, N., et al., \\u003cem\\u003eClinical outcome of sorting and recovery of ultrasmall amounts of live sperm stimulated with pentoxifylline followed by intracytoplasmic sperm injection.\\u003c/em\\u003e Journal of Mammalian Ova Research, 2009. \\u003cstrong\\u003e26\\u003c/strong\\u003e(2): p. 79-85.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-biology-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mole\",\"sideBox\":\"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)\",\"snPcode\":\"11033\",\"submissionUrl\":\"https://submission.nature.com/new-submission/11033/3\",\"title\":\"Molecular Biology Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"GM-CSF, Obstructive azoospermia, Sperm motility, Glucose Transporter Type 1\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3906456/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3906456/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eGranulocyte-macrophage colony-stimulating factor (GM-CSF) expressed in the human reproductive system, holds a pivotal role in the reproductive processes. This study investigates the in vitro effect of GM-CSF on the testicular sperm of obstructive azoospermia (OA) patients and assesses the effectiveness of GM-CSF‐supplemented sperm media in Intracytoplasmic sperm injection (ICSI) outcomes.\\u003c/p\\u003e\\u003ch2\\u003eMethods and Results\\u003c/h2\\u003e \\u003cp\\u003eFollowing testicular sperm extraction from 20 patients diagnosed with OA, each sample was divided into two parts: the experimental samples were incubated with the medium containing 2 ng/ml GM-CSF at 37\\u0026deg;C for 60 min, and control samples were incubated with medium without GM-CSF. Subsequently, the oocytes retrieved from the partner were injected with sperms from treatment and the control groups. The sperm parameters ( motility, viability), the expression level of sperm motility-related genes (\\u003cem\\u003ePIK3R1\\u003c/em\\u003e, \\u003cem\\u003ePIK3CA\\u003c/em\\u003e, and \\u003cem\\u003eAKT1\\u003c/em\\u003e ), and sperm energy metabolism-related genes (\\u003cem\\u003eGLUT1\\u003c/em\\u003e, \\u003cem\\u003eGLUT3\\u003c/em\\u003e, and \\u003cem\\u003eGLUT14\\u003c/em\\u003e) were assessed. Furthermore, the fertilization and cleavage rates and embryo quality were evaluated. Supplemented testicular sperm with GM-CSF significantly increased motility parameters, the mRNA expression of \\u003cem\\u003ePIK3R1\\u003c/em\\u003e, \\u003cem\\u003eAKT1\\u003c/em\\u003e, and \\u003cem\\u003eGLUT3\\u003c/em\\u003e compared to the non-treated group (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). However, no significant differences in mRNA expression of \\u003cem\\u003ePIK3CA\\u003c/em\\u003e, \\u003cem\\u003eGLUT1\\u003c/em\\u003e, or \\u003cem\\u003eGLUT14\\u003c/em\\u003e were identified. Based on ICSI outcomes, the GM-CSF treatment group exhibited significantly higher fertilization rates (p\\u0026thinsp;=\\u0026thinsp;0.027), cleavage rates (p\\u0026thinsp;=\\u0026thinsp;0.001), and the proportion of good-quality embryos (p\\u0026thinsp;=\\u0026thinsp;0.002) compared to the control group.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e \\u003cp\\u003eGM-CSF increased gene expression related to motility and energy metabolism pathway and effectively had a positive effect on the motility of testis-extracted spermatozoa and, consequently yielding positive clinical outcomes.\\u003c/p\\u003e\",\"manuscriptTitle\":\"In vitro effect of Granulocyte-macrophage colony-stimulating factor (GM-CSF) on the expression of related genes to sperm motility and energy metabolism, and ICSI outcomes in obstructive azoospermic patients\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-01-31 20:06:56\",\"doi\":\"10.21203/rs.3.rs-3906456/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2024-03-05T15:48:05+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-03-05T10:04:10+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"75724423-f0fa-4ffa-b8a8-585a92f57ea1\",\"date\":\"2024-02-13T12:46:09+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-01-29T16:00:06+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-01-29T15:54:11+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-01-29T03:14:06+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Molecular Biology Reports\",\"date\":\"2024-01-28T17:17:09+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"molecular-biology-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mole\",\"sideBox\":\"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)\",\"snPcode\":\"11033\",\"submissionUrl\":\"https://submission.nature.com/new-submission/11033/3\",\"title\":\"Molecular Biology Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"0aae205a-fb6e-45c8-b36e-8fdb1a65c8c6\",\"owner\":[],\"postedDate\":\"January 31st, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-05-24T08:36:27+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-01-31 20:06:56\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3906456\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3906456\",\"identity\":\"rs-3906456\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}