{"paper_id":"456c63b3-6b25-4148-ab05-e52cf6b22ba2","body_text":"Development of In Vitro Assay for Viral Escape from Broadly Neutralizing Antibodies | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Method Article Development of In Vitro Assay for Viral Escape from Broadly Neutralizing Antibodies Teresa Murphy, Rebecca M. Lynch This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7123859/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In vitro models to study HIV-1 escape from broadly neutralizing antibodies (bNAbs) are highly important for designing in vivo bNAb combination therapy. Frequently, short-term viral escape is studied in cell lines, which do not express physiological levels of receptors or with antigenic libraries that do not allow for the observation of concurrent escape or compensatory mutations. We designed an in vitro viral escape assay to measure the ability of HIV-1 to escape from single bNAbs in a high-throughput manner. We tested the multiplicity of infection (MOI) of virus, cloned and uncloned virus stocks, and different concentrations of antibody. From these results, we developed a 56-day assay to measure escape from bNAbs by adding multiple concentrations of antibody that is gradually increased over time. In this assay, we observed both common escape mutations previously published, but also novel mutations that could be either escape or compensatory mutations. This in vitro bNAb escape assay will lead to a deeper understanding of viral escape, to better inform the design of highly effective bNAb cocktails targeting multiple conserved sites. Broadly neutralizing antibodies HIV viral escape in vitro viral escape Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The use of monoclonal antibodies (mAbs) as treatments for infectious disease is especially advantageous as they are recognized as the host’s own molecules (“self”) with low chance of anti-drug immune responses, can be engineered for long half-lives and have the ability to harness the host’s immune system for cell clearance 1 , 2 . Monoclonal antibody treatments have been pioneered as anti-virals with successful application against SARS-CoV2 and Ebola infections 3 , 4 . A major roadblock for the use of mAb treatments is the generation of escape mutations that confer resistance, making combination mAb therapy necessary for successful virus clearance 5 , 6 . One virus against which antibody treatments show promise is Human Immunodeficiency Virus-1 (HIV-1), which is highly genetically diverse 7 , 8 . The virus’s ability to efficiently escape immune responses has made cure elusive 6 , 9 . One potential cure strategy derives from the identification and characterization of broadly neutralizing antibodies (bNAbs), which can neutralize many genetic variants of HIV-1 10 . Administered bNAbs are not immune to viral escape, as demonstrated in multiple clinical trials of monotherapy infusions 11 – 13 . In order to better inform combination bNAb clinical trials, escape pathways of individual mAbs should be determined to select mAb combinations that limit virus escape. In vitro assays allow virus escape to be studied across HIV genetically diverse strains and rely upon replication-competent viruses. Previous methods to study escape in vitro include antigenic profiling, pioneered by the lab of Jesse Bloom, in which every possible amino acid change is made at each residue position and are then incubated for 24 hours with a bNAb of choice with variants still prevalent after this selection period being resistant 14 , 15 . Drawbacks to this approach are the limited number of virus libraries used and that only single changes can be studied. Another traditional method for observing resistance mutations is utilizing a cell line, such as HEK-293T cells and passaging repeatedly in the presence of increasing plasma or polyclonal antibody concentrations to determine resistance variants 16 . Although high-throughput and efficient, this method does not mimic physiological levels of the virus receptor CD4 on T cells because these specially engineered cell lines express high levels of receptors on their surface 17 , 18 . Furthermore, while methods utilizing cloned viruses are useful for understanding viral resistance, the ability to study donor-derived viruses provides the opportunity to analyze bNAb escape pathways in authentic viral isolates that are genetically diverse. To address these limitations, additional in vitro methods should be designed. Here, we developed an in vitro assay to study HIV-1 viral escape from bNAbs that is optimized to allow the use of un-cloned HIV-1 isolates and primary ex vivo CD4 + T cells. This assay allows for multiple viruses, and any virus isolate that replicates well in ex vivo CD4 + T cells. The assay can be repeated multiple times and performed in replicate and does not rely on costly animal models. Our assay allows for the development of concurrent mutations that may be either escape or compensatory mutations in the entire Env protein and not only in the binding epitope of the bNAb. The assay can utilize panels of antibodies and viruses to be tested as a matrix to generate escape for each pairing, and longitudinal sequence data can be collected throughout the evolution of escape to map pathways. In this paper, we optimize the conditions for this assay to study viral escape pathways during in vitro viral replication from broadly neutralizing antibodies with both IMCs and donor derived virus in less than 60 days. We plan to utilize this assay to inform future combination therapy design in clinical trials for more effective and accessible HIV-1 interventions in the future. Methods Generation of virus stocks. The infectious molecular clone (IMC) YU2-NL4.3 + BN was derived by subcloning the subtype B YU2 env gene into a replication competent NL4.3 backbone using a previously described cloning strategy 12 . NL4.3 + BN backbone was synthesized by GenScript (Piscataway, NJ) and made by inserting NcoI and BstEII restriction sites that flank the env gene into the pNL4.3, leaving 37 AA at the 5’ and 8 at the 3’ end of the Env as NL4.3 in order to be able to clone in virtually the entire desired env gene. The pNL4.3 reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH:ARP-114, contributed by Dr. M. Martin. The YU2 plasmid (provided by the lab of Dr. Mascola, VRC) was PCR amplified with C-CstEII (GACGGTGACCCACAATTTTTCTGTAG) and TNE3 - NcoI (GCTATAAGCCATGGGGCAAGTGGTCAAAAAGTAGTGTGATTGGAT) primers to introduce flanking BstEII and NcoI restriction sites around the envelope with Phusion HF polymerase (ThermoFischer Scientific, Waltham, MA). PCR product was PCR purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, DE). Double digestion with NcoI and BstEII enzymes was performed on 30 uL of purified PCR product for the envelope and 5 uL of NL4.3 + BN backbone to prepare for ligation. In order to increase ligation efficiency, the NL4.3 + BN backbone was dephosphorylated with Antarctic Phosphatase at 37ºC. Ligation was performed on digested envelope and backbone products with the Quick Ligation Kit (New England Biolabs, Ipswich, MA). Plasmids were transformed using XL-10 Gold competent cells and plated on LB-ampicillin plates and harvested after 24 hours. Bacterial colonies were grown in LB-amp brother for 24 hours before being mini-prepped with the QiaPrep Spin MINIPrep kit (Qiagen, Hilden, DE). Plasmids were sequence verified via Sanger sequencing. Stocks were generated by transfecting 293T cells with the env plasmid. For all virus stock, culture supernatants were collected 72 hours after transfection, and were filtered, harvested, aliquoted and frozen at − 80°C until further use. Escape mutation pseudovirus containing the A561T mutation was generated by inserting a single mutation into the wild type YU2 plasmid synthesized by GenScript (Piscataway, NJ). Amplicons were transformed in Stbl2 competent cells and plated on LB-ampicillin plates for 24 hours at 30°C. DNA was isolated and verified as described for the IMC. Wild type and mutant pseudovirus stocks were generated by co-transfecting 293T cells with the env plasmid and an env -deficient backbone (pSG3 Δ env ) at a 1:3 ratio by mass of DNA while IMC stocks were transfected with 13.3µg of DNA. For all virus stock, culture supernatants were collected 72 hours after transfection, and were filtered, harvested, aliquoted and frozen at − 80°C until further use. Generation of Donor-derived stocks. Donor-derived HIV viral stocks were isolated from utilizing a quantitative viral outgrowth assay (QVOA) as described previously 19 . Leukapheresis was performed on ART-treated participants by Maple Clinic, isolated via QVOA and characterized as previously described in Wilson et al 20 . Briefly, isolates were characterized via single genome sequencing as described below and infectivity was determined by titering virus in a 12-point five-fold dilution series in quadruplicate in TZM-bl cells. Determination of Infectivity for MOI In Vitro. Viruses were titered on TZM-bl target cells according to a 12-point five-fold dilution series in quadruplicate. From these data the Spearman-Karber TCID50 calculation was used as follows to determine infectivity: (log highest dilution at which all wells are positive).5 -(# of total positive wells at highest dilution/# of replicates) = LogID50. TCID50 was calculated by inputting 10 LogID50 21 . Enrichment of Ex Vivo CD4 + Target Cells for In Vitro Culture. Uninfected, target cells were isolated from buffy coat obtained from GulfCoast Blood Bank (Houston, TX) by isolating PBMC using SepMate PBMC Isolation tubes (STEMCell, Vancouver, BC) and CD8-depleting these cells with CD8 + Dynabeads (ThermoFischer Scientific, Waltham, MA) according to the manufacturer’s instructions. These CD4 + enriched PBMC were cultured in complete RPMI medium for 3 days in the presence of 20 g/ml phytohemagglutinin (PHA) for activation prior to infection. 14-day In Vitro Replication Assay. Virus stock of YU2 + NL4.3 + BN at varying MOIs were added to 100 uL of uninfected CD4 + enriched PBMC at 1x10 6 cells/mL in duplicate and incubated for 2 hours in a low volume incubation before being supplemented to 2 mL with complete RPMI medium supplemented with 20 U/ml recombinant human interleukin-2 (IL-2; Roche Diagnostics). After 24 hours, all infected conditions were plated in 12 well plates at a specific MOI and cultured for 14 days. Every 2 to 3 days, half of the supernatant was refreshed with new IL-2 media and 200 uL of old supernatant was collected for p24 analysis with the AlphaLISA HIV p24 Biotin-Free detection kit (Revvity, Waltham, MA), and this volume was replaced with fresh complete medium supplemented with IL-2. Area under the curve was calculated from replication curves in GraphPad Prism and plotted. Study of Viral Escape of YU2 + NL4.3 + BN from bNAb. Virus stock of YU2 + NL4.3 + BN at an MOI of 1 was incubated with VRC01 or 10-1074 at varying concentrations for 30 minutes (Fig. 3B). 100 µL of uninfected CD4 + enriched PBMC at 1x10 6 cells/mL were added to each infection and incubated for 2 hours in a low volume incubation before being supplemented to 2 mL with complete RPMI medium supplemented with 20 U/ml recombinant human interleukin-2 (IL-2; Roche Diagnostics). After 24 hours, all infected cells are plated in individual wells based on experimental condition in 12 well plates in 2 mL of complete RPMI medium with IL-2. Cultures were maintained for up to 42 days in the presence of increasing concentrations of VRC01 or 10-1074. Every 2 to 3 days, half of the supernatant was refreshed with new IL-2 media and 200 uL of old supernatant was collected for p24 analysis with the AlphaLISA HIV p24 Biotin-Free detection kit (Revvity, Waltham, MA), and this volume was replaced with fresh complete medium supplemented with IL-2 and VRC01 or 10-1074. Every 14 days, cultures were refreshed with ex vivo CD4 + T cells to propagate infection by spinoculating new cells with infected media. CD4 + T cells grown in culture for previous 14 days were replenished with fresh complete RPMI medium for 24 hours. Aliquots of viral supernatant were taken for phenotypic and genotypic assays. Neutralization sensitivity was tested as described below. Sequencing Env genes from virus cultures. Sequences were obtained via single genome sequencing (SGS) as previously described 22 with the following modifications. Viral RNA was extracted from culture supernatants by QIAmp kit (Qiagen, Germantown MD). cDNA was synthesized as previously described in (9), and env genes were amplified by nested PCR using the Platinum Taq High Fidelity polymerase (Invitrogen). Template cDNA was serially diluted so that fewer than 33% of PCR replicates were positive, ensuring that a majority of amplicons would be generated from a single cDNA template. Well-described primers Env_outF1 (TAGAGCCCTGGAAGCATCCAGGAAG) and Env_outR1 (TTGCTACTTGTGATTGCTCCATGT) were used for first round amplification, and Env_inF2 (CACCTTAGGCATCTCCTATGGCAGGAAGAAG) and Env_inR2 (GTCTCGAGATACTGCTCCCACCC) for the second round. All PCR mixes were generated in PCR clean rooms free of post-PCR or plasmid DNA. Amplicons were run on 1% agarose gels and sequenced by ACGT Inc. A minimum of five single-template sequences were obtained from each well. Sequences that contained stop codons, large deletions, or mixed bases were removed from further analysis. Sequence Analysis. All QC’d sequences were translated and aligned by MUSCLE including the virus stock Env sequence, which was set as the reference sequence to determine mutations from stock. Amino acid highlighter plots were generated using the Los Alamos National Laboratories highlighter generator by comparing experimental sequences to the sequence of the infecting YU2 + NL4.3 + BN strain 14 . Amino acid mutations observed in more than half of an experimental condition were considered to be fixed and further analyzed. TZM-bl Neutralization Assay This assay was run as previously described 23 – 25 . Specifically, input virus dilution of pseudovirus and IMC stocks were calculated from titration experiments to ensure sufficient luciferase output within the linear portion of the titration curve (45,000 RLUs). Culture supernatant from the resistance assay was added undiluted. All replication competent viruses were run in the presence of 1 uM indinavir to prevent viral replication. 10 µl of five-fold serially diluted mAbs from a starting concentration of 50 µg/ml were incubated with 40 µl of virus in duplicate for 30 minutes at 37°C in 96-well clear flat-bottom black culture plates (Greiner Bio-One). Tzm-bl cells were added at a concentration of 10,000 cells per 20 µl to each well in DMEM containing 75 µg/ml DEAE-dextran Cell only and virus only controls were included on each plate. Plates were incubated for 24 hours at 37°C in a 5% CO2 incubator, after which the volume of culture medium was adjusted to 200 µl by adding complete DMEM. 48 hours post-infection, 100 µl was removed from each well and 100 µl of SpectraMax Glo Steady-Luc reporter assay (Molecular Devices, LLC., CA) reagent was added to the cells. After a 15-min incubation at room temperature to allow cell lysis, the luminescence intensity was measured using a SpectraMax i3x multi-mode detection platform per the manufacturers’ instructions. Neutralization curves were calculated by comparing luciferase units of wells containing antibody to virus-only controls after background subtraction. Curves are fit by nonlinear regression using the asymmetric five-parameter logistic equation in Prism 9 for macOS (GraphPad Software, LLC). Inhibitory concentrations (IC 25, IC 50 , IC 80 etc) are estimates of the antibody concentrations required to inhibit infection by the desired percentage (i.e. the IC 50 is the antibody concentration required to inhibit infection by 50%). Generation of broadly neutralizing antibodies The heavy- and light-chain genes of VRC01 and 10-1074 were expressed as full-length IgG1s from transient transfection of 293F cells and purified by affinity chromatography using HiTrap Protein A HP Columns (GE Healthcare). Heavy and light chain plasmids were obtained from the Vaccine Research Center (VRC), National Institute of Health (NIH). Results MOI of 0.5 and 1 provide high replication levels with increased levels of genetic variation in YU2 IMC. We first sought to determine the ideal multiplicity of infection (MOI) that would provide the highest levels of viral replication and subsequently highest number of random mutations to facilitate selection for escape mutations in a short period of time in vitro . To initially test the MOI, we utilized the YU2-NL4.3 + BN IMC, which replicates well in primary cells in vitro . We tested a range of MOIs: 0.5, 1, 2.5, 5, 7.5 and 10 to test the effect on replication and mutation. We observed that MOIs above 2.5 started to slightly decrease replication levels by day 14 of the assay (Fig. 1A). We quantified replication by calculating the area under the curve (AUC) for 14 days, and observed that MOIs 0.5, 1 and 2.5 all had AUC above 10 7 prompting us to further examine these three MOIs for genetic variation (Fig. 1A). When compared to the stock strain, viruses infecting cells with an MOI of 0.5 and 1 had more genetic mutations in the Env protein as compared to 2.5 (Fig. 1B). MOI of 0.5 and 1 yielded an average of 1 and 0.89 mutations per sequence, respectively, compared to 0.4 mutations per sequence in the 2.5 MOI condition (Fig. 1C). Thus 0.5 and 1 were determined to be the ideal MOIs for this assay. Importantly, we also observed a plateau in p24 levels between day 10 and 14, suggesting that the virus reached the limit of target ex vivo CD4 + T cells sometime after 10 days (Fig. 1A). In future experiments, therefore, target cells were refreshed every 14-days to successfully propagate the infection long-term. An MOI of 1 demonstrates higher virus replication and Env mutations compared to 0.5 in donor derived virus infections. We next tested the ability of MOIs 0.5 and 1 to generate similar results with replication competent donor derived virus from a PWH. When replication was measured for 14 days in vitro , wells infected with an MOI of 1 produced slightly higher levels of p24 (Fig. 2A). When single genome sequencing was performed in order to determine genetic mutations, more variation was documented per well in the MOI of 1 condition (Fig. 2B). There was an average of 1.5 and 2.25 mutations per sequence in the 0.5 and 1 MOI conditions, respectively (Fig. 2C). These findings confirm an MOI of 1 was ideal for this assay in order to maintain high levels of viral replication and genetic mutation. Both Novel and Previously Seen Escape Mutations Observed with In Vitro Escape Assay. In order to study in vitro replication in the presence of broadly neutralizing antibodies we next determined how much antibody to add into the cultures. Two well characterized bNAbs commonly used in clinical trials and that target two different epitopes, VRC01 and 10-1074, were chosen for study. The YU2-NL4.3 + BN virus stock was tested against VRC01 and 10-1074 to determine the sensitivity of the virus to each bNAb (Fig. 3A). From the curve generated in this assay, multiple inhibitory concentrations (IC) that block virus infectivity were extrapolated, and this range of bNAb concentrations were added individually to the virus stock before infecting target cells culture wells (Fig. 3B). In order to determine how much replication was affected by the presence of bNAbs, we measured replication kinetics by p24 for 14 days as previously described (Fig. 3C). We observed replication kinetics to be similar for all antibody concentrations, and so the high concentrations of antibody were not inhibiting replication. Therefore, only the highest concentrations of antibody (IC50 and IC75) were continued in the assay, now referred to as antibody low and high, respectively. The goal of this assay was to induce selection of virus with bNAb resistance mutations. In order to measure virus sensitivity of cultures longitudinally, we took advantage of our need to refresh target cells every 14 days. After cell-free virus was added to new target cells, the infected cells from the previous 14 days were washed to remove any lingering antibody and virus complexes. Media with no antibody was replenished, and cells were allowed to produce virus for 24 hours as described in the methods. This small volume of virus was tested for resistance to bNAb in the standard Tzm-bl assay as described in the methods. The antibody concentration was conservatively increased over time to provide more selection pressure after it was confirmed that day 14 viruses were not resistant to their bNAb (Fig. 3C). By day 42, the third ex vivo cell refresh point, all viruses were resistant to their respective bNAb while all negative controls maintained the same neutralization sensitivity as the stock virus (Fig. 4A). When virus cultures were sequenced, multiple mutations were observed in the Env proteins (Fig. 4B). Antibody-specific mutations were classified as mutations seen only in antibody conditions and not in no antibody control wells (Fig. 4C). In both 10-1074 wells, the mutation S334N removes the glycan at position 332 that is key in the 10-1074 binding epitope and this mutation has been described previously, especially in clinical trials administering 10-1074 (Fig. 4C) 26 , 27 . In the wells with lower antibody VRC01 concentration, a D279K mutation was observed in the CD4 binding site. This has been previously identified as an escape mutation in the individual from whom VRC01 was isolated from and in structural studies testing potential escape mutations from CD4bs bNAbs 12 , 28 . In the higher VRC01 concentration wells, a G459D mutation was observed that has been previously described in VRC01 escape as well as an A561T mutation in gp41 (Fig. 4C) 12 , 29 . This new gp41 mutation has not been previously described. To determine whether the observed novel mutation was a resistance mutation to the cultured bNAb, A561T was inserted into a YU-2 env expression plasmid and resulting mutant pseudovirus was tested for sensitivity to each bNAb (Fig. 4D). Final Schematic for In Vitro bNAb-Viral Escape assay . The final workflow for the viral escape assay is shown in Fig. 5. Virus stock of choice at an MOI of 1 is incubated with chosen bNAb at suboptimal concentrations individually for 30 minutes. 100 uL of uninfected CD4 + enriched PBMC at 1x10 6 cells/mL are added to each infection and incubated for 2 hours in a low volume incubation before being supplemented to 2 mL with complete RPMI medium supplemented with 20 U/ml recombinant human interleukin-2 (IL-2; Roche Diagnostics). After 24 hours, all infected conditions are plated in 12 well plates and cultured for up to 42 days in the presence of increasing concentrations of bNAb. Every 2 to 3 days, half of the supernatant is refreshed with new IL-2 media and 200 uL of old supernatant is collected for p24 analysis, and the removed volume is replaced with fresh complete medium supplemented with IL-2 and bNAb of choice. Every 14 days, fresh ex vivo CD4 + T cells were replenished via spinoculation with infected media. Prior to spinoculation, the infected supernatant is incubated, usually with increased bNAb concentration, for 30 minutes to apply bNAb pressure without the presence of CD4 + T cells. CD4 + T cells grown in culture for previous 14 days were replenished with fresh complete RPMI medium for 24 hours. Aliquots of viral supernatant were taken for phenotypic and genotypic assays. Discussion Here we describe an assay to elucidate neutralization resistance mutations to broadly neutralizing antibodies in order to study viral escape pathways from genetically diverse envelope proteins. Our assay improves upon traditional assays that increase antibody concentration by providing a standardized MOI and scheme to increase bNAb concentration throughout the assay to potentially decrease the time to bNAb resistance for more efficient observations of viral escape. Through multiple screening experiments with both infectious molecular clones and donor derived replication viruses, we determined that an MOI of 1 is ideal to enhance viral replication to high levels and generate the most genetic variation to increase the chances of seeing viral escape when cultured in the presence of bNAbs. In our main preliminary experiment to test time to escape using our optimized assay, we observed complete neutralization resistance by day 42 in the presence of increasing antibody concentration for both VRC01 and 10-1074, although resistance may have started increasing by day 28. Throughout this experiment, we increased bNAb concentration three separate times before resistance was developed between day 28 and 42. In subsequent experiments, we have only increased bNAb concentrations at the two-week target cell refresh points allowing for virus supernatant to be incubated with the increased bNAb concentrations before spinoculation infection of new target cells. Our hypothesis is that this allows increased virus-bNAb contact during this incubation before viral transmission becomes mostly cell-to-cell transmission, making bNAb accessibility and neutralization more difficult. In our experiments, we demonstrate that this assay can recapitulate multiple escape mutations seen previously in vivo in bNAb clinical trials and in other in vitro work, emphasizing its merit as use for enhancing viral escape knowledge before bNAb use in the clinic. For VRC01, we observed two major mutations that occurred in the CD4 binding site of the envelope, D279K in loop D and G459D in V5. Antigenic profiling assays also report viral escape mutations at these positions in both BG505 (subtype A) and ADA (subtype B) cultures 14 , 15 . Mutations at these positions were also noted as in vivo viral escape mutations in the individual from whom VRC01 was isolated as well as in humanized mouse models with VRC01 infusion, highlighting their importance 12 , 29 . When tested as prevention, it is of interest is that mutations at both of these positions were also observed in participants who developed complete resistance to VRC01 in the antibody mediated prevention (AMP) trial when viral escape was studied in participants who became infected with HIV after VRC01 infusion 30 . Also of note is the observation of the gp41 mutation A561T in the VRC01 treated wells at day 28. Although not in the bNAb epitope, this mutation has been previously described to increase resistance to CD4 mimetic DMJ-II-121 but not bNAbs when inserted into a YU2 backbone 31 . When we tested YU2-A561T neutralization sensitivity to VRC01 was not impacted, and thus must be tested further to determine its role as a possible compensatory mutation. For 10-1074 escape, the only mutation that we observed in the antibody condition wells was a single amino acid substitution of S334N, which shifts the N332 glycan that is pivotal to 10-1074 binding to position 334 and confers complete neutralization resistance. Mutations altering the N332 glycan are extremely well documented and commonly seen in clinical trials that administer 10-1074 to PWH 26 , 32 , 33 . The fact that this assay identifies clinically relevant mutations emphasizes its utility for testing bNAb combinations that would be useful in future clinical trials. Further experiments should be done to confirm the reproducibility of these mutation and to test the assay’s ability to predict common mutation pathways across genetically variable subtypes. The use of this assay provides the ability to test bNAb monoclonal and combination therapies in vitro in order to better inform clinical trial design. This assay can also potentially be used in order to better understand the replication costs or advantages of certain bNAb escape mutations and their compensatory counterparts, which has the ability to inform researchers of secondary targets in combination therapies. Here we demonstrate that this optimized in vitro viral escape assay has the ability to not only recapitulate previously seen mutations from clinical trials, but also provide information on potential compensatory mutations that may be occurring to lead to better combination therapy design for a HIV-1 cure strategies utilizing broadly neutralizing antibodies. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Available upon request. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This research was funded in part by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health grant number T32 AI158105 as a training grant to TM and grant number R01 AI152770 to RML. Authors' contributions TM performed and collected the generated in vitro data, performed all analyses with GraphPad Prism, Geneious Software and LANL Highlighter and wrote the paper. RL conceptualized the ideas, designed preliminary experiments and analyses and wrote the paper. Acknowledgements We acknowledge the people living with HIV from whom the viral species studied in this paper were obtained, for without them this research would not be possible. We thank previous lab members Andrew Wilson and Anjali Bhatnagar for generation of virus reagents and Maria Korom for performing preliminary neutralization sensitivity curves. We thank Gabe Galeotos and Thomas DeStefanis for their helpful feedback on this manuscript. Teresa Murphy is a predoctoral student in the Microbiology and Immunology Program of the Integrated Biomedical Sciences Program at the George Washington University. This work is from a dissertation to be presented to the above program in partial fulfillment of the requirements for the Ph.D. degree. References Malik B, Ghatol A. Understanding How Monoclonal Antibodies Work. In: StatPearls . StatPearls Publishing; 2025. Accessed June 6, 2025. http://www.ncbi.nlm.nih.gov/books/NBK572118/ Weiner GJ. Building better monoclonal antibody-based therapeutics. Nat Rev Cancer . 2015;15(6):361-370. doi:10.1038/nrc3930 Rijal P, Donnellan FR. A review of broadly protective monoclonal antibodies to treat Ebola virus disease. Curr Opin Virol . 2023;61:101339. doi:10.1016/j.coviro.2023.101339 Focosi D, McConnell S, Casadevall A, Cappello E, Valdiserra G, Tuccori M. Monoclonal antibody therapies against SARS-CoV-2. Lancet Infect Dis . 2022;22(11):e311-e326. doi:10.1016/S1473-3099(22)00311-5 Overbaugh J, Morris L. The Antibody Response against HIV-1. Cold Spring Harb Perspect Med . 2012;2(1):a007039. doi:10.1101/cshperspect.a007039 Burton DR, Mascola JR. Antibody responses to envelope glycoproteins in HIV-1 infection. Nat Immunol . 2015;16(6):571-576. doi:10.1038/ni.3158 Wilson A, Lynch RM. Embracing diversity: how can broadly neutralizing antibodies effectively target a diverse HIV-1 reservoir? Curr Opin Pharmacol . 2020;54:173-178. doi:10.1016/j.coph.2020.10.004 Lynch RM, Shen T, Gnanakaran S, Derdeyn CA. Appreciating HIV Type 1 Diversity: Subtype Differences in Env. AIDS Res Hum Retroviruses . 2009;25(3):237-248. doi:10.1089/aid.2008.0219 Swanstrom R, Coffin J. HIV-1 Pathogenesis: The Virus. Cold Spring Harb Perspect Med . 2012;2(12):a007443. doi:10.1101/cshperspect.a007443 Griffith SA, McCoy LE. To bnAb or Not to bnAb: Defining Broadly Neutralising Antibodies Against HIV-1. Front Immunol . 2021;12. doi:10.3389/fimmu.2021.708227 Mahomed S, Pillay K, Hassan-Moosa R, et al. Clinical trials of broadly neutralizing monoclonal antibodies in people living with HIV – a review. AIDS Res Ther . 2025;22:44. doi:10.1186/s12981-025-00734-8 Lynch RM, Wong P, Tran L, et al. HIV-1 fitness cost associated with escape from the VRC01 class of CD4 binding site neutralizing antibodies. J Virol . 2015;89(8):4201-4213. doi:10.1128/JVI.03608-14 Scheid JF, Horwitz JA, Bar-On Y, et al. HIV-1 antibody 3BNC117 suppresses viral rebound in humans during treatment interruption. Nature . 2016;535(7613):556-560. doi:10.1038/nature18929 Dingens AS, Arenz D, Weight H, Overbaugh J, Bloom JD. An Antigenic Atlas of HIV-1 Escape from Broadly Neutralizing Antibodies Distinguishes Functional and Structural Epitopes. Immunity . 2019;50(2):520-532.e3. doi:10.1016/j.immuni.2018.12.017 Otsuka Y, Schmitt K, Quinlan BD, et al. Diverse pathways of escape from all well-characterized VRC01-class broadly neutralizing HIV-1 antibodies. PLoS Pathog . 2018;14(8):e1007238. doi:10.1371/journal.ppat.1007238 Schmidt F, Weisblum Y, Rutkowska M, et al. High genetic barrier to SARS-CoV-2 polyclonal neutralizing antibody escape. Nature . 2021;600(7889):512-516. doi:10.1038/s41586-021-04005-0 Reil H, Höxter M, Moosmayer D, Pauli G, Hauser H. CD4 Expressing Human 293 Cells as a Tool for Studies in HIV-1 Replication: The Efficiency of Translational Frameshifting Is Not Altered by HIV-1 Infection. Virology . 1994;205(1):371-375. doi:10.1006/viro.1994.1655 Sarzotti-Kelsoe M, Bailer RT, Turk E, et al. Optimization and Validation of the TZM-bl Assay for Standardized Assessments of Neutralizing Antibodies Against HIV-1. J Immunol Methods . 2014;0:131-146. doi:10.1016/j.jim.2013.11.022 Enick PN, Brooker JP, Tumiotto CM, et al. Comparison of methods to quantify inducible HIV-1 outgrowth. J Virus Erad . 2021;7(2):100043. doi:10.1016/j.jve.2021.100043 Wilson A, Shakhtour L, Ward A, et al. Characterizing the Relationship Between Neutralization Sensitivity and env Gene Diversity During ART Suppression. Front Immunol . 2021;12. doi:10.3389/fimmu.2021.710327 Ramakrishnan MA. Determination of 50% endpoint titer using a simple formula. World J Virol . 2016;5(2):85. doi:10.5501/wjv.v5.i2.85 Salazar-Gonzalez JF, Salazar MG, Keele BF, et al. Genetic identity, biological phenotype, and evolutionary pathways of transmitted/founder viruses in acute and early HIV-1 infection. J Exp Med . 2009;206(6):1273-1289. doi:10.1084/jem.20090378 Montefiori DC. Measuring HIV Neutralization in a Luciferase Reporter Gene Assay. In: Prasad VR, Kalpana GV, eds. HIV Protocols . Humana Press; 2009:395-405. doi:10.1007/978-1-59745-170-3_26 Ren Y, Korom M, Truong R, et al. Susceptibility to Neutralization by Broadly Neutralizing Antibodies Generally Correlates with Infected Cell Binding for a Panel of Clade B HIV Reactivated from Latent Reservoirs. J Virol . 2018;92(23):e00895-18. doi:10.1128/JVI.00895-18 Lynch RM, Tran L, Louder MK, et al. The Development of CD4 Binding Site Antibodies during HIV-1 Infection. J Virol . 2012;86(14):7588-7595. doi:10.1128/jvi.00734-12 Zacharopoulou P, Ansari MA, Frater J. A calculated risk: Evaluating HIV resistance to the broadly neutralising antibodies10-1074 and 3BNC117. Curr Opin HIV AIDS . 2022;17(6):352-358. doi:10.1097/COH.0000000000000764 Caskey M, Schoofs T, Gruell H, et al. Antibody 10-1074 suppresses viremia in HIV-1-infected individuals. Nat Med . 2017;23(2):185-191. doi:10.1038/nm.4268 Diskin R, Klein F, Horwitz JA, et al. Restricting HIV-1 pathways for escape using rationally designed anti–HIV-1 antibodies. J Exp Med . 2013;210(6):1235-1249. doi:10.1084/jem.20130221 Klein F, Halper-Stromberg A, Horwitz JA, et al. HIV therapy by a combination of broadly neutralizing antibodies in humanized mice. Nature . 2012;492(7427):118-122. doi:10.1038/nature11604 Cohen P, Lambson BE, Mkhize NN, et al. Resistance mutations that distinguish HIV-1 envelopes with discordant VRC01 phenotypes from multi-lineage infections in the HVTN703/HPTN081 trial: implications for cross-resistance. J Virol . 99(2):e01730-24. doi:10.1128/jvi.01730-24 Pacheco B, Alsahafi N, Debbeche O, et al. Residues in the gp41 Ectodomain Regulate HIV-1 Envelope Glycoprotein Conformational Transitions Induced by gp120-Directed Inhibitors. J Virol . 2017;91(5):e02219-16. doi:10.1128/JVI.02219-16 Meijers M, Vanshylla K, Gruell H, Klein F, Lässig M. Predicting in vivo escape dynamics of HIV-1 from a broadly neutralizing antibody. Proc Natl Acad Sci . 2021;118(30):e2104651118. doi:10.1073/pnas.2104651118 Zacharopoulou P, Lee M, Oliveira T, et al. Prevalence of resistance-associated viral variants to the HIV-specific broadly neutralising antibody 10-1074 in a UK bNAb-naïve population. Front Immunol . 2024;15. doi:10.3389/fimmu.2024.1352123 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7123859\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Method Article\",\"associatedPublications\":[],\"authors\":[{\"id\":489438085,\"identity\":\"cb578d6a-c729-43b8-b664-8ee9d2973c70\",\"order_by\":0,\"name\":\"Teresa Murphy\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"George Washington University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Teresa\",\"middleName\":\"\",\"lastName\":\"Murphy\",\"suffix\":\"\"},{\"id\":489438086,\"identity\":\"2d38ad05-3730-49e9-97e9-449d13d73cbf\",\"order_by\":1,\"name\":\"Rebecca M. Lynch\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAr0lEQVRIiWNgGAWjYFAC5gYgcUAOwmEjSgsjWIsx6VoSG4jWYj7tYJt0Qc2d9PkROQYMH8oOE9YiczuxTXrGsWe5G2/kGDDOOEeEFglpoBbehsO5G2fnGDDztpGgJd0QpOUvKVoS5KWBWhiJ1NJszXPssOEG+WcFB3vOpROjJfngbZ6aw/LyPYc3PvhRZk1YCxCwSIBIgwPA2CFKPRAwfwCR8g3Eqh8Fo2AUjIIRBwCSLDtWjH998gAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"George Washington University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Rebecca\",\"middleName\":\"M.\",\"lastName\":\"Lynch\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-14 18:38:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7123859/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7123859/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":87526997,\"identity\":\"9fa4b474-7cc3-4096-aa1a-00a6847f8169\",\"added_by\":\"auto\",\"created_at\":\"2025-07-24 19:55:31\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":51309,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMOI of 0.5 and 1 provide high replication levels with increased levels of genetic variation in YU2 IMC.\\u003c/strong\\u003e A. Replication kinetics of all tested MOIs in duplicate over 14 days in YU2-NL4.3+BN IMC. Area under the curve analysis was performed to differentiate effect of MOI on replication kinetics. B. Single genome sequencing was performed to obtain \\u003cem\\u003eenv\\u003c/em\\u003esequences in well 1 of three chosen MOI conditions at Day 14 and compared to stock virus to determine mutation level. C. Table of number of mutations per condition to compare mutation levels.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FiguresLynchinvitroescapeassay1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7123859/v1/bfe823ace6cc1c4cdf93ec5d.png\"},{\"id\":87527590,\"identity\":\"47304956-e51b-4945-a5e1-7415fa8aae43\",\"added_by\":\"auto\",\"created_at\":\"2025-07-24 20:03:32\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":47838,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAn MOI of 1 proves to have higher viral replication and genetic variety compared to 0.5 in donor derived virus. \\u003c/strong\\u003e\\u0026nbsp;A. Replication kinetics of all tested MOIs in duplicate over 14 days in OM5334 7b donor derived virus. Area under the curve analysis was performed to differentiate effect of MOI on replication kinetics. B. Single genome sequencing was performed to obtain \\u003cem\\u003eenv\\u003c/em\\u003e sequences in all three wells at Day 14 and compared to stock virus to determine mutation level. Glycans in the stock are indicated in pink. C. Table of number of mutations per condition to compare mutation levels.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FiguresLynchinvitroescapeassay2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7123859/v1/9b5dbbdf4b7645a8a483bef6.png\"},{\"id\":87527001,\"identity\":\"adb27d97-d20c-4609-a775-3fc77c935418\",\"added_by\":\"auto\",\"created_at\":\"2025-07-24 19:55:32\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":80305,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffect of bNAb concentration on replication kinetics of IMC virus. \\u003c/strong\\u003eA. 5-fold 8-point neutralization curves of stock YU2-NL4.3+BN against 10-1074 and VRC01 in TZM-bl cells. B. Chosen concentrations for each respective bNAb. C. Replication kinetics of p24 concentration was measured for 56 days. Dotted lines indicated when cultures were refreshed with ex vivo CD4+ target cells. Arrows indicate increases in antibody concentration.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FiguresLynchinvitroescapeassay3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7123859/v1/f582549b830013ccd3a71973.png\"},{\"id\":87526999,\"identity\":\"25143753-68f6-4eb4-a298-b402d8f03235\",\"added_by\":\"auto\",\"created_at\":\"2025-07-24 19:55:31\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":69916,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eBoth Novel and Previously Seen Escape Mutations Observed with \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eIn Vitro\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e Escape Assay.\\u003c/strong\\u003e A. Antibody-free viral supernatant from 3 wells was tested for sensitivity to VRC01 by TZM-bl neutralization assay at Days 28 and 42 post infection. IC50s were calculated, and an IC50 \\u0026gt;50 ug/mL indicates resistance. Geometric mean is plotted. Dotted line indicates the highest bNAb concentration tested (50 ug/mL). B. Single genome sequencing was performed to obtain \\u003cem\\u003eenv\\u003c/em\\u003e sequences in all three wells at Day 42 and compared to stock virus. Glycans in the stock are indicated in pink. Changes that result in a putative glycan addition are indicated by pink diamonds. C. Table of mutations observed at day 42 in both bNAb and no antibody conditions. D. Pseudoviruses of\\u003cstrong\\u003e \\u003c/strong\\u003e246.F3-SG3 WT Env with the A561T mutation identified in VRC01 wells was tested for sensitivity to VRC01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FiguresLynchinvitroescapeassay4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7123859/v1/f4f4925c3963498f9e54d6ae.png\"},{\"id\":87527004,\"identity\":\"029b3b40-0464-4495-b877-bfdea62ec4ea\",\"added_by\":\"auto\",\"created_at\":\"2025-07-24 19:55:32\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":94829,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSchematic of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eviral resistance assay\\u003c/strong\\u003e. Virus and bNAb pairing are incubated for 30min. before a high MOI standing infection of pre-stimulated CD4 enriched ex vivo T cells. Infections are plated and monitored for replication kinetics by measuring p24 every 3 days. Every 14 days, supernatant is used to infect new CD4 T cells for infection propagation. New media without any bNAb is added to infected cells for virus to grow for 24 hours. This cell free/antibody free virus is then measured for resistance phenotypically and genotypically.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FiguresLynchinvitroescapeassay5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7123859/v1/793e5920692d355204aeea78.png\"},{\"id\":90440880,\"identity\":\"2434d2d9-e1b9-4a87-b991-b007fe458537\",\"added_by\":\"auto\",\"created_at\":\"2025-09-02 18:31:35\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":919751,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7123859/v1/c84ce105-dbbd-4562-85e3-52546ab56947.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Development of In Vitro Assay for Viral Escape from Broadly Neutralizing Antibodies\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe use of monoclonal antibodies (mAbs) as treatments for infectious disease is especially advantageous as they are recognized as the host’s own molecules (“self”) with low chance of anti-drug immune responses, can be engineered for long half-lives and have the ability to harness the host’s immune system for cell clearance \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e. Monoclonal antibody treatments have been pioneered as anti-virals with successful application against SARS-CoV2 and Ebola infections \\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u003c/sup\\u003e. A major roadblock for the use of mAb treatments is the generation of escape mutations that confer resistance, making combination mAb therapy necessary for successful virus clearance \\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. One virus against which antibody treatments show promise is Human Immunodeficiency Virus-1 (HIV-1), which is highly genetically diverse \\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. The virus’s ability to efficiently escape immune responses has made cure elusive \\u003csup\\u003e\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. One potential cure strategy derives from the identification and characterization of broadly neutralizing antibodies (bNAbs), which can neutralize many genetic variants of HIV-1\\u003csup\\u003e10\\u003c/sup\\u003e. Administered bNAbs are not immune to viral escape, as demonstrated in multiple clinical trials of monotherapy infusions \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR12\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e–\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. In order to better inform combination bNAb clinical trials, escape pathways of individual mAbs should be determined to select mAb combinations that limit virus escape.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eIn vitro\\u003c/em\\u003e assays allow virus escape to be studied across HIV genetically diverse strains and rely upon replication-competent viruses. Previous methods to study escape \\u003cem\\u003ein vitro\\u003c/em\\u003e include antigenic profiling, pioneered by the lab of Jesse Bloom, in which every possible amino acid change is made at each residue position and are then incubated for 24 hours with a bNAb of choice with variants still prevalent after this selection period being resistant \\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. Drawbacks to this approach are the limited number of virus libraries used and that only single changes can be studied. Another traditional method for observing resistance mutations is utilizing a cell line, such as HEK-293T cells and passaging repeatedly in the presence of increasing plasma or polyclonal antibody concentrations to determine resistance variants \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e. Although high-throughput and efficient, this method does not mimic physiological levels of the virus receptor CD4 on T cells because these specially engineered cell lines express high levels of receptors on their surface \\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, while methods utilizing cloned viruses are useful for understanding viral resistance, the ability to study donor-derived viruses provides the opportunity to analyze bNAb escape pathways in authentic viral isolates that are genetically diverse. To address these limitations, additional \\u003cem\\u003ein vitro\\u003c/em\\u003e methods should be designed.\\u003c/p\\u003e\\u003cp\\u003eHere, we developed an \\u003cem\\u003ein vitro\\u003c/em\\u003e assay to study HIV-1 viral escape from bNAbs that is optimized to allow the use of un-cloned HIV-1 isolates and primary \\u003cem\\u003eex vivo\\u003c/em\\u003e CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells. This assay allows for multiple viruses, and any virus isolate that replicates well in \\u003cem\\u003eex vivo\\u003c/em\\u003e CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells. The assay can be repeated multiple times and performed in replicate and does not rely on costly animal models. Our assay allows for the development of concurrent mutations that may be either escape or compensatory mutations in the entire Env protein and not only in the binding epitope of the bNAb. The assay can utilize panels of antibodies and viruses to be tested as a matrix to generate escape for each pairing, and longitudinal sequence data can be collected throughout the evolution of escape to map pathways. In this paper, we optimize the conditions for this assay to study viral escape pathways during \\u003cem\\u003ein vitro\\u003c/em\\u003e viral replication from broadly neutralizing antibodies with both IMCs and donor derived virus in less than 60 days. We plan to utilize this assay to inform future combination therapy design in clinical trials for more effective and accessible HIV-1 interventions in the future.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eGeneration of virus stocks.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe infectious molecular clone (IMC) YU2-NL4.3 + BN was derived by subcloning the subtype B YU2 \\u003cem\\u003eenv\\u003c/em\\u003e gene into a replication competent NL4.3 backbone using a previously described cloning strategy\\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. NL4.3 + BN backbone was synthesized by GenScript (Piscataway, NJ) and made by inserting NcoI and BstEII restriction sites that flank the \\u003cem\\u003eenv\\u003c/em\\u003e gene into the pNL4.3, leaving 37 AA at the 5’ and 8 at the 3’ end of the Env as NL4.3 in order to be able to clone in virtually the entire desired \\u003cem\\u003eenv\\u003c/em\\u003e gene. The pNL4.3 reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH:ARP-114, contributed by Dr. M. Martin. The YU2 plasmid (provided by the lab of Dr. Mascola, VRC) was PCR amplified with C-CstEII (GACGGTGACCCACAATTTTTCTGTAG) and TNE3\\u003cem\\u003e-\\u003c/em\\u003eNcoI (GCTATAAGCCATGGGGCAAGTGGTCAAAAAGTAGTGTGATTGGAT) primers to introduce flanking BstEII and NcoI restriction sites around the envelope with Phusion HF polymerase (ThermoFischer Scientific, Waltham, MA). PCR product was PCR purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, DE). Double digestion with NcoI and BstEII enzymes was performed on 30 uL of purified PCR product for the envelope and 5 uL of NL4.3 + BN backbone to prepare for ligation. In order to increase ligation efficiency, the NL4.3 + BN backbone was dephosphorylated with Antarctic Phosphatase at 37ºC. Ligation was performed on digested envelope and backbone products with the Quick Ligation Kit (New England Biolabs, Ipswich, MA). Plasmids were transformed using XL-10 Gold competent cells and plated on LB-ampicillin plates and harvested after 24 hours. Bacterial colonies were grown in LB-amp brother for 24 hours before being mini-prepped with the QiaPrep Spin MINIPrep kit (Qiagen, Hilden, DE). Plasmids were sequence verified via Sanger sequencing. Stocks were generated by transfecting 293T cells with the \\u003cem\\u003eenv\\u003c/em\\u003e plasmid. For all virus stock, culture supernatants were collected 72 hours after transfection, and were filtered, harvested, aliquoted and frozen at − 80°C until further use.\\u003c/p\\u003e\\u003cp\\u003eEscape mutation pseudovirus containing the A561T mutation was generated by inserting a single mutation into the wild type YU2 plasmid synthesized by GenScript (Piscataway, NJ). Amplicons were transformed in Stbl2 competent cells and plated on LB-ampicillin plates for 24 hours at 30°C. DNA was isolated and verified as described for the IMC. Wild type and mutant pseudovirus stocks were generated by co-transfecting 293T cells with the \\u003cem\\u003eenv\\u003c/em\\u003e plasmid and an \\u003cem\\u003eenv\\u003c/em\\u003e-deficient backbone (pSG3 Δ\\u003cem\\u003eenv\\u003c/em\\u003e) at a 1:3 ratio by mass of DNA while IMC stocks were transfected with 13.3µg of DNA. For all virus stock, culture supernatants were collected 72 hours after transfection, and were filtered, harvested, aliquoted and frozen at − 80°C until further use.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eGeneration of Donor-derived stocks.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eDonor-derived HIV viral stocks were isolated from utilizing a quantitative viral outgrowth assay (QVOA) as described previously \\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e. Leukapheresis was performed on ART-treated participants by Maple Clinic, isolated via QVOA and characterized as previously described in Wilson et al \\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. Briefly, isolates were characterized via single genome sequencing as described below and infectivity was determined by titering virus in a 12-point five-fold dilution series in quadruplicate in TZM-bl cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eDetermination of Infectivity for MOI In Vitro.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eViruses were titered on TZM-bl target cells according to a 12-point five-fold dilution series in quadruplicate. From these data the Spearman-Karber TCID50 calculation was used as follows to determine infectivity: (log highest dilution at which all wells are positive).5 -(# of total positive wells at highest dilution/# of replicates) = LogID50. TCID50 was calculated by inputting 10\\u003csup\\u003eLogID50 21\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eEnrichment of Ex Vivo CD4\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003e+\\u003c/em\\u003e\\u003c/sup\\u003e \\u003cem\\u003eTarget Cells for In Vitro Culture.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eUninfected, target cells were isolated from buffy coat obtained from GulfCoast Blood Bank (Houston, TX) by isolating PBMC using SepMate PBMC Isolation tubes (STEMCell, Vancouver, BC) and CD8-depleting these cells with CD8\\u003csup\\u003e+\\u003c/sup\\u003e Dynabeads (ThermoFischer Scientific, Waltham, MA) according to the manufacturer’s instructions. These CD4\\u003csup\\u003e+\\u003c/sup\\u003e enriched PBMC were cultured in complete RPMI medium for 3 days in the presence of 20 g/ml phytohemagglutinin (PHA) for activation prior to infection.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003e14-day In Vitro Replication Assay.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eVirus stock of YU2 + NL4.3 + BN at varying MOIs were added to 100 uL of uninfected CD4 + enriched PBMC at 1x10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL in duplicate and incubated for 2 hours in a low volume incubation before being supplemented to 2 mL with complete RPMI medium supplemented with 20 U/ml recombinant human interleukin-2 (IL-2; Roche Diagnostics). After 24 hours, all infected conditions were plated in 12 well plates at a specific MOI and cultured for 14 days. Every 2 to 3 days, half of the supernatant was refreshed with new IL-2 media and 200 uL of old supernatant was collected for p24 analysis with the AlphaLISA HIV p24 Biotin-Free detection kit (Revvity, Waltham, MA), and this volume was replaced with fresh complete medium supplemented with IL-2. Area under the curve was calculated from replication curves in GraphPad Prism and plotted.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eStudy of Viral Escape of YU2 + NL4.3 + BN from bNAb.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eVirus stock of YU2 + NL4.3 + BN at an MOI of 1 was incubated with VRC01 or 10-1074 at varying concentrations for 30 minutes (Fig.\\u0026nbsp;3B). 100 µL of uninfected CD4 + enriched PBMC at 1x10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL were added to each infection and incubated for 2 hours in a low volume incubation before being supplemented to 2 mL with complete RPMI medium supplemented with 20 U/ml recombinant human interleukin-2 (IL-2; Roche Diagnostics). After 24 hours, all infected cells are plated in individual wells based on experimental condition in 12 well plates in 2 mL of complete RPMI medium with IL-2. Cultures were maintained for up to 42 days in the presence of increasing concentrations of VRC01 or 10-1074. Every 2 to 3 days, half of the supernatant was refreshed with new IL-2 media and 200 uL of old supernatant was collected for p24 analysis with the AlphaLISA HIV p24 Biotin-Free detection kit (Revvity, Waltham, MA), and this volume was replaced with fresh complete medium supplemented with IL-2 and VRC01 or 10-1074. Every 14 days, cultures were refreshed with \\u003cem\\u003eex vivo\\u003c/em\\u003e CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells to propagate infection by spinoculating new cells with infected media. CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells grown in culture for previous 14 days were replenished with fresh complete RPMI medium for 24 hours. Aliquots of viral supernatant were taken for phenotypic and genotypic assays. Neutralization sensitivity was tested as described below.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eSequencing Env genes from virus cultures.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eSequences were obtained via single genome sequencing (SGS) as previously described\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e with the following modifications. Viral RNA was extracted from culture supernatants by QIAmp kit (Qiagen, Germantown MD). cDNA was synthesized as previously described in (9), and \\u003cem\\u003eenv\\u003c/em\\u003e genes were amplified by nested PCR using the Platinum Taq High Fidelity polymerase (Invitrogen). Template cDNA was serially diluted so that fewer than 33% of PCR replicates were positive, ensuring that a majority of amplicons would be generated from a single cDNA template. Well-described primers Env_outF1 (TAGAGCCCTGGAAGCATCCAGGAAG) and Env_outR1 (TTGCTACTTGTGATTGCTCCATGT) were used for first round amplification, and Env_inF2 (CACCTTAGGCATCTCCTATGGCAGGAAGAAG) and Env_inR2 (GTCTCGAGATACTGCTCCCACCC) for the second round. All PCR mixes were generated in PCR clean rooms free of post-PCR or plasmid DNA. Amplicons were run on 1% agarose gels and sequenced by ACGT Inc. A minimum of five single-template sequences were obtained from each well. Sequences that contained stop codons, large deletions, or mixed bases were removed from further analysis.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eSequence Analysis.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eAll QC’d sequences were translated and aligned by MUSCLE including the virus stock Env sequence, which was set as the reference sequence to determine mutations from stock. Amino acid highlighter plots were generated using the Los Alamos National Laboratories highlighter generator by comparing experimental sequences to the sequence of the infecting YU2 + NL4.3 + BN strain\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. Amino acid mutations observed in more than half of an experimental condition were considered to be fixed and further analyzed.\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eTZM-bl Neutralization Assay\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eThis assay was run as previously described \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR24\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e–\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e. Specifically, input virus dilution of pseudovirus and IMC stocks were calculated from titration experiments to ensure sufficient luciferase output within the linear portion of the titration curve (45,000 RLUs). Culture supernatant from the resistance assay was added undiluted. All replication competent viruses were run in the presence of 1 uM indinavir to prevent viral replication.\\u003c/p\\u003e\\u003cp\\u003e10 µl of five-fold serially diluted mAbs from a starting concentration of 50 µg/ml were incubated with 40 µl of virus in duplicate for 30 minutes at 37°C in 96-well clear flat-bottom black culture plates (Greiner Bio-One). Tzm-bl cells were added at a concentration of 10,000 cells per 20 µl to each well in DMEM containing 75 µg/ml DEAE-dextran Cell only and virus only controls were included on each plate. Plates were incubated for 24 hours at 37°C in a 5% CO2 incubator, after which the volume of culture medium was adjusted to 200 µl by adding complete DMEM. 48 hours post-infection, 100 µl was removed from each well and 100 µl of SpectraMax Glo Steady-Luc reporter assay (Molecular Devices, LLC., CA) reagent was added to the cells. After a 15-min incubation at room temperature to allow cell lysis, the luminescence intensity was measured using a SpectraMax i3x multi-mode detection platform per the manufacturers’ instructions. Neutralization curves were calculated by comparing luciferase units of wells containing antibody to virus-only controls after background subtraction. Curves are fit by nonlinear regression using the asymmetric five-parameter logistic equation in Prism 9 for macOS (GraphPad Software, LLC). Inhibitory concentrations (IC\\u003csub\\u003e25,\\u003c/sub\\u003e IC\\u003csub\\u003e50\\u003c/sub\\u003e, IC\\u003csub\\u003e80\\u003c/sub\\u003e etc) are estimates of the antibody concentrations required to inhibit infection by the desired percentage (i.e. the IC\\u003csub\\u003e50\\u003c/sub\\u003e is the antibody concentration required to inhibit infection by 50%).\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eGeneration of broadly neutralizing antibodies\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe heavy- and light-chain genes of VRC01 and 10-1074 were expressed as full-length IgG1s from transient transfection of 293F cells and purified by affinity chromatography using HiTrap Protein A HP Columns (GE Healthcare). Heavy and light chain plasmids were obtained from the Vaccine Research Center (VRC), National Institute of Health (NIH).\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eMOI of 0.5 and 1 provide high replication levels with increased levels of genetic variation in YU2 IMC.\\u003c/b\\u003e We first sought to determine the ideal multiplicity of infection (MOI) that would provide the highest levels of viral replication and subsequently highest number of random mutations to facilitate selection for escape mutations in a short period of time \\u003cem\\u003ein vitro\\u003c/em\\u003e. To initially test the MOI, we utilized the YU2-NL4.3\\u0026thinsp;+\\u0026thinsp;BN IMC, which replicates well in primary cells \\u003cem\\u003ein vitro\\u003c/em\\u003e. We tested a range of MOIs: 0.5, 1, 2.5, 5, 7.5 and 10 to test the effect on replication and mutation. We observed that MOIs above 2.5 started to slightly decrease replication levels by day 14 of the assay (Fig.\\u0026nbsp;1A). We quantified replication by calculating the area under the curve (AUC) for 14 days, and observed that MOIs 0.5, 1 and 2.5 all had AUC above 10\\u003csup\\u003e7\\u003c/sup\\u003e prompting us to further examine these three MOIs for genetic variation (Fig.\\u0026nbsp;1A). When compared to the stock strain, viruses infecting cells with an MOI of 0.5 and 1 had more genetic mutations in the Env protein as compared to 2.5 (Fig.\\u0026nbsp;1B). MOI of 0.5 and 1 yielded an average of 1 and 0.89 mutations per sequence, respectively, compared to 0.4 mutations per sequence in the 2.5 MOI condition (Fig.\\u0026nbsp;1C). Thus 0.5 and 1 were determined to be the ideal MOIs for this assay. Importantly, we also observed a plateau in p24 levels between day 10 and 14, suggesting that the virus reached the limit of target \\u003cem\\u003eex vivo\\u003c/em\\u003e CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells sometime after 10 days (Fig.\\u0026nbsp;1A). In future experiments, therefore, target cells were refreshed every 14-days to successfully propagate the infection long-term.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eAn MOI of 1 demonstrates higher virus replication and Env mutations compared to 0.5 in donor derived virus infections.\\u003c/b\\u003e We next tested the ability of MOIs 0.5 and 1 to generate similar results with replication competent donor derived virus from a PWH. When replication was measured for 14 days \\u003cem\\u003ein vitro\\u003c/em\\u003e, wells infected with an MOI of 1 produced slightly higher levels of p24 (Fig.\\u0026nbsp;2A). When single genome sequencing was performed in order to determine genetic mutations, more variation was documented per well in the MOI of 1 condition (Fig.\\u0026nbsp;2B). There was an average of 1.5 and 2.25 mutations per sequence in the 0.5 and 1 MOI conditions, respectively (Fig.\\u0026nbsp;2C). These findings confirm an MOI of 1 was ideal for this assay in order to maintain high levels of viral replication and genetic mutation.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eBoth Novel and Previously Seen Escape Mutations Observed with\\u003c/b\\u003e \\u003cb\\u003eIn Vitro\\u003c/b\\u003e \\u003cb\\u003eEscape Assay.\\u003c/b\\u003e In order to study \\u003cem\\u003ein vitro\\u003c/em\\u003e replication in the presence of broadly neutralizing antibodies we next determined how much antibody to add into the cultures. Two well characterized bNAbs commonly used in clinical trials and that target two different epitopes, VRC01 and 10-1074, were chosen for study. The YU2-NL4.3\\u0026thinsp;+\\u0026thinsp;BN virus stock was tested against VRC01 and 10-1074 to determine the sensitivity of the virus to each bNAb (Fig.\\u0026nbsp;3A). From the curve generated in this assay, multiple inhibitory concentrations (IC) that block virus infectivity were extrapolated, and this range of bNAb concentrations were added individually to the virus stock before infecting target cells culture wells (Fig.\\u0026nbsp;3B). In order to determine how much replication was affected by the presence of bNAbs, we measured replication kinetics by p24 for 14 days as previously described (Fig.\\u0026nbsp;3C). We observed replication kinetics to be similar for all antibody concentrations, and so the high concentrations of antibody were not inhibiting replication. Therefore, only the highest concentrations of antibody (IC50 and IC75) were continued in the assay, now referred to as antibody low and high, respectively.\\u003c/p\\u003e\\u003cp\\u003eThe goal of this assay was to induce selection of virus with bNAb resistance mutations. In order to measure virus sensitivity of cultures longitudinally, we took advantage of our need to refresh target cells every 14 days. After cell-free virus was added to new target cells, the infected cells from the previous 14 days were washed to remove any lingering antibody and virus complexes. Media with no antibody was replenished, and cells were allowed to produce virus for 24 hours as described in the methods. This small volume of virus was tested for resistance to bNAb in the standard Tzm-bl assay as described in the methods. The antibody concentration was conservatively increased over time to provide more selection pressure after it was confirmed that day 14 viruses were not resistant to their bNAb (Fig.\\u0026nbsp;3C). By day 42, the third \\u003cem\\u003eex vivo\\u003c/em\\u003e cell refresh point, all viruses were resistant to their respective bNAb while all negative controls maintained the same neutralization sensitivity as the stock virus (Fig.\\u0026nbsp;4A). When virus cultures were sequenced, multiple mutations were observed in the Env proteins (Fig.\\u0026nbsp;4B). Antibody-specific mutations were classified as mutations seen only in antibody conditions and not in no antibody control wells (Fig.\\u0026nbsp;4C). In both 10-1074 wells, the mutation S334N removes the glycan at position 332 that is key in the 10-1074 binding epitope and this mutation has been described previously, especially in clinical trials administering 10-1074 (Fig.\\u0026nbsp;4C) \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. In the wells with lower antibody VRC01 concentration, a D279K mutation was observed in the CD4 binding site. This has been previously identified as an escape mutation in the individual from whom VRC01 was isolated from and in structural studies testing potential escape mutations from CD4bs bNAbs \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e. In the higher VRC01 concentration wells, a G459D mutation was observed that has been previously described in VRC01 escape as well as an A561T mutation in gp41 (Fig.\\u0026nbsp;4C) \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. This new gp41 mutation has not been previously described. To determine whether the observed novel mutation was a resistance mutation to the cultured bNAb, A561T was inserted into a YU-2 env expression plasmid and resulting mutant pseudovirus was tested for sensitivity to each bNAb (Fig.\\u0026nbsp;4D).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eFinal Schematic for\\u003c/b\\u003e \\u003cb\\u003eIn Vitro\\u003c/b\\u003e \\u003cb\\u003ebNAb-Viral Escape assay\\u003c/b\\u003e. The final workflow for the viral escape assay is shown in Fig.\\u0026nbsp;5. Virus stock of choice at an MOI of 1 is incubated with chosen bNAb at suboptimal concentrations individually for 30 minutes. 100 uL of uninfected CD4\\u003csup\\u003e+\\u003c/sup\\u003e enriched PBMC at 1x10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL are added to each infection and incubated for 2 hours in a low volume incubation before being supplemented to 2 mL with complete RPMI medium supplemented with 20 U/ml recombinant human interleukin-2 (IL-2; Roche Diagnostics). After 24 hours, all infected conditions are plated in 12 well plates and cultured for up to 42 days in the presence of increasing concentrations of bNAb. Every 2 to 3 days, half of the supernatant is refreshed with new IL-2 media and 200 uL of old supernatant is collected for p24 analysis, and the removed volume is replaced with fresh complete medium supplemented with IL-2 and bNAb of choice. Every 14 days, fresh \\u003cem\\u003eex vivo\\u003c/em\\u003e CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells were replenished via spinoculation with infected media. Prior to spinoculation, the infected supernatant is incubated, usually with increased bNAb concentration, for 30 minutes to apply bNAb pressure without the presence of CD4\\u0026thinsp;+\\u0026thinsp;T cells. CD4\\u003csup\\u003e+\\u003c/sup\\u003e T cells grown in culture for previous 14 days were replenished with fresh complete RPMI medium for 24 hours. Aliquots of viral supernatant were taken for phenotypic and genotypic assays.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eHere we describe an assay to elucidate neutralization resistance mutations to broadly neutralizing antibodies in order to study viral escape pathways from genetically diverse envelope proteins. Our assay improves upon traditional assays that increase antibody concentration by providing a standardized MOI and scheme to increase bNAb concentration throughout the assay to potentially decrease the time to bNAb resistance for more efficient observations of viral escape. Through multiple screening experiments with both infectious molecular clones and donor derived replication viruses, we determined that an MOI of 1 is ideal to enhance viral replication to high levels and generate the most genetic variation to increase the chances of seeing viral escape when cultured in the presence of bNAbs. In our main preliminary experiment to test time to escape using our optimized assay, we observed complete neutralization resistance by day 42 in the presence of increasing antibody concentration for both VRC01 and 10-1074, although resistance may have started increasing by day 28. Throughout this experiment, we increased bNAb concentration three separate times before resistance was developed between day 28 and 42. In subsequent experiments, we have only increased bNAb concentrations at the two-week target cell refresh points allowing for virus supernatant to be incubated with the increased bNAb concentrations before spinoculation infection of new target cells. Our hypothesis is that this allows increased virus-bNAb contact during this incubation before viral transmission becomes mostly cell-to-cell transmission, making bNAb accessibility and neutralization more difficult.\\u003c/p\\u003e\\u003cp\\u003eIn our experiments, we demonstrate that this assay can recapitulate multiple escape mutations seen previously \\u003cem\\u003ein vivo\\u003c/em\\u003e in bNAb clinical trials and in other \\u003cem\\u003ein vitro\\u003c/em\\u003e work, emphasizing its merit as use for enhancing viral escape knowledge before bNAb use in the clinic. For VRC01, we observed two major mutations that occurred in the CD4 binding site of the envelope, D279K in loop D and G459D in V5. Antigenic profiling assays also report viral escape mutations at these positions in both BG505 (subtype A) and ADA (subtype B) cultures \\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. Mutations at these positions were also noted as \\u003cem\\u003ein vivo\\u003c/em\\u003e viral escape mutations in the individual from whom VRC01 was isolated as well as in humanized mouse models with VRC01 infusion, highlighting their importance \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. When tested as prevention, it is of interest is that mutations at both of these positions were also observed in participants who developed complete resistance to VRC01 in the antibody mediated prevention (AMP) trial when viral escape was studied in participants who became infected with HIV after VRC01 infusion \\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e. Also of note is the observation of the gp41 mutation A561T in the VRC01 treated wells at day 28. Although not in the bNAb epitope, this mutation has been previously described to increase resistance to CD4 mimetic DMJ-II-121 but not bNAbs when inserted into a YU2 backbone \\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. When we tested YU2-A561T neutralization sensitivity to VRC01 was not impacted, and thus must be tested further to determine its role as a possible compensatory mutation. For 10-1074 escape, the only mutation that we observed in the antibody condition wells was a single amino acid substitution of S334N, which shifts the N332 glycan that is pivotal to 10-1074 binding to position 334 and confers complete neutralization resistance. Mutations altering the N332 glycan are extremely well documented and commonly seen in clinical trials that administer 10-1074 to PWH \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e. The fact that this assay identifies clinically relevant mutations emphasizes its utility for testing bNAb combinations that would be useful in future clinical trials. Further experiments should be done to confirm the reproducibility of these mutation and to test the assay\\u0026rsquo;s ability to predict common mutation pathways across genetically variable subtypes.\\u003c/p\\u003e\\u003cp\\u003eThe use of this assay provides the ability to test bNAb monoclonal and combination therapies \\u003cem\\u003ein vitro\\u003c/em\\u003e in order to better inform clinical trial design. This assay can also potentially be used in order to better understand the replication costs or advantages of certain bNAb escape mutations and their compensatory counterparts, which has the ability to inform researchers of secondary targets in combination therapies. Here we demonstrate that this optimized \\u003cem\\u003ein vitro\\u003c/em\\u003e viral escape assay has the ability to not only recapitulate previously seen mutations from clinical trials, but also provide information on potential compensatory mutations that may be occurring to lead to better combination therapy design for a HIV-1 cure strategies utilizing broadly neutralizing antibodies.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eEthics approval and consent to participate\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eConsent for publication\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAvailable upon request.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003cem\\u003eAvailability of data and materials\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eCompeting interests\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eFunding\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research was funded in part by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health grant number\\u0026nbsp;T32 AI158105 as a training grant to TM and grant number R01 AI152770 to RML.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eAuthors' contributions\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTM performed and collected the generated \\u003cem\\u003ein vitro\\u003c/em\\u003e data, performed all analyses with GraphPad Prism, Geneious Software and LANL Highlighter and wrote the paper. RL conceptualized the ideas, designed preliminary experiments and analyses and wrote the paper.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eAcknowledgements\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe acknowledge the people living with HIV from whom the viral species studied in this paper were obtained, for without them this research would not be possible. We thank previous lab members Andrew Wilson and Anjali Bhatnagar for generation of virus reagents and Maria Korom for performing preliminary neutralization sensitivity curves. We thank Gabe Galeotos and Thomas DeStefanis for their helpful feedback on this manuscript. Teresa Murphy is a predoctoral student in the Microbiology and Immunology Program of the Integrated Biomedical Sciences Program at the George Washington University. This work is from a dissertation to be presented to the above program in partial fulfillment of the requirements for the Ph.D. degree.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eMalik B, Ghatol A. Understanding How Monoclonal Antibodies Work. In: \\u003cem\\u003eStatPearls\\u003c/em\\u003e. StatPearls Publishing; 2025. Accessed June 6, 2025. http://www.ncbi.nlm.nih.gov/books/NBK572118/\\u003c/li\\u003e\\n\\u003cli\\u003eWeiner GJ. Building better monoclonal antibody-based therapeutics. \\u003cem\\u003eNat Rev Cancer\\u003c/em\\u003e. 2015;15(6):361-370. doi:10.1038/nrc3930\\u003c/li\\u003e\\n\\u003cli\\u003eRijal P, Donnellan FR. A review of broadly protective monoclonal antibodies to treat Ebola virus disease. \\u003cem\\u003eCurr Opin Virol\\u003c/em\\u003e. 2023;61:101339. doi:10.1016/j.coviro.2023.101339\\u003c/li\\u003e\\n\\u003cli\\u003eFocosi D, McConnell S, Casadevall A, Cappello E, Valdiserra G, Tuccori M. Monoclonal antibody therapies against SARS-CoV-2. \\u003cem\\u003eLancet Infect Dis\\u003c/em\\u003e. 2022;22(11):e311-e326. doi:10.1016/S1473-3099(22)00311-5\\u003c/li\\u003e\\n\\u003cli\\u003eOverbaugh J, Morris L. The Antibody Response against HIV-1. \\u003cem\\u003eCold Spring Harb Perspect Med\\u003c/em\\u003e. 2012;2(1):a007039. doi:10.1101/cshperspect.a007039\\u003c/li\\u003e\\n\\u003cli\\u003eBurton DR, Mascola JR. Antibody responses to envelope glycoproteins in HIV-1 infection. \\u003cem\\u003eNat Immunol\\u003c/em\\u003e. 2015;16(6):571-576. doi:10.1038/ni.3158\\u003c/li\\u003e\\n\\u003cli\\u003eWilson A, Lynch RM. Embracing diversity: how can broadly neutralizing antibodies effectively target a diverse HIV-1 reservoir? \\u003cem\\u003eCurr Opin Pharmacol\\u003c/em\\u003e. 2020;54:173-178. doi:10.1016/j.coph.2020.10.004\\u003c/li\\u003e\\n\\u003cli\\u003eLynch RM, Shen T, Gnanakaran S, Derdeyn CA. Appreciating HIV Type 1 Diversity: Subtype Differences in Env. \\u003cem\\u003eAIDS Res Hum Retroviruses\\u003c/em\\u003e. 2009;25(3):237-248. doi:10.1089/aid.2008.0219\\u003c/li\\u003e\\n\\u003cli\\u003eSwanstrom R, Coffin J. HIV-1 Pathogenesis: The Virus. \\u003cem\\u003eCold Spring Harb Perspect Med\\u003c/em\\u003e. 2012;2(12):a007443. doi:10.1101/cshperspect.a007443\\u003c/li\\u003e\\n\\u003cli\\u003eGriffith SA, McCoy LE. To bnAb or Not to bnAb: Defining Broadly Neutralising Antibodies Against HIV-1. \\u003cem\\u003eFront Immunol\\u003c/em\\u003e. 2021;12. doi:10.3389/fimmu.2021.708227\\u003c/li\\u003e\\n\\u003cli\\u003eMahomed S, Pillay K, Hassan-Moosa R, et al. Clinical trials of broadly neutralizing monoclonal antibodies in people living with HIV \\u0026ndash; a review. \\u003cem\\u003eAIDS Res Ther\\u003c/em\\u003e. 2025;22:44. doi:10.1186/s12981-025-00734-8\\u003c/li\\u003e\\n\\u003cli\\u003eLynch RM, Wong P, Tran L, et al. HIV-1 fitness cost associated with escape from the VRC01 class of CD4 binding site neutralizing antibodies. \\u003cem\\u003eJ Virol\\u003c/em\\u003e. 2015;89(8):4201-4213. doi:10.1128/JVI.03608-14\\u003c/li\\u003e\\n\\u003cli\\u003eScheid JF, Horwitz JA, Bar-On Y, et al. HIV-1 antibody 3BNC117 suppresses viral rebound in humans during treatment interruption. \\u003cem\\u003eNature\\u003c/em\\u003e. 2016;535(7613):556-560. doi:10.1038/nature18929\\u003c/li\\u003e\\n\\u003cli\\u003eDingens AS, Arenz D, Weight H, Overbaugh J, Bloom JD. An Antigenic Atlas of HIV-1 Escape from Broadly Neutralizing Antibodies Distinguishes Functional and Structural Epitopes. \\u003cem\\u003eImmunity\\u003c/em\\u003e. 2019;50(2):520-532.e3. doi:10.1016/j.immuni.2018.12.017\\u003c/li\\u003e\\n\\u003cli\\u003eOtsuka Y, Schmitt K, Quinlan BD, et al. Diverse pathways of escape from all well-characterized VRC01-class broadly neutralizing HIV-1 antibodies. \\u003cem\\u003ePLoS Pathog\\u003c/em\\u003e. 2018;14(8):e1007238. doi:10.1371/journal.ppat.1007238\\u003c/li\\u003e\\n\\u003cli\\u003eSchmidt F, Weisblum Y, Rutkowska M, et al. High genetic barrier to SARS-CoV-2 polyclonal neutralizing antibody escape. \\u003cem\\u003eNature\\u003c/em\\u003e. 2021;600(7889):512-516. doi:10.1038/s41586-021-04005-0\\u003c/li\\u003e\\n\\u003cli\\u003eReil H, H\\u0026ouml;xter M, Moosmayer D, Pauli G, Hauser H. CD4 Expressing Human 293 Cells as a Tool for Studies in HIV-1 Replication: The Efficiency of Translational Frameshifting Is Not Altered by HIV-1 Infection. \\u003cem\\u003eVirology\\u003c/em\\u003e. 1994;205(1):371-375. doi:10.1006/viro.1994.1655\\u003c/li\\u003e\\n\\u003cli\\u003eSarzotti-Kelsoe M, Bailer RT, Turk E, et al. Optimization and Validation of the TZM-bl Assay for Standardized Assessments of Neutralizing Antibodies Against HIV-1. \\u003cem\\u003eJ Immunol Methods\\u003c/em\\u003e. 2014;0:131-146. doi:10.1016/j.jim.2013.11.022\\u003c/li\\u003e\\n\\u003cli\\u003eEnick PN, Brooker JP, Tumiotto CM, et al. Comparison of methods to quantify inducible HIV-1 outgrowth. \\u003cem\\u003eJ Virus Erad\\u003c/em\\u003e. 2021;7(2):100043. doi:10.1016/j.jve.2021.100043\\u003c/li\\u003e\\n\\u003cli\\u003eWilson A, Shakhtour L, Ward A, et al. Characterizing the Relationship Between Neutralization Sensitivity and env Gene Diversity During ART Suppression. \\u003cem\\u003eFront Immunol\\u003c/em\\u003e. 2021;12. doi:10.3389/fimmu.2021.710327\\u003c/li\\u003e\\n\\u003cli\\u003eRamakrishnan MA. Determination of 50% endpoint titer using a simple formula. \\u003cem\\u003eWorld J Virol\\u003c/em\\u003e. 2016;5(2):85. doi:10.5501/wjv.v5.i2.85\\u003c/li\\u003e\\n\\u003cli\\u003eSalazar-Gonzalez JF, Salazar MG, Keele BF, et al. Genetic identity, biological phenotype, and evolutionary pathways of transmitted/founder viruses in acute and early HIV-1 infection. \\u003cem\\u003eJ Exp Med\\u003c/em\\u003e. 2009;206(6):1273-1289. doi:10.1084/jem.20090378\\u003c/li\\u003e\\n\\u003cli\\u003eMontefiori DC. Measuring HIV Neutralization in a Luciferase Reporter Gene Assay. In: Prasad VR, Kalpana GV, eds. \\u003cem\\u003eHIV Protocols\\u003c/em\\u003e. Humana Press; 2009:395-405. doi:10.1007/978-1-59745-170-3_26\\u003c/li\\u003e\\n\\u003cli\\u003eRen Y, Korom M, Truong R, et al. Susceptibility to Neutralization by Broadly Neutralizing Antibodies Generally Correlates with Infected Cell Binding for a Panel of Clade B HIV Reactivated from Latent Reservoirs. \\u003cem\\u003eJ Virol\\u003c/em\\u003e. 2018;92(23):e00895-18. doi:10.1128/JVI.00895-18\\u003c/li\\u003e\\n\\u003cli\\u003eLynch RM, Tran L, Louder MK, et al. The Development of CD4 Binding Site Antibodies during HIV-1 Infection. \\u003cem\\u003eJ Virol\\u003c/em\\u003e. 2012;86(14):7588-7595. doi:10.1128/jvi.00734-12\\u003c/li\\u003e\\n\\u003cli\\u003eZacharopoulou P, Ansari MA, Frater J. A calculated risk: Evaluating HIV resistance to the broadly neutralising antibodies10-1074 and 3BNC117. \\u003cem\\u003eCurr Opin HIV AIDS\\u003c/em\\u003e. 2022;17(6):352-358. doi:10.1097/COH.0000000000000764\\u003c/li\\u003e\\n\\u003cli\\u003eCaskey M, Schoofs T, Gruell H, et al. Antibody 10-1074 suppresses viremia in HIV-1-infected individuals. \\u003cem\\u003eNat Med\\u003c/em\\u003e. 2017;23(2):185-191. doi:10.1038/nm.4268\\u003c/li\\u003e\\n\\u003cli\\u003eDiskin R, Klein F, Horwitz JA, et al. Restricting HIV-1 pathways for escape using rationally designed anti\\u0026ndash;HIV-1 antibodies. \\u003cem\\u003eJ Exp Med\\u003c/em\\u003e. 2013;210(6):1235-1249. doi:10.1084/jem.20130221\\u003c/li\\u003e\\n\\u003cli\\u003eKlein F, Halper-Stromberg A, Horwitz JA, et al. HIV therapy by a combination of broadly neutralizing antibodies in humanized mice. \\u003cem\\u003eNature\\u003c/em\\u003e. 2012;492(7427):118-122. doi:10.1038/nature11604\\u003c/li\\u003e\\n\\u003cli\\u003eCohen P, Lambson BE, Mkhize NN, et al. Resistance mutations that distinguish HIV-1 envelopes with discordant VRC01 phenotypes from multi-lineage infections in the HVTN703/HPTN081 trial: implications for cross-resistance. \\u003cem\\u003eJ Virol\\u003c/em\\u003e. 99(2):e01730-24. doi:10.1128/jvi.01730-24\\u003c/li\\u003e\\n\\u003cli\\u003ePacheco B, Alsahafi N, Debbeche O, et al. Residues in the gp41 Ectodomain Regulate HIV-1 Envelope Glycoprotein Conformational Transitions Induced by gp120-Directed Inhibitors. \\u003cem\\u003eJ Virol\\u003c/em\\u003e. 2017;91(5):e02219-16. doi:10.1128/JVI.02219-16\\u003c/li\\u003e\\n\\u003cli\\u003eMeijers M, Vanshylla K, Gruell H, Klein F, L\\u0026auml;ssig M. Predicting in vivo escape dynamics of HIV-1 from a broadly neutralizing antibody. \\u003cem\\u003eProc Natl Acad Sci\\u003c/em\\u003e. 2021;118(30):e2104651118. doi:10.1073/pnas.2104651118\\u003c/li\\u003e\\n\\u003cli\\u003eZacharopoulou P, Lee M, Oliveira T, et al. Prevalence of resistance-associated viral variants to the HIV-specific broadly neutralising antibody 10-1074 in a UK bNAb-na\\u0026iuml;ve population. \\u003cem\\u003eFront Immunol\\u003c/em\\u003e. 2024;15. doi:10.3389/fimmu.2024.1352123\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Broadly neutralizing antibodies, HIV viral escape, in vitro viral escape\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7123859/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7123859/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cem\\u003eIn vitro\\u003c/em\\u003e models to study HIV-1 escape from broadly neutralizing antibodies (bNAbs) are highly important for designing \\u003cem\\u003ein vivo\\u003c/em\\u003e bNAb combination therapy. Frequently, short-term viral escape is studied in cell lines, which do not express physiological levels of receptors or with antigenic libraries that do not allow for the observation of concurrent escape or compensatory mutations. We designed an \\u003cem\\u003ein vitro\\u003c/em\\u003e viral escape assay to measure the ability of HIV-1 to escape from single bNAbs in a high-throughput manner. We tested the multiplicity of infection (MOI) of virus, cloned and uncloned virus stocks, and different concentrations of antibody. From these results, we developed a 56-day assay to measure escape from bNAbs by adding multiple concentrations of antibody that is gradually increased over time. In this assay, we observed both common escape mutations previously published, but also novel mutations that could be either escape or compensatory mutations. This \\u003cem\\u003ein vitro\\u003c/em\\u003e bNAb escape assay will lead to a deeper understanding of viral escape, to better inform the design of highly effective bNAb cocktails targeting multiple conserved sites.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Development of In Vitro Assay for Viral Escape from Broadly Neutralizing Antibodies\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-07-24 19:55:27\",\"doi\":\"10.21203/rs.3.rs-7123859/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"360171a4-e32f-4c95-84fc-852d003fcb04\",\"owner\":[],\"postedDate\":\"July 24th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-09-02T18:23:28+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-07-24 19:55:27\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7123859\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7123859\",\"identity\":\"rs-7123859\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}