{"paper_id":"4491eff3-1854-47b0-ba99-ba7409ee7a47","body_text":"ALDH3B1 protects interfollicular epidermal cells against lipid peroxidation via the NRF2 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article ALDH3B1 protects interfollicular epidermal cells against lipid peroxidation via the NRF2 pathway zhenjie wu, Aoyu Chen, Guang Zhang, Chunyan Liu, Siyuan Yin, Ru Song, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1795852/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Nov, 2022 Read the published version in Cell Stress and Chaperones → Version 1 posted You are reading this latest preprint version Abstract Reactive oxygen species (ROS) production is critical for the initiation of wound repair; However, persistent high levels of reactive oxygen species can lead to lipid peroxidation of cells and thus affect wound healing. Iron is a transition metal that is an essential component of almost all living cells and organisms. when present in excess in cells and tissues, iron disrupts redox homeostasis and catalyses the generation of ROS, leading to increased lipid peroxidation. In this study, we found that after treating interepithelial follicular (IFE) cells with different concentrations of transferrin (0 µg/ml, 1 µg/ml, 10 µg/ml, 100 µg/ml, and 1 mg/ml), we increased the intracellular iron content, and our findings regarding viability and function did not differ significantly between groups of cells. It was also found that the level of lipid peroxidation in IFE cells did not increase. We speculate that there is a protective mechanism within IFE cells that reduces the occurrence of intracellular lipid peroxidation. We found that the elevated intracellular iron content of IFE cells was accompanied by elevated ALDH3B1 expression. We investigated the effect of ALDH3B1 on the level of lipid peroxidation in IFE cells and found that the elevated expression of ALDH3B1 could decrease the damage to IFE cells by lipid peroxidation. In addition, the NRF2 pathway was found to affect the expression of ALDH3B1, which in turn affected lipid peroxidation in IFE cells. In conclusion, these findings suggest that in IFE cells, activation of the NRF2 pathway can increase the expression of ALDH3B1 and thus reduce the production of intracellular ROS and the occurrence of intracellular lipid peroxidation. Therefore, ALDH3B1 may be a potential target for the treatment of chronic wounds. Transferrin ALDH3B1 interfollicular epidermal (IFE) cells lipid peroxidation NRF2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The failure of wounds to heal causes great pain to patients and places an economic burden on society ( 1 ). Wound healing is an important and complex physiological process that is essential to maintain the barrier function of the skin and consists of a haemostatic/inflammatory phase, a proliferative phase, and a remodelling phase ( 2 – 5 ). During the progression of many diseases, events related to wound healing can be compromised, leading to nonhealing of the wound and the formation of chronic wounds ( 6 , 7 ). Reactive oxygen species (ROS) play a key role in the orchestration of the normal wound healing response, and ROS-mediated redox signalling is involved in different processes, such as cellular recruitment and cytokine and growth factor production ( 8 ). On the one hand, ROS are essential mediators of intracellular signals for haemostasis, vascular regeneration and re-epithelialization and are crucial for stimulating effective wound healing ( 9 ). However, excessive release of ROS leads to impaired cellular damage and wound repair and lipid peroxidation and causes cell death or apoptosis, which is the main cause of chronic wounds ( 10 ). Iron is an important factor in the maintenance of healthy skin, and the skin is also one of the main organs of iron metabolism; iron is actively excreted from the body through skin desquamation ( 11 ). Iron is a powerful catalyst of lipid peroxidation, and high intracellular iron concentrations generate large amounts of ROS in the Fenton reaction, leading to elevated levels of lipid peroxidation, which in turn leads to cell death and has important implications for chronic wound formation ( 11 , 12 ). Although the underlying mechanisms have not been thoroughly investigated, it is agreed that iron affects wound healing by regulating lipid peroxidation ( 13 ). Keratin-forming cells derived from interfollicular epidermis and hair follicles play different but important roles in wound healing, and as the epidermis remodels after wound healing, keratin-forming cells of these different origins lose their original characteristics and eventually assume an interfollicular epidermis (IFE)-like phenotype ( 14 – 17 ) and are important in tissue repair. Therefore, it is crucial to identify the mechanisms that contribute to the resistance of IFE cells to lipid peroxidation. It has been shown that ALDH3B1 is an aldehyde dehydrogenase that plays an important role in the detoxification of cellular aldehydes ( 18 ). Therefore, we hypothesized that ALDH3B1 plays a role in the resistance of IFE cells to lipid peroxidation. We also verified that the ability of cells to resist lipid peroxidation gradually increased when the expression of ALDH3B1 in cells gradually increased under H 2 O 2 treatment conditions. According to related studies, the NRF2 pathway is one of the important mechanisms of cellular resistance to oxidative stress, and the activation of this pathway protects cells from oxidative stress damage and increases cell survival ( 19 ). Activation of NRF2 under pathological conditions has antioxidant properties, and NRF2 controls inflammation by inhibiting the production of ROS and the expression of inflammatory cytokines, which further improves angiogenesis and promotes wound healing ( 19 – 21 ). We speculated whether IFE cells also exert resistance to lipid peroxidation through the NRF2 pathway, and we experimentally verified that IFE cells protect cells from lipid peroxidation damage by elevating ALDH3B1 expression through the NRF2 pathway. Material And Methods Animals A total of 30 specific pathogen-free (SPF) wild-type male C57BL/6J neonatal mice (license: SCXK Lu20190001), purchased from Shandong University Laboratory Animal Center, all experimental animals were housed at 22 ± 1℃, 50 ± 1% relative humidity, 12/12 hours light/dark cycle. Cell isolation, culture, processing and transfection In this research, newborn mice for primary cell extraction were purchased from Shandong University Laboratory. All experiments were approved by the ethics committee of The First Affiliated Hospital of Shandong First Medical University & Shandong Provincial Qianfoshan Hospital (Approval Number: SYDWLS[2021]002) and were performed in accordance with the guidelines and regulations. The isolation and culture of cells were performed according to previous studies ( 15 , 16 , 38 – 41 ). However, we extended the adhesion time to 1 hour to obtain IFE cells. IFE cells were cultured in transferrin (Germany, Sigma) medium (Cellntec, Switzerland) containing different concentrations of transferrin (Germany, Sigma; 0 µg/ml, 1 µg/ml, 10 µg/ml, 100 µg/ml, 1 mg/ml) for 48 hours. All cells were cultured at 37°C with 5% CO2. For ALDH3B1 overexpression experiments,IFE cells were infected with Flag-ALDH3B1 adenovirus and Flag-control adenovirus (GeneChem Co., Ltd., Shanghai, China) for 10 hours. The multiplicity of infection (MOI) was determined to be 30. Cells were incubated with iron death inducer RSL3 (MedChemExpress, 5 µM) and erastin (MedChemExpress, 20 µM) for 6 hours. TMT quantitative proteomic analysis IFE cells were cultured in medium containing 100 µg/ml transferrin (experimental group) or without transferrin (control group) for 2 days. Three samples from each group were used for TMT quantitative proteomic analysis. The TMT quantitative proteomic analysis was performed by Shanghai Applied Protein Technology Co., Ltd. (Project number: P20200801875) Cell viability assay CCK-8 (Dojindo, Japan, 1/10) was used to assess the cellular viability of treated IFEs. IFE cells were seeded in 96-well plates and treated and cultured for 48 hours. After removing the medium, 100 µL of fresh medium and 10 µL of CCK8 were added to each cell, and cell viability was measured after incubation at 37°C for 1 hour. Spark (Tecan, Austria) was used to measure cell viability at an absorbance of 450 nm. Assessment of cell proliferation IFE cells were inoculated in 96-well plates at 4×10 5 cells per well, and IFE cells were cultured in medium containing different concentrations of transferrin (0 µg/ml, 1 µg/ml, 10 µg/ml, 100 µg/ml, 1 mg/ml) for 48 hours, observed and images were acquired using the Incubation Cell S3 Live Cell Analysis System (Sartorius AG, Göttingen, Germany). The area confluence was calculated, normalized to 0 hours and displayed as a ratio to calculate the proliferation rate. Western blot analysis Protein expression levels were determined by western blot analysis. To measure relative protein expression levels, treated IFE cells were fully lysed in RIPA buffer (Thermo Fisher Scientific) to obtain protein lysates, protease inhibitors and phosphatase inhibitors (1:100) were added during protein extraction (MedChemExpress), and Pierce BCA Protein Analysis Kit (Thermo Fisher Scientific) to measure protein concentrations. Protein samples were separated by 10% SDS–PAGE and transferred to PVDF membranes. They were blocked in 5% skim milk and incubated with the respective primary antibodies overnight at 4°C. The samples were incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000 dilution; Cell Signaling Technology) for 1 hour at room temperature and detected and analysed by an iBright FL1500 imaging system (Invitrogen) using the Super Signal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Invitrogen) to detect and analyse protein expression levels. Antibody information was provided for ALDH3B1 (Proteintech Group; 19446-1-AP), NRF2 (Cell Signaling Technology; 12721S), KRT10 (Abcam, Cambridge, UK; ab76318, WB: 1/1000), KRT15 (Abcam; ab52816, IF/FC: 1/200), rabbit anti-P63 (Abcam; ab124762, WB: 1/1000), rabbit anti-KRT14 (Abcam; ab181595, WB: 1/1000), FTH (Carlsbad, CA, USA, WB: 1/1000), rabbit anti-FTL (MA5-32755, WB: 1/1000), and rabbit anti-GAPDH (Cell Signaling Technology; WB: 1/1000). Flow cytometry measurement of intracellular lipid peroxidation levels IFE cells were treated and cultured for 48 hours, digested with trypsin (Gibco, Canada), collected in 2 ml sample tubes and centrifuged (1500 × g, 5 min). A BODIPY 581/591 C11 (Invitrogen, 10 µM) and FerroOrange (Dojindo,japan) probe was used to stain the cells, and the cells were stained with eBioscience Flow Cytometry Staining Buffer (the precipitate was resuspended in 300 µl of buffer after centrifugation), incubated at 37°C for 40 min and detected by CytoFLEX flow cytometry (Beckman Coulter, Indianapolis, CA). Relative levels of lipid peroxidation and divalent ferric ions were quantified by FITC/PE and PE, respectively. Immunofluorescence Cells were fixed in 4% paraformaldehyde for 15 min at room temperature, washed 3 times in PBS, permeabilized in 0.5% Triton X-100 and PBS for 10 min, and then blocked with BlockAid Blocking Solution (Invitrogen) for 1 hour. Primary antibodies were incubated overnight at 4°C and then with the secondary antibody anti-rabbit Alexa Flour-488 (diluted 1/200, Cell Signaling Technology) at room temperature for 1 hour. Finally, nuclei were stained with Hoechst (Invitrogen, Thermo Fisher Scientific) diluted 1:10000 at room temperature for 30 min. All immunofluorescence images were taken by an A1R confocal microscope (Nikon, Melville, NY). PCR Total RNA was extracted using RNAiso Plus (9109, Takara, Japan) according to the manufacturer's protocol. Sketch™ RT Master Mix (RR036A, Takara, Japan) was used to synthesize complementary DNA by reverse transcription of RNA into DNA. Quantitative real-time PCR (qRT–PCR) experiments were performed using TB-Green™ Premix™ II (RR820A, Takara, Japan). Primers were designed and synthesized by Takara. actin was used as an endogenous reference gene. Relative gene expression was determined using the 2 −ΔΔCT method. All PCR primers are shown below. Actin-F 5′-AAATGGTGAGGGTCGGTGAAC-3′ Actin-R 5′-CAAATCCTCTTTGCCACTG-3′ ALDH3B1-F 5′- GAACTACCCCGTGAACCTGAC − 3′ ALDH3B1-R 5′- ACCTTCTCCGTGCCCTTACTA − 3′ Inhibitors of the NRF2 pathway Cells were inoculated in six-well plates, and after 24 hours of cell culture, an inhibitor of NRF2 (Hinokitiol, MedChemExpress; 20 µM, 12 hours) was added to the cells. Statistical analysis All data were statistically analysed using GraphPad Prism version 9.0.0 (GraphPad Software, San Diego, CA). Data were obtained from three experiments and are expressed as the mean ± standard deviation, and between-group data were assessed using unpaired t tests or one-way ANOVA. Asterisks indicate significance between conditions in each group. P values are marked as *P < 0.05, **P < 0.01, ***P < 0.001. Results 1 Identification of IFE cells We extracted IFE cells from the skin of newborn mice, As shown in Fig. 1a, after two days of culture, IFE cells were observed as pebble-like under light microscopy. KRT14, KRT15 and P63 are epidermal stem cell markers, KRT10 is the markers of keratinocytes ( 41 ). We extracted protein lysates from rapidly adherent and nonadherent cells. KRT14, KRT15 and P63 were highly expressed in rapidly adherent cells, while the expression of KRT10 was low (Fig. 1b). In addition, flow cytometry showed that more than 85% of primary cells expressed KRT15, KRT14 and P63, while less than 15% expressed KRT10 (Fig. 1c). We extracted primary IFE cells from neonatal mouse skin for study and performed immunofluorescence staining using the basal cell markers KRT14, KRT15, and P63 and the mature keratinocyte marker KRT10, which showed that most of the primary cells were KRT14 positive, KRT15 positive or P63 positive, while few keratin-forming cells were KRT10 positive (Fig. 1d). These experimental results demonstrate that the purity of IFE cells we extracted from the skin of newborn mice was high. 2 Effect of different concentrations of transferrin treatment on the survival rate and lipid peroxidation level of IFE cells IFE cell viability and lipid peroxidation levels do not change with increasing iron ion concentration in IFE cells. As shown in Figure (2a-2b), flow cytometry detected the content of divalent iron (Fe 2+ ) in IFE cells treated with different concentrations of transferrin (0 µg/ml, 1 µg/ml, 10 µg/ml, 100 µg/ml, 1 mg/ml), and the results showed that with the increase in transferrin concentration, the content of intracellular divalent iron was also increased, while we detected protein by immunoblotting in each group of IFE cells. We also examined the expression of ferritin heavy chain (FTH) and ferritin light chain (FTL) in IFE cells by protein immunoblotting, and the results showed that the expression of FTH and FTL in IFE cells increased gradually with increasing transferrin concentration (Fig. 2c-2d). In addition, after we treated IFE cells with different concentrations of transferrin, we assayed IFE cell viability with CCK8 and found no difference between the groups (Fig. 2e). Under this condition, we also examined the changes in IFE cell proliferation, and the results showed almost no difference in the proliferation rate of IFE cells (Fig. 2f). Moreover, we examined the level of lipid peroxidation in IFE cells, and the results showed that there was almost no difference in the level of lipid peroxidation between the groups (Fig. 2g-2h). These experimental results showed that although the intracellular iron content increased, the level of lipid peroxidation, cell viability and proliferation in IFE cells were not affected. A protective mechanism may exist in IFE cells against lipid peroxidation. To investigate whether the elevated iron ion concentration had any protective effect on IFE cells or whether some protective mechanism was generated in IFE cells stimulated as described above, IFE cells were treated with different concentrations of transferrin along with 600 µM H 2 O 2 for 6 hours. The results showed a decreasing trend of intracellular lipid peroxidation levels with increasing transferrin concentration (Fig. 2i-2j). The experimental results suggest that there was a protective mechanism in IFE cells against lipid peroxidation damage, and the more iron content in IFE cells, the stronger this protective effect it produces. 3 Elevated expression of ALDH3B1 in IFE cells and ALDH3B1-overexpressing cells Based on the results of the previous study, we conducted further studies. IFE cells were cultured with medium containing 100 µg/ml transferrin (Tf group) and normal (Ctrl group) medium for 48 hours. The TMT quantitative proteomics results showed that the expression of ALDH3B1 and ferritin light chain (FTL) was elevated in the Tf group compared with the Ctrl group (Fig. 3a-3b). In addition, we cultured IFE cells with different transferrin concentrations (0 µg/ml, 1 µg/ml, 10 µg/ml, 100 µg/ml, and 1 mg/ml) for 48 hours, and after protein extraction, protein blotting analysis confirmed that ALDH3B1 expression showed an elevated trend (Fig. 3c-3d). Based on the above experimental results, The elevated expression of FTL further demonstrates that the addition of transferrin to cultured IFE cells increases the intracellular concentration of iron ions. As the concentration of transferrin increased, the expression of ALDH3B1 also gradually increased. This demonstrates that ALDH3B1 may be a key gene in the resistance of IFE cells to lipid peroxidation. We next set out to explore whether ALDH3B1 has a role in resisting lipid peroxidation in IFE cells. First, we infected IFE cells with Flag-ALDH3B1 adenovirus and Flag-control adenovirus. Western blot and qPCR analyses showed that ALDH3B1 protein expression and mRNA transcription in the Flag-ALDH3B1 group were significantly higher than those in the Flag-Control group (Fig. 3e-3f). The immunofluorescence results showed Flag expression in both the Flag-ALDH3B1 group and Flag-Control group, and the fluorescence of the Flag-ALDH3B1 group was more intense (Fig. 3g). Moreover, the cell proliferation and cell viability experiment result showed no difference in the cell proliferation curve between the two groups (Fig. 3h-3i). 4 Protective effect of ALDH3B1 on IFE cells against lipid peroxidation To verify the protective effect of ALDH3B1 on IFE cells, we divided the cells into the ALDH3B1 group and the control group. As shown in Fig. 4a, we first verified that overexpression of ALDH3B1 had no effect on the level of lipid peroxidation in IFE cells. Overexpression of ALDH3B1 has no effect on lipid peroxidation levels in IFE cells under unstimulated conditions. After treatment with H 2 O 2 , RSL3 and Erastin, IFE cells in the ALDH3B1 group showed lower levels of lipid peroxidation than those in the control group (Fig. 4b-4d). We demonstrate that overexpression of ALDH3B1 enables IFE cells to resist lipid peroxidation when factors that increase the level of lipid peroxidation in IFE cells are present. Meanwhile, the CCK8 results showed that IFE cells in the ALDH3B1 group had higher cell viability than those in the control group (Fig. 4e-4g). In IFE cells, we further verified whether ALDH3B1 expression is related to the ability to resist lipid peroxidation. We used different MOI values for cell transfection and found that as the expression of ALDH3B1 gradually increased (Fig. 4h-4i), the ability of IFE cells to resist lipid peroxidation also gradually increased, and the level of lipid peroxidation was gradually reduced by 600 µM H 2 O 2 treatment (Fig. 4j-4k). The above experiments verified that overexpression of ALDH3B1 in IFE cells can contribute to resistance to lipid peroxidation. 5 Activation of ALDH3B1 via the NRF2 pathway protects IFE cells As the NRF2 pathway is an important pathway for cellular antioxidant ( 29 ), after treatment of IFE cells with different concentrations of transferrin, we found that while the expression of ALDH3B1 gradually increased, the expression of NRF2 also gradually increased (Fig. 5a-5b). We speculate that ALDH3B1 may be linked to the NRF2 pathway. To verify the above speculation, we verified that under the treatment conditions of 1 mg/ml transferrin, IFE cells treated with NRF2 inhibitor (Hinokitiol group) compared with cells treated with DMSO (DMSO group), the expression of NRF2 in the Hinokitiol group was decreased along with the expression of ALDH3B1 (Fig. 5c-5d). In addition, we measured the lipid peroxidation level and cellular activity of the Hinokitiol group and DMSO group by flow cytometry and CCK8 assays. The Hinokitiol group had higher lipid peroxidation levels and lower cellular viability than the DMSO group (Fig. 5e-5g). After we used Hinokitiol to inhibit NRF2 expression in IFE cells, the expression of ALDH3B1 was reduced in the Hinokitiol group, while the lipid peroxidation level of the cells was elevated and cell viability was reduced. In conclusion, these results demonstrate that activation of ALDH3B1 through the NRF2 pathway protects IFE cells from damage caused by lipid peroxidation. Discussion IFE cells are located in the basal layer of the epidermis and proliferate and differentiate during migration to the suprabasal layer, promoting wound healing ( 22 – 24 ). Stem cells in hair follicles and IFE cells contribute to the re-epithelialization of wounds ( 25 ). IFE cells are mainly consisting mainly of stem cells and progenitor cells, which are the source of almost all differentiated keratinized cells in the epidermis ( 26 – 27 ). During wound healing, cells from hair follicles and IFE have been shown to migrate to the wound surface, and damage to IFE cells can lead to nonhealing of the wound surface ( 13 , 28 , 29 ). Therefore, IFE cells play an important role in the wound healing process. The balance between the positive and harmful effects of ROS is crucial for wound healing. Although the production of reactive oxygen species is important for initiating wound healing, excessive ROS can impair the wound healing process by causing lipid peroxidation in cells, which in turn affects protein modification and leads to DNA damage, ultimately increasing cell death and senescence ( 28 ). Excessive and uncontrolled lipid peroxidation during wound healing maintains the wound in an inflammatory phase, leading to delayed healing and the formation of chronic wounds ( 8 , 25 , 30 ). Additionally, Trace elements and transition metal iron play an important role in cell proliferation and differentiation, but when iron metabolism is abnormal, iron can disrupt redox homeostasis through the Fenton reaction leading to the development of lipid peroxidation and causing chronic trauma formation. There is iron overload in chronic wounds, with increased ROS production and pro-oxidant capacity, leading to delayed healing of the wounds ( 13 , 31 ). Some harmful factors that expose IFE cells to lipid peroxidation can lead to delayed or nonhealing of wounds. Therefore, how to maintain the balance of pro-oxidant and anti-oxidant capacity and increase the ability of trabecular cells to resist lipid peroxidation during wound healing has become an important issue. ALDH3B1 is a key enzyme for cellular resistance to aldehydes and oxidative inducers ( 18 , 32 ). In study, we found that IFE cell activity and proliferative capacity were not affected when the concentration of iron ions in IFE cells was elevated. The expression of ALDH3B1 in IFE cells was also detected to be elevated. Therefore, we hypothesized that ALDH3B1 helps to protect IFE cells from lipid peroxidation damage. Treatment of IFE cells with transferrin causes elevated intracellular divalent iron, which catalyses lipid peroxidation in the presence of divalent iron or esteroxygenase, a highly expressed unsaturated fatty acid on the cell membrane, thereby inducing cellular iron death ( 11 , 33 ). we selected the iron death inducers Rsl3 and erastin to culture IFE cells. We observed that the ALDH3B1 group had higher cell viability and lower levels of lipid peroxidation than the control group.In addition, it has been reported that the NRF2 pathway plays a key role in the body's resistance to lipid peroxidation, and this pathway can reduce oxidative damage and is involved in the regulation of antioxidant gene expression during oxidative stress, thereby enhancing cellular resistance to lipid peroxidation ( 34 – 37 ). We therefore hypothesized that activation of the NRF2 pathway elevates the expression of ALDH3B1 and thus promotes the resistance of IFE cells to lipid peroxidation damage. When IFE cells were treated with different concentration gradients of transferrin, an increase in ALDH3B1 expression was detected along with an increase in NRF2 expression. To this end, we selected the conditions of 1 mg/ml transferrin concentration with the addition of NRF2 inhibitor. We found that the decrease in NRF2 expression was accompanied by a decrease in ALDH3B1 expression and a decrease in Lipid peroxidation levels intracellular ROS in the experimental group compared to the control group. This confirms that it is through the activation of the NRF2 pathway that ALDH3B1 expression is increased and exerts its effects against lipid peroxidation in IFE cells. This study also has some drawbacks, as we only showed the resistance of ALDH3B1 to lipid peroxidation in IFE cells, and there were no animal experiments to confirm the role of ALDH3B1 in wound healing. In addition, we only demonstrated that NRF2 can affect the change in ALDH3B1 expression, but the mechanism of the NRF2 effect on ALDH3B1 was not demonstrated. Conclusion In this study, we established a cellular lipid peroxidation injury cell model using H 2 O 2 , RSL3 and erastin to investigate the resistance of ALDH3B1 to lipid peroxidation. Our results showed that ALDH3B1 could protect IFE cells from lipid peroxidation damage and demonstrated that the NRF2 pathway played a role in promoting ALDH3B1 expression to improve IFE cell survival and reduce lipid peroxidation levels. Declarations ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundation of China (81972947), Natural Science Foundation of Shandong Province of China (Major Basic Research Program) (ZR2019ZD38), “Academy Promotion Program” of Shandong First Medical University (Shandong Academy of Medical Sciences) (2019LJ005), Key Research and Development Program of Shandong Province of China (2019GSF108128) and Jinan Clinical Research Center for Tissue Engineering Skin Regeneration and Wound Repair. References Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng. 2001;7(2):211-28. Gosain A, DiPietro LA. Aging and wound healing. World J Surg. 2004;28(3):321-6. Guo S, Dipietro LA. Factors affecting wound healing. J Dent Res. 2010;89(3):219-29. Martin P. Wound healing--aiming for perfect skin regeneration. Science. 1997;276(5309):75-81. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med. 1999;341(10):738-46. Brem H, Stojadinovic O, Diegelmann RF, Entero H, Lee B, Pastar I, et al. Molecular markers in patients with chronic wounds to guide surgical debridement. Mol Med. 2007;13(1-2):30-9. Schultz GS, White M, Mitchell R, Brown G, Lynch J, Twardzik DR, et al. Epithelial wound healing enhanced by transforming growth factor-alpha and vaccinia growth factor. Science. 1987;235(4786):350-2. Cano Sanchez M, Lancel S, Boulanger E, Neviere R. Targeting Oxidative Stress and Mitochondrial Dysfunction in the Treatment of Impaired Wound Healing: A Systematic Review. Antioxidants (Basel). 2018;7(8). D'Autréaux B, Toledano MB. ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nat Rev Mol Cell Biol. 2007;8(10):813-24. Schäfer M, Werner S. Oxidative stress in normal and impaired wound repair. Pharmacol Res. 2008;58(2):165-71. Wright JA, Richards T, Srai SK. The role of iron in the skin and cutaneous wound healing. Front Pharmacol. 2014;5:156. Sindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, Peter H, et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. J Clin Invest. 2011;121(3):985-97. Wlaschek M, Singh K, Sindrilaru A, Crisan D, Scharffetter-Kochanek K. Iron and iron-dependent reactive oxygen species in the regulation of macrophages and fibroblasts in non-healing chronic wounds. Free Radic Biol Med. 2019;133:262-75. Abhishek S, Palamadai Krishnan S. Epidermal Differentiation Complex: A Review on Its Epigenetic Regulation and Potential Drug Targets. Cell J. 2016;18(1):1-6. Clayton E, Doupé DP, Klein AM, Winton DJ, Simons BD, Jones PH. A single type of progenitor cell maintains normal epidermis. Nature. 2007;446(7132):185-9. Gonzales KAU, Fuchs E. Skin and Its Regenerative Powers: An Alliance between Stem Cells and Their Niche. Dev Cell. 2017;43(4):387-401. Mardaryev AN, Gdula MR, Yarker JL, Emelianov VU, Poterlowicz K, Sharov AA, et al. p63 and Brg1 control developmentally regulated higher-order chromatin remodelling at the epidermal differentiation complex locus in epidermal progenitor cells. Development. 2014;141(1):101-11. Marchitti SA, Brocker C, Orlicky DJ, Vasiliou V. Molecular characterization, expression analysis, and role of ALDH3B1 in the cellular protection against oxidative stress. Free Radic Biol Med. 2010;49(9):1432-43. Li X, Xie X, Lian W, Shi R, Han S, Zhang H, et al. Exosomes from adipose-derived stem cells overexpressing NRF2 accelerate cutaneous wound healing by promoting vascularization in a diabetic foot ulcer rat model. Exp Mol Med. 2018;50(4):1-14. Lu MC, Ji JA, Jiang ZY, You QD. The Keap1-NRF2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update. Med Res Rev. 2016;36(5):924-63. Ma T, Fu B, Yang X, Xiao Y, Pan M. Adipose mesenchymal stem cell-derived exosomes promote cell proliferation, migration, and inhibit cell apoptosis via Wnt/β-catenin signaling in cutaneous wound healing. J Cell Biochem. 2019;120(6):10847-54. Ito M, Liu Y, Yang Z, Nguyen J, Liang F, Morris RJ, et al. Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Nat Med. 2005;11(12):1351-4. Mascré G, Dekoninck S, Drogat B, Youssef KK, Broheé S, Sotiropoulou PA, et al. Distinct contribution of stem and progenitor cells to epidermal maintenance. Nature. 2012;489(7415):257-62. Taylor G, Lehrer MS, Jensen PJ, Sun TT, Lavker RM. Involvement of follicular stem cells in forming not only the follicle but also the epidermis. Cell. 2000;102(4):451-61. Bagdas D, Etoz BC, Gul Z, Ziyanok S, Inan S, Turacozen O, et al. In vivo systemic chlorogenic acid therapy under diabetic conditions: Wound healing effects and cytotoxicity/genotoxicity profile. Food Chem Toxicol. 2015; 81:54-61. Page ME, Lombard P, Ng F, Göttgens B, Jensen KB. The epidermis comprises autonomous compartments maintained by distinct stem cell populations. Cell Stem Cell. 2013;13(4):471-82. Tumbar T, Guasch G, Greco V, Blanpain C, Lowry WE, Rendl M, et al. Defining the epithelial stem cell niche in skin. Science. 2004;303(5656):359-63. Chen L, Sun L, Liu Z, Wang H, Xu C. Protection afforded by quercetin against H2O2-induced apoptosis on PC12 cells via activating PI3K/Akt signal pathway. J Recept Signal Transduct Res. 2016;36(1):98-102. Liu Y, Yang X, Liu Y, Jiang T, Ren S, Chen J, et al. NRF2 signalling pathway: New insights and progress in the field of wound healing. J Cell Mol Med. 2021;25(13):5857-68. Moseley R, Stewart JE, Stephens P, Waddington RJ, Thomas DW. Extracellular matrix metabolites as potential biomarkers of disease activity in wound fluid: lessons learned from other inflammatory diseases? Br J Dermatol. 2004;150(3):401-13. Ding J, Gao B, Chen Z, Mei X. An NIR-Triggered Au Nanocage Used for Photo-Thermo Therapy of Chronic Wound in Diabetic Rats Through Bacterial Membrane Destruction and Skin Cell Mitochondrial Protection. Front Pharmacol. 2021;1 2:779944. Sun H, Zhang M, Li L, Huang Z. ALDH3B1 Is an Independent Prognostic Biomarker of Lung Adenocarcinoma. Technol Cancer Res Treat. 2020; 19:1533033820946018. Aroun A, Zhong JL, Tyrrell RM, Pourzand C. Iron, oxidative stress and the example of solar ultraviolet A radiation. Photochem Photobiol Sci. 2012;11(1):118-34. Jazvinšćak Jembrek M, Oršolić N, Mandić L, Sadžak A, Šegota S. Anti-Oxidative, Anti-Inflammatory and Anti-Apoptotic Effects of Flavonols: Targeting NRF2, NF-κB and p53 Pathways in Neurodegeneration. Antioxidants (Basel). 2021;10(10). Maresova P, Hruska J, Klimova B, Barakovic S, Krejcar O. Activities of Daily Living and Associated Costs in the Most Widespread Neurodegenerative Diseases: A Systematic Review. Clin Interv Aging. 2020; 15:1841-62. Li M, Yu H, Pan H, Zhou X, Ruan Q, Kong D, et al. NRF2 Suppression Delays Diabetic Wound Healing Through Sustained Oxidative Stress and Inflammation. Front Pharmacol. 2019; 10:1099. Xu Y, Sang W, Zhong Y, Xue S, Yang M, Wang C, et al. CoCrMo-Nanoparticles induced peri-implant osteolysis by promoting osteoblast ferroptosis via regulating NRF2-ARE signalling pathway. Cell Prolif. 2021;54(12): e13142. Aliborzi G, Vahdati A, Mehrabani D, Hosseini SE, Tamadon A. Isolation, Characterization and Growth Kinetic Comparison of Bone Marrow and Adipose Tissue Mesenchymal Stem Cells of Guinea Pig. Int J Stem Cells. 2016;9(1):115-23. Wang J, He J, Zhu M, Han Y, Yang R, Liu H, et al. Cellular Heterogeneity and Plasticity of Skin Epithelial Cells in Wound Healing and Tumorigenesis. Stem Cell Rev Rep. 2022. Singh R. Basal Cells in the Epidermis and Epidermal Differentiation. Stem Cell Rev Rep. 2022. Ghadially R. 25 years of epidermal stem cell research. J Invest Dermatol. 2012;132(3 Pt 2):797-810. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 01 Nov, 2022 Read the published version in Cell Stress and Chaperones → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-1795852\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":116506886,\"identity\":\"f75f3162-7923-4bad-a544-537eefde0ea7\",\"order_by\":0,\"name\":\"zhenjie wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"zhenjie\",\"middleName\":\"\",\"lastName\":\"wu\",\"suffix\":\"\"},{\"id\":116506890,\"identity\":\"b26e15cc-81bf-445e-bff2-ddbd8e29ee95\",\"order_by\":1,\"name\":\"Aoyu Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Shandong First Medical University, Shandong Provincial Qianfoshan Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aoyu\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":116506892,\"identity\":\"24adac31-01ee-48f9-a6e2-8c59cd5b2370\",\"order_by\":2,\"name\":\"Guang Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guang\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":116506894,\"identity\":\"3a0f1475-1db0-4a17-80a1-6e16858ee9d1\",\"order_by\":3,\"name\":\"Chunyan Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Shandong First Medical University, Shandong Provincial Qianfoshan Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chunyan\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":116506895,\"identity\":\"1bdd29e0-8a81-4491-b4fc-7c9b14adde44\",\"order_by\":4,\"name\":\"Siyuan Yin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Shandong First Medical University, Shandong Provincial Qianfoshan Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Siyuan\",\"middleName\":\"\",\"lastName\":\"Yin\",\"suffix\":\"\"},{\"id\":116506897,\"identity\":\"1251dec5-31d8-4b50-a05a-12e277bc95ea\",\"order_by\":5,\"name\":\"Ru Song\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ru\",\"middleName\":\"\",\"lastName\":\"Song\",\"suffix\":\"\"},{\"id\":116506899,\"identity\":\"01df94b7-252c-4b96-adf3-5983c306b669\",\"order_by\":6,\"name\":\"Jiaxu Ma\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiaxu\",\"middleName\":\"\",\"lastName\":\"Ma\",\"suffix\":\"\"},{\"id\":116506901,\"identity\":\"d32d2262-faf2-40c4-bbbd-0ebeef1550d5\",\"order_by\":7,\"name\":\"Guoqi Cao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guoqi\",\"middleName\":\"\",\"lastName\":\"Cao\",\"suffix\":\"\"},{\"id\":116506903,\"identity\":\"6c825647-1ac1-47fc-ac0b-1a264e3fdf42\",\"order_by\":8,\"name\":\"Rui Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rui\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":116506905,\"identity\":\"a8a587b4-7e46-42de-988d-1b7e4d53de11\",\"order_by\":9,\"name\":\"Jian Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jian\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":116506907,\"identity\":\"dd484760-13a6-4788-bc6d-fcdd091c8951\",\"order_by\":10,\"name\":\"Yibing Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYDACCTBpw8Bw+ACIwUy0ljQGhmMJpGk5TIIWg9s9hp8Lfp235zvGnSbBUGGd2MB+9gB+LXfOGEvP7LudOPMY7zYJhjPpiQ08eQn4tdzI3SDN23M7weB+7zYJxrbDiQ0SPAaEtGz+zdtzzt4AZAvjP+K0bJPm+XGAcQNYSwMRWiTvnP9mzduQDPLLZouEY+nGbTw5+LXw3W5Lvs3zxw4YYrwbb3yosZbtZz+DX4vCASDB2AblJQAxG171QCDfACL/EFI2CkbBKBgFIxoAALJVSzcMtnsQAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Shandong First Medical University, Shandong Provincial Qianfoshan Hospital\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yibing\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2022-06-26 05:44:07\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-1795852/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-1795852/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s12192-022-01306-9\",\"type\":\"published\",\"date\":\"2022-11-01T19:15:49+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":23465213,\"identity\":\"4abdfdab-d48b-42bf-9b00-4bc1f8a2971b\",\"added_by\":\"auto\",\"created_at\":\"2022-07-05 16:42:50\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1622293,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1795852/v1/78d9e012835c2667496dea90.png\"},{\"id\":23466795,\"identity\":\"efa66c93-7bc4-45f3-a520-b0c45b7cddb5\",\"added_by\":\"auto\",\"created_at\":\"2022-07-05 16:47:50\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":450044,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1795852/v1/ec73dd08047fa6ee4d84fc5c.png\"},{\"id\":23465216,\"identity\":\"cff2f607-5d95-49b0-92e7-bbda4fb3e0f2\",\"added_by\":\"auto\",\"created_at\":\"2022-07-05 16:42:50\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1256835,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1795852/v1/f108745ba7a1ec05961f909b.png\"},{\"id\":23465212,\"identity\":\"af6af4b4-0710-4e85-931d-3ae4f04de9a0\",\"added_by\":\"auto\",\"created_at\":\"2022-07-05 16:42:50\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":409481,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e Protective effect of ALDH3B1 on IFE cells against lipid peroxidation. (a) Flow cytometry detection of lipid peroxidation levels in the ALDH3B1 group and control group in the absence of any stimulation conditions. (b-d) Comparison of lipid peroxidation levels measured by flow cytometry in each group under Rsl3, Erastin and H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment conditions. (e-g) Comparison of cell viability between groups measured under Rsl3, Erastin, and H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment conditions. (h-i) IFE cell transfection set MOI value 0 to 50, protein immunoblotting assay to detect the expression of ALDH3B1. (j-k) The lipid peroxidation level of each group was detected in cells transfected with different MOI values under 600μMH2O2 treatment conditions. Data are presented as the mean ± SD, and significant differences were evaluated using an unpaired t test. *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1795852/v1/776ac9401acb2ba305b99d34.png\"},{\"id\":23465215,\"identity\":\"2f487777-c159-40b4-b8d1-e14a5f2ce718\",\"added_by\":\"auto\",\"created_at\":\"2022-07-05 16:42:50\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":430953,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eElevation of ALDH3B1 expression through activation of the NRF2 signalling pathway protects IFE cells from damage by lipid peroxidation. (a-b) Expression of NRF2 in IFE cells treated with 0, 1, 10, 100 or 1000 μg/ml transferrin. (c-d) Western blotting analysis of NRF2 and ALDH3B1 expression in the Hinokitiol and DMSO groups. (e) Cell viability in the Hinokitiol and DMSO groups were detected by CCK8 after NRF2 inhibitor treatment. (f-g) The levels of lipid peroxidation in the Hinokitiol and DMSO groups were detected by flow cytometry after NRF2 inhibitor treatment. Data are presented as the mean ± SD, and significant differences were evaluated using an unpaired t test. *P\\u0026lt;0.05, **P \\u0026lt;0.01, ***P\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1795852/v1/123cb43ce5c890a56272b0ca.png\"},{\"id\":23466797,\"identity\":\"68bee77b-0217-4ced-92c5-a60e76eeb39d\",\"added_by\":\"auto\",\"created_at\":\"2022-07-05 16:47:53\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1597224,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-1795852/v1/7e4d4687-27ab-4717-b455-e99c9f6de357.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"ALDH3B1 protects interfollicular epidermal cells against lipid peroxidation via the NRF2 pathway\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe failure of wounds to heal causes great pain to patients and places an economic burden on society (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). Wound healing is an important and complex physiological process that is essential to maintain the barrier function of the skin and consists of a haemostatic/inflammatory phase, a proliferative phase, and a remodelling phase (\\u003cspan additionalcitationids=\\\"CR3 CR4\\\" citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e). During the progression of many diseases, events related to wound healing can be compromised, leading to nonhealing of the wound and the formation of chronic wounds (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e). Reactive oxygen species (ROS) play a key role in the orchestration of the normal wound healing response, and ROS-mediated redox signalling is involved in different processes, such as cellular recruitment and cytokine and growth factor production (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). On the one hand, ROS are essential mediators of intracellular signals for haemostasis, vascular regeneration and re-epithelialization and are crucial for stimulating effective wound healing (\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). However, excessive release of ROS leads to impaired cellular damage and wound repair and lipid peroxidation and causes cell death or apoptosis, which is the main cause of chronic wounds (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIron is an important factor in the maintenance of healthy skin, and the skin is also one of the main organs of iron metabolism; iron is actively excreted from the body through skin desquamation (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e). Iron is a powerful catalyst of lipid peroxidation, and high intracellular iron concentrations generate large amounts of ROS in the Fenton reaction, leading to elevated levels of lipid peroxidation, which in turn leads to cell death and has important implications for chronic wound formation (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e). Although the underlying mechanisms have not been thoroughly investigated, it is agreed that iron affects wound healing by regulating lipid peroxidation (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eKeratin-forming cells derived from interfollicular epidermis and hair follicles play different but important roles in wound healing, and as the epidermis remodels after wound healing, keratin-forming cells of these different origins lose their original characteristics and eventually assume an interfollicular epidermis (IFE)-like phenotype (\\u003cspan additionalcitationids=\\\"CR15 CR16\\\" citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e) and are important in tissue repair. Therefore, it is crucial to identify the mechanisms that contribute to the resistance of IFE cells to lipid peroxidation.\\u003c/p\\u003e \\u003cp\\u003eIt has been shown that ALDH3B1 is an aldehyde dehydrogenase that plays an important role in the detoxification of cellular aldehydes (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). Therefore, we hypothesized that ALDH3B1 plays a role in the resistance of IFE cells to lipid peroxidation. We also verified that the ability of cells to resist lipid peroxidation gradually increased when the expression of ALDH3B1 in cells gradually increased under H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment conditions. According to related studies, the NRF2 pathway is one of the important mechanisms of cellular resistance to oxidative stress, and the activation of this pathway protects cells from oxidative stress damage and increases cell survival (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e). Activation of NRF2 under pathological conditions has antioxidant properties, and NRF2 controls inflammation by inhibiting the production of ROS and the expression of inflammatory cytokines, which further improves angiogenesis and promotes wound healing (\\u003cspan additionalcitationids=\\\"CR20\\\" citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). We speculated whether IFE cells also exert resistance to lipid peroxidation through the NRF2 pathway, and we experimentally verified that IFE cells protect cells from lipid peroxidation damage by elevating ALDH3B1 expression through the NRF2 pathway.\\u003c/p\\u003e\"},{\"header\":\"Material And Methods\",\"content\":\"\\u003ch2\\u003eAnimals\\u003c/h2\\u003e\\n\\u003cp\\u003eA total of 30 specific pathogen-free (SPF) wild-type male C57BL/6J neonatal mice (license: SCXK Lu20190001), purchased from Shandong University Laboratory Animal Center, all experimental animals were housed at 22\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1℃, 50\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1% relative humidity, 12/12 hours light/dark cycle.\\u003c/p\\u003e\\n\\u003ch2\\u003eCell isolation, culture, processing and transfection\\u003c/h2\\u003e\\n\\u003cp\\u003eIn this research, newborn mice for primary cell extraction were purchased from Shandong University Laboratory. All experiments were approved by the ethics committee of The First Affiliated Hospital of Shandong First Medical University \\u0026amp; Shandong Provincial Qianfoshan Hospital (Approval Number: SYDWLS[2021]002) and were performed in accordance with the guidelines and regulations. The isolation and culture of cells were performed according to previous studies (\\u003cspan class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e, \\u003cspan class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u0026ndash;\\u003cspan class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). However, we extended the adhesion time to 1 hour to obtain IFE cells. IFE cells were cultured in transferrin (Germany, Sigma) medium (Cellntec, Switzerland) containing different concentrations of transferrin (Germany, Sigma; 0 \\u0026micro;g/ml, 1 \\u0026micro;g/ml, 10 \\u0026micro;g/ml, 100 \\u0026micro;g/ml, 1 mg/ml) for 48 hours. All cells were cultured at 37\\u0026deg;C with 5% CO2. For ALDH3B1 overexpression experiments,IFE cells were infected with Flag-ALDH3B1 adenovirus and Flag-control adenovirus (GeneChem Co., Ltd., Shanghai, China) for 10 hours. The multiplicity of infection (MOI) was determined to be 30. Cells were incubated with iron death inducer RSL3 (MedChemExpress, 5 \\u0026micro;M) and erastin (MedChemExpress, 20 \\u0026micro;M) for 6 hours.\\u003c/p\\u003e\\n\\u003ch2\\u003eTMT quantitative proteomic analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eIFE cells were cultured in medium containing 100 \\u0026micro;g/ml transferrin (experimental group) or without transferrin (control group) for 2 days. Three samples from each group were used for TMT quantitative proteomic analysis. The TMT quantitative proteomic analysis was performed by Shanghai Applied Protein Technology Co., Ltd. (Project number: P20200801875)\\u003c/p\\u003e\\n\\u003ch2\\u003eCell viability assay\\u003c/h2\\u003e\\n\\u003cp\\u003eCCK-8 (Dojindo, Japan, 1/10) was used to assess the cellular viability of treated IFEs. IFE cells were seeded in 96-well plates and treated and cultured for 48 hours. After removing the medium, 100 \\u0026micro;L of fresh medium and 10 \\u0026micro;L of CCK8 were added to each cell, and cell viability was measured after incubation at 37\\u0026deg;C for 1 hour. Spark (Tecan, Austria) was used to measure cell viability at an absorbance of 450 nm.\\u003c/p\\u003e\\n\\u003ch2\\u003eAssessment of cell proliferation\\u003c/h2\\u003e\\n\\u003cp\\u003eIFE cells were inoculated in 96-well plates at 4\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well, and IFE cells were cultured in medium containing different concentrations of transferrin (0 \\u0026micro;g/ml, 1 \\u0026micro;g/ml, 10 \\u0026micro;g/ml, 100 \\u0026micro;g/ml, 1 mg/ml) for 48 hours, observed and images were acquired using the Incubation Cell S3 Live Cell Analysis System (Sartorius AG, G\\u0026ouml;ttingen, Germany). The area confluence was calculated, normalized to 0 hours and displayed as a ratio to calculate the proliferation rate.\\u003c/p\\u003e\\n\\u003ch2\\u003eWestern blot analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eProtein expression levels were determined by western blot analysis. To measure relative protein expression levels, treated IFE cells were fully lysed in RIPA buffer (Thermo Fisher Scientific) to obtain protein lysates, protease inhibitors and phosphatase inhibitors (1:100) were added during protein extraction (MedChemExpress), and Pierce BCA Protein Analysis Kit (Thermo Fisher Scientific) to measure protein concentrations. Protein samples were separated by 10% SDS\\u0026ndash;PAGE and transferred to PVDF membranes. They were blocked in 5% skim milk and incubated with the respective primary antibodies overnight at 4\\u0026deg;C. The samples were incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000 dilution; Cell Signaling Technology) for 1 hour at room temperature and detected and analysed by an iBright FL1500 imaging system (Invitrogen) using the Super Signal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Invitrogen) to detect and analyse protein expression levels. Antibody information was provided for ALDH3B1 (Proteintech Group; 19446-1-AP), NRF2 (Cell Signaling Technology; 12721S), KRT10 (Abcam, Cambridge, UK; ab76318, WB: 1/1000), KRT15 (Abcam; ab52816, IF/FC: 1/200), rabbit anti-P63 (Abcam; ab124762, WB: 1/1000), rabbit anti-KRT14 (Abcam; ab181595, WB: 1/1000), FTH (Carlsbad, CA, USA, WB: 1/1000), rabbit anti-FTL (MA5-32755, WB: 1/1000), and rabbit anti-GAPDH (Cell Signaling Technology; WB: 1/1000).\\u003c/p\\u003e\\n\\u003ch2\\u003eFlow cytometry measurement of intracellular lipid peroxidation levels\\u003c/h2\\u003e\\n\\u003cp\\u003eIFE cells were treated and cultured for 48 hours, digested with trypsin (Gibco, Canada), collected in 2 ml sample tubes and centrifuged (1500 \\u0026times; g, 5 min). A BODIPY 581/591 C11 (Invitrogen, 10 \\u0026micro;M) and FerroOrange (Dojindo,japan) probe was used to stain the cells, and the cells were stained with eBioscience Flow Cytometry Staining Buffer (the precipitate was resuspended in 300 \\u0026micro;l of buffer after centrifugation), incubated at 37\\u0026deg;C for 40 min and detected by CytoFLEX flow cytometry (Beckman Coulter, Indianapolis, CA). Relative levels of lipid peroxidation and divalent ferric ions were quantified by FITC/PE and PE, respectively.\\u003c/p\\u003e\\n\\u003ch2\\u003eImmunofluorescence\\u003c/h2\\u003e\\n\\u003cp\\u003eCells were fixed in 4% paraformaldehyde for 15 min at room temperature, washed 3 times in PBS, permeabilized in 0.5% Triton X-100 and PBS for 10 min, and then blocked with BlockAid Blocking Solution (Invitrogen) for 1 hour. Primary antibodies were incubated overnight at 4\\u0026deg;C and then with the secondary antibody anti-rabbit Alexa Flour-488 (diluted 1/200, Cell Signaling Technology) at room temperature for 1 hour. Finally, nuclei were stained with Hoechst (Invitrogen, Thermo Fisher Scientific) diluted 1:10000 at room temperature for 30 min. All immunofluorescence images were taken by an A1R confocal microscope (Nikon, Melville, NY).\\u003c/p\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec3\\\"\\u003e\\n \\u003ch2\\u003ePCR\\u003c/h2\\u003e\\n \\u003cp\\u003eTotal RNA was extracted using RNAiso Plus (9109, Takara, Japan) according to the manufacturer\\u0026apos;s protocol. Sketch\\u0026trade; RT Master Mix (RR036A, Takara, Japan) was used to synthesize complementary DNA by reverse transcription of RNA into DNA. Quantitative real-time PCR (qRT\\u0026ndash;PCR) experiments were performed using TB-Green\\u0026trade; Premix\\u0026trade; II (RR820A, Takara, Japan). Primers were designed and synthesized by Takara. actin was used as an endogenous reference gene. Relative gene expression was determined using the 2\\u003csup\\u003e\\u0026minus;\\u0026Delta;\\u0026Delta;CT\\u003c/sup\\u003e method. All PCR primers are shown below.\\u003c/p\\u003e\\n \\u003cp\\u003eActin-F 5\\u0026prime;-AAATGGTGAGGGTCGGTGAAC-3\\u0026prime;\\u003c/p\\u003e\\n \\u003cp\\u003eActin-R 5\\u0026prime;-CAAATCCTCTTTGCCACTG-3\\u0026prime;\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec4\\\"\\u003e\\n \\u003cp\\u003eALDH3B1-F 5\\u0026prime;- GAACTACCCCGTGAACCTGAC \\u0026minus;\\u0026thinsp;3\\u0026prime;\\u003c/p\\u003e\\n \\u003cdiv class=\\\"Section3\\\" id=\\\"Sec5\\\"\\u003e\\n \\u003cp\\u003eALDH3B1-R 5\\u0026prime;- ACCTTCTCCGTGCCCTTACTA \\u0026minus;\\u0026thinsp;3\\u0026prime;\\u003c/p\\u003e\\n \\u003ch2\\u003eInhibitors of the NRF2 pathway\\u003c/h2\\u003e\\n \\u003cp\\u003eCells were inoculated in six-well plates, and after 24 hours of cell culture, an inhibitor of NRF2 (Hinokitiol, MedChemExpress; 20 \\u0026micro;M, 12 hours) was added to the cells.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv class=\\\"Section2\\\" id=\\\"Sec6\\\"\\u003e\\n \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eAll data were statistically analysed using GraphPad Prism version 9.0.0 (GraphPad Software, San Diego, CA). Data were obtained from three experiments and are expressed as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation, and between-group data were assessed using unpaired t tests or one-way ANOVA. Asterisks indicate significance between conditions in each group. P values are marked as *P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, ***P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003ch2\\u003e1 Identification of IFE cells\\u003c/h2\\u003e\\n\\u003cp\\u003eWe extracted IFE cells from the skin of newborn mice, As shown in Fig.\\u0026nbsp;1a, after two days of culture, IFE cells were observed as pebble-like under light microscopy. KRT14, KRT15 and P63 are epidermal stem cell markers, KRT10 is the markers of keratinocytes (\\u003cspan class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). We extracted protein lysates from rapidly adherent and nonadherent cells. KRT14, KRT15 and P63 were highly expressed in rapidly adherent cells, while the expression of KRT10 was low (Fig. 1b). In addition, flow cytometry showed that more than 85% of primary cells expressed KRT15, KRT14 and P63, while less than 15% expressed KRT10 (Fig. 1c). We extracted primary IFE cells from neonatal mouse skin for study and performed immunofluorescence staining using the basal cell markers KRT14, KRT15, and P63 and the mature keratinocyte marker KRT10, which showed that most of the primary cells were KRT14 positive, KRT15 positive or P63 positive, while few keratin-forming cells were KRT10 positive (Fig. 1d). These experimental results demonstrate that the purity of IFE cells we extracted from the skin of newborn mice was high.\\u003c/p\\u003e\\n\\u003ch2\\u003e2 Effect of different concentrations of transferrin treatment on the survival rate and lipid peroxidation level of IFE cells\\u003c/h2\\u003e\\n\\u003cp\\u003eIFE cell viability and lipid peroxidation levels do not change with increasing iron ion concentration in IFE cells. As shown in Figure (2a-2b), flow cytometry detected the content of divalent iron (Fe\\u003csup\\u003e2+\\u003c/sup\\u003e) in IFE cells treated with different concentrations of transferrin (0 \\u0026micro;g/ml, 1 \\u0026micro;g/ml, 10 \\u0026micro;g/ml, 100 \\u0026micro;g/ml, 1 mg/ml), and the results showed that with the increase in transferrin concentration, the content of intracellular divalent iron was also increased, while we detected protein by immunoblotting in each group of IFE cells. We also examined the expression of ferritin heavy chain (FTH) and ferritin light chain (FTL) in IFE cells by protein immunoblotting, and the results showed that the expression of FTH and FTL in IFE cells increased gradually with increasing transferrin concentration (Fig.\\u0026nbsp;2c-2d). In addition, after we treated IFE cells with different concentrations of transferrin, we assayed IFE cell viability with CCK8 and found no difference between the groups (Fig.\\u0026nbsp;2e). Under this condition, we also examined the changes in IFE cell proliferation, and the results showed almost no difference in the proliferation rate of IFE cells (Fig.\\u0026nbsp;2f). Moreover, we examined the level of lipid peroxidation in IFE cells, and the results showed that there was almost no difference in the level of lipid peroxidation between the groups (Fig.\\u0026nbsp;2g-2h). These experimental results showed that although the intracellular iron content increased, the level of lipid peroxidation, cell viability and proliferation in IFE cells were not affected. A protective mechanism may exist in IFE cells against lipid peroxidation. To investigate whether the elevated iron ion concentration had any protective effect on IFE cells or whether some protective mechanism was generated in IFE cells stimulated as described above, IFE cells were treated with different concentrations of transferrin along with 600 \\u0026micro;M H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 6 hours. The results showed a decreasing trend of intracellular lipid peroxidation levels with increasing transferrin concentration (Fig. 2i-2j). The experimental results suggest that there was a protective mechanism in IFE cells against lipid peroxidation damage, and the more iron content in IFE cells, the stronger this protective effect it produces.\\u003c/p\\u003e\\n\\u003ch2\\u003e3 Elevated expression of ALDH3B1 in IFE cells and ALDH3B1-overexpressing cells\\u003c/h2\\u003e\\n\\u003cp\\u003eBased on the results of the previous study, we conducted further studies. IFE cells were cultured with medium containing 100 \\u0026micro;g/ml transferrin (Tf group) and normal (Ctrl group) medium for 48 hours. The TMT quantitative proteomics results showed that the expression of ALDH3B1 and ferritin light chain (FTL) was elevated in the Tf group compared with the Ctrl group (Fig. 3a-3b). In addition, we cultured IFE cells with different transferrin concentrations (0 \\u0026micro;g/ml, 1 \\u0026micro;g/ml, 10 \\u0026micro;g/ml, 100 \\u0026micro;g/ml, and 1 mg/ml) for 48 hours, and after protein extraction, protein blotting analysis confirmed that ALDH3B1 expression showed an elevated trend (Fig. 3c-3d). Based on the above experimental results, The elevated expression of FTL further demonstrates that the addition of transferrin to cultured IFE cells increases the intracellular concentration of iron ions. As the concentration of transferrin increased, the expression of ALDH3B1 also gradually increased. This demonstrates that ALDH3B1 may be a key gene in the resistance of IFE cells to lipid peroxidation. We next set out to explore whether ALDH3B1 has a role in resisting lipid peroxidation in IFE cells. First, we infected IFE cells with Flag-ALDH3B1 adenovirus and Flag-control adenovirus. Western blot and qPCR analyses showed that ALDH3B1 protein expression and mRNA transcription in the Flag-ALDH3B1 group were significantly higher than those in the Flag-Control group (Fig. 3e-3f). The immunofluorescence results showed Flag expression in both the Flag-ALDH3B1 group and Flag-Control group, and the fluorescence of the Flag-ALDH3B1 group was more intense (Fig. 3g). Moreover, the cell proliferation and cell viability experiment result showed no difference in the cell proliferation curve between the two groups (Fig. 3h-3i).\\u003c/p\\u003e\\n\\u003ch2\\u003e4 Protective effect of ALDH3B1 on IFE cells against lipid peroxidation\\u003c/h2\\u003e\\n\\u003cp\\u003eTo verify the protective effect of ALDH3B1 on IFE cells, we divided the cells into the ALDH3B1 group and the control group. As shown in Fig.\\u0026nbsp;4a, we first verified that overexpression of ALDH3B1 had no effect on the level of lipid peroxidation in IFE cells. Overexpression of ALDH3B1 has no effect on lipid peroxidation levels in IFE cells under unstimulated conditions. After treatment with H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e, RSL3 and Erastin, IFE cells in the ALDH3B1 group showed lower levels of lipid peroxidation than those in the control group (Fig.\\u0026nbsp;4b-4d). We demonstrate that overexpression of ALDH3B1 enables IFE cells to resist lipid peroxidation when factors that increase the level of lipid peroxidation in IFE cells are present. Meanwhile, the CCK8 results showed that IFE cells in the ALDH3B1 group had higher cell viability than those in the control group (Fig.\\u0026nbsp;4e-4g). In IFE cells, we further verified whether ALDH3B1 expression is related to the ability to resist lipid peroxidation. We used different MOI values for cell transfection and found that as the expression of ALDH3B1 gradually increased (Fig.\\u0026nbsp;4h-4i), the ability of IFE cells to resist lipid peroxidation also gradually increased, and the level of lipid peroxidation was gradually reduced by 600 \\u0026micro;M H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment (Fig. 4j-4k). The above experiments verified that overexpression of ALDH3B1 in IFE cells can contribute to resistance to lipid peroxidation.\\u003c/p\\u003e\\n\\u003ch2\\u003e5 Activation of ALDH3B1 via the NRF2 pathway protects IFE cells\\u003c/h2\\u003e\\n\\u003cp\\u003eAs the NRF2 pathway is an important pathway for cellular antioxidant (\\u003cspan class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e), after treatment of IFE cells with different concentrations of transferrin, we found that while the expression of ALDH3B1 gradually increased, the expression of NRF2 also gradually increased (Fig.\\u0026nbsp;5a-5b). We speculate that ALDH3B1 may be linked to the NRF2 pathway.\\u003c/p\\u003e\\n\\u003cp\\u003eTo verify the above speculation, we verified that under the treatment conditions of 1 mg/ml transferrin, IFE cells treated with NRF2 inhibitor (Hinokitiol group) compared with cells treated with DMSO (DMSO group), the expression of NRF2 in the Hinokitiol group was decreased along with the expression of ALDH3B1 (Fig. 5c-5d). In addition, we measured the lipid peroxidation level and cellular activity of the Hinokitiol group and DMSO group by flow cytometry and CCK8 assays. The Hinokitiol group had higher lipid peroxidation levels and lower cellular viability than the DMSO group (Fig. 5e-5g). After we used Hinokitiol to inhibit NRF2 expression in IFE cells, the expression of ALDH3B1 was reduced in the Hinokitiol group, while the lipid peroxidation level of the cells was elevated and cell viability was reduced. In conclusion, these results demonstrate that activation of ALDH3B1 through the NRF2 pathway protects IFE cells from damage caused by lipid peroxidation.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIFE cells are located in the basal layer of the epidermis and proliferate and differentiate during migration to the suprabasal layer, promoting wound healing (\\u003cspan additionalcitationids=\\\"CR23\\\" citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). Stem cells in hair follicles and IFE cells contribute to the re-epithelialization of wounds (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e). IFE cells are mainly consisting mainly of stem cells and progenitor cells, which are the source of almost all differentiated keratinized cells in the epidermis (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). During wound healing, cells from hair follicles and IFE have been shown to migrate to the wound surface, and damage to IFE cells can lead to nonhealing of the wound surface (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e). Therefore, IFE cells play an important role in the wound healing process.\\u003c/p\\u003e \\u003cp\\u003eThe balance between the positive and harmful effects of ROS is crucial for wound healing. Although the production of reactive oxygen species is important for initiating wound healing, excessive ROS can impair the wound healing process by causing lipid peroxidation in cells, which in turn affects protein modification and leads to DNA damage, ultimately increasing cell death and senescence (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). Excessive and uncontrolled lipid peroxidation during wound healing maintains the wound in an inflammatory phase, leading to delayed healing and the formation of chronic wounds (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e). Additionally, Trace elements and transition metal iron play an important role in cell proliferation and differentiation, but when iron metabolism is abnormal, iron can disrupt redox homeostasis through the Fenton reaction leading to the development of lipid peroxidation and causing chronic trauma formation. There is iron overload in chronic wounds, with increased ROS production and pro-oxidant capacity, leading to delayed healing of the wounds (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e). Some harmful factors that expose IFE cells to lipid peroxidation can lead to delayed or nonhealing of wounds. Therefore, how to maintain the balance of pro-oxidant and anti-oxidant capacity and increase the ability of trabecular cells to resist lipid peroxidation during wound healing has become an important issue.\\u003c/p\\u003e \\u003cp\\u003eALDH3B1 is a key enzyme for cellular resistance to aldehydes and oxidative inducers (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). In study, we found that IFE cell activity and proliferative capacity were not affected when the concentration of iron ions in IFE cells was elevated. The expression of ALDH3B1 in IFE cells was also detected to be elevated. Therefore, we hypothesized that ALDH3B1 helps to protect IFE cells from lipid peroxidation damage. Treatment of IFE cells with transferrin causes elevated intracellular divalent iron, which catalyses lipid peroxidation in the presence of divalent iron or esteroxygenase, a highly expressed unsaturated fatty acid on the cell membrane, thereby inducing cellular iron death (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e). we selected the iron death inducers Rsl3 and erastin to culture IFE cells. We observed that the ALDH3B1 group had higher cell viability and lower levels of lipid peroxidation than the control group.In addition, it has been reported that the NRF2 pathway plays a key role in the body's resistance to lipid peroxidation, and this pathway can reduce oxidative damage and is involved in the regulation of antioxidant gene expression during oxidative stress, thereby enhancing cellular resistance to lipid peroxidation (\\u003cspan additionalcitationids=\\\"CR35 CR36\\\" citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e). We therefore hypothesized that activation of the NRF2 pathway elevates the expression of ALDH3B1 and thus promotes the resistance of IFE cells to lipid peroxidation damage. When IFE cells were treated with different concentration gradients of transferrin, an increase in ALDH3B1 expression was detected along with an increase in NRF2 expression. To this end, we selected the conditions of 1 mg/ml transferrin concentration with the addition of NRF2 inhibitor. We found that the decrease in NRF2 expression was accompanied by a decrease in ALDH3B1 expression and a decrease in Lipid peroxidation levels intracellular ROS in the experimental group compared to the control group. This confirms that it is through the activation of the NRF2 pathway that ALDH3B1 expression is increased and exerts its effects against lipid peroxidation in IFE cells.\\u003c/p\\u003e \\u003cp\\u003eThis study also has some drawbacks, as we only showed the resistance of ALDH3B1 to lipid peroxidation in IFE cells, and there were no animal experiments to confirm the role of ALDH3B1 in wound healing. In addition, we only demonstrated that NRF2 can affect the change in ALDH3B1 expression, but the mechanism of the NRF2 effect on ALDH3B1 was not demonstrated.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn this study, we established a cellular lipid peroxidation injury cell model using H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e, RSL3 and erastin to investigate the resistance of ALDH3B1 to lipid peroxidation. Our results showed that ALDH3B1 could protect IFE cells from lipid peroxidation damage and demonstrated that the NRF2 pathway played a role in promoting ALDH3B1 expression to improve IFE cell survival and reduce lipid peroxidation levels.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eACKNOWLEDGMENTS\\u003c/h2\\u003e \\u003cp\\u003eThis study was supported by the National Natural Science Foundation of China (81972947), Natural Science Foundation of Shandong Province of China (Major Basic Research Program) (ZR2019ZD38), \\u0026ldquo;Academy Promotion Program\\u0026rdquo; of Shandong First Medical University (Shandong Academy of Medical Sciences) (2019LJ005), Key Research and Development Program of Shandong Province of China (2019GSF108128) and Jinan Clinical Research Center for Tissue Engineering Skin Regeneration and Wound Repair.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eZuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng. 2001;7(2):211-28.\\u003c/li\\u003e\\n\\u003cli\\u003eGosain A, DiPietro LA. Aging and wound healing. World J Surg. 2004;28(3):321-6.\\u003c/li\\u003e\\n\\u003cli\\u003eGuo S, Dipietro LA. Factors affecting wound healing. J Dent Res. 2010;89(3):219-29.\\u003c/li\\u003e\\n\\u003cli\\u003eMartin P. Wound healing--aiming for perfect skin regeneration. Science. 1997;276(5309):75-81.\\u003c/li\\u003e\\n\\u003cli\\u003eSinger AJ, Clark RA. Cutaneous wound healing. N Engl J Med. 1999;341(10):738-46.\\u003c/li\\u003e\\n\\u003cli\\u003eBrem H, Stojadinovic O, Diegelmann RF, Entero H, Lee B, Pastar I, et al. Molecular markers in patients with chronic wounds to guide surgical debridement. Mol Med. 2007;13(1-2):30-9.\\u003c/li\\u003e\\n\\u003cli\\u003eSchultz GS, White M, Mitchell R, Brown G, Lynch J, Twardzik DR, et al. Epithelial wound healing enhanced by transforming growth factor-alpha and vaccinia growth factor. Science. 1987;235(4786):350-2.\\u003c/li\\u003e\\n\\u003cli\\u003eCano Sanchez M, Lancel S, Boulanger E, Neviere R. Targeting Oxidative Stress and Mitochondrial Dysfunction in the Treatment of Impaired Wound Healing: A Systematic Review. Antioxidants (Basel). 2018;7(8).\\u003c/li\\u003e\\n\\u003cli\\u003eD\\u0026apos;Autr\\u0026eacute;aux B, Toledano MB. ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nat Rev Mol Cell Biol. 2007;8(10):813-24.\\u003c/li\\u003e\\n\\u003cli\\u003eSch\\u0026auml;fer M, Werner S. Oxidative stress in normal and impaired wound repair. Pharmacol Res. 2008;58(2):165-71.\\u003c/li\\u003e\\n\\u003cli\\u003eWright JA, Richards T, Srai SK. The role of iron in the skin and cutaneous wound healing. Front Pharmacol. 2014;5:156.\\u003c/li\\u003e\\n\\u003cli\\u003eSindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, Peter H, et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. J Clin Invest. 2011;121(3):985-97.\\u003c/li\\u003e\\n\\u003cli\\u003eWlaschek M, Singh K, Sindrilaru A, Crisan D, Scharffetter-Kochanek K. Iron and iron-dependent reactive oxygen species in the regulation of macrophages and fibroblasts in non-healing chronic wounds. Free Radic Biol Med. 2019;133:262-75.\\u003c/li\\u003e\\n\\u003cli\\u003eAbhishek S, Palamadai Krishnan S. Epidermal Differentiation Complex: A Review on Its Epigenetic Regulation and Potential Drug Targets. Cell J. 2016;18(1):1-6.\\u003c/li\\u003e\\n\\u003cli\\u003eClayton E, Doup\\u0026eacute; DP, Klein AM, Winton DJ, Simons BD, Jones PH. A single type of progenitor cell maintains normal epidermis. Nature. 2007;446(7132):185-9.\\u003c/li\\u003e\\n\\u003cli\\u003eGonzales KAU, Fuchs E. Skin and Its Regenerative Powers: An Alliance between Stem Cells and Their Niche. Dev Cell. 2017;43(4):387-401.\\u003c/li\\u003e\\n\\u003cli\\u003eMardaryev AN, Gdula MR, Yarker JL, Emelianov VU, Poterlowicz K, Sharov AA, et al. p63 and Brg1 control developmentally regulated higher-order chromatin remodelling at the epidermal differentiation complex locus in epidermal progenitor cells. Development. 2014;141(1):101-11.\\u003c/li\\u003e\\n\\u003cli\\u003eMarchitti SA, Brocker C, Orlicky DJ, Vasiliou V. Molecular characterization, expression analysis, and role of ALDH3B1 in the cellular protection against oxidative stress. Free Radic Biol Med. 2010;49(9):1432-43.\\u003c/li\\u003e\\n\\u003cli\\u003eLi X, Xie X, Lian W, Shi R, Han S, Zhang H, et al. Exosomes from adipose-derived stem cells overexpressing NRF2 accelerate cutaneous wound healing by promoting vascularization in a diabetic foot ulcer rat model. Exp Mol Med. 2018;50(4):1-14.\\u003c/li\\u003e\\n\\u003cli\\u003eLu MC, Ji JA, Jiang ZY, You QD. The Keap1-NRF2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update. Med Res Rev. 2016;36(5):924-63.\\u003c/li\\u003e\\n\\u003cli\\u003eMa T, Fu B, Yang X, Xiao Y, Pan M. Adipose mesenchymal stem cell-derived exosomes promote cell proliferation, migration, and inhibit cell apoptosis via Wnt/\\u0026beta;-catenin signaling in cutaneous wound healing. J Cell Biochem. 2019;120(6):10847-54.\\u003c/li\\u003e\\n\\u003cli\\u003eIto M, Liu Y, Yang Z, Nguyen J, Liang F, Morris RJ, et al. Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Nat Med. 2005;11(12):1351-4.\\u003c/li\\u003e\\n\\u003cli\\u003eMascr\\u0026eacute; G, Dekoninck S, Drogat B, Youssef KK, Brohe\\u0026eacute; S, Sotiropoulou PA, et al. Distinct contribution of stem and progenitor cells to epidermal maintenance. Nature. 2012;489(7415):257-62.\\u003c/li\\u003e\\n\\u003cli\\u003eTaylor G, Lehrer MS, Jensen PJ, Sun TT, Lavker RM. Involvement of follicular stem cells in forming not only the follicle but also the epidermis. Cell. 2000;102(4):451-61.\\u003c/li\\u003e\\n\\u003cli\\u003eBagdas D, Etoz BC, Gul Z, Ziyanok S, Inan S, Turacozen O, et al. In vivo systemic chlorogenic acid therapy under diabetic conditions: Wound healing effects and cytotoxicity/genotoxicity profile. Food Chem Toxicol. 2015; 81:54-61.\\u003c/li\\u003e\\n\\u003cli\\u003ePage ME, Lombard P, Ng F, G\\u0026ouml;ttgens B, Jensen KB. The epidermis comprises autonomous compartments maintained by distinct stem cell populations. Cell Stem Cell. 2013;13(4):471-82.\\u003c/li\\u003e\\n\\u003cli\\u003eTumbar T, Guasch G, Greco V, Blanpain C, Lowry WE, Rendl M, et al. Defining the epithelial stem cell niche in skin. Science. 2004;303(5656):359-63.\\u003c/li\\u003e\\n\\u003cli\\u003eChen L, Sun L, Liu Z, Wang H, Xu C. Protection afforded by quercetin against H2O2-induced apoptosis on PC12 cells via activating PI3K/Akt signal pathway. J Recept Signal Transduct Res. 2016;36(1):98-102.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu Y, Yang X, Liu Y, Jiang T, Ren S, Chen J, et al. NRF2 signalling pathway: New insights and progress in the field of wound healing. J Cell Mol Med. 2021;25(13):5857-68.\\u003c/li\\u003e\\n\\u003cli\\u003eMoseley R, Stewart JE, Stephens P, Waddington RJ, Thomas DW. Extracellular matrix metabolites as potential biomarkers of disease activity in wound fluid: lessons learned from other inflammatory diseases? Br J Dermatol. 2004;150(3):401-13.\\u003c/li\\u003e\\n\\u003cli\\u003eDing J, Gao B, Chen Z, Mei X. An NIR-Triggered Au Nanocage Used for Photo-Thermo Therapy of Chronic Wound in Diabetic Rats Through Bacterial Membrane Destruction and Skin Cell Mitochondrial Protection. Front Pharmacol. 2021;1 2:779944.\\u003c/li\\u003e\\n\\u003cli\\u003eSun H, Zhang M, Li L, Huang Z. ALDH3B1 Is an Independent Prognostic Biomarker of Lung Adenocarcinoma. Technol Cancer Res Treat. 2020; 19:1533033820946018.\\u003c/li\\u003e\\n\\u003cli\\u003eAroun A, Zhong JL, Tyrrell RM, Pourzand C. Iron, oxidative stress and the example of solar ultraviolet A radiation. Photochem Photobiol Sci. 2012;11(1):118-34.\\u003c/li\\u003e\\n\\u003cli\\u003eJazvin\\u0026scaron;ćak Jembrek M, Or\\u0026scaron;olić N, Mandić L, Sadžak A, \\u0026Scaron;egota S. Anti-Oxidative, Anti-Inflammatory and Anti-Apoptotic Effects of Flavonols: Targeting NRF2, NF-\\u0026kappa;B and p53 Pathways in Neurodegeneration. Antioxidants (Basel). 2021;10(10).\\u003c/li\\u003e\\n\\u003cli\\u003eMaresova P, Hruska J, Klimova B, Barakovic S, Krejcar O. Activities of Daily Living and Associated Costs in the Most Widespread Neurodegenerative Diseases: A Systematic Review. Clin Interv Aging. 2020; 15:1841-62.\\u003c/li\\u003e\\n\\u003cli\\u003eLi M, Yu H, Pan H, Zhou X, Ruan Q, Kong D, et al. NRF2 Suppression Delays Diabetic Wound Healing Through Sustained Oxidative Stress and Inflammation. Front Pharmacol. 2019; 10:1099.\\u003c/li\\u003e\\n\\u003cli\\u003eXu Y, Sang W, Zhong Y, Xue S, Yang M, Wang C, et al. CoCrMo-Nanoparticles induced peri-implant osteolysis by promoting osteoblast ferroptosis via regulating NRF2-ARE signalling pathway. Cell Prolif. 2021;54(12): e13142.\\u003c/li\\u003e\\n\\u003cli\\u003eAliborzi G, Vahdati A, Mehrabani D, Hosseini SE, Tamadon A. Isolation, Characterization and Growth Kinetic Comparison of Bone Marrow and Adipose Tissue Mesenchymal Stem Cells of Guinea Pig. Int J Stem Cells. 2016;9(1):115-23.\\u003c/li\\u003e\\n\\u003cli\\u003eWang J, He J, Zhu M, Han Y, Yang R, Liu H, et al. Cellular Heterogeneity and Plasticity of Skin Epithelial Cells in Wound Healing and Tumorigenesis. Stem Cell Rev Rep. 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eSingh R. Basal Cells in the Epidermis and Epidermal Differentiation. Stem Cell Rev Rep. 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eGhadially R. 25 years of epidermal stem cell research. J Invest Dermatol. 2012;132(3 Pt 2):797-810.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Transferrin, ALDH3B1, interfollicular epidermal (IFE) cells, lipid peroxidation, NRF2\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-1795852/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-1795852/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eReactive oxygen species (ROS) production is critical for the initiation of wound repair; However, persistent high levels of reactive oxygen species can lead to lipid peroxidation of cells and thus affect wound healing. Iron is a transition metal that is an essential component of almost all living cells and organisms. when present in excess in cells and tissues, iron disrupts redox homeostasis and catalyses the generation of ROS, leading to increased lipid peroxidation. In this study, we found that after treating interepithelial follicular (IFE) cells with different concentrations of transferrin (0 µg/ml, 1 µg/ml, 10 µg/ml, 100 µg/ml, and 1 mg/ml), we increased the intracellular iron content, and our findings regarding viability and function did not differ significantly between groups of cells. It was also found that the level of lipid peroxidation in IFE cells did not increase. We speculate that there is a protective mechanism within IFE cells that reduces the occurrence of intracellular lipid peroxidation. We found that the elevated intracellular iron content of IFE cells was accompanied by elevated ALDH3B1 expression. We investigated the effect of ALDH3B1 on the level of lipid peroxidation in IFE cells and found that the elevated expression of ALDH3B1 could decrease the damage to IFE cells by lipid peroxidation. In addition, the NRF2 pathway was found to affect the expression of ALDH3B1, which in turn affected lipid peroxidation in IFE cells. In conclusion, these findings suggest that in IFE cells, activation of the NRF2 pathway can increase the expression of ALDH3B1 and thus reduce the production of intracellular ROS and the occurrence of intracellular lipid peroxidation. Therefore, ALDH3B1 may be a potential target for the treatment of chronic wounds.\\u003c/p\\u003e\",\"manuscriptTitle\":\"ALDH3B1 protects interfollicular epidermal cells against lipid peroxidation via the NRF2 pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2022-07-05 16:42:48\",\"doi\":\"10.21203/rs.3.rs-1795852/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"6d04db0c-67c3-4dae-9872-6612c2fa5968\",\"owner\":[],\"postedDate\":\"July 5th, 2022\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-05-22T19:15:49+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-1795852\",\"link\":\"https://doi.org/10.1007/s12192-022-01306-9\",\"journal\":{\"identity\":\"cell-stress-and-chaperones\",\"isVorOnly\":false,\"title\":\"Cell Stress and Chaperones\"},\"publishedOn\":\"2022-11-01 19:15:49\",\"publishedOnDateReadable\":\"November 1st, 2022\"},\"versionCreatedAt\":\"2022-07-05 16:42:48\",\"video\":\"\",\"vorDoi\":\"10.1007/s12192-022-01306-9\",\"vorDoiUrl\":\"https://doi.org/10.1007/s12192-022-01306-9\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-1795852\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-1795852\",\"identity\":\"rs-1795852\",\"version\":[\"v1\"]},\"buildId\":\"_2-kVJe1T_tPrBINL-cwx\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}