{"paper_id":"46a2229a-20ce-4db1-9b3d-7576649c656c","body_text":"Muscone regulates microRNA-200c /UBE2W axis to promote osteogenic differentiation of bone marrow mesenchymal stem Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Muscone regulates microRNA-200c /UBE2W axis to promote osteogenic differentiation of bone marrow mesenchymal stem Cells JiLiang Wang, LiXin Zhao, Feng Gao, HongBo Wang, YongSheng Yang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5578006/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Bone marrow mesenchymal stem cells (BMSCs) in patients with degenerative bone diseases exhibit impaired in proliferation. Muscone, traditionally used in Chinese medicine for bone ailments, has anti-inflammatory properties, but its effect on bone tissue repair is still not clear. The aim of this study was to systematically investigate the osteogenic properties of muscone in BMSC and its potential molecular mechanisms. Methods BMSCs were treated with high, medium, and low doses of muscone, followed by CCK-8 assay, Western blot, and ALP staining to evaluate its effects on cell viability and osteogenic differentiation. The interaction between miR-200c and UBE2W was assessed using a luciferase reporter system. To investigate the role of the miR-200c/UBE2W axis in osteogenic differentiation, BMSCs overexpressing miR-200c alone or in combination with UBE2W were established. Results Muscone enhances BMSC viability and osteogenic differentiation capacity in a dose-dependent manner. Mechanistically, muscone upregulated miR-200c expression while downregulating UBE2W levels. miR-200c directly bound to the 3'UTR of UBE2W mRNA to suppress its transcription. Collectively, these results demonstrate that muscone promoted osteogenic differentiation through activation of the miR-200c/UBE2W axis. While UBE2W knockdown was demonstrated to reduce BMSC apoptosis while accelerating osteogenic differentiation. Conclusions Muscone can elevate the expression level of miR-200c to downregulate UBE2W, thereby exerting an influence on crucial cellular processes including osteogenic differentiation. Muscone MicroRNA-200c UBE2W BMSCs osteogenic differentiation Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Bone marrow mesenchymal stem cells (BMSCs) are primitive cells [ 1 ] with multipotent differentiation potential, capable of differentiating into adipocytes, chondrocytes, osteoblasts, bone cells, etc. Promoting osteogenic differentiation of BMSCs represents a potent strategy for enhancing bone tissue engineering and improving bone degenerative diseases [ 2 ]. Konarski et al [ 3 ] indicate that the proliferation of BMSCs is impaired in bone diseases. Therefore, a deeper understanding of the mechanisms underlying BMSC proliferation and differentiation will provide a foundation for further research on the pathogenesis of bone degenerative diseases [ 4 ]. Musk, a traditional Chinese medicine promotes blood circulation for bone degenerative conditions such as osteoporosis, knee osteoarthritis, and lumbar disc herniation, has a rich history of clinical application in orthopedic ailments [ 5 ]. Muscone, the main active component of natural musk, exhibits similar pharmacological effects and chemical action as musk [ 6 ]. Several studies have demonstrated that muscone promotes osteogenic differentiation of human gingival mesenchymal stem cells by inhibiting the Wnt/β-catenin signaling pathway [ 7 ]. Furthermore, muscone can reverse ethanol-suppressed osteogenic differentiation in hBMSCs, suggesting a protective effect against alcohol-induced osteonecrosis of the femoral head [ 8 ]. These collective findings indicate that muscone possesses significant potential to enhance osteogenic differentiation in stem cells. However, the molecular mechanisms underlying muscone's effects require further in-depth investigation. MicroRNAs are small RNA molecules that exist on non-coding single strands. Their function is to act on the 3'-UTR region of target genes, regulating cellular physiological and pathological processes, and participating in the differentiation and proliferation regulation of BMSCs [ 9 , 10 ]. MiR-200c belongs to miRNA and as a member of the miR-200 family, the miR-200c gene cluster is located on chromosome 12p13.31[ 11 ]. An increasing number of studies have demonstrated that miR-200c has strong physiological functions. For example, the overexpression of miR-200c can inhibit the proliferation, invasion, and migration of cancer cells, suggesting that miR-200c may exert a suppressive effect on cancer cell proliferation and invasion [ 12 ]. In addition to its anticancer effects, miR-200c has been demonstrated to promote osteogenic differentiation. As reported by Adil Akkouch et al., miR-200c plasmid DNA (pDNA) significantly enhanced bone formation and regeneration in a rat calvarial defect model [ 13 ]. Furthermore, microRNA-200c facilitated osteogenesis by suppressing IL-6, IL-8, and CCL-5 expression while simultaneously enhancing osteogenic differentiation [ 14 ]. Collectively, these findings strongly suggest that miR-200c may serve as a unique osteoinductive agent for bone healing and regeneration. The ubiquitin conjugating enzyme are recognized as target genes of microRNAs in cells. The ubiquitin conjugating enzyme 2W (UBE2W) is a novel ubiquitin-conjugating enzyme [ 15 ] that catalyzes the process of ubiquitination and is expressed in both human and murine tissues [ 16 ]. Previous studies have shown that UBE2W is involved in the regulation of nuclear factor-κB (NF-κB) transcriptional activity [ 17 ]. The NF-κB pathway, as an important signaling hub, plays a crucial role in multiple biological effects including inflammatory and immune responses, as well as cell proliferation and apoptosis [ 18 , 19 ]. Our preliminary bioinformatics analysis predicted UBE2W as a downstream target gene of miR-200c. However, the role of UBE2W in osteogenic differentiation remains unreported and requires further experimental validation to elucidate its functional involvement in this process. Considering the unique pathogenesis of bone degenerative diseases, we propose the following hypothesis: Muscone may regulate the activity of miR-200c, affecting the function of UBE2W, thereby modulating the complex ubiquitination process in mesenchymal stem cells, particularly in protein synthesis. In this process, UBE2W plays a crucial role in shaping the spatial conformation of proteins. Through this modulation, we aim to enhance the synthesis of extracellular matrix(ECM)proteins in BMSCs, leading to the improvement of compromised bone tissue. Additionally, this modulation will help suppress the apoptotic tendencies of BMSC triggered by inflammatory stimuli and promote cellular regeneration, ultimately impeding the insidious progression of bone degenerative diseases. This study systematically investigated the osteogenic properties of muscone in BMSCs and its underlying molecular mechanisms. Our findings demonstrate that muscone significantly accelerated osteogenic differentiation of BMSCs by modulating the miR-200c/UBE2W axis, thereby promoting the regeneration of damaged bone tissue. These results suggest muscone's potential as a novel therapeutic agent for osteoporosis and skeletal aging. Furthermore, the miR-200c/UBE2W axis emerges as a promising therapeutic target for enhancing osteogenic differentiation. Materials and methods Cell culture and treatment A rat BMSCs cell line (SCIENCELL, USA) was cultivated in Dulbecco's modified Eagle's medium (DMEM; GIBCO, USA) supplemented with 10% fetal bovine serum (FBS; GIBCO, USA), as well as 100 IU/mL of penicillin, 100 µg/mL of streptomycin, and 2 mM of glutamine. The cells were incubated in a controlled environment of 37°C with 5% CO 2 . Following a previously reported protocol, cells were seeded at a density of 3×10 4 cells/cm 2 containing complete DMEM supplemented with β-glycerol phosphate and ascorbic acid (Sigma-Aldrich, USA). After 72 h incubation, the complete DMEM was replaced with fresh DMEM devoid of FBS, and the cells were further incubated for an additional 24 h. Multiple experiments were conducted following the procedures described below. BMSCs were cultured in osteogenic induction medium (OIM) containing 10 − 8 mol/L dexamethasone, 50 mM l-ascorbyl-2-phosphate and 10 − 2 mol/L β-glycerophosphate [ 20 ]. Cells were treated with different concentrations (10 µM, 20 µM and 40 µM) of Muscone (Cat: PHL89737; Sigma-Aldrich, USA). To observe the effect of Muscone on osteogenic differentiation of BMSCs, the cells were divided into the following four groups: control group (cultured with PBS and OIM); high and medium-low dose Muscone group (cultured with 10, 20 or 40 µM Muscone and OIM). After 14 days of culture, osteogenic gene expression and Alkaline phosphatase were detected. For the inhibitor-treated rescue experiment, cells were first pretreated with inhibitors for 48 hours, followed by treatment of successfully transfected cells with OIM and 40 µM Muscone for 14 days. Luciferase assays The psiCHECK-2 reporter plasmid was transfected into cells using Lipofectamine 3000 (Cat: L30000015; Invitrogen, Thermo Fisher Scientific, USA). The 3'‑UTR of UBE2W (Binding sites: WT: CAGTATTA; MUT: GTCATAAT) was amplified through PCR, following previously described methods, and subsequently inserted into the psiCHECK-2 vector (Cat: E2241; Promega, USA). BMSCs were co-transfected with either the wild-type or mutant psiCHECK-2 vector (100 ng/well), along with either the miR‑200c mimic or NC (100 ng/well). After 48 h of transfection, cell lysis was performed to measure luciferase activity using the Dual Luciferase Reporter Assay System, with luciferase activity serving as the normalization factor. Transfection and lentiviral transduction A total of 1 µg plasmid (100 nM miRNA mimic or 00 nM miRNA inhibitor) was diluted in 50 µL serum-free Opti-MEM. The plasmid was gently mixed and incubated at room temperature for 5 min. Lipo3000 was diluted in 50 µL serum-free Opti-MEM, mixed gently, and incubated at room temperature for 5 min. The miR-200c mimic, miR-200c inhibitor and lipo3000 were combined and left at room temperature for 20 min before transfection into the cells. Subsequent luciferase assay was conducted 48 h post-transfection. Lentiviral transduction was employed in subsequent experiments, including alkaline phosphatase staining and mRNA and protein expression analysis of UBE2W. The supernatant of the 293T cells was collected by centrifugation at 1,000 g for 4 h at 4˚C, then transferred to a syringe and filtered using a 0.45 µm filter. The plasmid was mixed with 1.5 mL serum-free α-MEM medium and left at room temperature for 20 min before transfection. The plasmid ratio used was 8 µg LV2 shuttle plasmid, 8 µg pGag/Pol, 4 µg pRev, and 6 µg PVSV-G. 300 µL of liposome was mixed with 1.2 mL of serum-free medium and left at room temperature for 5 min. The plasmid and liposome were then mixed and left at room temperature for 20 min. This mixture was added to the 293T cell culture medium. After 6 h of incubation, the medium was removed, and serum-containing medium was added. The supernatant was collected after 72 h of culture at 37˚C. The collected supernatant was centrifuged at 23,000 g for 4 h at 4˚C. The plates were gently shaken and then placed back into the incubator for culture. Positive cells were screened using 0.5 µg/mL puromycin and maintained at a concentration of 2 µg/mL. After 6 h of cell culture, the virus-containing medium was replaced with fresh medium, and the cells were cultured for an additional 72 h before subsequent experiments, including cell proliferation assays and mRNA analysis. RT‑qPCR Total RNA was isolated from cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc, USA) following the manufacturer's instructions. Subsequently, cDNA was synthesized using the Prime Script RT Reagent kit at 42˚C for 60 min, followed by incubation at 70˚C for 10 min (Takara Biotechnology Co., Ltd., Japen). Quantitative PCR (qPCR) was performed using SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd., Japen) on an ABI StepOne Plus Real‑Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc., USA). The thermocycling protocol included an initial denaturation step at 95˚C for 5 min, followed by 40 cycles of 95˚C for 10 s and 60˚C for 34 s (35‑37). The relative mRNA levels were determined using the 2 ‑ΔΔCt method (38). Reverse transcription of mRNA and quantitative PCR primers were obtained from Guangzhou Ribobio Co., Ltd., USA. The experiments were conducted five times. The U6 gene was used as the reference gene for miR‑141, while GAPDH served as the reference gene for E2F3. The primers (General Biosystems) used were as follows: UBE2W Forward: 5'‑GCAAGTTCAACGGCACAG‑3'; Reverse: 5'‑ GCCAGTAGACTCCACGACAT‑3' ; GAPDH Forward: 5'‑TTCACCACCATGGAGAAGGC‑3'; Reverse: 5'‑AGTGATGGCATGGACTGTG‑3'. CCK8 Assay The cell lines were cultured in complete MEM medium containing 10% fetal bovine serum and incubated at 37°C with 5% CO 2 . When the cells reached 80–90% confluence, they were digested with trypsin and passaged at a 1:3 ratio. For cell passage, the cells were washed with PBS and digested with 1 mL of trypsin for 1–3 min. The digestion was stopped by adding 3 mL of complete medium and the cells were transferred to a 15 mL centrifuge tube, centrifuged at 1000 rpm for 5 min by a centrifuge (Cat: Micro-15R; KEWLAB, Australia), and the supernatant was discarded. The cells were then resuspended in 3 mL of medium and passaged at a 1:3 ratio in a culture dish. To perform the CCK8 assay (Cat: C0037; Beyotime Biotechnology, China), the BMSCs were digested with trypsin and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the cells were resuspended in complete medium and seeded in 96-well plates at a density of 5000 cells per well. After the cells adhered to the well surface, the medium was replaced with a mixture of CCK8 reagent and medium in a 10:90 ratio. The cells were then incubated for an additional 3 h in a cell culture incubator. After incubation, the medium was removed, and 150 µL of DMSO was added to each well. The plate was gently shaken to ensure uniform mixing, and the absorbance was measured at 450 nm using a microplate reader. The absorbance values represented the cell viability, and higher values indicated greater cell vitality. The CCK8 assay was performed according to the manufacturer's instructions. Cell osteogenesis induction BMSCs obtained from male Sprague Dawley rats, were cultured at a density of 1x10 5 cells and subsequently infected with lentivirus. The protocol for cell osteogenesis induction followed the methodology previously described by Yaghoobi et al[ 21 ]. Upon reaching 80–90% confluence, BMSCs were enzymatically dissociated using trypsin (HyClone; Cytiva, USA), followed by centrifugation at 100 xg for 5 min at room temperature. The supernatant was carefully aspirated, and the BMSCs were resuspended in α-MEM (HyClone; Cytiva, USA) and plated onto a 24-well culture plate. The cells were allowed to grow until they reached 70% confluence, at which point the culture medium was replaced with osteogenic induction medium. The medium was subsequently refreshed every 3 days. The levels of osteogenesis were evaluated on days 3, 7, and 14 using alkaline phosphatase staining [ 22 ]. Images were captured and stored for subsequent alkaline phosphatase assay. Alkaline phosphatase staining A total of 1×10 5 cells were seeded into each well of 24‑well plates. The cells were cultured until reaching 60‑70% confluence, following which the culture medium was substituted with osteogenic induction culture medium. The osteogenic medium was refreshed every 3 days, and upon completion of the osteogenic induction process, the cells were washed with phosphate-buffered saline (PBS). On days 3, 7, and 14, the BMSCs were fixed with a 10% formaldehyde solution at room temperature for 30 min, followed by two washes with PBS. Subsequently, the fixed cells were stained with 50 µL of alkaline phosphatase solution at 37˚C for 2 h[ 23 ]. Flow cytometry detects cell apoptosis When the cell confluence reached 70%, apoptosis was induced by drug treatment. For adherent cells, both the cells in the supernatant and the collected cells were harvested. The cells in the supernatant were collected in the same 7 mL centrifuge tube after being detached using trypsin digestion and resuspended in complete culture medium. To ensure an adequate number of cells (≥ 5×10 5 cells/treatment), three replicate wells were set for each group. For suspension cells, they were directly collected. After centrifugation at 1300 rpm for 5 min, the supernatant was discarded. The cell pellet was washed once with PBS and centrifuged again at 1300 rpm for 5 min. The cells were collected and then washed once with 1× binding buffer followed by another centrifugation at 1300 rpm for 5 min. The cells were collected again. The cell pellet was resuspended in 0.1-1 mL of 1× cell staining buffer to achieve a final cell density of 1 × 10 6 to 1 x 10 7 cells/mL. Then, 100 µL of the cell suspension (1 × 10 5 to 1 × 10 6 cells) was taken and 5 µL of annexin V-APC staining (Cat: E-CK-A217; elabscience, USA) was added. The samples were stored protected from light and brought to the flow cytometry facility within 15 min. After centrifugation at 1300 rpm for 5 min to remove the supernatant, the cells were resuspended in 100 µL of 1× binding buffer. Subsequently, 5 µL of PI (diluted 10 times with 40× PI staining solution) was added, and the cell staining buffer was supplemented to a final volume of 300 µL for flow cytometry analysis. This flow cytometry procedure allowed for the detection of cell apoptosis and was conducted according to established protocols. Statistical analysis Each experiment was conducted by performing each experiment three times, and the results are presented as the mean value ± standard deviation GraphPad Prism 8 software was used to analyze the data statistically. The unpaired Student's t test was utilized to compare the differences between two groups, whereas one-way analysis of variance followed by Tukey's post hoc test was performed to compare the differences between three or more groups. A significance level of P < 0.05 was considered to indicate a statistically significant difference. Results Muscone increases cell viability and promotes osteogenic differentiation. We aimed to explore whether muscone might exert an effect on BMSCs viability. The effect of muscone on the viability of BMSCs was examined using the CCK8 assay. The results showed that the cell viability of BMSCs was gradually increased in the presence of muscone at concentrations of 10 µM, 20 µM and 40 µM (Fig. 1 A). In addition, extracellular matrix proteins and osteogenic markers were analyzed by Western blot. The results revealed that muscone upregulated the protein expression of RUNX2, MMP3, MMP9, and OCN in a concentration-dependent manner (Fig. 1 B). ALP staining further confirmed that muscone promoted osteogenic differentiation of BMSCs (Fig. 1 C). Collectively, these findings demonstrate that muscone enhanced BMSC viability and osteogenic capacity dose-dependently. BMSCs were treated with muscone at concentrations of 10 µM, 20 µM and 40 µM. (A) Cells were cultured for 5 consecutive days for CCK-8 staining respectively, and the results were observed by OD450 absorbance. (B) The protein expression of RUNX2, MMP3, MMP9, and OCN was detected by western blot in BMSCs treatment with muscone. (E) Alkaline phosphatase staining was used to detect osteoblast differentiation after treated with muscone. Muscone enhances the viability and osteogenic differentiation of BMSCs by increasing the expression of miR-200c. This study also investigates the molecular mechanisms associated with muscone. To achieve this, BMSCs were exposed to muscone at final concentrations of 10, 20, and 40 µM. Subsequently, an RT-PCR assay was conducted to measure mRNA levels. The results of the RT-PCR indicated that the mRNA level of miR-200c significantly increased with higher concentrations of muscone (Fig. 1 B). The results demonstrate that Muscone enhances the expression of miR-200c. To further investigate whether Muscone's effects on osteogenic differentiation are dependent on miR-200c expression, we introduced a miR-200c inhibitor. RT-PCR results showed that the miR-200c inhibitor significantly downregulated miR-200c expression, an effect that was reversed by Muscone (Fig. 2 B). Additionally, CCK8 assays indicated that the miR-200c inhibitor significantly reduced cell viability, counteracting the upregulation of cell viability induced by Muscone (Fig. 2 C). Furthermore, Muscone increased the expression of osteogenesis-related genes, including RUNX2, MMP3, MMP9, and OCN, and enhanced ALP staining intensity, which was also reversed by the miR-200c inhibitors (Fig. 2 D-E). In conclusion, these results demonstrate that the osteogenic differentiation effect of Muscone was dependent on miR-200c expression. BMSCs were treated with muscone or miR-200c inhibitor. (A) The miR-200c mRNA level conducted on BMSCs cultured in the presence of Muscone at concentrations of 10 µM, 20 µM, and 40 µM. (B) The miR-200c mRNA level was detected by western blot in BMSCs. (C) Cells were cultured for 5 consecutive days for CCK-8 staining respectively, and the results were observed by OD450 absorbance. (D) The protein expression of RUNX2, MMP3, MMP9, and OCN was detected by western blot in BMSCs. (E) Alkaline phosphatase staining was used to detect osteoblast differentiation. UBE2W is a target of miR-200c This study demonstrated that miR-200c has a role in enhancing osteogenic differentiation; however, the molecular mechanisms involved in miR-200c are unknown. Therefore, we also explored the downstream genes regulated by miR-200c. Through Target Scan Human database prediction, we found that UBE2W might be a potential target for miR-200c (Fig. 3 A). To investigate the regulatory relationship between UBE2W and miR-200c, we used a luciferase assay to determine whether miR-200c can directly target UBE2W expression through its UTR. In the wild-type group, the average UBE2W luciferase activity was significantly lower than that of the NC group. However, after transduction with miRNA, the average UBE2W luciferase activity of the mutant remained unchanged (Fig. 3 A). This result demonstrated that UBE2W is a direct target of miR-200c in BMSCs. Interestingly, muscone progressively downregulated the mRNA levels of UBE2W with increasing concentration. This observation suggests that UBE2W may play a role in negatively regulating osteogenic differentiation. To confirm this hypothesis, we conducted a knockdown of UBE2W for the study. As shown in Fig. S1 A, the knockdown of UBE2W significantly decreased cell viability after 5 days of culture (p < 0.01). Additionally, the knockdown of UBE2W resulted in significantly higher protein expression levels of the osteogenic genes MMP3, MMP9, and Runx2 (Fig. S1 B). Flow cytometry analysis of apoptosis, presented in Fig. S1 C, indicated that in BMSCs with UBE2W knockdown, the total apoptosis rate was significantly lower than that of the control group (p < 0.01). These results demonstrate that the knockdown of UBE2W enhanced the viability and osteogenic differentiation of BMSCs. miR-200c may influence BMSCs' viability, expression of osteogenic genes and osteogenic differentiation by regulating UBE2W expression Our study demonstrated that UBE2W is a target of miR-200c and that the knockdown of UBE2W promotes osteogenic differentiation. However, it remains unclear whether the osteogenic differentiation effect of miR-200c is mediated by the negative regulation of UBE2W expression. Accordingly, we investigated the impact of the miR-200c/UBE2W interaction on osteogenic differentiation. Constructed miR-200c plasmid and UBE2W overexpression plasmid were introduced, and the following groups were established: NC group, miR-NC group, miR-200c overexpress group, and miR-200c + UBE2W overexpress group. As shown in the results Fig. 3 A-B, when the miR-200c plasmid was transfected, an increase in miR-200c expression was observed (p < 0.01). But when in miR-200c + UBE2W overexpression group, the miR-200c expression was significantly suppressed (p < 0.01). When the miR-200c plasmid was transfected, a decrease in UBE2W expression was observed (p < 0.001). But when miR-200c + UBE2W overexpression, the UBE2W expression was significantly increased (p < 0.001). This suggests that miR-200c plays an important role in regulating UBE2W gene expression, and its overexpression can inhibit the expression of UBE2W, whereas the expression of miR-200c is also significantly inhibited when co-overexpressed with UBE2W, further confirming their mutual regulatory relationship (Fig. 4 A-B). Additionally, CCK-8 experimental results showed that there was no significant difference between the NC group and the miR-NC group. Compared to the miR-NC group, the miR-200c overexpress group exhibited a significant increase of cell viability (p < 0.01) (Fig. 4 C). Furthermore, compared to the miR-200c overexpress group, the miR-200c + UBE2W overexpress group showed a significant decrease of cell viability (p < 0.01). These experimental results demonstrate that muscone exerts an inhibitory effect on the cell viability of BMSCs and that miR-200c may affect the cell viability of BMSCs by regulating UBE2W expression As shown in the Fig. 4 D, revealed that after introducing the constructed miR-200c plasmid and UBE2W overexpression plasmid, there were no significant differences in protein expression compared to the control group and control group after 14 days of osteogenic induction culture. However, when miR-200c was overexpressed, the protein expression level of UBE2W was significantly reduced, while the expression of osteogenic genes RUNX2 was significantly increased. And the expression of cell viability genes MMP3 and MMP9 was also increased. When both miR-200c and UBE2W were overexpressed, the expression of osteogenic genes RUNX2, MMP3, and MMP9 was significantly decreased. Figure 4 D is the grayscale analysis of the Western blot results. Therefore, it can be inferred that miR-200c overexpression may have a promotional effect on skeletal cell differentiation, while co-overexpression of miR-200c and UBE2W may inhibit this process. Discussion Muscone is extracted from musk. Muscone is a secretion from the ventral glands of male musk and is considered to be the main active ingredient in musk[ 24 , 25 ]. Pengfei Liu et al. investigated that muscone enhanced the therapeutic action of BMSCs by promoting cell proliferation, secretion, and migration[ 26 ]. Hou Feiyi demonstrated that muscone promotes the proliferation and osteogenic differentiation of BMSCs. Some researchers found that muscone also promotes the migration of exogenous rat BMSCs in a rat model[ 27 ]. Nevertheless, the exact mechanism by which muscone regulates bone marrow MSCs is still not fully understood. In the current study, we observed that muscone dose-dependently enhanced BMSC viability and promoted osteogenic differentiation. However, the precise molecular mechanisms underlying muscone-mediated osteogenesis require further investigation. The miR-200c has been indicated to increase the biomarkers of osteogenic differentiation involving calcium content, alkaline-phosphatase (ALP) as well as runt related transcription factor 2 (Runx2) in hBMSCs. Peng Xia et al. discovered that overexpressed miR-200c enhanced osteoblast differentiation of hBMSCs, whereas inhibition of miR-200c reduced their osteogenic potential [ 28 ]. Consistent with previous studies, our findings confirm the osteogenic-promoting capacity of miR-200c. Specifically, muscone significantly upregulated miR-200c expression, while inhibition of miR-200c reduced BMSC viability and downregulated the expression of osteogenic markers (RUNX2, MMP3, MMP9, and OCN) along with ALP staining intensity. These results demonstrate that miR-200c enhanced osteogenic differentiation, and muscone promoted this process through miR-200c upregulation. To examine the molecular mechanism of miR-200c regulating osteoblast differentiation of BMSCs, we screened out potential target genes of miR-200c.The luciferase activity verified that miR-200c significantly inhibited the luciferase activity of wild-type UBE2W, but it failed to suppress luciferase activity of mutated one. This suggests that UBE2W is a target of miR-200c. In vitro cell experiments showed that muscone upregulates miR-200c and downregulates UBE2W, which is closely associated with the human body's self-repair mechanisms, highlights the importance of investigating the relationship between muscone, UBE2W, and miR-200c. To examine the relationship between miR-200c and UBE2W RNA expression, different groups of BMSCs were transfected with constructed miR-200c and UBE2W overexpression plasmids. And UBE2W were transfected with knockdown plasmids. The results of the experiment found that a negative feedback relationship between miR-200c and UBE2W. When miR-200c was overexpressed, our data showed a significant increase in cell viability and expression levels of the osteogenic genes RUNX2, MMP3, and MMP9. In contrast, cell viability and expression levels of RUNX2, MMP3, and MMP9 were significantly reduced when UBE2W was overexpressed. These results consistent with the negative feedback regulatory mechanism. UBE2W is a newly discovered ubiquitin-binding enzyme (E2) in recent years, which plays a role in ubiquitination modification[ 29 ]. Shaoxin Wang et.al found that UBE2W suppressed NF-κB transcriptional activity under TNFα stimulation and inhibited TNFα-induced phosphorylation of IκB and p65 in HEK293T cells and HCT116 cells[ 30 ]. Bo Wang et.al showed that UBE2W functions as a significant factor in mouse postnatal survival as well as in skin differentiation, G-CSF-related immune response, and male fertility. High expression of UBE2W is observed in testis and thymus tissues, indicating its critical involvement in the proper functioning of multiple organ systems [ 31 ]. In addition, high expression of UBE2W may promote breast cancer tumor cell invasion and metastasis [ 32 ]. The down-regulation of UBE2W can promote apoptosis and spermatogenesis [ 33 ] and may be involved as a key gene in the molecular regulation of major depressive disorder in adolescence [ 34 ]. However, the correlation between UBE2W and degenerative bone disease is not fully understood. This study also investigated the role of UBE2W in osteogenesis. UBE2W knockdown significantly enhanced cell viability and upregulated osteogenic marker expression. Flow cytometric analysis further revealed reduced overall apoptosis rates following UBE2W silencing. These results provide the first evidence that UBE2W exerts negative feedback regulation on osteogenic differentiation in BMSCs, identifying it as a potential therapeutic target for bone formation. Therefore, regulating miR-200c expression can become a new idea for the prevention and treatment of osteoporosis. Another study has shown that overexpressed miR-200c can inhibits chemoresistance, invasion and colony formation of cancer stem cells [ 35 ]. Moreover, miR-200c has a significant relationship with the epithelial-mesenchymal transition, anti-apoptosis, and cancer stem cell phenotype [ 36 ]. Modulating miR-200c expression may be a new approach to prevent and treat bone degenerative diseases. During the cellular pathological process, various signals can affect the regulation of cells, which can influence the healing and progression of diseases. Among them, microRNA has been extensively studied because of its unique features of producing no transcriptional proteins but having a significant impact on cytokine regulation. Therefore, it is crucial for gene expression in other cellular processes. UBE2W functions as a negative feedback regulator in conjunction with miR-200c, affects ubiquitination in cellular protein production, which can have far-reaching effects on protein activity, osteogenic differentiation, and cell autophagy. Based on the results of this experiment, our research group hypothesis posits that muscone, through indirect means, can elevate the expression level of miR-200c, thereby exerting an influence on crucial cellular processes including osteogenic differentiation, cell viability, and autophagy by modulating the activity of UBE2W. UBE2W was identified as a molecular and biological target gene of miR-200c. These data suggest that miR-200c may serve as a new therapeutic target for degenerative bone diseases. Further research on muscone, miR-200c and UBE2W will shed light on the signal regulation of BMSCs and other cells in pathological process of bone degenerative diseases. Declarations Ethics approval and consent to participate The present study was performed at the Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine. All the animal experiment procedures performed in this research were approved by Ethical Review Committee of Traditional Chinese Medicine Hospital of Inner Mongolia Autonomous Region, which is under international guidelines for animal experiments. Consent for publication Not applicable. Availability of data and material The datasets during and/or analysed during the current study available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Authors' contributions JL.W, L.X and Y.L contributed to the Conception and design, writing the article and critical revision of the article. LX.Z, F.G, HB.W and YS.Y contributed to the Statistical analysis. ZH.L and JL.W contributed to data collection. Y.L and YS.Y Obtained funding, finished the critical revision, and approved the final manuscript. All authors commented on previous versions. Funding The study was supported by the Natural Science Foundation of Inner Mongolia Autonomous Region (grant NO. 2023SHZR2129). The study was supported by the Inner Mongolia Autonomous Region Hospital of traditional Chinese medicine project (grant NO. 2022Z-A010). The study was supported by the Inner Mongolia Autonomous Region Hospital of traditional Chinese medicine project (grant NO. 2023Z-A002). The study was supported by the Inner Mongolia Medical University Joint Project Fund (grant NO. YKD2024LH006). Acknowledgements Not applicable. References Li, M., et al., Genistein mitigates senescence of bone marrow mesenchymal stem cells via ERRα-mediated mitochondrial biogenesis and mitophagy in ovariectomized rats . Redox Biol, 2023. 61: p. 102649. Yi, C., et al., Gold nanoparticles promote osteogenic differentiation of mesenchymal stem cells through p38 MAPK pathway . ACS Nano, 2010. 4(11): p. 6439–48. Konarski, W., et al., Avascular Necrosis of Femoral Head-Overview and Current State of the Art . Int J Environ Res Public Health, 2022. 19(12). Ouyang, Z., et al., DEPTOR exacerbates bone-fat imbalance in osteoporosis by transcriptionally modulating BMSC differentiation . Biomed Pharmacother, 2022. 151: p. 113164. Zhai, X., et al., Muscone Ameliorates Ovariectomy-Induced Bone Loss and Receptor Activator of Nuclear Factor-κb Ligand-Induced Osteoclastogenesis by Suppressing TNF Receptor-Associated Factor 6-Mediated Signaling Pathways . Front Pharmacol, 2020. 11: p. 348. He, M.C., et al., Muscone Ameliorates LPS-Induced Depressive-Like Behaviors and Inhibits Neuroinflammation in Prefrontal Cortex of Mice . Am J Chin Med, 2020. 48(3): p. 559–577. Yuan, W.X., et al., Muscone Promotes The Adipogenic Differentiation Of Human Gingival Mesenchymal Stem Cells By Inhibiting The Wnt/β-Catenin Signaling Pathway . Drug Des Devel Ther, 2019. 13: p. 3291–3306. Guo, Y.J., et al., Muscone exerts protective roles on alcohol-induced osteonecrosis of the femoral head . Biomed Pharmacother, 2018. 97: p. 825–832. Farazi, T.A., et al., miRNAs in human cancer . Journal of Pathology, 2015. 223(2): p. 102–115. Shi, C., et al., Glucocorticoid inhibits cell proliferation in differentiating osteoblasts by microRNA-199a targeting of WNT signaling . Journal of Molecular Endocrinology, 2015. 54(3): p. 325–337. Kim, J., et al., TMPRSS2-ERG gene fusions induce prostate tumorigenesis by modulating microRNA miR-200c . Oncogene, 2014. 33(44): p. 5183–92. Anastasiadou, E., et al., MiR-200c-3p Contrasts PD-L1 Induction by Combinatorial Therapies and Slows Proliferation of Epithelial Ovarian Cancer through Downregulation of β-Catenin and c-Myc . Cells, 2021. 10(3). Akkouch, A., et al., Enhancement of MicroRNA-200c on Osteogenic Differentiation and Bone Regeneration by Targeting Sox2-Mediated Wnt Signaling and Klf4 . Hum Gene Ther, 2019. 30(11): p. 1405–1418. Hong, L., et al., MicroRNA-200c Represses IL-6, IL-8, and CCL-5 Expression and Enhances Osteogenic Differentiation . PLoS One, 2016. 11(8): p. e0160915. Yin, G., et al., Cloning, characterization and subcellular localization of a gene encoding a human Ubiquitin-conjugating enzyme (E2) homologous to the Arabidopsis thaliana UBC-16 gene product . Front Biosci, 2006. 11: p. 1500–7. Liu, W., et al., The Ubiquitin Conjugating Enzyme: An Important Ubiquitin Transfer Platform in Ubiquitin-Proteasome System . Int J Mol Sci, 2020. 21(8). Wang, S., et al., UBE2W Improves the Experimental Colitis by Inhibiting the NF-κB Signaling Pathway . Dig Dis Sci, 2022. 67(12): p. 5529–5539. Ivona, A. and Q. Zhou, NF-κB Pathway in Autoinflammatory Diseases: Dysregulation of Protein Modifications by Ubiquitin Defines a New Category of Autoinflammatory Diseases . Frontiers in Immunology, 2017. 8: p. 399-. Lehman, H.L., et al., NFkB hyperactivation causes invasion of esophageal squamous cell carcinoma with EGFR overexpression and p120-catenin down-regulation . Oncotarget, 2018. 9(13): p. 11180–11196. Yuan, S., C. Zhang, and B. Wang, Neohesperidin promotes the proliferation and osteogenic differentiation of BMSCs via BMP2-Wnt/β-catenin pathway . Cell Cycle, 2022. 21(2): p. 187–201. Yaghoobi, M., et al., Osteogenic induction of human mesenchymal stem cells in multilayered electrospun scaffolds at different flow rates and configurations in a perfusion bioreactor . J Biosci Bioeng, 2019. 128(4): p. 495–503. Adibkia, K., et al., Silver nanoparticles induce the cardiomyogenic differentiation of bone marrow derived mesenchymal stem cells via telomere length extension . Beilstein J Nanotechnol, 2021. 12: p. 786–797. Li, X., et al., Potential Roles of Bone Morphogenetic Protein 9 in the Odontogenic Differentiation of Dental Pulp Cells . J Endod, 2021. 47(3): p. 436–443. Lin, D.L., H.C. Chang, and S.H. Huang, Characterization of allegedly musk-containing medicinal products in Taiwan . J Forensic Sci, 2004. 49(6): p. 1187–93. Wu, Q., et al., Protective effects of muscone on ischemia-reperfusion injury in cardiac myocytes . J Ethnopharmacol, 2011. 138(1): p. 34–9. Liu, P., et al., Administration of BMSCs with muscone in rats with gentamicin-induced AKI improves their therapeutic efficacy . PLoS One, 2014. 9(5): p. e97123. Xie, X.W., F.W. Hou, and N. Li, [Effects of musk ketone at different concentrations on in vivo migration of exogenous rat bone marrow mesenchymal stem cells]. Zhongguo Zhong Xi Yi Jie He Za Zhi, 2012. 32(7): p. 980-5. Xia, P., et al., MicroRNA-200c promotes osteogenic differentiation of human bone mesenchymal stem cells through activating the AKT/beta-Catenin signaling pathway via downregulating Myd88 . J Cell Physiol, 2019. 234(12): p. 22675–22686. Wang, S., et al., [UBE2W overexpression promotes proliferation of intestinal mucosal cells in mice with chemically induced colitis]. Nan Fang Yi Ke Da Xue Xue Bao, 2023. 43(12): p. 2023–2028. Wang, S., et al., UBE2W Improves the Experimental Colitis by Inhibiting the NF-kappaB Signaling Pathway . Dig Dis Sci, 2022. 67(12): p. 5529–5539. Wang, B., et al., Loss of the Ubiquitin-conjugating Enzyme UBE2W Results in Susceptibility to Early Postnatal Lethality and Defects in Skin, Immune, and Male Reproductive Systems . J Biol Chem, 2016. 291(6): p. 3030–42. Yuan, Y., et al., Prognostic value of ubiquitin E2 UBE2W and its correlation with tumor-infiltrating immune cells in breast cancer . BMC Cancer, 2021. 21(1): p. 479. Lei, B., et al., UBE2W down-regulation promotes cell apoptosis and correlates with hypospermatogenesis . Andrologia, 2020. 52(1): p. e13474. Zhao, B., et al., Identification of Key Modules and Genes Associated with Major Depressive Disorder in Adolescents . Genes (Basel), 2022. 13(3). Ma, C., et al., microRNA-200c overexpression inhibits chemoresistance, invasion and colony formation of human pancreatic cancer stem cells . International Journal of Clinical & Experimental Pathology, 2014. 8(6): p. 6533. Radisky, D.C., miR-200c at the nexus of epithelial-mesenchymal transition, resistance to apoptosis, and the breast cancer stem cell phenotype . Breast Cancer Research, 2011. 13(3): p. 1–2. Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif Fig. S1. UBE2W knockdown affects the biological function of BMSCs. (A) Proliferation of BMSCs transfected with UBE2W knockdown detected by CCK8 assay. (B) The UBE2W knockdown experiment Western blot results. The grayscale analysis of the western blot results. (C) Osteogenic differentiation was detected by alizarin red staining. (D) The Following flow cytometry procedure detect cell apoptosis rate. Data are presented as mean ± SD. Ns means statistically insignificant; *P<0.05, **P<0.01, ***P<0.001. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 06 May, 2025 Reviewers agreed at journal 30 Apr, 2025 Reviews received at journal 22 Apr, 2025 Reviewers agreed at journal 22 Apr, 2025 Reviewers invited by journal 21 Apr, 2025 Submission checks completed at journal 09 Apr, 2025 First submitted to journal 02 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5578006\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":445692792,\"identity\":\"8ac09f97-aa8b-440c-8569-cdee3cf0c770\",\"order_by\":0,\"name\":\"JiLiang Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"JiLiang\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":445692793,\"identity\":\"2f988479-3bbf-4ea3-bfcd-f0338839313b\",\"order_by\":1,\"name\":\"LiXin Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"LiXin\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":445692794,\"identity\":\"f74781c6-b0c2-4642-96f8-b25d5f3f62d3\",\"order_by\":2,\"name\":\"Feng Gao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Feng\",\"middleName\":\"\",\"lastName\":\"Gao\",\"suffix\":\"\"},{\"id\":445692795,\"identity\":\"a7ad7b29-0a22-45b0-be61-eb383834e3a2\",\"order_by\":3,\"name\":\"HongBo Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"HongBo\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":445692796,\"identity\":\"e79fa668-b8de-424c-9971-de8f8ed29d61\",\"order_by\":4,\"name\":\"YongSheng Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"YongSheng\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":445692797,\"identity\":\"517cac1c-6f8c-4543-bc4d-abc6f8e15b05\",\"order_by\":5,\"name\":\"ZeHeng Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"ZeHeng\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":445692798,\"identity\":\"8b339081-f59d-4991-bf03-fc92b932ac75\",\"order_by\":6,\"name\":\"Le Xu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Affiliated Hospital of Inner Mongolia Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Le\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":445692801,\"identity\":\"00b9c160-687b-45a3-9990-fdf7b02011fe\",\"order_by\":7,\"name\":\"Yuan Liu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYJCCA4l//vGwsTc2PvxApA7GAx8bDsjx8RxuNpYgUgvzwZkNB4zlJNLbBHiIUS/f3v7gMO+OO4ltkg/bGCQY7OR0GwhoMThzxuAw75lniW3SiW0PChiSjc0OENIikcNwmIeNGaSl3UACGBTbCGmRn5H+AKJF8mCbBA8xWhhuJBgcnNl22JhNgpFILSC/HPhwJk2OjScRGMgGRPgFGGKPPyRU2PDItx9/+PBDhZ0cQS3olpKmfBSMglEwCkYBDgAAw2VIA1Ksru0AAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yuan\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-12-04 08:40:29\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5578006/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5578006/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":81507933,\"identity\":\"d7620a67-c31a-454b-9771-cfdf712d9a6a\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 05:37:27\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5343992,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMuscone increases cell viability and promotes osteogenic differentiation.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBMSCs were treated with muscone at concentrations of 10 μM, 20 μM and 40 μM. (A) Cells were cultured for 5 consecutive days for CCK-8 staining respectively, and the results were observed by OD450 absorbance. \\u0026nbsp;(B) The protein expression of RUNX2, MMP3, MMP9, and OCN was detected by western blot in BMSCs treatment with muscone. (E) Alkaline phosphatase staining was used to detect osteoblast differentiation after treated with muscone.\\u003c/p\\u003e\\n\\u003cp\\u003eData are presented as mean ± SD. Ns means statistically insignificant; *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5578006/v1/f55e389ea45d1efda252b89f.png\"},{\"id\":81507932,\"identity\":\"db8e40e0-2f80-4211-893e-14235dd3cac4\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 05:37:27\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4996698,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMuscone enhances the viability and osteogenic differentiation of BMSCs by increasing the expression of miR-200c.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBMSCs were treated with muscone or miR-200c inhibitor. (A) The miR-200c mRNA level conducted on BMSCs cultured in the presence of Muscone at concentrations of 10 μM, 20 μM, and 40 μM. (B) The miR-200c mRNA level was detected by western blot in BMSCs. (C) Cells were cultured for 5 consecutive days for CCK-8 staining respectively, and the results were observed by OD450 absorbance. (D) The protein expression of RUNX2, MMP3, MMP9, and OCN was detected by western blot in BMSCs. (E) Alkaline phosphatase staining was used to detect osteoblast differentiation.\\u003c/p\\u003e\\n\\u003cp\\u003eData are presented as mean ± SD. Ns means statistically insignificant; *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5578006/v1/3c8bb106bb12768d305c8616.png\"},{\"id\":81507934,\"identity\":\"047d43ab-cc6b-4b61-8349-e44b37480f2d\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 05:37:27\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":462744,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUBE2W is a target of miR-200c. \\u003cstrong\\u003e(A) \\u003c/strong\\u003eThe Target Scan Human database prediction results (top).In the experiment of co-transfection of miR-200c and UBE2W cell luciferase detection plasmids in BMSCs, wild-type or mutant was used to evaluate the relative activity of the luciferase reporter (bottom)\\u003cstrong\\u003e.\\u003c/strong\\u003e \\u003cstrong\\u003e(B)\\u003c/strong\\u003e The UBE2W mRNA level conducted on BMSCs cultured in the presence of Muscone at concentrations of 10 μM, 20 μM, and 40 μM.\\u003c/p\\u003e\\n\\u003cp\\u003eData are presented as mean ± SD. *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5578006/v1/64a493be18760fb0874a836a.png\"},{\"id\":81507937,\"identity\":\"637c5650-eb63-443f-99c6-9737b2154821\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 05:37:27\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":899523,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003emiR-200c may influence BMSCs' viability, expression of osteogenic genes and osteogenic differentiation by regulating UBE2W expression. \\u003cstrong\\u003e(A-B)\\u003c/strong\\u003e Detection of miR-200cand UBE2W mRNA levels in BMSCs transfected with miR-200cor co-transfected with miR-200c+ UBE2W. Relative expression of miR-200c mRNA in BMSCs transfected with miR-200cor co-transfected with miR-200c+ UBE2W.The mRNA expression of UBE2W and miR-200c in Muscone‑exposed BMSCs. \\u0026nbsp;\\u003cstrong\\u003e(C)\\u003c/strong\\u003e Proliferation of BMSCs transfected with UBE2W knockdown detected by CCK8 assay. \\u003cstrong\\u003e(D)\\u003c/strong\\u003e Theresults of western blot in miR-200c and UBE2W overexpressed test.\\u003c/p\\u003e\\n\\u003cp\\u003eData are presented as mean ± SD. Ns means statistically insignificant; *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5578006/v1/da44733d992242710883fda7.png\"},{\"id\":81510126,\"identity\":\"6aead792-e7a4-4c82-abc1-e90f1ef3f502\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 06:04:24\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":12528342,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5578006/v1/fa48ffea-fe80-466a-b19e-ed7b32decd19.pdf\"},{\"id\":81509104,\"identity\":\"8c72b34f-254b-47f6-92a7-0c5b38b139da\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 05:45:27\",\"extension\":\"tif\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":887916,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFig. S1. UBE2W knockdown affects the biological function of BMSCs.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Proliferation of BMSCs transfected with UBE2W knockdown detected by CCK8 assay. (B) The UBE2W knockdown experiment Western blot results. The grayscale analysis of the western blot results. (C) Osteogenic differentiation was detected by alizarin red staining. (D) The Following flow cytometry procedure detect cell apoptosis rate.\\u003c/p\\u003e\\n\\u003cp\\u003eData are presented as mean ± SD. Ns means statistically insignificant; *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS1.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5578006/v1/3b9bf38f1f170c0b97f31e18.tif\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Muscone regulates microRNA-200c /UBE2W axis to promote osteogenic differentiation of bone marrow mesenchymal stem Cells\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eBone marrow mesenchymal stem cells (BMSCs) are primitive cells [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e] with multipotent differentiation potential, capable of differentiating into adipocytes, chondrocytes, osteoblasts, bone cells, etc. Promoting osteogenic differentiation of BMSCs represents a potent strategy for enhancing bone tissue engineering and improving bone degenerative diseases [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Konarski et al [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e] indicate that the proliferation of BMSCs is impaired in bone diseases. Therefore, a deeper understanding of the mechanisms underlying BMSC proliferation and differentiation will provide a foundation for further research on the pathogenesis of bone degenerative diseases [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eMusk, a traditional Chinese medicine promotes blood circulation for bone degenerative conditions such as osteoporosis, knee osteoarthritis, and lumbar disc herniation, has a rich history of clinical application in orthopedic ailments [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Muscone, the main active component of natural musk, exhibits similar pharmacological effects and chemical action as musk [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Several studies have demonstrated that muscone promotes osteogenic differentiation of human gingival mesenchymal stem cells by inhibiting the Wnt/β-catenin signaling pathway [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Furthermore, muscone can reverse ethanol-suppressed osteogenic differentiation in hBMSCs, suggesting a protective effect against alcohol-induced osteonecrosis of the femoral head [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. These collective findings indicate that muscone possesses significant potential to enhance osteogenic differentiation in stem cells. However, the molecular mechanisms underlying muscone's effects require further in-depth investigation.\\u003c/p\\u003e \\u003cp\\u003eMicroRNAs are small RNA molecules that exist on non-coding single strands. Their function is to act on the 3'-UTR region of target genes, regulating cellular physiological and pathological processes, and participating in the differentiation and proliferation regulation of BMSCs [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. MiR-200c belongs to miRNA and as a member of the miR-200 family, the miR-200c gene cluster is located on chromosome 12p13.31[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. An increasing number of studies have demonstrated that miR-200c has strong physiological functions. For example, the overexpression of miR-200c can inhibit the proliferation, invasion, and migration of cancer cells, suggesting that miR-200c may exert a suppressive effect on cancer cell proliferation and invasion [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. In addition to its anticancer effects, miR-200c has been demonstrated to promote osteogenic differentiation. As reported by Adil Akkouch et al., miR-200c plasmid DNA (pDNA) significantly enhanced bone formation and regeneration in a rat calvarial defect model [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Furthermore, microRNA-200c facilitated osteogenesis by suppressing IL-6, IL-8, and CCL-5 expression while simultaneously enhancing osteogenic differentiation [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Collectively, these findings strongly suggest that miR-200c may serve as a unique osteoinductive agent for bone healing and regeneration.\\u003c/p\\u003e \\u003cp\\u003eThe ubiquitin conjugating enzyme are recognized as target genes of microRNAs in cells. The ubiquitin conjugating enzyme 2W (UBE2W) is a novel ubiquitin-conjugating enzyme [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e] that catalyzes the process of ubiquitination and is expressed in both human and murine tissues [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Previous studies have shown that UBE2W is involved in the regulation of nuclear factor-κB (NF-κB) transcriptional activity [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. The NF-κB pathway, as an important signaling hub, plays a crucial role in multiple biological effects including inflammatory and immune responses, as well as cell proliferation and apoptosis [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Our preliminary bioinformatics analysis predicted UBE2W as a downstream target gene of miR-200c. However, the role of UBE2W in osteogenic differentiation remains unreported and requires further experimental validation to elucidate its functional involvement in this process.\\u003c/p\\u003e \\u003cp\\u003eConsidering the unique pathogenesis of bone degenerative diseases, we propose the following hypothesis: Muscone may regulate the activity of miR-200c, affecting the function of UBE2W, thereby modulating the complex ubiquitination process in mesenchymal stem cells, particularly in protein synthesis. In this process, UBE2W plays a crucial role in shaping the spatial conformation of proteins. Through this modulation, we aim to enhance the synthesis of extracellular matrix(ECM)proteins in BMSCs, leading to the improvement of compromised bone tissue. Additionally, this modulation will help suppress the apoptotic tendencies of BMSC triggered by inflammatory stimuli and promote cellular regeneration, ultimately impeding the insidious progression of bone degenerative diseases.\\u003c/p\\u003e \\u003cp\\u003eThis study systematically investigated the osteogenic properties of muscone in BMSCs and its underlying molecular mechanisms. Our findings demonstrate that muscone significantly accelerated osteogenic differentiation of BMSCs by modulating the miR-200c/UBE2W axis, thereby promoting the regeneration of damaged bone tissue. These results suggest muscone's potential as a novel therapeutic agent for osteoporosis and skeletal aging. Furthermore, the miR-200c/UBE2W axis emerges as a promising therapeutic target for enhancing osteogenic differentiation.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture and treatment\\u003c/h2\\u003e \\u003cp\\u003eA rat BMSCs cell line (SCIENCELL, USA) was cultivated in Dulbecco's modified Eagle's medium (DMEM; GIBCO, USA) supplemented with 10% fetal bovine serum (FBS; GIBCO, USA), as well as 100 IU/mL of penicillin, 100 \\u0026micro;g/mL of streptomycin, and 2 mM of glutamine. The cells were incubated in a controlled environment of 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. Following a previously reported protocol, cells were seeded at a density of 3\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells/cm\\u003csup\\u003e2\\u003c/sup\\u003e containing complete DMEM supplemented with β-glycerol phosphate and ascorbic acid (Sigma-Aldrich, USA). After 72 h incubation, the complete DMEM was replaced with fresh DMEM devoid of FBS, and the cells were further incubated for an additional 24 h. Multiple experiments were conducted following the procedures described below.\\u003c/p\\u003e \\u003cp\\u003eBMSCs were cultured in osteogenic induction medium (OIM) containing 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;8\\u003c/sup\\u003e mol/L dexamethasone, 50 mM l-ascorbyl-2-phosphate and 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;2\\u003c/sup\\u003e mol/L β-glycerophosphate [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Cells were treated with different concentrations (10 \\u0026micro;M, 20 \\u0026micro;M and 40 \\u0026micro;M) of Muscone (Cat: PHL89737; Sigma-Aldrich, USA). To observe the effect of Muscone on osteogenic differentiation of BMSCs, the cells were divided into the following four groups: control group (cultured with PBS and OIM); high and medium-low dose Muscone group (cultured with 10, 20 or 40 \\u0026micro;M Muscone and OIM). After 14 days of culture, osteogenic gene expression and Alkaline phosphatase were detected. For the inhibitor-treated rescue experiment, cells were first pretreated with inhibitors for 48 hours, followed by treatment of successfully transfected cells with OIM and 40 \\u0026micro;M Muscone for 14 days.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eLuciferase assays\\u003c/h3\\u003e\\n\\u003cp\\u003eThe psiCHECK-2 reporter plasmid was transfected into cells using Lipofectamine 3000 (Cat: L30000015; Invitrogen, Thermo Fisher Scientific, USA). The 3'‑UTR of UBE2W (Binding sites: WT: CAGTATTA; MUT: GTCATAAT) was amplified through PCR, following previously described methods, and subsequently inserted into the psiCHECK-2 vector (Cat: E2241; Promega, USA). BMSCs were co-transfected with either the wild-type or mutant psiCHECK-2 vector (100 ng/well), along with either the miR‑200c mimic or NC (100 ng/well). After 48 h of transfection, cell lysis was performed to measure luciferase activity using the Dual Luciferase Reporter Assay System, with luciferase activity serving as the normalization factor.\\u003c/p\\u003e\\n\\u003ch3\\u003eTransfection and lentiviral transduction\\u003c/h3\\u003e\\n\\u003cp\\u003eA total of 1 \\u0026micro;g plasmid (100 nM miRNA mimic or 00 nM miRNA inhibitor) was diluted in 50 \\u0026micro;L serum-free Opti-MEM. The plasmid was gently mixed and incubated at room temperature for 5 min. Lipo3000 was diluted in 50 \\u0026micro;L serum-free Opti-MEM, mixed gently, and incubated at room temperature for 5 min. The miR-200c mimic, miR-200c inhibitor and lipo3000 were combined and left at room temperature for 20 min before transfection into the cells. Subsequent luciferase assay was conducted 48 h post-transfection.\\u003c/p\\u003e \\u003cp\\u003eLentiviral transduction was employed in subsequent experiments, including alkaline phosphatase staining and mRNA and protein expression analysis of UBE2W. The supernatant of the 293T cells was collected by centrifugation at 1,000 g for 4 h at 4˚C, then transferred to a syringe and filtered using a 0.45 \\u0026micro;m filter. The plasmid was mixed with 1.5 mL serum-free α-MEM medium and left at room temperature for 20 min before transfection. The plasmid ratio used was 8 \\u0026micro;g LV2 shuttle plasmid, 8 \\u0026micro;g pGag/Pol, 4 \\u0026micro;g pRev, and 6 \\u0026micro;g PVSV-G. 300 \\u0026micro;L of liposome was mixed with 1.2 mL of serum-free medium and left at room temperature for 5 min. The plasmid and liposome were then mixed and left at room temperature for 20 min. This mixture was added to the 293T cell culture medium. After 6 h of incubation, the medium was removed, and serum-containing medium was added. The supernatant was collected after 72 h of culture at 37˚C. The collected supernatant was centrifuged at 23,000 g for 4 h at 4˚C. The plates were gently shaken and then placed back into the incubator for culture. Positive cells were screened using 0.5 \\u0026micro;g/mL puromycin and maintained at a concentration of 2 \\u0026micro;g/mL. After 6 h of cell culture, the virus-containing medium was replaced with fresh medium, and the cells were cultured for an additional 72 h before subsequent experiments, including cell proliferation assays and mRNA analysis.\\u003c/p\\u003e\\n\\u003ch3\\u003eRT‑qPCR\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from cells using TRIzol\\u0026reg; (Invitrogen; Thermo Fisher Scientific, Inc, USA) following the manufacturer's instructions. Subsequently, cDNA was synthesized using the Prime Script RT Reagent kit at 42˚C for 60 min, followed by incubation at 70˚C for 10 min (Takara Biotechnology Co., Ltd., Japen). Quantitative PCR (qPCR) was performed using SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd., Japen) on an ABI StepOne Plus Real‑Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc., USA). The thermocycling protocol included an initial denaturation step at 95˚C for 5 min, followed by 40 cycles of 95˚C for 10 s and 60˚C for 34 s (35‑37). The relative mRNA levels were determined using the 2\\u003csup\\u003e‑ΔΔCt\\u003c/sup\\u003e method (38). Reverse transcription of mRNA and quantitative PCR primers were obtained from Guangzhou Ribobio Co., Ltd., USA. The experiments were conducted five times. The U6 gene was used as the reference gene for miR‑141, while GAPDH served as the reference gene for E2F3. The primers (General Biosystems) used were as follows:\\u003c/p\\u003e \\u003cp\\u003eUBE2W Forward: 5'‑GCAAGTTCAACGGCACAG‑3';\\u003c/p\\u003e \\u003cp\\u003eReverse: 5'‑ GCCAGTAGACTCCACGACAT‑3' ;\\u003c/p\\u003e \\u003cp\\u003eGAPDH Forward: 5'‑TTCACCACCATGGAGAAGGC‑3';\\u003c/p\\u003e \\u003cp\\u003eReverse: 5'‑AGTGATGGCATGGACTGTG‑3'.\\u003c/p\\u003e\\n\\u003ch3\\u003eCCK8 Assay\\u003c/h3\\u003e\\n\\u003cp\\u003eThe cell lines were cultured in complete MEM medium containing 10% fetal bovine serum and incubated at 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. When the cells reached 80\\u0026ndash;90% confluence, they were digested with trypsin and passaged at a 1:3 ratio. For cell passage, the cells were washed with PBS and digested with 1 mL of trypsin for 1\\u0026ndash;3 min. The digestion was stopped by adding 3 mL of complete medium and the cells were transferred to a 15 mL centrifuge tube, centrifuged at 1000 rpm for 5 min by a centrifuge (Cat: Micro-15R; KEWLAB, Australia), and the supernatant was discarded. The cells were then resuspended in 3 mL of medium and passaged at a 1:3 ratio in a culture dish. To perform the CCK8 assay (Cat: C0037; Beyotime Biotechnology, China), the BMSCs were digested with trypsin and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the cells were resuspended in complete medium and seeded in 96-well plates at a density of 5000 cells per well. After the cells adhered to the well surface, the medium was replaced with a mixture of CCK8 reagent and medium in a 10:90 ratio. The cells were then incubated for an additional 3 h in a cell culture incubator. After incubation, the medium was removed, and 150 \\u0026micro;L of DMSO was added to each well. The plate was gently shaken to ensure uniform mixing, and the absorbance was measured at 450 nm using a microplate reader. The absorbance values represented the cell viability, and higher values indicated greater cell vitality. The CCK8 assay was performed according to the manufacturer's instructions.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell osteogenesis induction\\u003c/h2\\u003e \\u003cp\\u003eBMSCs obtained from male Sprague Dawley rats, were cultured at a density of 1x10\\u003csup\\u003e5\\u003c/sup\\u003e cells and subsequently infected with lentivirus. The protocol for cell osteogenesis induction followed the methodology previously described by Yaghoobi et al[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Upon reaching 80\\u0026ndash;90% confluence, BMSCs were enzymatically dissociated using trypsin (HyClone; Cytiva, USA), followed by centrifugation at 100 xg for 5 min at room temperature. The supernatant was carefully aspirated, and the BMSCs were resuspended in α-MEM (HyClone; Cytiva, USA) and plated onto a 24-well culture plate. The cells were allowed to grow until they reached 70% confluence, at which point the culture medium was replaced with osteogenic induction medium. The medium was subsequently refreshed every 3 days. The levels of osteogenesis were evaluated on days 3, 7, and 14 using alkaline phosphatase staining [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Images were captured and stored for subsequent alkaline phosphatase assay.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eAlkaline phosphatase staining\\u003c/h3\\u003e\\n\\u003cp\\u003eA total of 1\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells were seeded into each well of 24‑well plates. The cells were cultured until reaching 60‑70% confluence, following which the culture medium was substituted with osteogenic induction culture medium. The osteogenic medium was refreshed every 3 days, and upon completion of the osteogenic induction process, the cells were washed with phosphate-buffered saline (PBS). On days 3, 7, and 14, the BMSCs were fixed with a 10% formaldehyde solution at room temperature for 30 min, followed by two washes with PBS. Subsequently, the fixed cells were stained with 50 \\u0026micro;L of alkaline phosphatase solution at 37˚C for 2 h[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e].\\u003c/p\\u003e\\n\\u003ch3\\u003eFlow cytometry detects cell apoptosis\\u003c/h3\\u003e\\n\\u003cp\\u003eWhen the cell confluence reached 70%, apoptosis was induced by drug treatment. For adherent cells, both the cells in the supernatant and the collected cells were harvested. The cells in the supernatant were collected in the same 7 mL centrifuge tube after being detached using trypsin digestion and resuspended in complete culture medium. To ensure an adequate number of cells (\\u0026ge;\\u0026thinsp;5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells/treatment), three replicate wells were set for each group. For suspension cells, they were directly collected. After centrifugation at 1300 rpm for 5 min, the supernatant was discarded. The cell pellet was washed once with PBS and centrifuged again at 1300 rpm for 5 min. The cells were collected and then washed once with 1\\u0026times; binding buffer followed by another centrifugation at 1300 rpm for 5 min. The cells were collected again. The cell pellet was resuspended in 0.1-1 mL of 1\\u0026times; cell staining buffer to achieve a final cell density of 1 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e to 1 x 10\\u003csup\\u003e7\\u003c/sup\\u003e cells/mL. Then, 100 \\u0026micro;L of the cell suspension (1 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e to 1 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e cells) was taken and 5 \\u0026micro;L of annexin V-APC staining (Cat: E-CK-A217; elabscience, USA) was added. The samples were stored protected from light and brought to the flow cytometry facility within 15 min. After centrifugation at 1300 rpm for 5 min to remove the supernatant, the cells were resuspended in 100 \\u0026micro;L of 1\\u0026times; binding buffer. Subsequently, 5 \\u0026micro;L of PI (diluted 10 times with 40\\u0026times; PI staining solution) was added, and the cell staining buffer was supplemented to a final volume of 300 \\u0026micro;L for flow cytometry analysis. This flow cytometry procedure allowed for the detection of cell apoptosis and was conducted according to established protocols.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eEach experiment was conducted by performing each experiment three times, and the results are presented as the mean value\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation GraphPad Prism 8 software was used to analyze the data statistically. The unpaired Student's t test was utilized to compare the differences between two groups, whereas one-way analysis of variance followed by Tukey's post hoc test was performed to compare the differences between three or more groups. A significance level of P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered to indicate a statistically significant difference.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eMuscone increases cell viability and promotes osteogenic differentiation.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe aimed to explore whether muscone might exert an effect on BMSCs viability. The effect of muscone on the viability of BMSCs was examined using the CCK8 assay. The results showed that the cell viability of BMSCs was gradually increased in the presence of muscone at concentrations of 10 \\u0026micro;M, 20 \\u0026micro;M and 40 \\u0026micro;M (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). In addition, extracellular matrix proteins and osteogenic markers were analyzed by Western blot. The results revealed that muscone upregulated the protein expression of RUNX2, MMP3, MMP9, and OCN in a concentration-dependent manner (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). ALP staining further confirmed that muscone promoted osteogenic differentiation of BMSCs (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Collectively, these findings demonstrate that muscone enhanced BMSC viability and osteogenic capacity dose-dependently.\\u003c/p\\u003e\\n\\u003cp\\u003eBMSCs were treated with muscone at concentrations of 10 \\u0026micro;M, 20 \\u0026micro;M and 40 \\u0026micro;M. (A) Cells were cultured for 5 consecutive days for CCK-8 staining respectively, and the results were observed by OD450 absorbance. (B) The protein expression of RUNX2, MMP3, MMP9, and OCN was detected by western blot in BMSCs treatment with muscone. (E) Alkaline phosphatase staining was used to detect osteoblast differentiation after treated with muscone.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMuscone enhances the viability and osteogenic differentiation of BMSCs by increasing the expression of miR-200c.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study also investigates the molecular mechanisms associated with muscone. To achieve this, BMSCs were exposed to muscone at final concentrations of 10, 20, and 40 \\u0026micro;M. Subsequently, an RT-PCR assay was conducted to measure mRNA levels. The results of the RT-PCR indicated that the mRNA level of miR-200c significantly increased with higher concentrations of muscone (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). The results demonstrate that Muscone enhances the expression of miR-200c. To further investigate whether Muscone\\u0026apos;s effects on osteogenic differentiation are dependent on miR-200c expression, we introduced a miR-200c inhibitor. RT-PCR results showed that the miR-200c inhibitor significantly downregulated miR-200c expression, an effect that was reversed by Muscone (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Additionally, CCK8 assays indicated that the miR-200c inhibitor significantly reduced cell viability, counteracting the upregulation of cell viability induced by Muscone (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). Furthermore, Muscone increased the expression of osteogenesis-related genes, including RUNX2, MMP3, MMP9, and OCN, and enhanced ALP staining intensity, which was also reversed by the miR-200c inhibitors (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD-E). In conclusion, these results demonstrate that the osteogenic differentiation effect of Muscone was dependent on miR-200c expression.\\u003c/p\\u003e\\n\\u003cp\\u003eBMSCs were treated with muscone or miR-200c inhibitor. (A) The miR-200c mRNA level conducted on BMSCs cultured in the presence of Muscone at concentrations of 10 \\u0026micro;M, 20 \\u0026micro;M, and 40 \\u0026micro;M. (B) The miR-200c mRNA level was detected by western blot in BMSCs. (C) Cells were cultured for 5 consecutive days for CCK-8 staining respectively, and the results were observed by OD450 absorbance. (D) The protein expression of RUNX2, MMP3, MMP9, and OCN was detected by western blot in BMSCs. (E) Alkaline phosphatase staining was used to detect osteoblast differentiation.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eUBE2W is a target of miR-200c\\u003c/h2\\u003e\\n \\u003cp\\u003eThis study demonstrated that miR-200c has a role in enhancing osteogenic differentiation; however, the molecular mechanisms involved in miR-200c are unknown. Therefore, we also explored the downstream genes regulated by miR-200c. Through Target Scan Human database prediction, we found that UBE2W might be a potential target for miR-200c (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). To investigate the regulatory relationship between UBE2W and miR-200c, we used a luciferase assay to determine whether miR-200c can directly target UBE2W expression through its UTR. In the wild-type group, the average UBE2W luciferase activity was significantly lower than that of the NC group. However, after transduction with miRNA, the average UBE2W luciferase activity of the mutant remained unchanged (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). This result demonstrated that UBE2W is a direct target of miR-200c in BMSCs. Interestingly, muscone progressively downregulated the mRNA levels of UBE2W with increasing concentration. This observation suggests that UBE2W may play a role in negatively regulating osteogenic differentiation. To confirm this hypothesis, we conducted a knockdown of UBE2W for the study. As shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eA, the knockdown of UBE2W significantly decreased cell viability after 5 days of culture (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). Additionally, the knockdown of UBE2W resulted in significantly higher protein expression levels of the osteogenic genes MMP3, MMP9, and Runx2 (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eB). Flow cytometry analysis of apoptosis, presented in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eC, indicated that in BMSCs with UBE2W knockdown, the total apoptosis rate was significantly lower than that of the control group (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). These results demonstrate that the knockdown of UBE2W enhanced the viability and osteogenic differentiation of BMSCs.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003emiR-200c may influence BMSCs\\u0026apos; viability, expression of osteogenic genes and osteogenic differentiation by regulating UBE2W expression\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003eOur study demonstrated that UBE2W is a target of miR-200c and that the knockdown of UBE2W promotes osteogenic differentiation. However, it remains unclear whether the osteogenic differentiation effect of miR-200c is mediated by the negative regulation of UBE2W expression. Accordingly, we investigated the impact of the miR-200c/UBE2W interaction on osteogenic differentiation. Constructed miR-200c plasmid and UBE2W overexpression plasmid were introduced, and the following groups were established: NC group, miR-NC group, miR-200c overexpress group, and miR-200c\\u0026thinsp;+\\u0026thinsp;UBE2W overexpress group. As shown in the results Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-B, when the miR-200c plasmid was transfected, an increase in miR-200c expression was observed (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). But when in miR-200c\\u0026thinsp;+\\u0026thinsp;UBE2W overexpression group, the miR-200c expression was significantly suppressed (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). When the miR-200c plasmid was transfected, a decrease in UBE2W expression was observed (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). But when miR-200c\\u0026thinsp;+\\u0026thinsp;UBE2W overexpression, the UBE2W expression was significantly increased (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). This suggests that miR-200c plays an important role in regulating UBE2W gene expression, and its overexpression can inhibit the expression of UBE2W, whereas the expression of miR-200c is also significantly inhibited when co-overexpressed with UBE2W, further confirming their mutual regulatory relationship (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-B). Additionally, CCK-8 experimental results showed that there was no significant difference between the NC group and the miR-NC group. Compared to the miR-NC group, the miR-200c overexpress group exhibited a significant increase of cell viability (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Furthermore, compared to the miR-200c overexpress group, the miR-200c\\u0026thinsp;+\\u0026thinsp;UBE2W overexpress group showed a significant decrease of cell viability (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). These experimental results demonstrate that muscone exerts an inhibitory effect on the cell viability of BMSCs and that miR-200c may affect the cell viability of BMSCs by regulating UBE2W expression As shown in the Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD, revealed that after introducing the constructed miR-200c plasmid and UBE2W overexpression plasmid, there were no significant differences in protein expression compared to the control group and control group after 14 days of osteogenic induction culture. However, when miR-200c was overexpressed, the protein expression level of UBE2W was significantly reduced, while the expression of osteogenic genes RUNX2 was significantly increased. And the expression of cell viability genes MMP3 and MMP9 was also increased. When both miR-200c and UBE2W were overexpressed, the expression of osteogenic genes RUNX2, MMP3, and MMP9 was significantly decreased. Figure \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD is the grayscale analysis of the Western blot results. Therefore, it can be inferred that miR-200c overexpression may have a promotional effect on skeletal cell differentiation, while co-overexpression of miR-200c and UBE2W may inhibit this process.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eMuscone is extracted from musk. Muscone is a secretion from the ventral glands of male musk and is considered to be the main active ingredient in musk[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Pengfei Liu et al. investigated that muscone enhanced the therapeutic action of BMSCs by promoting cell proliferation, secretion, and migration[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Hou Feiyi demonstrated that muscone promotes the proliferation and osteogenic differentiation of BMSCs. Some researchers found that muscone also promotes the migration of exogenous rat BMSCs in a rat model[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Nevertheless, the exact mechanism by which muscone regulates bone marrow MSCs is still not fully understood. In the current study, we observed that muscone dose-dependently enhanced BMSC viability and promoted osteogenic differentiation. However, the precise molecular mechanisms underlying muscone-mediated osteogenesis require further investigation.\\u003c/p\\u003e \\u003cp\\u003eThe miR-200c has been indicated to increase the biomarkers of osteogenic differentiation involving calcium content, alkaline-phosphatase (ALP) as well as runt related transcription factor 2 (Runx2) in hBMSCs. Peng Xia et al. discovered that overexpressed miR-200c enhanced osteoblast differentiation of hBMSCs, whereas inhibition of miR-200c reduced their osteogenic potential [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Consistent with previous studies, our findings confirm the osteogenic-promoting capacity of miR-200c. Specifically, muscone significantly upregulated miR-200c expression, while inhibition of miR-200c reduced BMSC viability and downregulated the expression of osteogenic markers (RUNX2, MMP3, MMP9, and OCN) along with ALP staining intensity. These results demonstrate that miR-200c enhanced osteogenic differentiation, and muscone promoted this process through miR-200c upregulation. To examine the molecular mechanism of miR-200c regulating osteoblast differentiation of BMSCs, we screened out potential target genes of miR-200c.The luciferase activity verified that miR-200c significantly inhibited the luciferase activity of wild-type UBE2W, but it failed to suppress luciferase activity of mutated one. This suggests that UBE2W is a target of miR-200c. In vitro cell experiments showed that muscone upregulates miR-200c and downregulates UBE2W, which is closely associated with the human body's self-repair mechanisms, highlights the importance of investigating the relationship between muscone, UBE2W, and miR-200c. To examine the relationship between miR-200c and UBE2W RNA expression, different groups of BMSCs were transfected with constructed miR-200c and UBE2W overexpression plasmids. And UBE2W were transfected with knockdown plasmids. The results of the experiment found that a negative feedback relationship between miR-200c and UBE2W. When miR-200c was overexpressed, our data showed a significant increase in cell viability and expression levels of the osteogenic genes RUNX2, MMP3, and MMP9. In contrast, cell viability and expression levels of RUNX2, MMP3, and MMP9 were significantly reduced when UBE2W was overexpressed. These results consistent with the negative feedback regulatory mechanism.\\u003c/p\\u003e \\u003cp\\u003eUBE2W is a newly discovered ubiquitin-binding enzyme (E2) in recent years, which plays a role in ubiquitination modification[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Shaoxin Wang et.al found that UBE2W suppressed NF-κB transcriptional activity under TNFα stimulation and inhibited TNFα-induced phosphorylation of IκB and p65 in HEK293T cells and HCT116 cells[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Bo Wang et.al showed that UBE2W functions as a significant factor in mouse postnatal survival as well as in skin differentiation, G-CSF-related immune response, and male fertility. High expression of UBE2W is observed in testis and thymus tissues, indicating its critical involvement in the proper functioning of multiple organ systems [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. In addition, high expression of UBE2W may promote breast cancer tumor cell invasion and metastasis [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. The down-regulation of UBE2W can promote apoptosis and spermatogenesis [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e] and may be involved as a key gene in the molecular regulation of major depressive disorder in adolescence [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. However, the correlation between UBE2W and degenerative bone disease is not fully understood. This study also investigated the role of UBE2W in osteogenesis. UBE2W knockdown significantly enhanced cell viability and upregulated osteogenic marker expression. Flow cytometric analysis further revealed reduced overall apoptosis rates following UBE2W silencing. These results provide the first evidence that UBE2W exerts negative feedback regulation on osteogenic differentiation in BMSCs, identifying it as a potential therapeutic target for bone formation.\\u003c/p\\u003e \\u003cp\\u003eTherefore, regulating miR-200c expression can become a new idea for the prevention and treatment of osteoporosis. Another study has shown that overexpressed miR-200c can inhibits chemoresistance, invasion and colony formation of cancer stem cells [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Moreover, miR-200c has a significant relationship with the epithelial-mesenchymal transition, anti-apoptosis, and cancer stem cell phenotype [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. Modulating miR-200c expression may be a new approach to prevent and treat bone degenerative diseases. During the cellular pathological process, various signals can affect the regulation of cells, which can influence the healing and progression of diseases. Among them, microRNA has been extensively studied because of its unique features of producing no transcriptional proteins but having a significant impact on cytokine regulation. Therefore, it is crucial for gene expression in other cellular processes. UBE2W functions as a negative feedback regulator in conjunction with miR-200c, affects ubiquitination in cellular protein production, which can have far-reaching effects on protein activity, osteogenic differentiation, and cell autophagy. Based on the results of this experiment, our research group hypothesis posits that muscone, through indirect means, can elevate the expression level of miR-200c, thereby exerting an influence on crucial cellular processes including osteogenic differentiation, cell viability, and autophagy by modulating the activity of UBE2W. UBE2W was identified as a molecular and biological target gene of miR-200c. These data suggest that miR-200c may serve as a new therapeutic target for degenerative bone diseases. Further research on muscone, miR-200c and UBE2W will shed light on the signal regulation of BMSCs and other cells in pathological process of bone degenerative diseases.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe present study was performed at the Inner Mongolia Autonomous Region Hospital of Traditional Chinese Medicine. All the animal experiment procedures performed in this research were approved by Ethical Review Committee of Traditional Chinese Medicine Hospital of Inner Mongolia Autonomous Region, which is under international guidelines for animal experiments.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets during and/or analysed during the current study available from\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ethe corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors' contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJL.W, L.X and Y.L contributed to the Conception and design, writing the article and critical revision of the article. LX.Z, F.G, HB.W and YS.Y contributed to the Statistical analysis. ZH.L and JL.W contributed to data collection. Y.L and YS.Y \\u0026nbsp;Obtained funding, finished the critical revision, and approved the final manuscript. All authors commented on previous versions.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was supported by the Natural Science Foundation of Inner Mongolia Autonomous Region (grant NO. 2023SHZR2129).\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was supported by the Inner Mongolia Autonomous Region Hospital of traditional Chinese medicine project (grant NO. 2022Z-A010).\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was supported by the Inner Mongolia Autonomous Region Hospital of traditional Chinese medicine project (grant NO. 2023Z-A002).\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was supported by the Inner Mongolia Medical University Joint Project Fund (grant NO. YKD2024LH006).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi, M., et al., \\u003cem\\u003eGenistein mitigates senescence of bone marrow mesenchymal stem cells via ERRα-mediated mitochondrial biogenesis and mitophagy in ovariectomized rats\\u003c/em\\u003e. Redox Biol, 2023. 61: p. 102649.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYi, C., et al., \\u003cem\\u003eGold nanoparticles promote osteogenic differentiation of mesenchymal stem cells through p38 MAPK pathway\\u003c/em\\u003e. ACS Nano, 2010. 4(11): p. 6439\\u0026ndash;48.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKonarski, W., et al., \\u003cem\\u003eAvascular Necrosis of Femoral Head-Overview and Current State of the Art\\u003c/em\\u003e. Int J Environ Res Public Health, 2022. 19(12).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOuyang, Z., et al., \\u003cem\\u003eDEPTOR exacerbates bone-fat imbalance in osteoporosis by transcriptionally modulating BMSC differentiation\\u003c/em\\u003e. Biomed Pharmacother, 2022. 151: p. 113164.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhai, X., et al., \\u003cem\\u003eMuscone Ameliorates Ovariectomy-Induced Bone Loss and Receptor Activator of Nuclear Factor-κb Ligand-Induced Osteoclastogenesis by Suppressing TNF Receptor-Associated Factor 6-Mediated Signaling Pathways\\u003c/em\\u003e. Front Pharmacol, 2020. 11: p. 348.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHe, M.C., et al., \\u003cem\\u003eMuscone Ameliorates LPS-Induced Depressive-Like Behaviors and Inhibits Neuroinflammation in Prefrontal Cortex of Mice\\u003c/em\\u003e. Am J Chin Med, 2020. 48(3): p. 559\\u0026ndash;577.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYuan, W.X., et al., \\u003cem\\u003eMuscone Promotes The Adipogenic Differentiation Of Human Gingival Mesenchymal Stem Cells By Inhibiting The Wnt/β-Catenin Signaling Pathway\\u003c/em\\u003e. Drug Des Devel Ther, 2019. 13: p. 3291\\u0026ndash;3306.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuo, Y.J., et al., \\u003cem\\u003eMuscone exerts protective roles on alcohol-induced osteonecrosis of the femoral head\\u003c/em\\u003e. Biomed Pharmacother, 2018. 97: p. 825\\u0026ndash;832.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFarazi, T.A., et al., \\u003cem\\u003emiRNAs in human cancer\\u003c/em\\u003e. Journal of Pathology, 2015. 223(2): p. 102\\u0026ndash;115.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi, C., et al., \\u003cem\\u003eGlucocorticoid inhibits cell proliferation in differentiating osteoblasts by microRNA-199a targeting of WNT signaling\\u003c/em\\u003e. Journal of Molecular Endocrinology, 2015. 54(3): p. 325\\u0026ndash;337.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKim, J., et al., \\u003cem\\u003eTMPRSS2-ERG gene fusions induce prostate tumorigenesis by modulating microRNA miR-200c\\u003c/em\\u003e. Oncogene, 2014. 33(44): p. 5183\\u0026ndash;92.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAnastasiadou, E., et al., \\u003cem\\u003eMiR-200c-3p Contrasts PD-L1 Induction by Combinatorial Therapies and Slows Proliferation of Epithelial Ovarian Cancer through Downregulation of β-Catenin and c-Myc\\u003c/em\\u003e. Cells, 2021. 10(3).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAkkouch, A., et al., \\u003cem\\u003eEnhancement of MicroRNA-200c on Osteogenic Differentiation and Bone Regeneration by Targeting Sox2-Mediated Wnt Signaling and Klf4\\u003c/em\\u003e. Hum Gene Ther, 2019. 30(11): p. 1405\\u0026ndash;1418.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHong, L., et al., \\u003cem\\u003eMicroRNA-200c Represses IL-6, IL-8, and CCL-5 Expression and Enhances Osteogenic Differentiation\\u003c/em\\u003e. PLoS One, 2016. 11(8): p. e0160915.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYin, G., et al., \\u003cem\\u003eCloning, characterization and subcellular localization of a gene encoding a human Ubiquitin-conjugating enzyme (E2) homologous to the Arabidopsis thaliana UBC-16 gene product\\u003c/em\\u003e. Front Biosci, 2006. 11: p. 1500\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, W., et al., \\u003cem\\u003eThe Ubiquitin Conjugating Enzyme: An Important Ubiquitin Transfer Platform in Ubiquitin-Proteasome System\\u003c/em\\u003e. Int J Mol Sci, 2020. 21(8).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, S., et al., \\u003cem\\u003eUBE2W Improves the Experimental Colitis by Inhibiting the NF-κB Signaling Pathway\\u003c/em\\u003e. Dig Dis Sci, 2022. 67(12): p. 5529\\u0026ndash;5539.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIvona, A. and Q. Zhou, \\u003cem\\u003eNF-κB Pathway in Autoinflammatory Diseases: Dysregulation of Protein Modifications by Ubiquitin Defines a New Category of Autoinflammatory Diseases\\u003c/em\\u003e. Frontiers in Immunology, 2017. 8: p. 399-.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLehman, H.L., et al., \\u003cem\\u003eNFkB hyperactivation causes invasion of esophageal squamous cell carcinoma with EGFR overexpression and p120-catenin down-regulation\\u003c/em\\u003e. Oncotarget, 2018. 9(13): p. 11180\\u0026ndash;11196.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYuan, S., C. Zhang, and B. Wang, \\u003cem\\u003eNeohesperidin promotes the proliferation and osteogenic differentiation of BMSCs via BMP2-Wnt/β-catenin pathway\\u003c/em\\u003e. Cell Cycle, 2022. 21(2): p. 187\\u0026ndash;201.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYaghoobi, M., et al., \\u003cem\\u003eOsteogenic induction of human mesenchymal stem cells in multilayered electrospun scaffolds at different flow rates and configurations in a perfusion bioreactor\\u003c/em\\u003e. J Biosci Bioeng, 2019. 128(4): p. 495\\u0026ndash;503.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAdibkia, K., et al., \\u003cem\\u003eSilver nanoparticles induce the cardiomyogenic differentiation of bone marrow derived mesenchymal stem cells via telomere length extension\\u003c/em\\u003e. Beilstein J Nanotechnol, 2021. 12: p. 786\\u0026ndash;797.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, X., et al., \\u003cem\\u003ePotential Roles of Bone Morphogenetic Protein 9 in the Odontogenic Differentiation of Dental Pulp Cells\\u003c/em\\u003e. J Endod, 2021. 47(3): p. 436\\u0026ndash;443.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin, D.L., H.C. Chang, and S.H. Huang, \\u003cem\\u003eCharacterization of allegedly musk-containing medicinal products in Taiwan\\u003c/em\\u003e. J Forensic Sci, 2004. 49(6): p. 1187\\u0026ndash;93.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, Q., et al., \\u003cem\\u003eProtective effects of muscone on ischemia-reperfusion injury in cardiac myocytes\\u003c/em\\u003e. J Ethnopharmacol, 2011. 138(1): p. 34\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, P., et al., \\u003cem\\u003eAdministration of BMSCs with muscone in rats with gentamicin-induced AKI improves their therapeutic efficacy\\u003c/em\\u003e. PLoS One, 2014. 9(5): p. e97123.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie, X.W., F.W. Hou, and N. Li, \\u003cem\\u003e[Effects of musk ketone at different concentrations on in vivo migration of exogenous rat bone marrow mesenchymal stem cells].\\u003c/em\\u003e Zhongguo Zhong Xi Yi Jie He Za Zhi, 2012. 32(7): p. 980-5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXia, P., et al., \\u003cem\\u003eMicroRNA-200c promotes osteogenic differentiation of human bone mesenchymal stem cells through activating the AKT/beta-Catenin signaling pathway via downregulating Myd88\\u003c/em\\u003e. J Cell Physiol, 2019. 234(12): p. 22675\\u0026ndash;22686.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, S., et al., \\u003cem\\u003e[UBE2W overexpression promotes proliferation of intestinal mucosal cells in mice with chemically induced colitis].\\u003c/em\\u003e Nan Fang Yi Ke Da Xue Xue Bao, 2023. 43(12): p. 2023\\u0026ndash;2028.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, S., et al., \\u003cem\\u003eUBE2W Improves the Experimental Colitis by Inhibiting the NF-kappaB Signaling Pathway\\u003c/em\\u003e. Dig Dis Sci, 2022. 67(12): p. 5529\\u0026ndash;5539.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, B., et al., \\u003cem\\u003eLoss of the Ubiquitin-conjugating Enzyme UBE2W Results in Susceptibility to Early Postnatal Lethality and Defects in Skin, Immune, and Male Reproductive Systems\\u003c/em\\u003e. J Biol Chem, 2016. 291(6): p. 3030\\u0026ndash;42.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYuan, Y., et al., \\u003cem\\u003ePrognostic value of ubiquitin E2 UBE2W and its correlation with tumor-infiltrating immune cells in breast cancer\\u003c/em\\u003e. BMC Cancer, 2021. 21(1): p. 479.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLei, B., et al., \\u003cem\\u003eUBE2W down-regulation promotes cell apoptosis and correlates with hypospermatogenesis\\u003c/em\\u003e. Andrologia, 2020. 52(1): p. e13474.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao, B., et al., \\u003cem\\u003eIdentification of Key Modules and Genes Associated with Major Depressive Disorder in Adolescents\\u003c/em\\u003e. Genes (Basel), 2022. 13(3).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa, C., et al., \\u003cem\\u003emicroRNA-200c overexpression inhibits chemoresistance, invasion and colony formation of human pancreatic cancer stem cells\\u003c/em\\u003e. International Journal of Clinical \\u0026amp; Experimental Pathology, 2014. 8(6): p. 6533.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRadisky, D.C., \\u003cem\\u003emiR-200c at the nexus of epithelial-mesenchymal transition, resistance to apoptosis, and the breast cancer stem cell phenotype\\u003c/em\\u003e. Breast Cancer Research, 2011. 13(3): p. 1\\u0026ndash;2.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"discover-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"Learn more about [Discover Medicine](https://link.springer.com/journal/44337)\",\"snPcode\":\"44337\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/44337/3\",\"title\":\"Discover Medicine\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Discover Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Muscone, MicroRNA-200c, UBE2W, BMSCs, osteogenic differentiation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5578006/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5578006/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eBone marrow mesenchymal stem cells (BMSCs) in patients with degenerative bone diseases exhibit impaired in proliferation. Muscone, traditionally used in Chinese medicine for bone ailments, has anti-inflammatory properties, but its effect on bone tissue repair is still not clear. The aim of this study was to systematically investigate the osteogenic properties of muscone in BMSC and its potential molecular mechanisms.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eBMSCs were treated with high, medium, and low doses of muscone, followed by CCK-8 assay, Western blot, and ALP staining to evaluate its effects on cell viability and osteogenic differentiation. The interaction between miR-200c and UBE2W was assessed using a luciferase reporter system. To investigate the role of the miR-200c/UBE2W axis in osteogenic differentiation, BMSCs overexpressing miR-200c alone or in combination with UBE2W were established.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eMuscone enhances BMSC viability and osteogenic differentiation capacity in a dose-dependent manner. Mechanistically, muscone upregulated miR-200c expression while downregulating UBE2W levels. miR-200c directly bound to the 3'UTR of UBE2W mRNA to suppress its transcription. Collectively, these results demonstrate that muscone promoted osteogenic differentiation through activation of the miR-200c/UBE2W axis. While UBE2W knockdown was demonstrated to reduce BMSC apoptosis while accelerating osteogenic differentiation.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e \\u003cp\\u003eMuscone can elevate the expression level of miR-200c to downregulate UBE2W, thereby exerting an influence on crucial cellular processes including osteogenic differentiation.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Muscone regulates microRNA-200c /UBE2W axis to promote osteogenic differentiation of bone marrow mesenchymal stem Cells\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-28 05:37:22\",\"doi\":\"10.21203/rs.3.rs-5578006/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-05-06T04:16:15+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"67603400210223777373253514205143746496\",\"date\":\"2025-04-30T23:04:58+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-04-22T09:33:52+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"334350791264963397744172599953304575707\",\"date\":\"2025-04-22T07:59:16+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-04-21T10:05:01+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-04-09T12:16:47+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Discover Medicine\",\"date\":\"2025-04-03T02:02:40+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"discover-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"Learn more about [Discover Medicine](https://link.springer.com/journal/44337)\",\"snPcode\":\"44337\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/44337/3\",\"title\":\"Discover Medicine\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Discover Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"92c2bdb2-eaa9-46b7-8bac-19d9153d511a\",\"owner\":[],\"postedDate\":\"April 28th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-05-17T18:08:15+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-04-28 05:37:22\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5578006\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5578006\",\"identity\":\"rs-5578006\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}