{"paper_id":"448d5001-c058-4fcd-9ed4-c87eb8e01604","body_text":"Short abstract\nEndometriosis, characterized by the presence of endometrial tissue at ectopic sites, is a leading cause of pelvic pain and subfertility in women. The stromal compartment of the endometrium is considered to play a pivotal role in the establishment and persistence of endometriotic lesions, thus impaired decidualization of these cells may result in enhanced invasion capacity at ectopic sites. Consequently, stimulation of decidualization may alleviate this disease. To analyze the effect of systemically applied compounds on decidualization of ectopic endometrial tissue, endometriosis was induced by suturing human eutopic endometrium to the peritoneum of 22 NOD/SCID mice. Each mouse received four tissue fragments from the same patient. Mice were randomly allocated either to one control and three experimental groups (n = 4/group) which were treated with progesterone alone or in combination with forskolin or human chorionic gonadotropin for seven days or to one control and one experimental group (n = 3/group) which was treated with progesterone and human chorionic gonadotropin for 10 days followed by 7 days without treatment. At the end of the experiments, lesions were measured and analyzed for markers of decidualization (FOXO-1, prolactin) and proliferation (Ki-67). Decidualization was induced in the ectopic lesions by systemic treatment in vivo. This induction was significantly stronger after treatment with progesterone in combination with human chorionic gonadotropin than with forskolin or with progesterone alone. Only the combination with human chorionic gonadotropin led to induction of FOXO1 protein expression and a significant physiologic transformation of the ectopic endometrial stromal cells after seven days of treatment. After termination of human chorionic gonadotropin treatment, the decidualization process continued, leading to a significant inhibition of proliferation. Thus, decidualization of human ectopic endometrial tissue can be induced in a humanized endometriosis mouse model in vivo. This model may help to decipher the signal pathways involved in this decidualization process and to develop novel therapeutical approaches to alleviate this painful disease.\nImpact statement\nImpaired decidualization of endometrial stromal cells may contribute to the development of endometriosis, and an increased decidualization reaction may prevent or alleviate this prevalent gynecological disease. Human chorionic gonadotropin (hCG) has been shown to promote decidualization in eutopic endometrium. Up to now in vitro studies mainly used cAMP for successful induction of decidualization of isolated endometrial stromal cells. Here, for the first time, decidualization of ectopic endometrial lesions is induced in an experimental endometriosis mouse model, comparing the effectiveness of hCG with that of the direct adenylyl cyclase activator Forskolin. In this 3D-organ structure in vivo, hCG proved to be more effective in the induction of decidualization than forskolin. Particularly in case of progesterone resistance, alternative pathways inducing decidualization could alleviate endometriosis, and the sophisticated hCG action could constitute a therapeutical tool to induce terminal differentiation in ectopic endometrial lesions.\nKeywords: cAMP, endometriosis, decidualization, human chorionic gonadotropin, forskolin\nIntroduction\nEndometriosis is a leading cause of pelvic pain and subfertility, affecting up to 10% of reproductive-age women and even up to 50% of women seeking infertility treatment.1,2 The symptoms are caused by endometrial tissue at ectopic sites outside the uterine cavity where it proliferates, induces neoangeogenesis, and invades surrounding structures.3 The most accepted theory for the formation of peritoneal endometriosis is retrograde menstruation of shed endometrial tissue via the fallopian tubes into the peritoneal cavity.4 However, since not all women with retrograde menstruation develop lesions,5 and endometriotic foci have also been described distant from the pelvis and even in male patients,6 not all kinds of endometriosis can be explained by this theory. Additional theories of the pathogenesis of endometriosis have to be considered including genetical, immunological, and environmental factors7 or an impaired differentiation of the urogenital tract.8 Due to the severe clinical manifestation, endometriosis has a high impact on life quality and work productivity, causing a substantial economic burden on the health-care system.9,10 Current therapies include the surgical removal of lesions and/or hormonal treatment, aimed at the establishment of a hypoestrogenic state in order to achieve a reduction in ectopic lesions and endometriosis-associated pain and to improve fertility.11 However, recurrence rates are up to 50%.12 Since there has been little research progress in the medical management of endometriosis over the last three years,13 there is a definite need for developing more efficacious therapeutic alternatives.\nOne factor that may influence the severity of the disease is whether the cells undergo proliferation or differentiation at ectopic sites. Since it is assumed that the stromal compartment of the endometrium plays a pivotal role in the establishment and persistence of the endometriotic lesions,14 one cause for this disease may be an impaired decidualization of endometrial stromal cells, resulting in enhanced invasion and proliferation capacity at ectopic sites.15 Physiologically, the decidualization process of human endometrial stromal cells is initiated by progesterone during the luteal phase of the menstrual cycle16 and continues throughout pregnancy under the influence of progesterone and human chorionic gonadotropin (hCG). If pregnancy does not occur, the endometrium is shed and may reach the peritoneal cavity by retrograde.4 There is substantial evidence that the decidualization of stromal cells is impaired in endometriosis patients.17,18 This may be due to a progesterone resistance in these patients17,19,20 and may lead to an impaired differentiation of stromal cells and thus an enhanced proliferation and invasion capacity when reaching the peritoneal cavity. The involvement of additional pathways activated by hCG21,22 or cAMP15 has been described. The fact that hCG has an effect on ectopic endometrial tissue is supported by the finding that decidualization can be found in 77% of lesions in pregnant women.23 This decidualization may induce atrophy of the ectopic tissue in humans,24,25 and a regression of induced endometriotic lesions has been described after pregnancy in monkeys.26 However, although numerous in vitro studies have investigated the pathways leading to decidualization, only a limited number of in vivo studies have been conducted and the pathways involved in the decidualization of ectopic lesions require further in vivo examination. We have here used an established humanized endometriosis mouse model27 to investigate whether decidualization can be successfully induced in human ectopic endometriotic lesions in vivo, and whether there is a difference in the level of decidualization between cAMP/forskolin and hCG treatment, respectively.\nMaterials and methods\nHuman endometrial tissue\nEndometrium was obtained from seven premenopausal women undergoing endometrial biopsy for diagnostic reasons due to benign indications at the Department of Gynecology, University Hospital Essen, Germany. Age of patients was 42.6 ± 3.0 years. All endometrial tissues were obtained from the proliferative phase of the menstrual cycle. Additionally, histological staging according to Noyes et al.28 was performed to confirm the cycle stage. The patients received no hormonal treatment for at least three months before surgery. After removal, endometrial tissue was cut into fragments of 1.5 mm in diameter under sterile conditions and left for 1 h in culture medium (DMEM Ham's F12 1:1, Biochrom KG, Berlin, Germany) supplemented with Pen/Strep (Invitrogen, Karlsruhe, Germany) at 37°C and 5% CO2 before transplantation into NOD/SCID mice.\nAnimals and transplantation of endometrial tissue fragments\nFemale non-obese diabetic (NOD) – severe combined immunodeficiency (SCID) mice (aged two to six months) were housed in a controlled pathogen-free barrier unit under a 12-h light/dark cycle with access to food and water ad libitum. All equipment and food entering the barrier was autoclaved. In all experiments, endometrial tissue of the same patient was transplanted in parallel into two or four cycling NOD/SCID mice, depending on the experimental approach. Each mouse received four endometrial tissue fragments of the same patient which were fixed with surgical sutures to the parietal peritoneum of the abdominal wall by laparotomy as described before.27,29,30\nEthical approval\nInstitutional ethical approval was given and written informed consent to the use of the human endometrial tissue for research purposes was obtained from all the women concerned. All the animal experiments were approved by the institutional animal care committee of the German government (LANUV 87–51.04.2010.A034).\nApplication of drugs and tissue processing\nEndometrial tissue was transplanted in a total of 22 mice. In a first set of experiments, 16 transplanted mice were randomly allocated to one control group treated with vehicle only and three experimental groups (n = 4/group) which were treated with progesterone alone (50 µg/mouse/day s.c.; Sigma Aldrich, Munich, Germany) or in combination with forskolin (100 µg/mouse/day i.p.; Sigma Aldrich, Munich, Germany) or hCG (7.5 IU/mouse/day i.p.; Ovogest®, Intervet, Boxmeer, Netherlands) for seven days. In a second set of experiments, six transplanted mice were randomly allocated to one experimental group (n = 3/group) treated with progesterone in combination with hCG for 10 days and left untreated for an additional 7 days, and one control group which received an intraperitoneal injection of the vehicle only (benzylbenzoate-castor oil, 1:4) for the corresponding time period. After termination of the respective experiment, the size of the implanted endometrial tissue fragments was measured in situ before lesions were dissected. One lesion of each mouse was processed for paraffin histology and immunohistochemistry, and three lesions of each mouse were snap-frozen in liquid nitrogen and stored at −80°C for molecular analyses.\nRNA preparation, cDNA synthesis, and quantitative real-time PCR\nThe frozen tissues were homogenized and RNA extracted using the E.Z.N.A total RNA midi kit (Omega Bio-Tek, Norcross, GA) according to the manufacturer’s protocol. Following DNase treatment (Invitrogen), reverse transcription reactions were carried out as previously described.31 Subsequently, quantitative real-time PCRs were performed in triplicate using an ABI Prism 7300 sequence detector (Applied Biosystems, Weiterstadt, Germany); 40 ng of cDNA was diluted in a final volume of 20 µl containing 40 ng of cDNA, 3.75 pmol gene-specific primers, and 10 µl of SYBR Green Master Mix reagent (Applied Biosystems, Weiterstadt, Germany). The primers were purchased from Invitrogen (Darmstadt, Germany). Melting curve analysis allowed determination of PCR product specificity. Quantification was performed by using a 10-fold series dilution of purified PCR products of each gene ranging from 1 pg to 0.1 fg as standards. The expression levels of the analyzed genes were normalized to actin-beta content. The primer sequences used for qPCR are summarized in Table 1.\nTable 1.\n| Gene | Ref-Seq transcript ID | Primer sequence 5′-3′ | Product size (bp) |\n|---|---|---|---|\n| FOXO1 | NM002015.3 | F GACAGCCCTGGATCACAGTT | 198 |\n| R AGATGGCGGGTACACCATAG | |||\n| IGFBP1 | NM000596.2 | F CTATGATGGCTCGAAGGCTC | 156 |\n| R TTCTTGTTGCAGTTTGGCAG | |||\n| PRL | NM000948.4 | F CATCAACAGCTGCCACACTT | 213 |\n| R CGTTTGGTTTGCTCCTCAAT | |||\n| ACTB | NM001101.3 | F AGCACAGAGCCTGGCCTTTGCC | 108 |\n| R CACATGCCGGAGCCGTTGTCGA |\nMorphological and immunohistochemical analyses\nThe tissues were fixed in 4% formalin, dehydrated in a graded series of alcohol and embedded in Paraplast Tissue Embedding Medium (Mc Cormick Scientific, St. Louis, MO, USA). Sections of 7 µm were cut on a 2050 Supercut Reichert-Jung Microtom (Leica, Wetzlar, Germany) and two sections were mounted on each slide. For morphological evaluation, sections on every fifth slide were stained with hematoxylin and eosin. For immunohistochemistry, sections were deparaffinized, rehydrated in a series of alcohol and fixed in ice-cold absolute ethanol for 5 min. After washing with PBS, endogenous peroxidase activity was blocked with 2.5% hydrogen peroxide in methanol for 10 min in the dark followed by antigen retrieval by boiling slides in 0.01 M Natrium-citrate buffer (pH 6)/0.5% Tween-20 for 10 min. After cooling, sections were permeabilized in 0.1% Triton X-100 in PBS for 30 s. Non-specific binding sites were blocked with 0.5% BSA in PBS for 20 min. The primary antibodies used were anti-prolactin mouse monoclonal antibody (1:25; Zytomed, Carlsbad, CA, USA), anti-Ki-67 mouse monoclonal antibody (1:400; Dako, Hamburg, Germany), anti-Foxo1 rabbit polyclonal antibody (1:50; Cell signaling, Danvers, MA, USA), and anti-caspase-3 rabbit polyclonal antibody (1:200; Zytomed, Carlsbad, CA, USA). A suitable biotinylated secondary antibody (Dako, Hamburg, Germany) was used. The primary antibody was omitted in the negative controls. Positive controls were performed on paraffin-embedded decidual tissue of mature human placenta, since it has been shown that prolactin protein can be stained in decidual cells of term placentas.32 Sections were counterstained with hematoxylin. Staining was analyzed using an Axiophot photomicroscope (Zeiss, Jena, Germany), and images were captured with a Nikon DS-U1 camera. The area of decidualized tissue and cell numbers were quantified with NIS-Elements BR software (Nikon, Düsseldorf, Germany). The proliferation rate was calculated as a percentage of Ki-67 stained cells per total amount of glandular epithelial cells and stromal cells, respectively. Evaluation of FOXO1 immunostaining was performed by semiquantitative classification as a percentage of stained tissue per total tissue with nine different staining intensity classes (0 = no staining to 8 = very intense staining). For each experimental approach, one representative section of an endometrial fragment of at least three different patients was analyzed.\nStatistical analysis\nStatistical analysis was performed with SPSS 16.0 (IBM, Ehningen, Germany) using the Mann–Whitney U test for non-parametric analysis of variances. Results are represented as mean ± SEM. Probability values of ≤0.05 were considered statistically significant.\nResults\nMorphological differentiation of ectopic endometrial stromal cells is promoted by hCG\nAfter intraperitoneal transplantation of human endometrial tissue, NOD-SCID mice were treated with progesterone alone or in combination with forskolin or hCG for seven days. The control mice only received the vehicle. At the end of the culture period, the peritoneal cavity was inspected. Only in few cases a weak adhesion of lesions to the gut was found which could be easily separated. No strong local and no distal adhesions were found. Histological examination revealed a well-preserved histomorphology of all lesions showing typical endometrial glands surrounded by stromal cells (Figure 1(a) to (d)). Decidualized stromal cells could be distinguished from non-decidualized stromal cells by their epitheloid appearance. While only very small spots of decidualized cells were observed in the lesions of the control group (Figure 1(a)) as well as in those treated with progesterone alone (Figure 1(b)), an increase in the size of the area of decidualized cells was seen after treatment with progesterone in combination with forskolin (Figure 1(c)). This effect was markedly increased after combination with hCG. Here nearly the whole area of the lesions consisted of decidualized cells (Figure 1(d) and (e)). After the seven-day culture period, no significant differences in the size of lesions were observed between the different treatment groups (Figure 1(f)). Thus, treatment with progesterone and hCG resulted in an extensive morphological differentiation of stromal cells of the ectopic endometrial lesions.\nFunctional differentiation of ectopic endometrial lesions is induced by hCG\nExpression of the decidualization markers PRL and IGFBP1 was investigated in the ectopic human endometrial lesions after seven days of treatment. qPCR analysis revealed that treatment with progesterone alone had no effect on endometrial PRL (Figure 2(a)) and IGFBP1 (Figure 2(b)) gene expression compared to controls. Transcription of PRL and IGFBP1 was slightly enhanced after treatment with progesterone in combination with forskolin, while treatment with progesterone and hCG led to significantly enhanced endometrial PRL (Figure 2(a)) and IGFBP1 expression (Figure 2(b)). To prove this decidual differentiation on protein level, the PRL protein was localized by immunohistochemical analysis. Lesions treated with the vehicle only (Figure 2(d)), progesterone only (Figure 2(e)) or in combination with forskolin (Figure 2(f)) showed no positive staining for PRL in any cell. In contrast, more than 30% of the lesions cultured in mice treated with hCG revealed cells positively stained for PRL (Figure 2(c) and (g)). PRL-stained cells were scattered within the decidualized areas of hCG-treated lesions (Figure 2(g)), correlating to the pattern seen in decidua of mature placentae (Figure 2(h)). In decidualized ectopic endometrial lesions as also in mature decidua, not all cells are stained positively for PRL as this protein is secreted and the amount is not high enough in all cells to be detected by immunohistochemistry. As a result, PRL protein was exclusively observed in those ectopic endometrial lesions treated with a combination of progesterone with hCG.\nSince FOXO1 is induced during decidualization,33 the effect of the different treatments on the expression level of FOXO1 was analyzed parallely in the ectopic endometrial lesions after seven days of treatment. Combined treatment with progesterone and forskolin as well as with hCG significantly increased the transcription of the FOXO1 gene compared to controls as well as to lesions grown in mice treated with progesterone only (Figure 3(a)). Only a faint immunohistochemical staining for the FOXO1 protein was observed in controls (Figure 3(c)) as well as in those lesions treated with progesterone only (Figure 3(d)) or with progesterone and forskolin (Figure 3(e)). In contrast, lesions revealed an intense staining for the FOXO1 protein after combined treatment with hCG (Figure 3(f)), showing a pattern comparable to decidual tissue of the mature placenta (Figure 3(g)). Quantification of the staining intensity revealed a significant increase in FOXO1 protein expression only in those lesions treated with hCG (Figure 3(b)). In contrast to those decidualization markers, no staining for caspase-3 as an indicator of apoptosis was observed in any experimental group (not shown).\nThus, the increase in area of morphologically decidualized endometrial stromal cells in ectopic lesions treated with hCG corresponded to a significant increase in the production of the decidualization markers PRL and FOXO1.\nProliferation in ectopic endometrial lesions\nTo analyze the effect of the different treatments on proliferation of the human ectopic endometrial lesions, the rate of proliferation of endometrial stromal cells was determined by quantification of immunostaining for Ki-67. While, in a comparison with controls after seven days (Figure 4(a) and (e)), there was a trend to an increase in the proliferation rate of ectopic endometrial stromal cells after treatment with progesterone alone (Figure 4(b) and (e)) or in combination with forskolin (Figure 4(c) and (e), such an increase was not observed after application of hCG (Figure 4(d) and (e)).\nhCG has a sustainable effect on decidualization after termination of treatment\nWe have demonstrated that the combined treatment with progesterone and hCG proved to be a significantly stronger inductor of decidualization of the stromal compartment of the ectopic endometrial lesions than progesterone alone or in combination with forskolin. To evaluate if this hCG-mediated effect is maintained after termination of treatment, NOD-SCID mice transplanted with human endometrial tissue fragments were treated for 10 days with progesterone and hCG, followed by an additional period of 7 days without treatment. Subsequently, lesions were removed and analyzed. After termination of treatment, the expression of PRL continued to increase considerably, leading to a highly significant increase compared to controls (Figure 5(a)). In parallel thereto, a significant decrease in the proliferation rate of ectopic endometrial stromal cells was observed (Figure 5(b)). During this differentiation process, a trend towards a decrease in the size of the lesions was seen (Figure 5(c)), while no staining for ccaspase-3 as an indicator of apoptosis was observed (not shown). Thus, after initiation of the decidualization process by progesterone and hCG, this differentiation of the ectopic endometrial lesions also continued to progress after termination of treatment.\nDiscussion\nIn this study, we have demonstrated that decidualization of human ectopic endometrial tissue can be successfully induced in an endometriosis mouse model by systemic treatment in vivo. Using substances which had been shown before to be involved in the induction of decidualization of human endometrial stromal cells, it was shown that this induction of decidualization is significantly stronger when progesterone is applied with hCG rather than applying progesterone alone or in combination with the direct adenylyl cyclase activator forskolin.\nProgesterone resistance is a common feature in endometriosis patients, potentially leading to impaired decidualization, and thus increased capability of ectopic endometrial tissue to proliferate and persist in ectopic sites.17,18,20 Although progesterone is generally considered to be the key inducing factor for the decidualization process,34 it is known to be a weak inductor of decidualization.35,36 Thus, the enhancement of progesterone action could lead to an enhancement of the decidualization reaction. It has long been known that combining progestins with cAMP leads to a significantly increased decidualization of isolated human endometrial stromal cells in vitro compared to the application of progestins alone,15,35 and that the activated cAMP/PKA-signal pathway may interact with the progesterone pathway.35,37 Also hCG, a major early embryonic signal already produced by the pre-implantation blastocyst,38,39 has been shown to modulate endometrial cell differentiation prior to blastocyst implantation in humans and non-human primates21,40–42 and, in addition, is under discussion with regard to its effect on ectopic endometrial tissue.23–26\nIn the present in vivo study, hCG led to a significantly stronger induction of decidualization of human ectopic endometrial tissue in progesterone-treated mice than forskolin did. While both treatments initiated early steps in the decidualization process, such as the induction of gene expression of the transcription factor FOXO1, only hCG led to the induction of FOXO1 protein expression, which is important in the initiation of the decidualization process,43–45 as well as in a significant morphological and physiologic transformation of the ectopic endometrial stromal cells after seven days of treatment. While forskolin enhances intracellular cAMP by direct activation of the enzyme adenylyl cyclase, hCG binds to the G-protein-coupled LH/hCG-receptor.46–48 This receptor is well known to mediate the maintenance of progesterone production by the corpus luteum in the ovary during early pregnancy,41,49 but is also found in human endometrial cells.50–52 Here, hCG may induce in vitro decidualization of endometrial stromal cells via the cAMP/PKA pathway22,53–55 but has also been shown to up-regulate the progesterone receptor in a PKA-independent manner in human endometrial stromal cells in vitro,22 possibly increasing the effects of hCG on progesterone action in these cells, as has been observed previously.56,57\nAlthough it has been shown that a continual application of progesterone and cAMP is necessary to maintain the decidual phenotype of isolated endometrial stromal cells in vitro,35,58 in the present in vivo study, the decidualizing effect of progesterone and hCG on PRL secretion concomitant with an inhibition of proliferation even increased seven days after termination of treatment.\nPublished data regarding the effectiveness of hCG on decidualization induction in vitro have been contradictory.53,59,60 In contrast to our study, however, these experiments have been performed with isolated endometrial stromal cells in vitro. The lack of a three-dimensional structure and of endometrial epithelial cells might have a considerable impact on the cellular pathways necessary for hCG-induced stromal cell differentiation. We here used an established humanized endometriosis mouse model in which the human endometriotic-like lesions resemble those found in patients.27,61 When analyzing mechanisms of decidualization, it is paramount to use human endometrium instead of, for example, an autologous rodent model, since the process of decidualization differs considerably between rodents and primates.33 In contrast to studies injecting minced endometrial tissue into the peritoneal cavity to analyze the degree of adhesion of the randomly attached lesions,62 in our model, human endometrial fragments were fixed by surgical sutures to the abdominal wall. As described previously,61 this allows a 100% recovery rate of fragments for analysis. Using this humanized endometriosis model, we have been able to demonstrate that systemic treatment with hCG induces decidualization of human ectopic endometrial lesions more effectively than forskolin.\nIn conclusion, in this study, we have proved that ectopic endometrial tissue can be decidualized in a humanized animal model in vivo. The factors and signaling pathways inducing the process of decidualization are only partly understood and are regulated by a complex interaction of multiple factors. It is still not fully clear how the distinct signal cascades are impaired in endometriosis patients. Though these may be altered by endometrial disorders like for example chronic endometritis,63,64 especially in the case of progesterone resistance, alternative pathways inducing decidualization could alleviate endometriosis. The sophisticated hCG action could constitute a therapeutical tool to induce terminal differentiation in ectopic endometrial lesions. This model provides a tool to further investigate the effect of therapeutical compounds or compound combinations in regard to their decidualizing potential on ectopic endometrial tissue in an in vivo system.\nAcknowledgments\nThe authors thank Stephanie Levin, Gabriele Sehn, and Kathrin Kazuschke for technical assistance and Ann Soether for proofreading of the manuscript.\nAuthors’ contributions\nAll authors participated in the design, interpretation of the studies and analysis of the data and review of the manuscript; YK developed and performed the experiments, analyzed the data including statistical analysis, and revised the manuscript. PW provided administrative, technical and material support, and revised the manuscript. RG developed study concept and design, contributed to analyzing the data and wrote the manuscript. All authors revised the manuscript and approved the final draft.\nDeclaration of Conflicting Interests\nThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article\nFunding\nThe author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was partly funded by a grant from the Deutsche Forschungsgemeinschaft to Ruth Grümmer (DFG 1138/4–1).\nReferences\n- 1.Burney RO, Giudice LC. Pathogenesis and pathophysiology of endometriosis. Fertil Steril 2012; 98:511–9 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 2.Meuleman C, Vandenabeele B, Fieuws S, Spiessens C, Timmerman D, D’hooghe T. High prevalence of endometriosis in infertile women with normal ovulation and normospermic partners. Fertil Steril 2009; 92:68–74 [DOI] [PubMed] [Google Scholar]\n- 3.Hickey M, Ballard K, Farquhar C. Endometriosis. BMJ 2014; 348:g1752. [DOI] [PubMed] [Google Scholar]\n- 4.Sampson J. Peritoneal endometriosis due to menstrual dissemination of endometrial tissue into the peritoneal cavity. Am J Obstet Gynecol 1927; 14:422–9 [Google Scholar]\n- 5.Liu DT, Hitchcock A. Endometriosis: its association with retrograde menstruation, dysmenorrhoea and tubal pathology. Br J Obstet Gynaecol 1986; 93:859–62 [DOI] [PubMed] [Google Scholar]\n- 6.Rei C, Williams T, Feloney M. Endometriosis in a man as a rare source of abdominal pain: a case report and review of the literature. Case Rep Obstet Gynecol 2018; 2018:2083121. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 7.Jensen JR, Coddington CC. Evolving spectrum: the pathogenesis of endometriosis. Clin Obstet Gynecol 2010; 53:379–88 [DOI] [PubMed] [Google Scholar]\n- 8.Laganà AS, Vitale SG, Salmeri FM, Triolo O, Ban Frangež H, Vrtačnik-Bokal 4, Stojanovska L, Apostolopoulos V, Granese R, Sofo V. Unus pro omnibus, omnes pro uno: a novel, evidence-based, unifying theory for the pathogenesis of endometriosis. Med Hypoth 2017; 103:10–20 [DOI] [PubMed] [Google Scholar]\n- 9.de Graaff AA, D’hooghe TM, Dunselman GA, Dirksen CD, Hummelshoj L, Consortium WE, Simoens S. The significant effect of endometriosis on physical, mental and social wellbeing: results from an international cross-sectional survey. Hum Reprod 2013; 28:2677–85 [DOI] [PubMed] [Google Scholar]\n- 10.Moradi M, Parker M, Sneddon A, Lopez V, Ellwood D. Impact of endometriosis on women’s lives: a qualitative study. BMC Womens Health 2014; 14:123. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 11.Brown J, Farquhar C. Endometriosis: an overview of cochrane reviews. Cochrane Database Syst Rev 2014; 3:CD009590. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 12.Vercellini P, Barbara G, Abbiati A, Somigliana E, Vigano P, Fedele L. Repetitive surgery for recurrent symptomatic endometriosis: what to do? Euro J Obstet Gynecol Reprod Biol 2009; 146:15–21 [DOI] [PubMed] [Google Scholar]\n- 13.Rogers PA, Adamson GD, Al-Jefout M, Becker CM, D'Hooghe TM, Dunselman GA, Fazleabas A, Giudice LC, Horne AW, Hull ML, Hummelshoj L, Missmer SA, Montgomery GW, Stratton P, Taylor RN, Rombauts L, Saunders PT, Vincent K, Zondervan KT. Research priorities for endometriosis. Reprod Sci 2017; 24:202–26 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 14.Nisolle M, Casanas-Roux F, Donnez J. Early-stage endometriosis: adhesion and growth of human menstrual endometrium in nude mice. Fertil Steril 2000; 74:306–12 [DOI] [PubMed] [Google Scholar]\n- 15.Gellersen B, Brosens JJ. Cyclic decidualization of the human endometrium in reproductive health and failure. Endocr Rev 2014; 35:851–905 [DOI] [PubMed] [Google Scholar]\n- 16.Rock J, Bartlett MK. Biopsy studies of human endometrium: criteria of dating and information about amenorrhea, menorrhagia, and time of ovulation. J Am Med Assoc 1937; 108:2022–8 [DOI] [PubMed] [Google Scholar]\n- 17.Klemmt PA, Carver JG, Kennedy SH, Koninckx PR, Mardon HJ. Stromal cells from endometriotic lesions and endometrium from women with endometriosis have reduced decidualization capacity. Fertil Steril 2006; 85:564–72 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 18.Aghajanova L, Hamilton A, Kwintkiewicz J, Vo KC, Giudice LC. Steroidogenic enzyme and key decidualization marker dysregulation in endometrial stromal cells from women with versus without endometriosis. Biol Reprod 2009; 80:105–14 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 19.Aghajanova L, Tatsumi K, Horcajadas JA, Zamah AM, Esteban FJ, Herndon CN, Conti M, Giudice LC. Unique transcriptome, pathways, and networks in the human endometrial fibroblast response to progesterone in endometriosis. Biol Reprod 2011; 84:801–15 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 20.Bulun SE, Cheng YH, Yin P, Imir G, Utsunomiya H, Attar E, Innes J, Julie Kim J. Progesterone resistance in endometriosis: link to failure to metabolize estradiol. Mol Cell Endocrinol 2006; 248:94–103 [DOI] [PubMed] [Google Scholar]\n- 21.Strug MR, Su R, Young JE, Dodds WG, Shavell VI, Díaz-Gimeno P, Ruíz-Alonso M, Simón C, Lessey BA, Leach RE, Fazleabas AT. Intrauterine human chorionic gonadotropin infusion in oocyte donors promotes endometrial synchrony and induction of early decidual markers for stromal survival: a randomized clinical trial. Hum Reprod 2016; 31:1552–61 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 22.Tapia-Pizarro A, Archiles S, Argandoña F, Valencia C, Zavaleta K, Cecilia Johnson M, González-Ramos R, Devoto L. hCG activates Epac-Erk1/2 signaling regulating progesterone receptor expression and function in human endometrial stromal cells. Mol Hum Reprod 2017; 23:393–405 [DOI] [PubMed] [Google Scholar]\n- 23.Moen MH, Muus KM. Endometriosis in pregnant and non-pregnant women at tubal sterilization. Hum Reprod 1991; 6:699–702 [DOI] [PubMed] [Google Scholar]\n- 24.Olive DL, Haney AF. Endometriosis-associated infertility: a critical review of therapeutic approaches. Obstet Gynecol Surv 1986; 41:538–55 [PubMed] [Google Scholar]\n- 25.Mahmood TA, Templeton A. Pathophysiology of mild endometriosis: review of literature. Hum Reprod 1990; 5:765–84 [DOI] [PubMed] [Google Scholar]\n- 26.Schenken RS, Williams RF, Hodgen GD. Effect of pregnancy on surgically induced endometriosis in cynomolgus monkeys. Am J Obstet Gynecol 1987; 157:1392. [DOI] [PubMed] [Google Scholar]\n- 27.Grümmer R, Schwarzer F, Bainczyk K, Hess-Stumpp H, Regidor PA, Schindler AE, Winterhager E. Peritoneal endometriosis: validation of an in-vivo model. Hum Reprod 2001; 16:1736–43 [DOI] [PubMed] [Google Scholar]\n- 28.Noyes RW, Hertig AT, Rock J. Dating the endometrial biopsy. Fertil Steril 1950; 1:3–25 [DOI] [PubMed] [Google Scholar]\n- 29.Fechner S, Husen B, Thole H, Schmidt M, Gashaw I, Kimmig R, Winterhager E, Grümmer R. Expression and regulation of estrogen-converting enzymes in ectopic human endometrial tissue. Fertil Steril 2007; 88:1029–38 [DOI] [PubMed] [Google Scholar]\n- 30.Monckedieck V, Sannecke C, Husen B, Kumbartski M, Kimmig R, Totsch M, Winterhager E, Grümmer R. Progestins inhibit expression of MMPs and of angiogenic factors in human ectopic endometrial lesions in a mouse model. Mol Hum Reprod 2009; 15:633–43 [DOI] [PubMed] [Google Scholar]\n- 31.Koch Y, van Fürden B, Kaiser S, Klein D, Kibschull M, Schorle H, Carpinteiro A, Gellhaus A, Winterhager E. Connexin 31 (GJB3) deficiency in mouse trophoblast stem cells alters giant cell differentiation and leads to loss of oxygen sensing. Biol Reprod 2012; 87:37. [DOI] [PubMed] [Google Scholar]\n- 32.Maaskant RA, Bogic LV, Gilger S, Kelly PA, Bryant-Greenwood GD. The human prolactin receptor in the fetal membranes, decidua, and placenta. J Clin Endocrinol Metab 1996; 81:396–405 [DOI] [PubMed] [Google Scholar]\n- 33.Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK. Endometrial decidualization: of mice and men. Semin Reprod Med 2010; 28:17–26 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 34.Brosens JJ, Gellersen B. Death or survival – progesterone-dependent cell fate decisions in the human endometrial stroma. J Mol Endocrinol 2006; 36:389–98 [DOI] [PubMed] [Google Scholar]\n- 35.Gellersen B, Brosens J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol 2003; 178:357–72 [DOI] [PubMed] [Google Scholar]\n- 36.de Ziegler D, Fanchin R, de Moustier B, Bulletti C. The hormonal control of endometrial receptivity: estrogen (E2) and progesterone. J Reprod Immunol 1998; 39:149–66 [DOI] [PubMed] [Google Scholar]\n- 37.Maruyama T, Yoshimura Y. Molecular and cellular mechanisms for differentiation and regeneration of the uterine endometrium. Endocr J 2008; 55:795–810 [DOI] [PubMed] [Google Scholar]\n- 38.Lopata A, Hay DL. The potential of early human embryos to form blastocysts, hatch from their zona and secrete HCG in culture. Hum Reprod 1989; 4:87–94 [DOI] [PubMed] [Google Scholar]\n- 39.Ramu S, Acacio B, Adamowicz M, Parrett S, Jeyendran RS. Human chorionic gonadotropin from day 2 spent embryo culture media and its relationship to embryo development. Fertil Steril 2011; 96:615–7 [DOI] [PubMed] [Google Scholar]\n- 40.Cameo P, Srisuparp S, Strakova Z, Fazleabas AT. Chorionic gonadotropin and uterine dialogue in the primate. Reprod Biol Endocrinol 2004; 2:50. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 41.Filicori M, Fazleabas AT, Huhtaniemi I, Licht P, Rao ChV Tesarik J, Zygmunt M. Novel concepts of human chorionic gonadotropin: reproductive system interactions and potential in the management of infertility. Fertil Steril 2005; 84:275–84 [DOI] [PubMed] [Google Scholar]\n- 42.Banerjee P, Fazleabas AT. Endometrial responses to embryonic signals in the primate. Int J Dev Biol 2010; 54:295–302 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 43.Grinius L, Kessler C, Schroeder J, Handwerger S. Forkhead transcription factor FOXO1A is critical for induction of human decidualization. J Endocrinol 2006; 189:179–87 [DOI] [PubMed] [Google Scholar]\n- 44.Buzzio OL, Lu Z, Miller CD, Unterman TG, Kim JJ. FOXO1A differentially regulates genes of decidualization. Endocrinology 2006; 147:3870–6 [DOI] [PubMed] [Google Scholar]\n- 45.Takano M, Lu Z, Goto T, Fusi L, Higham J, Francis J, Whitey A, Hardt J, Cloke B, Stavropoulou AV, Ishihara O, Lam EW, Unterman TG, Brosens JJ, Kim JJ. Transcriptional cross talk between the forkhead transcription factor box O1A and the progesterone receptor coordinates cell cycle regulation and differentiation in human endometrial stromal cells. Mol Endocrinol 2007; 21:2334–49 [DOI] [PubMed] [Google Scholar]\n- 46.Ascoli M, Fanelli F, Segaloff DL. The lutropin/choriogonadotropin receptor, a 2002 perspective. Endocr Rev 2002; 23:141–74 [DOI] [PubMed] [Google Scholar]\n- 47.Weedon-Fekjaer MS, Tasken K. Review: spatiotemporal dynamics of hCG/cAMP signaling and regulation of placental function. Placenta 2010; 33:S87–91 [DOI] [PubMed] [Google Scholar]\n- 48.McFarland KC, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, Segaloff DL, Seeburg PH. Lutropin-choriogonadotropin receptor: an unusual member of the G protein-coupled receptor family. Science 1989; 245:494–9 [DOI] [PubMed] [Google Scholar]\n- 49.Srisuparp S, Strakova Z, Fazleabas AT. The role of chorionic gonadotropin (CG) in blastocyst implantation. Arch Med Res 2001; 32:627–34 [DOI] [PubMed] [Google Scholar]\n- 50.Reshef E, Lei ZM, Rao CV, Pridham DD, Chegini N, Luborsky JL. The presence of gonadotropin receptors in nonpregnant human uterus, human placenta, fetal membranes, and decidua. J Clin Endocrinol Metab 1990; 70:421–30 [DOI] [PubMed] [Google Scholar]\n- 51.Licht P, von WM, Berkholz A, Wildt L. Evidence for cycle-dependent expression of full-length human chorionic gonadotropin/luteinizing hormone receptor mRNA in human endometrium and decidua. Fertil Steril 2003; 79(Suppl1):718–23 [DOI] [PubMed] [Google Scholar]\n- 52.Rao CV, Lei ZM. The past, present and future of nongonadal LH/hCG actions in reproductive biology and medicine. Mol Cell Endocrinol 2007; 269:2–8 [DOI] [PubMed] [Google Scholar]\n- 53.Tang B, Gurpide E. Direct effect of gonadotropins on decidualization of human endometrial stroma cells. J Steroid Biochem Mol Biol 1993; 47:115–21 [DOI] [PubMed] [Google Scholar]\n- 54.Chatterjee A, Jana NR, Bhattacharya S. Stimulation of cyclic AMP, 17betaoestradiol and protein synthesis by human chorionic gonadotrophin in human endometrial cells. Hum Reprod 1997; 12:1903–8 [DOI] [PubMed] [Google Scholar]\n- 55.Houslay MD, Adams DR. PDE4 cAMP phosphodiesterases: modular enzymes that orchestrate signalling cross-talk, desensitization and compartmentalization. Biochem J 2003; 370:1–18 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 56.Banaszak S, Brudney A, Donnelly K, Chai D, Chwalisz K, Fazleabas AT. Modulation of the action of chorionic gonadotropin in the baboon (Papio anubis) uterus by a progesterone receptor antagonist (ZK 137. 316). Biol Reprod 2000; 63:820–5 [DOI] [PubMed] [Google Scholar]\n- 57.Sherwin JR, Sharkey AM, Cameo P, Mavrogianis PM, Catalano RD, Edassery S, Fazleabas AT. Identification of novel genes regulated by chorionic gonadotropin in baboon endometrium during the window of implantation. Endocrinology 2007; 148:618–26 [DOI] [PubMed] [Google Scholar]\n- 58.Telgmann R, Gellersen B. Marker genes of decidualization: activation of the decidual prolactin gene. Hum Reprod Update 1998; 4:472–9 [DOI] [PubMed] [Google Scholar]\n- 59.Han SW, Lei ZM, Rao CV. Treatment of human endometrial stromal cells with chorionic gonadotropin promotes their morphological and functional differentiation into decidua. Mol Cell Endocrinol 1999; 147:7–16 [DOI] [PubMed] [Google Scholar]\n- 60.Kasahara K, Takakura K, Takebayashi K, Kimura F, Nakanishi K, Noda Y. The role of human chorionic gonadotropin on decidualization of endometrial stromal cells in vitro. J Clin Endocrinol Metab 2001; 86:1281–6 [DOI] [PubMed] [Google Scholar]\n- 61.Grümmer R. Animal models in endometriosis research. Hum Reprod Update 2006; 12:641–9 [DOI] [PubMed] [Google Scholar]\n- 62.Bruner-Tran KL, Carvalho-Macedo AC, Duleba AJ, Crispens MA, Osteen KG. Experimental endometriosis in immunocompromised mice after adoptive transfer of human leukocytes. Fertil Steril. 2010; 93:2519–24 [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 63.Wu D, Kimura F, Zheng L, Ishida M, Niwa Y, Hirata K, Takebayashi A, Takashima A, Takahashi K, Kushima R, Zhang G, Murakami T. Chronic endometritis modifies decidualization in human endometrial stromal cells. Reprod Biol Endocrinol 2017; 15:16. [DOI] [PMC free article] [PubMed] [Google Scholar]\n- 64.Di Pietro C, Caruso S, Battaglia R, Iraci Sareri M, La Ferlita A, Strino F, Bonaventura G, Di Mauro M, Barcellona ML, Perciavalle V, Purrello M, Cianci A. MiR-27a-3p and miR-124-3p, upregulated in endometrium and serum from women affected by chronic endometritis, are new potential molecular markers of endometrial receptivity. Am J Reprod Immunol 2018;e12858. [DOI] [PubMed] [Google Scholar]","source_license":"CC0","license_restricted":false}