{"paper_id":"44d291fc-be8c-4617-b991-4f8aa18cd6e6","body_text":"Cadmium induced mitochondria apoptosis via the reduction of Th2 cells in pig thyroids | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cadmium induced mitochondria apoptosis via the reduction of Th2 cells in pig thyroids Yilei Zhang, Xiaojing Liu, Wenyue Zhang, Jing Lan, Gang Sun This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2085246/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Cadmium, as an environmental pollution element, is considered as a strong toxic substance of organisms. High doses of cadmium have serious cytotoxicity and induces programmed cell necrosis, autophagy, and apoptosis. Th1/Th2 balance is involved in regulating the dynamic balance of cytokine networks and is closely related to the occurrence and development of a variety of diseases. The purpose of this study was to investigate the relationship between Th1/Th2 balance and cadmium-induced apoptosis of thyroid cells. Cadmium poisoning pig model was established in which healthy 6-week-old pigs were exposed to CdCl2 for 40 days (with a dietary cadmium content of 20mg/kg). First, apoptosis was detected by TUNEL staining, and Th1/Th2 equilibrium shift was detected by immunofluorescence. Secondly, the mRNA and protein expression of related proteins were detected by qRT-PCR and Western blot. The results showed that the Th1/Th2 balance shifted towards Th1 and Th2 cells decreased；and the expression levels of Ras/Raf/MEK/ERK pathway related proteins were inhibited in group Cd. In addition, Bax, CytC, Caspase9, and Caspase3 expression increased and Bcl2 expression decreased after cadmium exposure. In brief, our experiments suggested that the pro-apoptosis-related genes expression upregulates and apoptosis induces by activating the mitochondrial pathway signaling pathway in thyroid cells after Cadmium exposure. These negative effects are in connection with the Th1/Th2 imbalance and the reduction of Th2 cytokines. Cadmium Pig Thyroid Th1/Th2 balance Mitochondria apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 1 Introduction Cadmium (Cd) is widely distributed in the environment as heavy metal element. When it accumulates in the body, it will damage the health of the humans and animals. Studies have shown that the thyroid is also one of the targeted organs for Cd, and Cd poisoning causes thyroid injury (Buha et al. 2018 ). For example, Cd causes thyroid dysfunction by altering the gene expression on the HPT axis of minnow larvae (Li et al. 2014 ). Cd induces apoptosis in humans and animals. Cd induces apoptosis bronchial epithelial cells by activating the mitochondrial intrinsic apoptosis pathway in human(Cao et al. 2021 ), and can also induce apoptosis testicular stromal cells in mouse(Ren et al. 2020 ). Mitochondria-mediated apoptosis plays an important role in apoptosis induced by Cd poisoning. Cd induces apoptosis of rat osteoblasts by activating tumor protein p53 (P53) protein in mitochondrial apoptotic pathway (Zheng et al. 2020 ). Inhibition of mitochondria-mediated apoptosis has a strong protective effect on Cd-induced testicular injury in mice (Han et al. 2020 ). Helper T cells (Th cells) are classified into two subgroups, Th1 cell and Th2 cell, according to the cytokines they secrete. Cytokines secreted by Th1 and Th2 cell not only promote their own proliferation, but also inhibit each other's proliferation. There is a relatively balanced state in healthy animals of Th1 and Th2 cell. Cd poisoning also induces Th1/Th2 cell immune drift. For example, Cd poisoning causes Th1/Th2 balance to shift to Th1 in the pancreas of pigs (Wu et al. 2021 ). IL-6 and interferon-γ (IFN-γ) as Th1 cell markers expression is increased, and IL-10 as Th2 cell markers expression is decreased in Cd poisoning rat testis (Sivaprakasam and Nachiappan 2016). Body could be damaged when Th1/Th2 balance is deviated. Fluoride and manganese, for example, interfere with the Th1/Th2 cell balance, thereby damaging the spleen of mice (Li et al. 2021 ) and the nervous system of chickens (Miao et al. 2021 ). Immune drift of Th1/Th2 cell also induces thyroid damage. For example, Th1/Th2 imbalance mediates DINP-induced thyroid injury in rats (Duan et al. 2019 ), while ATMSC reduces thyroid inflammatory damage in rats by down-regulating Th1 cytokines and improving Th1/Th2 balance (Choi et al. 2011 ). When the balance of Th1/Th2 shifts to Th1, it also causes apoptosis. Hydrogen sulfide induces apoptosis by inducing Th1/Th2 homeostasis shift towards Th1 in the bursa of Fabricius of broilers (Hu, Chi, et al. 2018 ). The increased expression of IFN-γ and IL-2 as Th1 cell markers and the decreased expression of IL-6 and IL-10 as Th2 cell markers, accompanied by myocardial apoptosis in the serum of rats with autoimmune myocarditis. However, decreased expressions of IFN-γ and IL-2 and increased expressions of IL-6 and IL-10 inhibit myocardial apoptosis (Xue et al. 2019 ). Apoptosis could be regulated via rat sarcoma (Ras) /rapidly accelerated fibrosarcoma (Raf) /MAP kinase-ERK kinase (MEK) /extracellular regulated MAP kinase (ERK) cascade pathway. Inhibition of ERK1/2 expression in liver cancer (Tian et al. 2021 ) and colorectal cancer (Odintsov et al. 2021 ) cells promotes apoptosis, and inhibition of MEK1/2 expression in melanoma cells also promotes apoptosis (Mielczarek-Lewandowska et al. 2019 ). Activation of Ras/Raf/MEK/ERK cascade pathway alleviates LPS-induced apoptosis of renal podocytes in mice (Li, Ma, and Liu 2019 ). As members of the B lymphoma gene family, BCL2 like 11 (Bim), Bcl2 Associated X (Bax), and B-cell lymphoma-2 (Bcl2) play a crucial role in mitochondria apoptosis pathway (Maes, Schlamp, and Nickells 2017 ). Promotion of ERK-mediated Bim degradation inhibits apoptosis in rat PC12 cells (Kennedy et al. 2017 ), while inhibition of ERK or pERK induces apoptosis by reducing Bim degradation (Sun et al. 2019 ). The levels of apoptosis-related cytokines such as mitochondrial cytochrome C (CytC), Caspase9 and Caspase3 all increase at different levels during apoptosis (Kalpage et al. 2020 ). Although more and more evidence has shown that Cd poisoning may induce immune drift of Th1/Th2 cell and apoptosis, the relationship of Th1/Th2 balance and apoptosis which is cause by Cd poisoning in pig thyroid cells is still unclear. The levels of Th1/Th2 markers, Ras/Raf/MEK/ERK cascade pathway and mitochondrial apoptotic pathway related factors in were detected by TUNEL, immunofluorescence, qRT-PCR and Western Blot. These data provide toxicological study of Cd and comparative medicine theoretical basis and reference basis. 2 Materials And Methods 2.1 Cd poisoning animal model establishment and grouping All procedures in the experiment were consistent with the animal welfare standards of the Northeast Agricultural University Animal Protection and Utilization Committee. Ten healthy 6-week-old pigs were randomly divided into two groups of 5 pigs each. The control group (group C) was fed normally, while the Cd poisoning group (group Cd) was fed with the diet containing 20mg/kg cadmium chloride (CdCl 2 ). On the 40th day, the pigs were euthanized, the thyroid tissue was extracted and partially fixed in 10% formalin, and left part was placed in liquid nitrogen for further use. 2.2 TUNEL assay in thyroid tissue To analyze Cd intoxication-induced apoptosis of thyroid cells, TUNEL analysis was performed using an insitu cell death detection kit (luciferin, Roche, Basel, Switzerland). Tunel staining for DNA fragments is considered a standard technique for detecting apoptosis in tissue sections. The experiment was in accordance with the manufacturer's instructions and the samples were observed under a fluorescence microscope after reverse-fluorescence quenching. Sections were randomly selected from each sample, and used a high-power field of vision (×400) to count the number of positive cells in each thyroid section. 2.3 Immunofluorescence analysis Frozen sections of 5µm thyroid were taken and stained with DAPI. T lymphocyte specific anti-tumor necrosis factor alpha (TNF-α) antibody (ABCAM) and anti-CC motif chemokine receptor 4 (CCR4) antibody (ABCAM) were used to stain Th1 and Th2 subgroups of frozen thyroid sections, respectively. Use Nikon's fluorescence microscope for observation and image acquisition. 2.4 Real-time quantitative PCR analysis Total RNA was extracted from thyroid tissue by using Trizol reagent according to the manufacturer's instructions, and the reverse transcription step for cDNA was also based on the manufacturer's instructions (Roche, Shanghai, China). qRT-PCR was performed using the 480 system (Roche, Basel, Switzerland) and Fast Universal SYBR Green Master Mix (Roche, Basel, Switzerland). The primers used in our experiment were showed in Table 1 . Only the peak of each PCR product was shown in the melting curve analysis. The relative gene abundance of mRNAs was calculated by 2 −ΔΔCT method, and the gene-specific efficiency was considered, and normalized to the mean value of the above indexes. Table 1 The primers used in the present study Target gene Forward Primer (5′→ 3′) Reverse Primer (5′→ 3′) β-actin AATCCTGCGGCATCCACGAAAC CAGCACCGTGTTGGCGTAGAG IFN-γ GTGCGACGACCCTGATGCTG CTGACGGATTCACTGCTGCTCTTC TNF-α GCACTGAGAGCATGATCCGAGAC CGACCAGGAGGAAGGAGAAGAGG CCR4 ACGAGAAGAAGAACAAGGCAGTGAAG CCAGGAAGAGCACCACATTGTAAGG IL-4 GCTTCGGCACATCTACAGACACC TCTTGGCTTCATGCACAGAACAGG SHC1 AGGAAGAGCCGCCTGACCATC TCCCGAAGCCTCATGTCCACTAC GRB2 GGACATAGAACAGGTGCCACAGC ACCAGTTGGGGTCCGAGTTATCC SOS1 TCCTCCTGCTTCTGGTGCTTCTAG AAAGACGGTATCGCTGCTTGAGTG KRas AAAGACGGTATCGCTGCTTGAGTG TACTCCTCTTGACCTGCTGTGTCG Raf-1 AATGCGTCGGATGCGAGAATCTG AGAGGAAGGGCTGGAGGTGTTG MEK-1 TCGATGAACAGCAGCGGAAGC ACCTTGAACACCACACCTCCATTG MEK-2 CGCTCACCATCAACCCTACCATC TTCTTCTGCTGCTCGTCAAGTTCC ERK1 ACCTACTGCCAGCGGACCTTG AGAATGTCTCGGATGCCAATGACG ERK2 AACCTTCCAACCTGCTGCTCAAC CCAACGTGTGGCGACATACTCC Bim GCAGGAGTTACGGCGTATTGGAG AGGGAGGGTGTGAGGGGAAAAG Bax TTTGCTTCAGGGTTTCATCCAGGATC GAGACACTCGCTCAACTTCTTGGTAG CytC TTGTTCAGAAGTGTGCCCAGTGC CTGACCTGTCTTCCGCCCAAAG Caspase9 TCCTGTGTTCATCTCCTGCTTAG CCCGCTTTGTTGCTTGTCTAC Caspase3 CTGTAGAACTCTAACTGGCAAACC CCCACTGTCCGTCTCAATCC P53 GCCCATCCTCACCATCATCACAC GCACAAACACGCACCTCAAAGC Bcl2 CAGAGGGGCTACGAGTGGGATG CCGGGCTGGGAGGAGAAGATG 2.5 Western blot analysis The total protein was electrophoresed in a 12% SDS-polyacrylamide gel, and the separated protein was transferred to a nitrocellulose membrane in a Tris-glycine buffer containing 20% methanol at 4°C. The membrane was covered with 5% skimmed milk and blocked at 37°C for 2 h, and then incubated with diluted anti-rabbit primary antibody at 4°C overnight. the diluted concentration was shown in Table 2 . It was then combined with peroxidase-conjugated anti-rabbit secondary antibody IgG (1:5000, Santa Cruz, USA) at 37°C for 50 min. Finally, X-ray film (Transgen Biotech Co., Beijing, China) was used to detect the signal. Table 2 The primary antibodies used in present study Target gene Dilution ratio Resource β-actin 1: 10000 ABclonal Biotechnology GRB2 1: 500 WanLei Biotechnology, China KRas 1: 500 WanLei Biotechnology, China Raf-1 1: 500 WanLei Biotechnology, China MEK1/2 1: 500 WanLei Biotechnology, China ERK1/2 1: 500 WanLei Biotechnology, China pERK1/2 1: 300 WanLei Biotechnology, China Bax 1: 500 WanLei Biotechnology, China CytC 1: 500 WanLei Biotechnology, China Caspase9 1: 1000 WanLei Biotechnology, China cleaved-Caspase9 1: 1000 WanLei Biotechnology, China Caspase3 1: 500 WanLei Biotechnology, China cleaved-Caspase3 1: 500 WanLei Biotechnology, China Bcl2 1: 300 Laboratory made 2.6 Statistical analysis GraphPad Prism software (version 8.0, GraphPad Software Inc., San Diego, California, U.S.) was used to analyze the data by t test for each group. All the date presented in this study were collected from at least three independent experiments(n = 3), and the data is reported as the mean standard ± deviation (SD). When p < 0.05, the difference is statistically significant. * p < 0.05, ** p < 0.01, *** p < 0.001. 3 Results 3.1 The number of apoptotic cells in thyroid tissue increased after Cd exposure In order to detect Cd-induced apoptosis of thyroid tissue cells, the TUNEL kit was first used to detect the thyroid tissue of group Cd and group C respectively. The results were shown in Fig. 1 . Compared with the group C, the number of TUNEL positive cells increased in the group Cd. 3.2 Abnormal levels of cytokines secreted by Th1/ Th2 cell in thyroid tissue Th1/Th2 cell balance is a basic pathway to regulate immune response. To explore the Cd-induced pig thyroid Th1/Th2 imbalance, we evaluated Th1/Th2 cell markers levels in the thyroid (Fig. 2 ). As shown in Fig. 2 (a), Cd regulated the Th1/Th2 imbalance, Th1 cells number increased while Th2 cells number decreased according to TNF-α and CCR4 staining. In Fig. 2 (b), mRNA levels of TNF-α and IFN-γ as Th1 cell markers in the group Cd were all upregulated compared with group C, while mRNA levels of Th2 cell marker IL-4 (interleukin 4), CCR4 were down-regulated in Fig. 2 (c) (p < 0.05). In summary, the immune response may be modulated by Cd, thus turning polarization homeostasis into a harmful phase. 3.3 Inhibitions of Ras/RAF/MEK/ERK pathway and related factors expression in thyroid tissue In order to determine whether IL-4 regulates apoptosis via Ras/Raf/MEK/ERK signaling pathway in thyroid tissue, the expression of this signaling pathway related factors were detected by qRT-PCR and Western Blot (Fig. 3 ). Compared with the group C, the mRNA expression levels of the downstream cytokines SHC1 (SHC adaptor protein 1), GRB2 (growth factor receptor bound protein 2), SOS1 (SOS Ras/Rac guanine nucleotide exchange factor 1), KRas, Raf-1, MEK1/2, and ERK1/2 of IL-4 in the group Cd were significantly down-regulated (Fig. 3 (a)); the protein level was consistent with it, and the protein expression level of pERK1/2 was significantly down-regulated (Fig. 3 (b), Fig. 3 (c)) (p < 0.05). These data suggest that Ras/Raf/MEK/ERK signaling pathway is inhibited in pig thyroid tissues after Cd exposure. 3.4 Increased expression of mitochondrial apoptotic pathway factors in thyroid Inhibition of Ras/Raf/MEK/ERK signaling pathway can activate mitochondria apoptosis pathway in vivo. To verify this hypothesis, we detected the expression levels of mitochondria apoptosis pathway related cytokines such as Bim, Bax, CytC, Caspase9, Caspase3, P53 and Bcl2 in thyroid by qRT-PCR and Western Blot (Fig. 4 ). Compared with the group C, the mRNA levels of Bim, Bax and CytC were significantly up-regulated in the group Cd, and the mRNA level of Bcl2 was significantly down-regulated (Fig. 4 (a)); the protein expression level was consistent with that (Fig. 4 (b), Fig. 4 (c)). This indicates a change in mitochondrial permeability and the release of CytC into the cytoplasm in thyroid. In addition, the mRNA levels of Caspase 9, Caspase 3 and P53 in the group Cd were all up-regulated (Fig. 4 (a)), the protein levels were consistent with them; and the protein expression levels of cleaved-caspase3 and cleaved-caspase9 were also up-regulated (Fig. 4 (b), Fig. 4 (c)) (p < 0.05) This result shows that mitochondria apoptosis occurs after Cd exposure in thyroid. 4 Discussion Apoptosis is one of the main forms of body damage caused by Cd. Cd poisoning can induce apoptosis in organs such as kidney (Chen et al. 2021 ) and liver (Yiming et al. 2021 ). Cd exposure causes the imbalance of Th1/Th2 and the changes in Th1/Th2 cell markers (Zheng et al. 2021 ). This study explores the relationship between Th1/Th2 imbalance and Cd-induced apoptosis in thyroid of pig. Our results show that the mitochondrial apoptotic pathways related factors expression increased significantly, such as Bim, Bax, CytC, Caspase9 and Caspase3. In the group Cd, the markers of Th1 cell IFN-γ and TNF-α increased, the markers of Th2 cell CCR4 and IL-4 decreased, and shifted the Th1/Th2 balance to Th1. ERK signaling pathway related factors were significantly down-regulated. Th1 cell markers such as TNF-α, IL-2, IFN-γ, etc. and Th2 cell markers such as IL-4, IL-10, etc. play an important role in the regulation of apoptosis (Feng et al. 2016 ). TNF-α and IFN-γ expression is increased, while IL-4 expression is decreased in Cd poisoning chicken neutrophils(Chen et al. 2017 ). The expression of TNF-α is also increased in Cd poisoning rat testis and the expression of IL-4 is also decreased in the same way (Al-Azemi et al. 2010 ). Moreover, the experiments of Wu et al. have also shown that TNF-α and IFN-γ expression is increased and IL-4 and CCR4 expression is decreased, causing Th1/Th2 imbalance in Cd poisoning pig pancreas (Wu et al. 2021 ). In this experiment, we detected the Th1 cell markers TNF-α, IFN-γ and Th2 cell markers IL-4 and CCR4 expression levels. The results showed that Th1 cell markers TNF-α and IFN-γ expression levels increased significantly in the group Cd, and Th2 cell markers CCR4 and IL-4 expression levels decreased significantly. This result indicates that Th1/Th2 cell balance shifts and Th2 cells are reduced in the thyroid of Cd poisoning pigs. These results suggest that Cd exposure causes Th1/Th2 cell imbalance and Th2 cell reduction in pig thyroid tissue. In macrophages, lead treatment leads to imbalance of Th1/Th2 cell and induces expression of Th1 cell markers such as IL-2 and IFN-γ (Krocova et al. 2000 ). The Th1/Th2 cytokine ratio in serum and liver of African green frog exposed to Cu, Cr, Pb and other heavy metals is more inclined to Th1, and the levels of IL-6 and IFN-γ in serum and TNF-α and IFN-γ in liver are significantly increased (Jayawardena et al. 2016 ). The Ras/Raf/MEK/ERK signaling pathway can be widely activated as a mitogen-activated protein kinase pathway, which can transfer extracellular signals into cells, thereby regulating cell apoptosis, proliferation and differentiation. The dysregulation of the Ras/Raf/MEK/ERK pathway controls the occurrence and development of apoptosis. For example, catechin-3-gallic acid induces apoptosis of human thyroid cancer cells by down-regulating the expression of the Ras/Raf/MEK/ERK pathway (Wu et al. 2019 ). And the apoptosis of human liver cancer cells could be induced by inhibiting of RaS/RAF/MEK/ERK signaling pathway (Tian et al. 2020 ). The Th2 cell markers IL-4 and CCR4 have regulatory effects on the Ras / Raf / MEK / ERK pathway. For example, IL-4 can interact with important upstream proteins of ERK signaling pathway SHC and GRB2 and activate ERK2 (Soon et al. 1999 ). IL-4 causes phosphorylation of ERK in the rat retina (Goulart et al. 2018 ). CCR4 can also activate the ERK signaling pathway. For example, in mice, CCR4 activates its downstream ERK signaling pathway and improves hematoma after cerebral hemorrhage (Deng et al. 2020 ). This result also confirms the above statement. When the Th1/Th2 balance shifts to Th1 cell, the Th2 cell markers IL-4 and CCR4 is decreased, inhibit the activation of the ERK signaling pathway, activate the mitochondrial pathway, and thyroid cells undergo apoptosis. Studies have also shown that the mitochondria apoptosis pathway could be activated by inhibiting the Ras/Raf/MEK/ERK pathway. For example, in mouse endometrial epithelial cells, inhibiting the Ras/Raf/MEK/ERK signaling pathway, the expression levels of Bax, Caspase3 increased and the expression level of Bcl2 decreased, which activates the mitochondria apoptosis pathway (Liu et al. 2020 ). In addition, Bhalla et al. demonstrated that MEK inhibitors mediated mitochondria apoptosis pathway in diffuse large B-cell lymphoma by inhibiting MEK/ERK pathway activation (Bhalla et al. 2011 ). And by up-regulating the expression of MEK/ERK in cervical cancer cells, the ratio of Bax to Bcl2 can be inhibited, and the lysis of Caspase9 and Caspase3 can be reduced, thereby inhibiting the mitochondrial apoptotic pathway (Hu, Zhang, et al. 2018 ). In granulosa cell KGN, Cd causes an increase in Bax level and a decrease in Bcl2 level by inducing mitochondrial dysfunction, leading to apoptosis (Xu et al. 2021 ). Cd can also activate the mitochondrial apoptotic pathway in rat neural stem cells (Luo et al. 2021 ). The above evidence validates our results, that is, Cd causes Th1/Th2 cell balance shift, Th2 cells decrease, inhibits Ras/Raf/MEK/ERK signaling pathway, and induces mitochondria apoptosis in pig thyroid. In conclusion, our study showed that the pig thyroid is one of the important target organs of Cd, and Cd can inhibit the expression of Ras/Raf/MEK/ERK pathway and activate the mitochondrial apoptosis pathway by interfering with Th1/Th2 balance and reducing Th2 cells. These results indicate that Cd induces mitochondria apoptosis in pig thyroid via reducing Th2 cell. This study aims to draw people's attention to the harm of soil environmental damage to humans and animals, and to provide a theoretical basis for the toxicological study of Cd. Declarations Ethics approval and consent to participate All procedures of this experiment were in accordance with animal welfare standards and the requirements of the Animal Protection and Utilization Committee of Northeast Agricultural University. Consent for publication All of authors have read the manuscript and have agreed to submit it in its current form for consideration for publication. Availability of data and material The authors claim that none of the material in the paper has been published or is under consideration for publication elsewhere. Competing interests We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Authors' contributions Yilei Zhang : Conceptualization, Methodology, Software, Investigation, Writing-original draft, Formal analysis, Visualization. Xiaojing Liu : Validation, Formal analysis, Software. Wenyue Zhang : Supervision, Data curation. Jing Lan and Gang Sun : Writing - review & editing. Acknowledgements All authors thank all members of the Key Laboratory of the Provincial Education Department of Heilongjiang for Common Animal Disease Prevention; Heilongjiang Provincial Animal Disease Prevention and Control Center; Institute of Quality and Safety of Agricultural Products, Heilongjiang Academy of Agricultural Sciences and Treatment in the College of Veterinary Medicine, Northeast Agricultural University, for their help in the experiment. References Al-Azemi, M, FE Omu, EO Kehinde, JT Anim, MA Oriowo, and AE Omu. 2010. 'Lithium protects against toxic effects of cadmium in the rat testes', <bi>Journal of assisted reproduction and genetics</bi>, 27: 469 – 76. Bhalla, S, AM Evens, B Dai, S Prachand, LI Gordon, and RB Gartenhaus. 2011. 'The novel anti-MEK small molecule AZD6244 induces BIM-dependent and AKT-independent apoptosis in diffuse large B-cell lymphoma', Blood, 118: 1052–61. Buha, A, V Matovic, B Antonijevic, Z Bulat, M Curcic, EA Renieri, AM Tsatsakis, A Schweitzer, and D Wallace. 2018. 'Overview of Cadmium Thyroid Disrupting Effects and Mechanisms', <bi>International journal of molecular sciences</bi>, 19. Cao, X, M Fu, R Bi, X Zheng, B Fu, S Tian, C Liu, Q Li, and J Liu. 2021. 'Cadmium induced BEAS-2B cells apoptosis and mitochondria damage via MAPK signaling pathway', <bi>Chemosphere</bi>, 263: 128346. Chen, J, W Lai, Y Deng, M Liu, M Dong, Z Liu, T Wang, X Li, Z Zhao, X Yin, J Yang, R Yu, and L Liu. 2021. 'MicroRNA-363-3p promotes apoptosis in response to cadmium-induced renal injury by down-regulating phosphoinositide 3-kinase expression', <bi>Toxicology letters</bi>, 345: 12–23. Chen, J, T Pan, N Wan, Z Sun, Z Zhang, and S Li. 2017. 'Cadmium-induced endoplasmic reticulum stress in chicken neutrophils is alleviated by selenium', <bi>Journal of inorganic biochemistry</bi>, 170: 169 – 77. Choi, EW, IS Shin, HW Lee, SY Park, JH Park, MH Nam, JS Kim, SK Woo, EJ Yoon, SK Kang, JC Ra, HY Youn, and SH Hong. 2011. 'Transplantation of CTLA4Ig gene-transduced adipose tissue-derived mesenchymal stem cells reduces inflammatory immune response and improves Th1/Th2 balance in experimental autoimmune thyroiditis', <bi>The journal of gene medicine</bi>, 13: 3–16. Deng, S, P Sherchan, P Jin, L Huang, Z Travis, JH Zhang, Y Gong, and J Tang. 2020. 'Recombinant CCL17 Enhances Hematoma Resolution and Activation of CCR4/ERK/Nrf2/CD163 Signaling Pathway After Intracerebral Hemorrhage in Mice', Neurotherapeutics : the journal of the American Society for Experimental NeuroTherapeutics , 17: 1940–53. Duan, J, T Deng, J Kang, and M Chen. 2019. 'DINP aggravates autoimmune thyroid disease through activation of the Akt/mTOR pathway and suppression of autophagy in Wistar rats', Environmental pollution <bi>(Barking, Essex: 1987)</bi>, 245: 316 – 24. Feng, Y, J Tian, HQ Xie, J She, SL Xu, T Xu, W Tian, H Fu, S Li, W Tao, L Wang, Y Chen, S Zhang, W Zhang, TL Guo, and B Zhao. 2016. 'Effects of Acute Low-Dose Exposure to the Chlorinated Flame Retardant Dechlorane 602 and Th1 and Th2 Immune Responses in Adult Male Mice', <bi>Environmental health perspectives</bi>, 124: 1406-13. Goulart, VG, GD Menezes, S Espírito-Santo, ADC Faria-Melibeu, CA Serfaty, and P Campello-Costa. 2018. 'Interleukin 4 Leads to Sustained Phosphorylation of the STAT6 and ERK Pathways in the Retina and Disrupts Subcortical Visual Circuitry in Rodents', Neuroimmunomodulation, 25: 96–102. Han, C, Y Zhu, Z Yang, S Fu, W Zhang, and C Liu. 2020. 'Protective effect of Polygonatum sibiricum against cadmium-induced testicular injury in mice through inhibiting oxidative stress and mitochondria-mediated apoptosis', <bi>Journal of ethnopharmacology</bi>, 261: 113060. Hu, G, J Zhang, F Xu, H Deng, W Zhang, S Kang, and W Liang. 2018. 'Stomatin-like protein 2 inhibits cisplatin-induced apoptosis through MEK/ERK signaling and the mitochondrial apoptosis pathway in cervical cancer cells', <bi>Cancer science</bi>, 109: 1357-68. Hu, X, Q Chi, D Wang, X Chi, X Teng, and S Li. 2018. 'Hydrogen sulfide inhalation-induced immune damage is involved in oxidative stress, inflammation, apoptosis and the Th1/Th2 imbalance in broiler bursa of Fabricius', <bi>Ecotoxicology and environmental safety</bi>, 164: 201-09. Jayawardena, UA, WD Ratnasooriya, DD Wickramasinghe, and PV Udagama. 2016. 'Heavy metal mediated innate immune responses of the Indian green frog, Euphlyctis hexadactylus (Anura: Ranidae): Cellular profiles and associated Th1 skewed cytokine response', <bi>The Science of the total environment</bi>: 1194 – 204. Kalpage, HA, J Wan, PT Morse, MP Zurek, AA Turner, A Khobeir, N Yazdi, L Hakim, J Liu, A Vaishnav, TH Sanderson, MA Recanati, LI Grossman, I Lee, BFP Edwards, and M Hüttemann. 2020. 'Cytochrome c phosphorylation: Control of mitochondrial electron transport chain flux and apoptosis', <bi>The international journal of biochemistry & cell biology</bi>, 121: 105704. Kennedy, D, K Mnich, D Oommen, R Chakravarthy, L Almeida-Souza, M Krols, S Saveljeva, K Doyle, S Gupta, V Timmerman, S Janssens, AM Gorman, and A Samali. 2017. 'HSPB1 facilitates ERK-mediated phosphorylation and degradation of BIM to attenuate endoplasmic reticulum stress-induced apoptosis', <bi>Cell death & disease</bi>, 8: e3026. Krocova, Z, A Macela, M Kroca, and L Hernychova. 2000. 'The immunomodulatory effect(s) of lead and cadmium on the cells of immune system in vitro', Toxicology in vitro : an international journal published in association with BIBRA , 14: 33–40. Li, X, A Ma, and K Liu. 2019. 'Geniposide alleviates lipopolysaccharide-caused apoptosis of murine kidney podocytes by activating Ras/Raf/MEK/ERK-mediated cell autophagy', <bi>Artificial cells, nanomedicine, and biotechnology</bi>, 47: 1524-32. Li, Y, X Du, Y Zhao, J Wang, and J Wang. 2021. 'Fluoride Can Damage the Spleen of Mice by Perturbing Th1/Th2 Cell Balance', <bi>Biological trace element research</bi>, 199: 1493 – 500. Li, ZH, L Chen, YH Wu, P Li, YF Li, and ZH Ni. 2014. 'Effects of waterborne cadmium on thyroid hormone levels and related gene expression in Chinese rare minnow larvae', Comparative biochemistry and physiology . Toxicology & pharmacology : CBP , 161: 53 – 7. Liu, X, L Zhang, L Yang, J Cui, S Che, Y Liu, J Han, X An, B Cao, and Y Song. 2020. 'miR-34a/c induce caprine endometrial epithelial cell apoptosis by regulating circ-8073/CEP55 via the RAS/RAF/MEK/ERK and PI3K/AKT/mTOR pathways', <bi>Journal of cellular physiology</bi>, 235: 10051-67. Luo, H, B Song, G Xiong, B Zhang, Z Zuo, Z Zhou, and X Chang. 2021. 'Cadmium inhibits neural stem/progenitor cells proliferation via MitoROS-dependent AKT/GSK-3β/β-catenin signaling pathway', Journal of applied toxicology : JAT . Maes, ME, CL Schlamp, and RW Nickells. 2017. 'Live-cell imaging to measure BAX recruitment kinetics to mitochondria during apoptosis', PloS one, 12: e0184434. Miao, Z, K Zhang, R Bao, J Li, Y Tang, and X Teng. 2021. 'Th1/Th2 imbalance and heat shock protein mediated inflammatory damage triggered by manganese via activating NF-κB pathway in chicken nervous system in vivo and in vitro', Environmental science and pollution research international . Mielczarek-Lewandowska, A, M Sztiller-Sikorska, M Osrodek, M Czyz, and ML Hartman. 2019. '17-Aminogeldanamycin selectively diminishes IRE1α-XBP1s pathway activity and cooperatively induces apoptosis with MEK1/2 and BRAF inhibitors in melanoma cells of different genetic subtypes', <bi>Apoptosis: an international journal on programmed cell death</bi>, 24: 596–611. Odintsov, I, AJW Lui, WJ Sisso, E Gladstone, Z Liu, L Delasos, RI Kurth, EM Sisso, M Vojnic, I Khodos, MS Mattar, E de Stanchina, SM Leland, M Ladanyi, and R Somwar. 2021. 'NRG1The Anti-HER3 mAb Seribantumab Effectively Inhibits Growth of Patient-Derived and Isogenic Cell Line and Xenograft Models with Oncogenic Fusions', <bi>Clinical cancer research: an official journal of the American Association for Cancer Research</bi>, 27: 3154-66. Ren, X, S Wang, C Zhang, X Hu, L Zhou, Y Li, and L Xu. 2020. 'Selenium ameliorates cadmium-induced mouse leydig TM3 cell apoptosis via inhibiting the ROS/JNK /c-jun signaling pathway', <bi>Ecotoxicology and environmental safety</bi>, 192: 110266. Sivaprakasam, C, and V Nachiappan. 2016. 'Modulatory effect of cadmium on the expression of phospholipase A2 and proinflammatory genes in rat testis', <bi>Environmental toxicology</bi>, 31: 1176-84. Soon, L, L Flechner, JS Gutkind, LH Wang, R Baserga, JH Pierce, and W Li. 1999. 'Insulin-like growth factor I synergizes with interleukin 4 for hematopoietic cell proliferation independent of insulin receptor substrate expression', <bi>Molecular and cellular biology</bi>, 19: 3816-28. Sun, QY, LW Ding, K Johnson, S Zhou, JW Tyner, H Yang, NB Doan, JW Said, JF Xiao, XY Loh, XB Ran, N Venkatachalam, Z Lao, Y Chen, L Xu, LF Fan, W Chien, DC Lin, and HP Koeffler. 2019. 'SOX7 regulates MAPK/ERK-BIM mediated apoptosis in cancer cells', <bi>Oncogene</bi>, 38: 6196 – 210. Tian, J, J Li, B Bie, J Sun, Y Mu, M Shi, S Zhang, G Kong, Z Li, and Y Guo. 2021. 'MiR-3663-3p participates in the anti-hepatocellular carcinoma proliferation activity of baicalein by targeting SH3GL1 and negatively regulating EGFR/ERK/NF-κB signaling', <bi>Toxicology and applied pharmacology</bi>, 420: 115522. Tian, X, J Geng, Q Zheng, L Wang, P Huang, J Tong, and S Zheng. 2020. 'Single high dose irradiation induces cell cycle arrest and apoptosis in human hepatocellular carcinoma cells through the Ras/Raf/MEK/ERK pathways', <bi>International journal of radiation biology</bi>, 96: 740 – 47. Wu, D, Z Liu, J Li, Q Zhang, P Zhong, T Teng, M Chen, Z Xie, A Ji, and Y Li. 2019. 'Epigallocatechin-3-gallate inhibits the growth and increases the apoptosis of human thyroid carcinoma cells through suppression of EGFR/RAS/RAF/MEK/ERK signaling pathway', <bi>Cancer cell international</bi>, 19: 43. Wu, H, S Zheng, J Zhang, S Xu, and Z Miao. 2021. 'Cadmium induces endoplasmic reticulum stress-mediated apoptosis in pig pancreas via the increase of Th1 cells', Toxicology , 457: 152790. Xu, G, S Liu, M Huang, X Jiang, and M Yang. 2021. 'Cadmium induces apoptosis of human granulosa cell line KGN via mitochondrial dysfunction-mediated pathways', <bi>Ecotoxicology and environmental safety</bi>, 220: 112341. Xue, YL, SX Zhang, CF Zheng, YF Li, LH Zhang, YF Hao, S Wang, and XW Li. 2019. 'Silencing of STAT4 Protects Against Autoimmune Myocarditis by Regulating Th1/Th2 Immune Response via Inactivation of the NF-κB Pathway in Rats', <bi>Inflammation</bi>, 42: 1179-89. Yiming, Z, L Zhaoyi, L Jing, W Jinliang, S Zhiqiang, S Guangliang, and L Shu. 2021. 'Cadmium induces the thymus apoptosis of pigs through ROS-dependent PTEN/PI3K/AKT signaling pathway', Environmental science and pollution research international . Zheng, J, L Zhuo, D Ran, Y Ma, T Luo, H Zhao, R Song, H Zou, J Zhu, J Gu, J Bian, Y Yuan, and Z Liu. 2020. 'Cadmium induces apoptosis via generating reactive oxygen species to activate mitochondrial p53 pathway in primary rat osteoblasts', <bi>Toxicology</bi>, 446: 152611. Zheng, X, X Xu, F Lu, Q Wang, Z Zeng, and X Huo. 2021. 'High serum IgG subclass concentrations in children with e-waste Pb and Cd exposure', <bi>The Science of the total environment</bi>, 764: 142806. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2085246\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":138641295,\"identity\":\"a5ebe616-d7e0-4635-a77c-d08812bea7a8\",\"order_by\":0,\"name\":\"Yilei Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Northeast Agricultural University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yilei\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":138641296,\"identity\":\"9f4eaeb7-ac59-42f3-9fdf-e69038dd3705\",\"order_by\":1,\"name\":\"Xiaojing Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Northeast Agricultural University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaojing\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":138641297,\"identity\":\"acb5e8aa-7064-408b-8206-bb45faa25dab\",\"order_by\":2,\"name\":\"Wenyue Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Northeast Agricultural University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wenyue\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":138641298,\"identity\":\"232aa3db-007e-470e-a46f-f8b158ee580b\",\"order_by\":3,\"name\":\"Jing Lan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing\",\"middleName\":\"\",\"lastName\":\"Lan\",\"suffix\":\"\"},{\"id\":138641299,\"identity\":\"57aa8495-43b7-45dc-bd16-dbea88d0b810\",\"order_by\":4,\"name\":\"Gang Sun\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYBADHsb5BxsfJFTYEK9FjnkGc7PBgzNpxGsxZp/B3ib5sO0QYaXyM3IPv/i5ozaxd3ZjW0UC2wEG/vbuBLxaDG7kpVn2njmeOHPOwbYbCTx3GCTOnN2AX4tEjpkBb9uxxI0NiUAtEs+AIrn4tcjPyDEz/AvUsv9AYltBgsFhwloYbuQYP+ZtqzFmnJHYxpCQQIQWgzNvzJhl2w7IMfYcbJZIOJDGQ9Av8u05xh/fttXxMLa3P/z485+NHH97LwGHMTCwSTAwHIbzeAgpBwHmDwwMdcQoHAWjYBSMgpEKAONlUqW/N5i7AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Northeast Agricultural University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gang\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2022-09-20 13:59:25\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2085246/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2085246/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":26997527,\"identity\":\"3854b242-fb74-460d-b6bd-5640c201c3ae\",\"added_by\":\"auto\",\"created_at\":\"2022-09-27 01:42:00\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":195854,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCadmium poisoning induces apoptosis of thyroid. (a) represents the TUNEL staining of thyroid and quantification of the images is shown in (b), in which the blue dots are DAPI stained nuclei and the green dots are TUNEL positive cells. Scale bars of (a), (b) are 50 μM.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"F1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2085246/v1/689e602fdaf2fef341b3fab5.png\"},{\"id\":26996955,\"identity\":\"3d62ede7-230b-4073-9b93-8df13b32d719\",\"added_by\":\"auto\",\"created_at\":\"2022-09-27 01:37:00\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":117991,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of Cadmium on Th1/Th2 Balance Shift in Thyroid Tissue. (a) shows the Immunofluorescence images and their quantification, TNF-α in red, CCR4 in green. Scale bars of (a) are 50 μM. The mRNA expression levels of TNF-α and IFN-γ, markers of Th1 cell in group C and group Cd are shown in (b), the mRNA expression levels of CCR4 and IL-4, markers of Th2 cell are shown in (c). Data expressed as mean ± SD (n=3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"F2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2085246/v1/e015b1e11dcf685952cdcd3b.png\"},{\"id\":26996962,\"identity\":\"69e8f5f0-ee63-406a-9e5b-efa7c4ad4119\",\"added_by\":\"auto\",\"created_at\":\"2022-09-27 01:37:00\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":119192,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCadmium inhibits the expression of Ras/Raf/MEK/ERK pathway and related factors in thyroid. The mRNA expression levels of SHC1 GRB2, SOS1, KRas, Raf-1, MEK1/2, ERK1/2 in group C and group Cd were detected by qRT-PCR (a), western blot detected the GRB2, KRas, Raf-1, MEK1/2, ERK1/2, and pERK1/2 protein levels in the normal group and the group Cd (b), (c). Data expressed as mean±SD (n=3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"F3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2085246/v1/009d5905db52156052389069.png\"},{\"id\":26996963,\"identity\":\"1428464f-3859-49d7-99ec-71771b6c1b26\",\"added_by\":\"auto\",\"created_at\":\"2022-09-27 01:37:00\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":124182,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCadmium activates the expression of mitochondrial apoptosis related factors in the thyroid. (a), qRT-PCR detected the mRNA expression levels of Bim, Bax, CytC, Caspase9, Caspase3, P53, and Bcl2 in the group C and the group Cd. (b), (c), Western blot detected the protein levels of Bim, Bax, CytC, Caspase9, cleaved-Caspase9, Caspase3, cleaved-Caspase3, and Bcl2 in the normal group and the cadmium poisoning group. Data are expressed as mean ± SD (n=3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"F4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2085246/v1/712157eb23a9e0981890c985.png\"},{\"id\":30994505,\"identity\":\"a6e83146-aca9-4dc9-8f7b-79c6ce6562c7\",\"added_by\":\"auto\",\"created_at\":\"2023-01-03 00:14:32\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":871604,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2085246/v1/7d143d1e-13e2-45cb-9cd6-3f7a9a6a3143.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Cadmium induced mitochondria apoptosis via the reduction of Th2 cells in pig thyroids\",\"fulltext\":[{\"header\":\"1 Introduction\",\"content\":\"\\u003cp\\u003eCadmium (Cd) is widely distributed in the environment as heavy metal element. When it accumulates in the body, it will damage the health of the humans and animals. Studies have shown that the thyroid is also one of the targeted organs for Cd, and Cd poisoning causes thyroid injury (Buha et al. \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). For example, Cd causes thyroid dysfunction by altering the gene expression on the HPT axis of minnow larvae (Li et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Cd induces apoptosis in humans and animals. Cd induces apoptosis bronchial epithelial cells by activating the mitochondrial intrinsic apoptosis pathway in human(Cao et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), and can also induce apoptosis testicular stromal cells in mouse(Ren et al. \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Mitochondria-mediated apoptosis plays an important role in apoptosis induced by Cd poisoning. Cd induces apoptosis of rat osteoblasts by activating tumor protein p53 (P53) protein in mitochondrial apoptotic pathway (Zheng et al. \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Inhibition of mitochondria-mediated apoptosis has a strong protective effect on Cd-induced testicular injury in mice (Han et al. \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Helper T cells (Th cells) are classified into two subgroups, Th1 cell and Th2 cell, according to the cytokines they secrete. Cytokines secreted by Th1 and Th2 cell not only promote their own proliferation, but also inhibit each other's proliferation. There is a relatively balanced state in healthy animals of Th1 and Th2 cell. Cd poisoning also induces Th1/Th2 cell immune drift. For example, Cd poisoning causes Th1/Th2 balance to shift to Th1 in the pancreas of pigs (Wu et al. \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). IL-6 and interferon-γ (IFN-γ) as Th1 cell markers expression is increased, and IL-10 as Th2 cell markers expression is decreased in Cd poisoning rat testis (Sivaprakasam and Nachiappan 2016). Body could be damaged when Th1/Th2 balance is deviated. Fluoride and manganese, for example, interfere with the Th1/Th2 cell balance, thereby damaging the spleen of mice (Li et al. \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) and the nervous system of chickens (Miao et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Immune drift of Th1/Th2 cell also induces thyroid damage. For example, Th1/Th2 imbalance mediates DINP-induced thyroid injury in rats (Duan et al. \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e), while ATMSC reduces thyroid inflammatory damage in rats by down-regulating Th1 cytokines and improving Th1/Th2 balance (Choi et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eWhen the balance of Th1/Th2 shifts to Th1, it also causes apoptosis. Hydrogen sulfide induces apoptosis by inducing Th1/Th2 homeostasis shift towards Th1 in the bursa of Fabricius of broilers (Hu, Chi, et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). The increased expression of IFN-γ and IL-2 as Th1 cell markers and the decreased expression of IL-6 and IL-10 as Th2 cell markers, accompanied by myocardial apoptosis in the serum of rats with autoimmune myocarditis. However, decreased expressions of IFN-γ and IL-2 and increased expressions of IL-6 and IL-10 inhibit myocardial apoptosis (Xue et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Apoptosis could be regulated via rat sarcoma (Ras) /rapidly accelerated fibrosarcoma (Raf) /MAP kinase-ERK kinase (MEK) /extracellular regulated MAP kinase (ERK) cascade pathway. Inhibition of ERK1/2 expression in liver cancer (Tian et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) and colorectal cancer (Odintsov et al. \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) cells promotes apoptosis, and inhibition of MEK1/2 expression in melanoma cells also promotes apoptosis (Mielczarek-Lewandowska et al. \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Activation of Ras/Raf/MEK/ERK cascade pathway alleviates LPS-induced apoptosis of renal podocytes in mice (Li, Ma, and Liu \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). As members of the B lymphoma gene family, BCL2 like 11 (Bim), Bcl2 Associated X (Bax), and B-cell lymphoma-2 (Bcl2) play a crucial role in mitochondria apoptosis pathway (Maes, Schlamp, and Nickells \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Promotion of ERK-mediated Bim degradation inhibits apoptosis in rat PC12 cells (Kennedy et al. \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e), while inhibition of ERK or pERK induces apoptosis by reducing Bim degradation (Sun et al. \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). The levels of apoptosis-related cytokines such as mitochondrial cytochrome C (CytC), Caspase9 and Caspase3 all increase at different levels during apoptosis (Kalpage et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eAlthough more and more evidence has shown that Cd poisoning may induce immune drift of Th1/Th2 cell and apoptosis, the relationship of Th1/Th2 balance and apoptosis which is cause by Cd poisoning in pig thyroid cells is still unclear. The levels of Th1/Th2 markers, Ras/Raf/MEK/ERK cascade pathway and mitochondrial apoptotic pathway related factors in were detected by TUNEL, immunofluorescence, qRT-PCR and Western Blot. These data provide toxicological study of Cd and comparative medicine theoretical basis and reference basis.\\u003c/p\\u003e\"},{\"header\":\"2 Materials And Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Cd poisoning animal model establishment and grouping\\u003c/h2\\u003e \\u003cp\\u003e All procedures in the experiment were consistent with the animal welfare standards of the Northeast Agricultural University Animal Protection and Utilization Committee. Ten healthy 6-week-old pigs were randomly divided into two groups of 5 pigs each. The control group (group C) was fed normally, while the Cd poisoning group (group Cd) was fed with the diet containing 20mg/kg cadmium chloride (CdCl\\u003csub\\u003e2\\u003c/sub\\u003e). On the 40th day, the pigs were euthanized, the thyroid tissue was extracted and partially fixed in 10% formalin, and left part was placed in liquid nitrogen for further use.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 TUNEL assay in thyroid tissue\\u003c/h2\\u003e \\u003cp\\u003eTo analyze Cd intoxication-induced apoptosis of thyroid cells, TUNEL analysis was performed using an insitu cell death detection kit (luciferin, Roche, Basel, Switzerland). Tunel staining for DNA fragments is considered a standard technique for detecting apoptosis in tissue sections. The experiment was in accordance with the manufacturer's instructions and the samples were observed under a fluorescence microscope after reverse-fluorescence quenching. Sections were randomly selected from each sample, and used a high-power field of vision (\\u0026times;400) to count the number of positive cells in each thyroid section.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Immunofluorescence analysis\\u003c/h2\\u003e \\u003cp\\u003eFrozen sections of 5\\u0026micro;m thyroid were taken and stained with DAPI. T lymphocyte specific anti-tumor necrosis factor alpha (TNF-α) antibody (ABCAM) and anti-CC motif chemokine receptor 4 (CCR4) antibody (ABCAM) were used to stain Th1 and Th2 subgroups of frozen thyroid sections, respectively. Use Nikon's fluorescence microscope for observation and image acquisition.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Real-time quantitative PCR analysis\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from thyroid tissue by using Trizol reagent according to the manufacturer's instructions, and the reverse transcription step for cDNA was also based on the manufacturer's instructions (Roche, Shanghai, China). qRT-PCR was performed using the 480 system (Roche, Basel, Switzerland) and Fast Universal SYBR Green Master Mix (Roche, Basel, Switzerland). The primers used in our experiment were showed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. Only the peak of each PCR product was shown in the melting curve analysis. The relative gene abundance of mRNAs was calculated by 2\\u003csup\\u003e\\u0026minus;ΔΔCT\\u003c/sup\\u003e method, and the gene-specific efficiency was considered, and normalized to the mean value of the above indexes.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe primers used in the present study\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTarget gene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward Primer (5\\u0026prime;\\u0026rarr; 3\\u0026prime;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse Primer (5\\u0026prime;\\u0026rarr; 3\\u0026prime;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eβ-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATCCTGCGGCATCCACGAAAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAGCACCGTGTTGGCGTAGAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIFN-γ\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTGCGACGACCCTGATGCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTGACGGATTCACTGCTGCTCTTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTNF-α\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCACTGAGAGCATGATCCGAGAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGACCAGGAGGAAGGAGAAGAGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCCR4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACGAGAAGAAGAACAAGGCAGTGAAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCAGGAAGAGCACCACATTGTAAGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTTCGGCACATCTACAGACACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCTTGGCTTCATGCACAGAACAGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSHC1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGGAAGAGCCGCCTGACCATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCCCGAAGCCTCATGTCCACTAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGRB2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGACATAGAACAGGTGCCACAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eACCAGTTGGGGTCCGAGTTATCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSOS1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCCTCCTGCTTCTGGTGCTTCTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAAAGACGGTATCGCTGCTTGAGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eKRas\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAAAGACGGTATCGCTGCTTGAGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTACTCCTCTTGACCTGCTGTGTCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRaf-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATGCGTCGGATGCGAGAATCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGAGGAAGGGCTGGAGGTGTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMEK-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCGATGAACAGCAGCGGAAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eACCTTGAACACCACACCTCCATTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMEK-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGCTCACCATCAACCCTACCATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTCTTCTGCTGCTCGTCAAGTTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eERK1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACCTACTGCCAGCGGACCTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGAATGTCTCGGATGCCAATGACG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eERK2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAACCTTCCAACCTGCTGCTCAAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCAACGTGTGGCGACATACTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBim\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCAGGAGTTACGGCGTATTGGAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGGGAGGGTGTGAGGGGAAAAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBax\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTTGCTTCAGGGTTTCATCCAGGATC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAGACACTCGCTCAACTTCTTGGTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCytC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTGTTCAGAAGTGTGCCCAGTGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTGACCTGTCTTCCGCCCAAAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCaspase9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCCTGTGTTCATCTCCTGCTTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCCGCTTTGTTGCTTGTCTAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCaspase3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTGTAGAACTCTAACTGGCAAACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCCACTGTCCGTCTCAATCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eP53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCCCATCCTCACCATCATCACAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCACAAACACGCACCTCAAAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBcl2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAGAGGGGCTACGAGTGGGATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCGGGCTGGGAGGAGAAGATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Western blot analysis\\u003c/h2\\u003e \\u003cp\\u003eThe total protein was electrophoresed in a 12% SDS-polyacrylamide gel, and the separated protein was transferred to a nitrocellulose membrane in a Tris-glycine buffer containing 20% methanol at 4\\u0026deg;C. The membrane was covered with 5% skimmed milk and blocked at 37\\u0026deg;C for 2 h, and then incubated with diluted anti-rabbit primary antibody at 4\\u0026deg;C overnight. the diluted concentration was shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. It was then combined with peroxidase-conjugated anti-rabbit secondary antibody IgG (1:5000, Santa Cruz, USA) at 37\\u0026deg;C for 50 min. Finally, X-ray film (Transgen Biotech Co., Beijing, China) was used to detect the signal.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe primary antibodies used in present study\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTarget gene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eDilution ratio\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eResource\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eβ-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 10000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eABclonal Biotechnology\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGRB2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eKRas\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRaf-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMEK1/2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eERK1/2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003epERK1/2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBax\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCytC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCaspase9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 1000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ecleaved-Caspase9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 1000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCaspase3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ecleaved-Caspase3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWanLei Biotechnology, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBcl2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1: 300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLaboratory made\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eGraphPad Prism software (version 8.0, GraphPad Software Inc., San Diego, California, U.S.) was used to analyze the data by t test for each group. All the date presented in this study were collected from at least three independent experiments(n\\u0026thinsp;=\\u0026thinsp;3), and the data is reported as the mean standard\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;deviation (SD). When \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, the difference is statistically significant. * \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, ** \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, *** \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3 Results\",\"content\":\"\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 The number of apoptotic cells in thyroid tissue increased after Cd exposure\\u003c/h2\\u003e \\u003cp\\u003eIn order to detect Cd-induced apoptosis of thyroid tissue cells, the TUNEL kit was first used to detect the thyroid tissue of group Cd and group C respectively. The results were shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. Compared with the group C, the number of TUNEL positive cells increased in the group Cd.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Abnormal levels of cytokines secreted by Th1/ Th2 cell in thyroid tissue\\u003c/h2\\u003e \\u003cp\\u003eTh1/Th2 cell balance is a basic pathway to regulate immune response. To explore the Cd-induced pig thyroid Th1/Th2 imbalance, we evaluated Th1/Th2 cell markers levels in the thyroid (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e(a), Cd regulated the Th1/Th2 imbalance, Th1 cells number increased while Th2 cells number decreased according to TNF-α and CCR4 staining. In Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e(b), mRNA levels of TNF-α and IFN-γ as Th1 cell markers in the group Cd were all upregulated compared with group C, while mRNA levels of Th2 cell marker IL-4 (interleukin 4), CCR4 were down-regulated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e(c) (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). In summary, the immune response may be modulated by Cd, thus turning polarization homeostasis into a harmful phase.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Inhibitions of Ras/RAF/MEK/ERK pathway and related factors expression in thyroid tissue\\u003c/h2\\u003e \\u003cp\\u003eIn order to determine whether IL-4 regulates apoptosis via Ras/Raf/MEK/ERK signaling pathway in thyroid tissue, the expression of this signaling pathway related factors were detected by qRT-PCR and Western Blot (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Compared with the group C, the mRNA expression levels of the downstream cytokines SHC1 (SHC adaptor protein 1), GRB2 (growth factor receptor bound protein 2), SOS1 (SOS Ras/Rac guanine nucleotide exchange factor 1), KRas, Raf-1, MEK1/2, and ERK1/2 of IL-4 in the group Cd were significantly down-regulated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e(a)); the protein level was consistent with it, and the protein expression level of pERK1/2 was significantly down-regulated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e(b), Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e(c)) (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05). These data suggest that Ras/Raf/MEK/ERK signaling pathway is inhibited in pig thyroid tissues after Cd exposure.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 Increased expression of mitochondrial apoptotic pathway factors in thyroid\\u003c/h2\\u003e \\u003cp\\u003eInhibition of Ras/Raf/MEK/ERK signaling pathway can activate mitochondria apoptosis pathway in vivo. To verify this hypothesis, we detected the expression levels of mitochondria apoptosis pathway related cytokines such as Bim, Bax, CytC, Caspase9, Caspase3, P53 and Bcl2 in thyroid by qRT-PCR and Western Blot (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Compared with the group C, the mRNA levels of Bim, Bax and CytC were significantly up-regulated in the group Cd, and the mRNA level of Bcl2 was significantly down-regulated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e(a)); the protein expression level was consistent with that (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e(b), Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e(c)). This indicates a change in mitochondrial permeability and the release of CytC into the cytoplasm in thyroid. In addition, the mRNA levels of Caspase 9, Caspase 3 and P53 in the group Cd were all up-regulated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e(a)), the protein levels were consistent with them; and the protein expression levels of cleaved-caspase3 and cleaved-caspase9 were also up-regulated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e(b), Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e(c)) (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) This result shows that mitochondria apoptosis occurs after Cd exposure in thyroid.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4 Discussion\",\"content\":\"\\u003cp\\u003eApoptosis is one of the main forms of body damage caused by Cd. Cd poisoning can induce apoptosis in organs such as kidney (Chen et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) and liver (Yiming et al. \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Cd exposure causes the imbalance of Th1/Th2 and the changes in Th1/Th2 cell markers (Zheng et al. \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). This study explores the relationship between Th1/Th2 imbalance and Cd-induced apoptosis in thyroid of pig. Our results show that the mitochondrial apoptotic pathways related factors expression increased significantly, such as Bim, Bax, CytC, Caspase9 and Caspase3. In the group Cd, the markers of Th1 cell IFN-γ and TNF-α increased, the markers of Th2 cell CCR4 and IL-4 decreased, and shifted the Th1/Th2 balance to Th1. ERK signaling pathway related factors were significantly down-regulated.\\u003c/p\\u003e \\u003cp\\u003eTh1 cell markers such as TNF-α, IL-2, IFN-γ, etc. and Th2 cell markers such as IL-4, IL-10, etc. play an important role in the regulation of apoptosis (Feng et al. \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e). TNF-α and IFN-γ expression is increased, while IL-4 expression is decreased in Cd poisoning chicken neutrophils(Chen et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). The expression of TNF-α is also increased in Cd poisoning rat testis and the expression of IL-4 is also decreased in the same way (Al-Azemi et al. \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). Moreover, the experiments of Wu et al. have also shown that TNF-α and IFN-γ expression is increased and IL-4 and CCR4 expression is decreased, causing Th1/Th2 imbalance in Cd poisoning pig pancreas (Wu et al. \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). In this experiment, we detected the Th1 cell markers TNF-α, IFN-γ and Th2 cell markers IL-4 and CCR4 expression levels. The results showed that Th1 cell markers TNF-α and IFN-γ expression levels increased significantly in the group Cd, and Th2 cell markers CCR4 and IL-4 expression levels decreased significantly. This result indicates that Th1/Th2 cell balance shifts and Th2 cells are reduced in the thyroid of Cd poisoning pigs. These results suggest that Cd exposure causes Th1/Th2 cell imbalance and Th2 cell reduction in pig thyroid tissue. In macrophages, lead treatment leads to imbalance of Th1/Th2 cell and induces expression of Th1 cell markers such as IL-2 and IFN-γ (Krocova et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e). The Th1/Th2 cytokine ratio in serum and liver of African green frog exposed to Cu, Cr, Pb and other heavy metals is more inclined to Th1, and the levels of IL-6 and IFN-γ in serum and TNF-α and IFN-γ in liver are significantly increased (Jayawardena et al. \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe Ras/Raf/MEK/ERK signaling pathway can be widely activated as a mitogen-activated protein kinase pathway, which can transfer extracellular signals into cells, thereby regulating cell apoptosis, proliferation and differentiation. The dysregulation of the Ras/Raf/MEK/ERK pathway controls the occurrence and development of apoptosis. For example, catechin-3-gallic acid induces apoptosis of human thyroid cancer cells by down-regulating the expression of the Ras/Raf/MEK/ERK pathway (Wu et al. \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). And the apoptosis of human liver cancer cells could be induced by inhibiting of RaS/RAF/MEK/ERK signaling pathway (Tian et al. \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). The Th2 cell markers IL-4 and CCR4 have regulatory effects on the Ras / Raf / MEK / ERK pathway. For example, IL-4 can interact with important upstream proteins of ERK signaling pathway SHC and GRB2 and activate ERK2 (Soon et al. \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e). IL-4 causes phosphorylation of ERK in the rat retina (Goulart et al. \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). CCR4 can also activate the ERK signaling pathway. For example, in mice, CCR4 activates its downstream ERK signaling pathway and improves hematoma after cerebral hemorrhage (Deng et al. \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). This result also confirms the above statement. When the Th1/Th2 balance shifts to Th1 cell, the Th2 cell markers IL-4 and CCR4 is decreased, inhibit the activation of the ERK signaling pathway, activate the mitochondrial pathway, and thyroid cells undergo apoptosis. Studies have also shown that the mitochondria apoptosis pathway could be activated by inhibiting the Ras/Raf/MEK/ERK pathway. For example, in mouse endometrial epithelial cells, inhibiting the Ras/Raf/MEK/ERK signaling pathway, the expression levels of Bax, Caspase3 increased and the expression level of Bcl2 decreased, which activates the mitochondria apoptosis pathway (Liu et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). In addition, Bhalla et al. demonstrated that MEK inhibitors mediated mitochondria apoptosis pathway in diffuse large B-cell lymphoma by inhibiting MEK/ERK pathway activation (Bhalla et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). And by up-regulating the expression of MEK/ERK in cervical cancer cells, the ratio of Bax to Bcl2 can be inhibited, and the lysis of Caspase9 and Caspase3 can be reduced, thereby inhibiting the mitochondrial apoptotic pathway (Hu, Zhang, et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). In granulosa cell KGN, Cd causes an increase in Bax level and a decrease in Bcl2 level by inducing mitochondrial dysfunction, leading to apoptosis (Xu et al. \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Cd can also activate the mitochondrial apoptotic pathway in rat neural stem cells (Luo et al. \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). The above evidence validates our results, that is, Cd causes Th1/Th2 cell balance shift, Th2 cells decrease, inhibits Ras/Raf/MEK/ERK signaling pathway, and induces mitochondria apoptosis in pig thyroid.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, our study showed that the pig thyroid is one of the important target organs of Cd, and Cd can inhibit the expression of Ras/Raf/MEK/ERK pathway and activate the mitochondrial apoptosis pathway by interfering with Th1/Th2 balance and reducing Th2 cells. These results indicate that Cd induces mitochondria apoptosis in pig thyroid via reducing Th2 cell. This study aims to draw people's attention to the harm of soil environmental damage to humans and animals, and to provide a theoretical basis for the toxicological study of Cd.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll procedures of this experiment were in accordance with animal welfare standards and the requirements of the Animal Protection and Utilization Committee of Northeast Agricultural University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll of authors have read the manuscript and have agreed to submit it in its current form for consideration for publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors claim that none of the material in the paper has been published or is under consideration for publication elsewhere.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eYilei Zhang\\u003c/strong\\u003e: Conceptualization, Methodology, Software, Investigation, Writing-original draft, Formal analysis, Visualization. \\u003cstrong\\u003eXiaojing Liu\\u003c/strong\\u003e: Validation, Formal analysis, Software. \\u003cstrong\\u003eWenyue Zhang\\u003c/strong\\u003e: Supervision, Data curation. \\u003cstrong\\u003eJing Lan\\u003c/strong\\u003e and\\u0026nbsp;\\u003cstrong\\u003eGang Sun\\u003c/strong\\u003e: Writing - review \\u0026amp; editing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors thank all members of the Key Laboratory of the Provincial Education Department of Heilongjiang for Common Animal Disease Prevention; Heilongjiang Provincial Animal Disease Prevention and Control Center; Institute of Quality and Safety of Agricultural Products, Heilongjiang Academy of Agricultural Sciences and Treatment in the College of Veterinary Medicine, Northeast Agricultural University, for their help in the experiment.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAl-Azemi, M, FE Omu, EO Kehinde, JT Anim, MA Oriowo, and AE Omu. 2010. 'Lithium protects against toxic effects of cadmium in the rat testes', \\u0026lt;bi\\u0026gt;Journal of assisted reproduction and genetics\\u0026lt;/bi\\u0026gt;, 27: 469 \\u0026ndash; 76.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBhalla, S, AM Evens, B Dai, S Prachand, LI Gordon, and RB Gartenhaus. 2011. 'The novel anti-MEK small molecule AZD6244 induces BIM-dependent and AKT-independent apoptosis in diffuse large B-cell lymphoma', Blood, 118: 1052\\u0026ndash;61.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBuha, A, V Matovic, B Antonijevic, Z Bulat, M Curcic, EA Renieri, AM Tsatsakis, A Schweitzer, and D Wallace. 2018. 'Overview of Cadmium Thyroid Disrupting Effects and Mechanisms', \\u0026lt;bi\\u0026gt;International journal of molecular sciences\\u0026lt;/bi\\u0026gt;, 19.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCao, X, M Fu, R Bi, X Zheng, B Fu, S Tian, C Liu, Q Li, and J Liu. 2021. 'Cadmium induced BEAS-2B cells apoptosis and mitochondria damage via MAPK signaling pathway', \\u0026lt;bi\\u0026gt;Chemosphere\\u0026lt;/bi\\u0026gt;, 263: 128346.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, J, W Lai, Y Deng, M Liu, M Dong, Z Liu, T Wang, X Li, Z Zhao, X Yin, J Yang, R Yu, and L Liu. 2021. 'MicroRNA-363-3p promotes apoptosis in response to cadmium-induced renal injury by down-regulating phosphoinositide 3-kinase expression', \\u0026lt;bi\\u0026gt;Toxicology letters\\u0026lt;/bi\\u0026gt;, 345: 12\\u0026ndash;23.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, J, T Pan, N Wan, Z Sun, Z Zhang, and S Li. 2017. 'Cadmium-induced endoplasmic reticulum stress in chicken neutrophils is alleviated by selenium', \\u0026lt;bi\\u0026gt;Journal of inorganic biochemistry\\u0026lt;/bi\\u0026gt;, 170: 169 \\u0026ndash; 77.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChoi, EW, IS Shin, HW Lee, SY Park, JH Park, MH Nam, JS Kim, SK Woo, EJ Yoon, SK Kang, JC Ra, HY Youn, and SH Hong. 2011. 'Transplantation of CTLA4Ig gene-transduced adipose tissue-derived mesenchymal stem cells reduces inflammatory immune response and improves Th1/Th2 balance in experimental autoimmune thyroiditis', \\u0026lt;bi\\u0026gt;The journal of gene medicine\\u0026lt;/bi\\u0026gt;, 13: 3\\u0026ndash;16.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDeng, S, P Sherchan, P Jin, L Huang, Z Travis, JH Zhang, Y Gong, and J Tang. 2020. 'Recombinant CCL17 Enhances Hematoma Resolution and Activation of CCR4/ERK/Nrf2/CD163 Signaling Pathway After Intracerebral Hemorrhage in Mice', \\u003cem\\u003eNeurotherapeutics\\u003c/em\\u003e: \\u003cem\\u003ethe journal of the American Society for Experimental NeuroTherapeutics\\u003c/em\\u003e, 17: 1940\\u0026ndash;53.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDuan, J, T Deng, J Kang, and M Chen. 2019. 'DINP aggravates autoimmune thyroid disease through activation of the Akt/mTOR pathway and suppression of autophagy in Wistar rats', \\u003cem\\u003eEnvironmental pollution\\u003c/em\\u003e \\u0026lt;bi\\u0026gt;(Barking, Essex: 1987)\\u0026lt;/bi\\u0026gt;, 245: 316 \\u0026ndash; 24.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFeng, Y, J Tian, HQ Xie, J She, SL Xu, T Xu, W Tian, H Fu, S Li, W Tao, L Wang, Y Chen, S Zhang, W Zhang, TL Guo, and B Zhao. 2016. 'Effects of Acute Low-Dose Exposure to the Chlorinated Flame Retardant Dechlorane 602 and Th1 and Th2 Immune Responses in Adult Male Mice', \\u0026lt;bi\\u0026gt;Environmental health perspectives\\u0026lt;/bi\\u0026gt;, 124: 1406-13.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGoulart, VG, GD Menezes, S Esp\\u0026iacute;rito-Santo, ADC Faria-Melibeu, CA Serfaty, and P Campello-Costa. 2018. 'Interleukin 4 Leads to Sustained Phosphorylation of the STAT6 and ERK Pathways in the Retina and Disrupts Subcortical Visual Circuitry in Rodents', Neuroimmunomodulation, 25: 96\\u0026ndash;102.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHan, C, Y Zhu, Z Yang, S Fu, W Zhang, and C Liu. 2020. 'Protective effect of Polygonatum sibiricum against cadmium-induced testicular injury in mice through inhibiting oxidative stress and mitochondria-mediated apoptosis', \\u0026lt;bi\\u0026gt;Journal of ethnopharmacology\\u0026lt;/bi\\u0026gt;, 261: 113060.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu, G, J Zhang, F Xu, H Deng, W Zhang, S Kang, and W Liang. 2018. 'Stomatin-like protein 2 inhibits cisplatin-induced apoptosis through MEK/ERK signaling and the mitochondrial apoptosis pathway in cervical cancer cells', \\u0026lt;bi\\u0026gt;Cancer science\\u0026lt;/bi\\u0026gt;, 109: 1357-68.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu, X, Q Chi, D Wang, X Chi, X Teng, and S Li. 2018. 'Hydrogen sulfide inhalation-induced immune damage is involved in oxidative stress, inflammation, apoptosis and the Th1/Th2 imbalance in broiler bursa of Fabricius', \\u0026lt;bi\\u0026gt;Ecotoxicology and environmental safety\\u0026lt;/bi\\u0026gt;, 164: 201-09.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJayawardena, UA, WD Ratnasooriya, DD Wickramasinghe, and PV Udagama. 2016. 'Heavy metal mediated innate immune responses of the Indian green frog, Euphlyctis hexadactylus (Anura: Ranidae): Cellular profiles and associated Th1 skewed cytokine response', \\u0026lt;bi\\u0026gt;The Science of the total environment\\u0026lt;/bi\\u0026gt;: 1194 \\u0026ndash; 204.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKalpage, HA, J Wan, PT Morse, MP Zurek, AA Turner, A Khobeir, N Yazdi, L Hakim, J Liu, A Vaishnav, TH Sanderson, MA Recanati, LI Grossman, I Lee, BFP Edwards, and M H\\u0026uuml;ttemann. 2020. 'Cytochrome c phosphorylation: Control of mitochondrial electron transport chain flux and apoptosis', \\u0026lt;bi\\u0026gt;The international journal of biochemistry \\u0026amp; cell biology\\u0026lt;/bi\\u0026gt;, 121: 105704.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKennedy, D, K Mnich, D Oommen, R Chakravarthy, L Almeida-Souza, M Krols, S Saveljeva, K Doyle, S Gupta, V Timmerman, S Janssens, AM Gorman, and A Samali. 2017. 'HSPB1 facilitates ERK-mediated phosphorylation and degradation of BIM to attenuate endoplasmic reticulum stress-induced apoptosis', \\u0026lt;bi\\u0026gt;Cell death \\u0026amp; disease\\u0026lt;/bi\\u0026gt;, 8: e3026.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKrocova, Z, A Macela, M Kroca, and L Hernychova. 2000. 'The immunomodulatory effect(s) of lead and cadmium on the cells of immune system in vitro', \\u003cem\\u003eToxicology in vitro\\u003c/em\\u003e: \\u003cem\\u003ean international journal published in association with BIBRA\\u003c/em\\u003e, 14: 33\\u0026ndash;40.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, X, A Ma, and K Liu. 2019. 'Geniposide alleviates lipopolysaccharide-caused apoptosis of murine kidney podocytes by activating Ras/Raf/MEK/ERK-mediated cell autophagy', \\u0026lt;bi\\u0026gt;Artificial cells, nanomedicine, and biotechnology\\u0026lt;/bi\\u0026gt;, 47: 1524-32.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, Y, X Du, Y Zhao, J Wang, and J Wang. 2021. 'Fluoride Can Damage the Spleen of Mice by Perturbing Th1/Th2 Cell Balance', \\u0026lt;bi\\u0026gt;Biological trace element research\\u0026lt;/bi\\u0026gt;, 199: 1493 \\u0026ndash; 500.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, ZH, L Chen, YH Wu, P Li, YF Li, and ZH Ni. 2014. 'Effects of waterborne cadmium on thyroid hormone levels and related gene expression in Chinese rare minnow larvae', \\u003cem\\u003eComparative biochemistry and physiology\\u003c/em\\u003e. \\u003cem\\u003eToxicology \\u0026amp; pharmacology\\u003c/em\\u003e: \\u003cem\\u003eCBP\\u003c/em\\u003e, 161: 53 \\u0026ndash; 7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, X, L Zhang, L Yang, J Cui, S Che, Y Liu, J Han, X An, B Cao, and Y Song. 2020. 'miR-34a/c induce caprine endometrial epithelial cell apoptosis by regulating circ-8073/CEP55 via the RAS/RAF/MEK/ERK and PI3K/AKT/mTOR pathways', \\u0026lt;bi\\u0026gt;Journal of cellular physiology\\u0026lt;/bi\\u0026gt;, 235: 10051-67.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLuo, H, B Song, G Xiong, B Zhang, Z Zuo, Z Zhou, and X Chang. 2021. 'Cadmium inhibits neural stem/progenitor cells proliferation via MitoROS-dependent AKT/GSK-3β/β-catenin signaling pathway', \\u003cem\\u003eJournal of applied toxicology : JAT\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMaes, ME, CL Schlamp, and RW Nickells. 2017. 'Live-cell imaging to measure BAX recruitment kinetics to mitochondria during apoptosis', PloS one, 12: e0184434.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiao, Z, K Zhang, R Bao, J Li, Y Tang, and X Teng. 2021. 'Th1/Th2 imbalance and heat shock protein mediated inflammatory damage triggered by manganese via activating NF-κB pathway in chicken nervous system in vivo and in vitro', \\u003cem\\u003eEnvironmental science and pollution research international\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMielczarek-Lewandowska, A, M Sztiller-Sikorska, M Osrodek, M Czyz, and ML Hartman. 2019. '17-Aminogeldanamycin selectively diminishes IRE1α-XBP1s pathway activity and cooperatively induces apoptosis with MEK1/2 and BRAF inhibitors in melanoma cells of different genetic subtypes', \\u0026lt;bi\\u0026gt;Apoptosis: an international journal on programmed cell death\\u0026lt;/bi\\u0026gt;, 24: 596\\u0026ndash;611.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOdintsov, I, AJW Lui, WJ Sisso, E Gladstone, Z Liu, L Delasos, RI Kurth, EM Sisso, M Vojnic, I Khodos, MS Mattar, E de Stanchina, SM Leland, M Ladanyi, and R Somwar. 2021. 'NRG1The Anti-HER3 mAb Seribantumab Effectively Inhibits Growth of Patient-Derived and Isogenic Cell Line and Xenograft Models with Oncogenic Fusions', \\u0026lt;bi\\u0026gt;Clinical cancer research: an official journal of the American Association for Cancer Research\\u0026lt;/bi\\u0026gt;, 27: 3154-66.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRen, X, S Wang, C Zhang, X Hu, L Zhou, Y Li, and L Xu. 2020. 'Selenium ameliorates cadmium-induced mouse leydig TM3 cell apoptosis via inhibiting the ROS/JNK /c-jun signaling pathway', \\u0026lt;bi\\u0026gt;Ecotoxicology and environmental safety\\u0026lt;/bi\\u0026gt;, 192: 110266.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSivaprakasam, C, and V Nachiappan. 2016. 'Modulatory effect of cadmium on the expression of phospholipase A2 and proinflammatory genes in rat testis', \\u0026lt;bi\\u0026gt;Environmental toxicology\\u0026lt;/bi\\u0026gt;, 31: 1176-84.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSoon, L, L Flechner, JS Gutkind, LH Wang, R Baserga, JH Pierce, and W Li. 1999. 'Insulin-like growth factor I synergizes with interleukin 4 for hematopoietic cell proliferation independent of insulin receptor substrate expression', \\u0026lt;bi\\u0026gt;Molecular and cellular biology\\u0026lt;/bi\\u0026gt;, 19: 3816-28.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun, QY, LW Ding, K Johnson, S Zhou, JW Tyner, H Yang, NB Doan, JW Said, JF Xiao, XY Loh, XB Ran, N Venkatachalam, Z Lao, Y Chen, L Xu, LF Fan, W Chien, DC Lin, and HP Koeffler. 2019. 'SOX7 regulates MAPK/ERK-BIM mediated apoptosis in cancer cells', \\u0026lt;bi\\u0026gt;Oncogene\\u0026lt;/bi\\u0026gt;, 38: 6196 \\u0026ndash; 210.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTian, J, J Li, B Bie, J Sun, Y Mu, M Shi, S Zhang, G Kong, Z Li, and Y Guo. 2021. 'MiR-3663-3p participates in the anti-hepatocellular carcinoma proliferation activity of baicalein by targeting SH3GL1 and negatively regulating EGFR/ERK/NF-κB signaling', \\u0026lt;bi\\u0026gt;Toxicology and applied pharmacology\\u0026lt;/bi\\u0026gt;, 420: 115522.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTian, X, J Geng, Q Zheng, L Wang, P Huang, J Tong, and S Zheng. 2020. 'Single high dose irradiation induces cell cycle arrest and apoptosis in human hepatocellular carcinoma cells through the Ras/Raf/MEK/ERK pathways', \\u0026lt;bi\\u0026gt;International journal of radiation biology\\u0026lt;/bi\\u0026gt;, 96: 740 \\u0026ndash; 47.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, D, Z Liu, J Li, Q Zhang, P Zhong, T Teng, M Chen, Z Xie, A Ji, and Y Li. 2019. 'Epigallocatechin-3-gallate inhibits the growth and increases the apoptosis of human thyroid carcinoma cells through suppression of EGFR/RAS/RAF/MEK/ERK signaling pathway', \\u0026lt;bi\\u0026gt;Cancer cell international\\u0026lt;/bi\\u0026gt;, 19: 43.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, H, S Zheng, J Zhang, S Xu, and Z Miao. 2021. 'Cadmium induces endoplasmic reticulum stress-mediated apoptosis in pig pancreas via the increase of Th1 cells', \\u003cem\\u003eToxicology\\u003c/em\\u003e, 457: 152790.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu, G, S Liu, M Huang, X Jiang, and M Yang. 2021. 'Cadmium induces apoptosis of human granulosa cell line KGN via mitochondrial dysfunction-mediated pathways', \\u0026lt;bi\\u0026gt;Ecotoxicology and environmental safety\\u0026lt;/bi\\u0026gt;, 220: 112341.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXue, YL, SX Zhang, CF Zheng, YF Li, LH Zhang, YF Hao, S Wang, and XW Li. 2019. 'Silencing of STAT4 Protects Against Autoimmune Myocarditis by Regulating Th1/Th2 Immune Response via Inactivation of the NF-κB Pathway in Rats', \\u0026lt;bi\\u0026gt;Inflammation\\u0026lt;/bi\\u0026gt;, 42: 1179-89.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYiming, Z, L Zhaoyi, L Jing, W Jinliang, S Zhiqiang, S Guangliang, and L Shu. 2021. 'Cadmium induces the thymus apoptosis of pigs through ROS-dependent PTEN/PI3K/AKT signaling pathway', \\u003cem\\u003eEnvironmental science and pollution research international\\u003c/em\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZheng, J, L Zhuo, D Ran, Y Ma, T Luo, H Zhao, R Song, H Zou, J Zhu, J Gu, J Bian, Y Yuan, and Z Liu. 2020. 'Cadmium induces apoptosis via generating reactive oxygen species to activate mitochondrial p53 pathway in primary rat osteoblasts', \\u0026lt;bi\\u0026gt;Toxicology\\u0026lt;/bi\\u0026gt;, 446: 152611.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZheng, X, X Xu, F Lu, Q Wang, Z Zeng, and X Huo. 2021. 'High serum IgG subclass concentrations in children with e-waste Pb and Cd exposure', \\u0026lt;bi\\u0026gt;The Science of the total environment\\u0026lt;/bi\\u0026gt;, 764: 142806.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Cadmium, Pig, Thyroid, Th1/Th2 balance, Mitochondria apoptosis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2085246/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2085246/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eCadmium, as an environmental pollution element, is considered as a strong toxic substance of organisms. High doses of cadmium have serious cytotoxicity and induces programmed cell necrosis, autophagy, and apoptosis. Th1/Th2 balance is involved in regulating the dynamic balance of cytokine networks and is closely related to the occurrence and development of a variety of diseases. The purpose of this study was to investigate the relationship between Th1/Th2 balance and cadmium-induced apoptosis of thyroid cells. Cadmium poisoning pig model was established in which healthy 6-week-old pigs were exposed to CdCl2 for 40 days (with a dietary cadmium content of 20mg/kg). First, apoptosis was detected by TUNEL staining, and Th1/Th2 equilibrium shift was detected by immunofluorescence. Secondly, the mRNA and protein expression of related proteins were detected by qRT-PCR and Western blot. The results showed that the Th1/Th2 balance shifted towards Th1 and Th2 cells decreased；and the expression levels of Ras/Raf/MEK/ERK pathway related proteins were inhibited in group Cd. In addition, Bax, CytC, Caspase9, and Caspase3 expression increased and Bcl2 expression decreased after cadmium exposure. In brief, our experiments suggested that the pro-apoptosis-related genes expression upregulates and apoptosis induces by activating the mitochondrial pathway signaling pathway in thyroid cells after Cadmium exposure. These negative effects are in connection with the Th1/Th2 imbalance and the reduction of Th2 cytokines.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Cadmium induced mitochondria apoptosis via the reduction of Th2 cells in pig thyroids\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2022-09-27 01:36:58\",\"doi\":\"10.21203/rs.3.rs-2085246/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"a2a7f0d8-760f-43a9-93c8-33c9b720cf58\",\"owner\":[],\"postedDate\":\"September 27th, 2022\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-01-03T00:14:19+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2022-09-27 01:36:58\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2085246\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2085246\",\"identity\":\"rs-2085246\",\"version\":[\"v1\"]},\"buildId\":\"-HB7Z8yhvgn0wM9Nzuekk\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}