{"paper_id":"43dc15b1-d13b-43ef-8d3c-16197f75f787","body_text":"IFI16 induced hepatocyte inflammation with HBV infection by regulating STING-IRF3 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article IFI16 induced hepatocyte inflammation with HBV infection by regulating STING-IRF3 pathway Xiaoyan Liu, Cheng Li, Shumin Ma, Xuehui Bu, Shuangshuang Xie, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6883660/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aims and background: This study explores that in HBV infection, IFI16 further activates IRF3 through the STING pathway, leading to the release of inflammatory factors and thereby causing liver inflammation. This provides new ideas and theoretical basis for the inflammatory damage caused by hepatitis B virus infection, and also offers new therapeutic targets. Methods In vitro experiments were conducted using human hepatoma cell lines (Huh-7 and HepAD38) transfected with HBV DNA. IFI16 was either overexpressed or silenced, and the expression levels of IFI16, STING, IRF3, IFN-β, and IL-29 were evaluated through Western blot and qRT-PCR analyses. In vivo, an HBV-infected BALB/c mouse model was established to further validate the role of the IFI16-STING-IRF3 pathway in HBV-induced hepatic inflammation. Results IFI16 overexpression in HBV-infected Huh-7 and HepAD38 cells increased the expression of STING, IRF3, IFN-β, and IL-29. Conversely, knockdown of IFI16 using siRNA significantly suppressed the expression of these molecules. In vivo studies indicated that IFI16 overexpression elevated serum levels of ALT, AST, HBeAg, and HBsAg, as well as the expression of STING, IRF3, IFN-β, and IL-29. Furthermore, IFI16 expression correlated with the severity of HBV-associated liver fibrosis. Conclusions The IFI16-STING pathway facilitates HBV-induced hepatic inflammation by activating IRF3 and promoting the secretion of pro-inflammatory cytokines, such as IFN-β and IL-29. These insights lay a theoretical groundwork for the development of innovative antiviral therapeutic approaches. IFI16 STING IRF3 IFN-β IL-29 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Hepatitis B virus (HBV) infection continues to pose a significant global public health challenge, affecting approximately 290 million individuals worldwide [ 1 , 2 ]. In China, nearly 100 million people are chronically infected with HBV [ 3 ], and about one-third of these cases progress to chronic hepatitis B (CHB). Tragically, half a million deaths occur annually due to complications related to HBV, including liver failure, cirrhosis, and hepatocellular carcinoma (HCC) [ 4 ]. Although current antiviral therapies, such as interferon (IFN) and nucleos(t)ide analogues (NAs), can reduce the risk of hepatocellular carcinoma (HCC) and other life-threatening complications in chronic hepatitis B (CHB) patients [ 5 ], their clinical utility remains limited. Interferon-based regimens are hindered by significant side effects, suboptimal response rates, and strict eligibility criteria, whereas long-term NA therapy faces challenges including indefinite treatment duration and the emergence of drug-resistant viral variants [ 6 ]. These limitations highlight the urgent need for more effective therapeutic strategies against HBV infection. An unresolved critical issue in HBV pathogenesis is the mechanistic basis of chronic inflammation caused by persistent viral infection. Elucidating the molecular pathways that drive HBV-associated inflammatory liver injury could offer new insights for developing targeted anti-inflammatory and antiviral interventions. The immune response of an organism can be divided into the innate immune response and the adaptive immune response. During innate immunity, multiple pattern recognition receptors (PRRs) participate in precise regulation. PRRs function as sensors that detect exogenous and endogenous danger signals within the organism.By recognizing pathogen-associated molecular patterns (PAMPs)[ 7 ] and damage-associated molecular patterns (DAMPs)[ 8 ], these receptors can identify both invading microorganisms and internally generated danger signals. Upon activation, they trigger downstream signaling pathways, release inflammatory factors, and subsequently initiate adaptive immune responses. PRRs primarily include Toll-like receptors (TLRs), NOD-like receptors (NLRs), and cyclic GMP-AMP synthase (cGAS) [ 9 – 10 ]. As a cytosolic DNA sensor, cGAS specifically detects aberrant double-stranded DNA (dsDNA) in the cytoplasm and catalyzes the synthesis of the second messenger cyclic GMP-AMP (cGAMP) [ 11 ]. The synthesized cGAMP binds to the stimulator of interferon genes (STING) localized on the endoplasmic reticulum, inducing its activation [ 12 ].Activated STING subsequently translocates to perinuclear regions, including the Golgi apparatus, endosomes, and autophagosome-related compartments [ 13 ]. During this trafficking process, the C-terminal tail of STING recruits TANK-binding kinase 1 (TBK1) and facilitates its phosphorylation [ 14 ], which in turn promotes the phosphorylation of the transcription factor interferon regulatory factor 3 (IRF3) [ 15 ].This signaling cascade ultimately induces the production of type I interferons, (articularly IFN-β, and proinflammatory cytokines such as TNF-α and IL-29. While this mechanism enables rapid innate immune responses and bridges adaptive immunity, excessive activation may lead to inflammatory tissue damage. The Hepatitis B virus (HBV), a DNA virus with a 3.2 kb genome, releases at least two distinct forms of DNA during its replication cycle: relaxed circular DNA (rcDNA) and covalently closed circular DNA (cccDNA)[ 16 ]. Notably, the cytoplasmic DNA sensor, cyclic GMP-AMP synthase (cGAS), could theoretically detect HBV-derived DNA to activate the STING (stimulator of interferon genes) signaling pathway, triggering type I interferon production and subsequent inflammatory cytokine release, which may contribute to tissue damage.However, current studies indicate that Hepatitis B Virus DNA is a Substrate for the cGAS/STING Pathway but is not Sensed in Infected Hepatocytes [ 17 ]. Intriguingly, emerging evidence demonstrates that STING undergoes significant upregulation and activation during HBV infection, initiating downstream signaling that drives the release of proinflammatory mediators and establishes sustained inflammatory responses [ 18 ].This apparent paradox suggests that while the STING pathway plays a pivotal role in HBV-induced inflammatory pathogenesis, its activation mechanism seems to originate from upstream regulators that are independent of cGAS. IFI16 (Interferon-γ-inducible protein 16), a key member of the interferon-inducible HIN-200 protein family [ 19 ], displays an evolutionarily conserved domain architecture typical of this family. Phylogenetically, HIN-200 members are characterized by two signature domains: a C-terminal hematopoietic interferon-inducible nuclear (HIN) domain with tandem 200-amino acid repeats, which are crucial for nucleic acid recognition, and an N-terminal pyrin domain (PYD) that facilitates homotypic protein interactions and inflammasome complex assembly [ 20 ]. The C-terminal HIN domain binds to double-stranded DNA (dsDNA), activates both the IRF3 and NF-κB pathways, and induces the release of downstream pro-inflammatory factors, such as IFN-β. This mechanism results in inflammatory tissue damage and plays a critical role in autoimmune diseases [ 21 – 23 ]. Early investigations suggested that IFI16 is a nuclear-restricted protein involved in inflammasome formation and nuclear-driven inflammatory responses. However, emerging evidence indicates that IFI16 displays biphasic localization in both the nuclear and cytoplasmic compartments. Recent studies further confirm its ubiquitous expression across various tissue-derived cell types, including epithelial cells [ 24 ], endothelial cells [ 25 ], and fibroblasts [ 26 ].This pan-tissue distribution strongly suggests that IFI16 plays critical roles in orchestrating functional pathways across multiple organ systems, potentially serving as a systemic regulator of inflammation and immune homeostasis. Building upon the established role of the IFI16-STING-NF-κB pathway in DNA damage response [ 27 – 28 ], this study proposes a central mechanistic hypothesis: During HBV infection, viral genomic DNA (particularly covalently closed circular DNA, cccDNA) may trigger aberrant innate immune hyperactivation through the IFI16-STING-IRF3 signaling axis, thereby driving IFN-β/IL-29-mediated immunopathological liver injury. To verify this conclusion, we conducted this study, thereby enriching the mechanism of inflammatory damage caused by HBV infection and providing new targets and ideas for further treatment. Materials and methods Cell lines、reagents and cell culture The human hepatocellular carcinoma cell line (Huh-7) and HepAD38 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The Huh-7 cells were cultured in DMEM-H medium (HyClone, Cat. No. SH30243.01), whereas the HepAD38 cells were maintained in MEM-EBSS medium (HyClone, Cat. No. SH30265.01B). Both media were supplemented with 10% fetal bovine serum (FBS; Gibco, Cat. No. 10099-141) and 1% penicillin-streptomycin solution (containing 100 U/mL penicillin and 100 U/mL streptomycin). All cells were incubated under standard conditions at 37°C with 5% CO 2 . Cell transfection Human hepatocellular carcinoma cell lines (Huh-7 and HepAD38) were seeded in 12-well plates containing 1 mL of complete medium. The cells were then transfected with either pcDNA3.0–1.1HBV DNA-IFI16 (an overexpression construct), the corresponding negative control plasmid siIFI16 (gene-specific siRNA), or scrambled siRNA (a non-targeting control) for knockdown studies. The efficiency of IFI16 overexpression and knockdown was validated 48 hours post-transfection using quantitative real-time PCR (qRT-PCR) and Western blot analysis. Western blots According to the manufacturer’s instructions, the whole cell protein extracts were prepared and were separated using sodium dodecyl sulphate polyacrylamide gel electrophoresis and 10% gel. Proteins were then transferred to a polyvinylidene difluoride membrane (Millipore, Bed-ford, MA, USA), according to the instruction manual. Filters were blocked overnight in 5% w/v low-fat dry milk in 10 mmol/L Tris-HCl, pH 7.5, 0.1 mol/L NaCl and 0.1% Tween-20 and incubated with primary antibodies overnight at 4°C. After washing with TBST buffer, the blots were then incubated with HRP-conjugated secondary antibody for 2 hours at room temperature. After washing with TBST buffer, the blots were visualized using the ECL-Plus reagent (Millipore, Billerica, MA, USA). GAPDH was used as the loading control in the Western blotting. RNA isolation and qRT-PCR Total RNA was isolated using the Trizol RNA reagent (Invitrogen, California, USA). Quantitative real-time PCR was performed, and the expression levels of STING, IRF3, IFNβ, and IL-29 were normalized to GAPDH for gene expression analysis. The primers are listed in Table 1 . Table 1 Primers’ sequences used for qRT-PCR ID Sequence(5’- 3’) GAPDH F TGTTCGTCATGGGTGTGAAC GAPDH R ATGGCATGGACTGTGGTCAT STING F CCAACATTCGCTTCCTGGAT STING R TCTTCCTTTTCCTCCTGCCG IFI16 F AGCTCAGAACCCGAAAACAG IFI16 R TCTGTGTAGCCACTGTAGCA IFN-βF GCCGCATTGACCATCTATGA IFN-βR TTGGCCTTCAGGTAATGCAG HBV F TCTCAATGTTAGTATTCCTTGGACTCATAAG HBV R GTGTGTAAATAGTGTCTAGTTTGGAAGTAATGAT IRF3 F ACAGCAGGAGGATTTCGGAA IRF3 R TTATGTGGGTCGTGAGGGTC IL-29 F GCTGGTGACTTTGGTGCTAG IL-29 R AAGACAGGAGAGCTGCAACT Profiling of Liver Fibrogenesis Liver tissues from experimental models were fixed in 10% neutral buffered formalin for 24 to 48 hours, followed by dehydration through a graded ethanol series (from 70–100%), clearing in xylene, and embedding in paraffin. Collagen deposition was quantified using digital image analysis software (Image-Pro Plus v.6.0, Media Cybernetics). Five random fields per section (at 200× magnification) were captured under a light microscope (Model, Manufacturer). The percentage of collagen-positive area relative to the total tissue area was calculated to determine fibrosis severity. Fibrosis staging was further classified according to the Metavir scoring system (F0: no fibrosis; F4: cirrhosis). Statistical analysis The SPSS program (version 19.0) and GraphPad Prism (version 8.0) were used for analysis. Measurement data was described as mean ± standard deviation. Background factors were compared using Student’s-test (numerical data) or the Chisquare test (categorical data). Spearman’s two-tailed test was used for correlation analysis, and differences were regarded as significant if the p value was less than 0.05 on either side. Results Over expression of IFI16 promotes the occurrence of inflammation in vitro. Human hepatocellular carcinoma cell lines Huh-7 and HepAD38 were used to establish an HBV infection model (Fig. 1 A). The cells were divided into four groups: the HBV group (HBV), the IFI16 and HBV DNA co-transfected group (overexpression group, HBV + IFI16), the HBV DNA-transfected group without IFI16 (negative control group, HBV + vector), and the empty plasmids transfected group (blank group, Blank). The expression of inflammatory factors was detected by Western blot and qRT-PCR (Figs. 1 B, 1 C, 1 D). The results indicated that, in comparison to both the HBV + vector group and the blank control group, the overexpression of IFI16 resulted in a 1.6-fold increase in STING, a 1.8-fold increase in IFR3, a 1.9-fold increase in IFN-β, and a 1.5-fold increase in IL-29 within Huh-7 cells. In HepAD38 cells, there was a 1.3-fold increase in STING, a 2.5-fold increase in IFR3, a 2.1-fold increase in IFN-β, and a 1.1-fold increase in IL-29 (p < 0.005). These findings suggest that the overexpression of IFI16 leads to the upregulation of STING, IFR3, IFN-β, and IL-29 levels. Knockdown of IFI16 reduced inflammation in vitro To determine and further confirm whether reducing IFI16 levels can ameliorate the inflammatory response observed in the aforementioned overexpression experiments, we down-regulated the gene expression of IFI16 in infected Huh7 and HepAD38 cells using siRNA (siIFI16). The cell lines were divided into four groups: the HBV group (HBV), the IFI16-siRNA and HBV DNA co-transfected group (siIFI16 group), the HBV DNA-transfected group without siIFI16 (negative control group, NC), and the empty plasmids transfected group (blank group, Blank). The siRNA-mediated IFI16 knockdown group effectively suppressed the activation of this pathway, showing a 33% decrease in STING and a 35% decrease in IRF3 (p < 0.05), and significantly reduced the release of inflammatory factors, with a 40% decrease in IFN-β and a 43% decrease in IL-29 (p < 0.05) in Huh-7 cells. There were also significant differences in the HepAD38 cell line (Figs. 2 A, B). The knockout of IFI16 significantly downregulated the expression of STING, IRF3, IFN-β, and IL-29, as confirmed by Western blot analysis ((Figs. 2 C). Hepatic inflammatory progression and HBV replication could be induced by IFI16 activation of STING signals. IFI16 exhibits a stage-specific functional dichotomy in viral pathogenesis: it is primarily characterized as an intrinsic antiviral factor through mechanisms such as the transcriptional silencing of HBV cccDNA and the induction of interferon-stimulated genes (ISGs). However, emerging evidence reveals its paradoxical role in potentiating inflammatory cascades under conditions of chronic infection. This immunopathological exacerbation may inadvertently establish proviral niches through the remodeling of the hepatic microenvironment. The pAAV-HBV1.3 plasmid was delivered into mice via hydrodynamic injection to establish an HBV replication-competent model, enabling a systematic investigation of viral persistence and host-pathogen interactions. Experimental validation has shown that administering AAV-HBV in established murine cohorts—AAV-EV (empty vector control), AAV-HBV (viral replication model), AAV-HBV + siNC (non-targeting siRNA control), and AAV-HBV + siRNA (therapeutic intervention)—significantly increased serum ALT/AST levels and HBV replication markers (HBeAg/HBsAg) compared to the AAV-EV group (p < 0.01). (Fig. 3 ). Quantitative analysis confirmed the dual efficacy of siRNA-mediated therapy: virological suppression, with HBsAg levels reduced by 53.4% (95% CI 48.2–58.6), and a decrease in hepatic inflammatory response, as indicated by an ALT/AST ratio of 1.6 (p = 0.008 compared to siNC) (Fig. 3 ). AAV-HBV significantly upregulated IFI16, STING, IRF3, IFN-β, and IL-29 compared to AAV-EV controls (p < 0.01) (Fig. 4 ). Western blot analysis confirmed that siRNA-IFI16 reduced inflammatory cytokines through the cGAS-STING pathway(Figure 5 ). IFI16 activates STING-IRF3 signals for its anti-fibrosis effects in vivo Building upon the established anti-inflammatory properties of IFI16 in cellular models, we next investigated its therapeutic potential against hepatic fibrogenesis in vivo by employing siRNA-AAV-mediated hepatocyte-specific IFI16 silencing. The extent of fibrosis in the liver tissues of mice from each group (AAV-EV, AAV-HBV, AAV-HBV + siNC, and AAV-HBV + siRNA) was observed and compared using Masson staining. Quantitative histopathological analysis with Masson's trichrome staining revealed significant differences in fibrosis among the AAV-EV, AAV-HBV, AAV-HBV + siNC, and AAV-HBV + siRNA groups.We found that, compared to the AAV-EV group, the severity of liver fibrosis following AAV-HBV treatment was more pronounced. In comparison to the AAV-HBV + siNC group, the introduction of siRNA significantly mitigated this effect, thereby reducing liver fibrosis (Fig. 6 ). Discussion According to the latest epidemiological report from the World Health Organization, China is one of ten countries that together account for two-thirds of the global hepatitis B disease burden, with 79.7 million chronic HBV infections (31.5% of the global prevalence) [ 29 ]. A stratified analysis of individuals aged 15 years and older who are positive for HBsAg reveals that chronic HBV carriers (including both HBeAg-positive and HBeAg-negative infections) make up 78.03% of cases; CHB patients (with or without HBeAg) represent 19.63%; while advanced complications include cirrhosis (0.84%) and hepatocellular carcinoma (HCC) (0.15%) [ 30 ]. Despite clinical advances with interferon-based therapies and nucleos(t)ide analogues (NAs), functional cure rates remain suboptimal (< 5% HBsAg loss), highlighting unmet therapeutic needs in HBV management. Emerging evidence indicates that sequential interferon (IFN)-nucleos(t)ide analogue (NA) therapy achieves functional cure (HBsAg seroclearance) in patients with undetectable HBV DNA and low-level HBsAg (< 100 IU/mL) [ 31 ]. However, adverse effects associated with IFN (e.g., cytopenias, autoimmune complications) and suboptimal response rates (30–40% in ideal candidates) limit its broad clinical utility. In this study, we utilized human hepatocellular carcinoma cells (Huh-7 and HepAD38) and HBV-infected mouse models to investigate the relationship between IFI16 expression in hepatocytes and the expression of STING, IRF3, IFN-β, and IL-29. We also explored the association of IFI16 levels with inflammatory cytokines and the severity of liver fibrosis. Our primary goal was to elucidate how the IFI16-STING-IRF3 pathway alleviates liver injury and slows the progression of cirrhosis by stimulating the production of inflammatory factors, such as IFN-β and IL-29, and by modulating the inflammatory response in chronic HBV infection. Within the immune system, cGAS and IFI16 serve as critical cytosolic DNA sensors that both activate the STING signaling pathway to mediate antiviral and inflammatory responses. However, they exhibit distinct differences in DNA recognition patterns, subcellular localization, and pathophysiological functions, collectively forming a complementary and dynamically balanced immune surveillance network. cGAS primarily localizes in the cytoplasm, where it binds to free double-stranded DNA and catalyzes the production of the second messenger cGAMP. This directly activates STING, triggering the IRF3/NF-κB signaling pathway to induce the secretion of type I interferons and pro-inflammatory cytokines. IFI16, a member of the PYHIN family, serves as both an innate immune DNA sensor and an epigenetic regulator. It recognizes pathogen-derived DNA, such as that from bacteria or viruses, or self-DNA released during host damage, triggering the STING-TBK1-IRF3 axis to induce the production of type I interferons (IFN-α/β) [ 32 ]. Furthermore, through its epigenetic regulatory role, IFI16 silences viral genomes, including HBV cccDNA, or host genes, thereby suppressing viral replication or tumorigenesis. Previous studies have indicated that IFI16 plays a dual role in diseases such as infections, autoimmune disorders, and tumors [ 33 ]. It exhibits antiviral effects, inhibits tumor progression, and maintains intestinal homeostasis, but also drives autoimmune responses, promotes chronic inflammation, and is involved in neurodegenerative processes. Current research has confirmed that hepatitis B Virus DNA is a Substrate for the cGAS/STING Pathway but is not Sensed in Infected Hepatocytes [ 17 ]. However, Yang et al. proposed that other DNA sensors such as IFI16, which was recently suggested to sense HBV cccDNA in the nucleus of hepatocytes, might act as cofactors of the cGAS/STING pathway [ 34 ]. As an intranuclear DNA sensor, IFI16 plays a pivotal role in initiating innate immune responses through direct recognition of hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and aberrant DNA fragments generated during viral replication. This molecular surveillance mechanism enables IFI16 to detect viral genetic material in host nuclei, subsequently activating downstream antiviral defense pathways. Mechanistically, upon viral DNA engagement via its HIN200 domain, IFI16 undergoes structural oligomerization and assembles into a complex with STING, thereby promoting the endoplasmic reticulum-to-perinuclear microsome translocation of STING. This coordinated trafficking process is mediated by adaptor proteins including SCAP (SREBP Cleavage-Activating Protein), which bridges IRF3 recruitment through C-terminal binding interactions [ 35 ]. The subsequent formation of the STING-TBK1 signaling platform orchestrates IRF3 activation through three sequential biochemical events: TBK1-mediated phosphorylation at specific serine residues;conformational dimerization through reciprocal phosphoserine recognition and nuclear translocation of activated IRF3 dimers to initiate antiviral transcriptional programs. Activated IRF3 orchestrates antiviral immunity through transcriptional activation of type I interferons (e.g., IFN-β) and pro-inflammatory cytokines (e.g., TNF-α, IL-6), constituting the mechanistic core of host defense against HBV infection [ 36 ]. Notably, our experimental data demonstrate that IFI16 overexpression during HBV infection significantly amplifies the expression of key immune mediators including STING, IRF3, IFN-β, and the antiviral cytokine IL-29 (IFN-λ1). This nuclear surveillance-specific enhancement highlights the strategic advantage of IFI16's chromatin-associated localization, which facilitates efficient detection of viral DNA replication intermediates in hepatocytes. The HBV cccDNA is long-term located within the nucleus of liver cells, while the cytoplasmic DNA sensor cGAS may be unable to effectively recognize it due to spatial limitations [ 36 ]. This further validates that IFI16 becomes a key molecule for monitoring viral DNA within the nucleus. This mechanism may partially explain the molecular basis of liver-specific inflammatory responses in HBV infection. However, the continuously activated STING-IRF3 pathway may also lead to immune pathological damage. Studies have found that in the liver tissues of patients with chronic HBV infection, excessive activation of the STING signal can be detected, which is positively correlated with the degree of liver fibrosis and inflammation [ 37 ], suggesting that the imbalance of this pathway may be involved in the progression of the disease. Previous studies have shown that overexpression of IFI16 can significantly inhibit the expression of HBsAg and HBeAg in HepG2 and HepAD38 cells, and reduce the level of HBV mRNA [ 38 ]. At the same time, IFI16 can inhibit the transcriptional activity of cccDNA through epigenetic modifications (such as histone acetylation), and reduce the synthesis of HBsAg and HBeAg. This study reveals a seemingly contradictory phenomenon: overexpression of IFI16 may increase the expression of HBsAg and HBeAg. This finding contrasts with the discovery by Zhang et al., who reported significantly reduced HBsAg and HBeAg levels in HBV-infected hepatocytes with IFI16 overexpression [ 39 ]. This phenomenon can be mechanistically dissected through the following aspects: HBV DNA integrated fragments may evade immune recognition. Early in infection, HBV DNA integrates into the host genome. Although these integrated fragments lack complete replicative capacity, they persistently produce HBsAg and HBeAg. Since IFI16 primarily recognizes nuclear-free cccDNA rather than integrated fragments, the integrated HBsAg remains unregulated by IFI16. This creates a state of “sustained viral protein production with compromised immune surveillance\". Secondly, overexpression of IFI16 binds to viral DNA through the HIN200 domain, promoting the oligomerization of STING protein and its transport to the nuclear periphery microbody. This process accelerates the formation of the TBK1-IRF3 complex, leading to the phosphorylation and nuclear translocation of IRF3, and thereby driving the explosive release of type I interferons (IFN-α/β) and pro-inflammatory cytokines (such as IL-6, TNF-α). Excessive IFN-β and TNF-α may activate cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells, resulting in extensive apoptosis of infected liver cells, releasing the intracellular stored HBsAg/HBeAg into the bloodstream, presenting a transient increase in serum antigen levels [ 40 ]. Meanwhile, the inflammatory microenvironment can induce compensatory proliferation of liver cells. Under the continuous IFNβ/IL-29-mediated inflammatory damage, the remaining liver cells activate through the NF-κB pathway and secrete mitogens such as TNF-α and IL-6, stimulating the compensatory proliferation of liver cells. If these proliferating liver cells carry integrated HBV DNA fragments, it will further increase the overall production of HBsAg, forming a vicious cycle of \"inflammation - regeneration - increase of HBsAg\". At the same time, we also considered that knocking out IFI16 may alleviate its competitive inhibition of cGAS, thereby enhancing the activity of the cGAS-STING pathway and boosting type I interferon production to suppress HBV transcription. Concurrently, alternative antiviral pathways, such as AIM2, which may inhibit viral replication through unknown mechanisms, could be activated. Further investigations should quantify the expression levels of cGAS, STING, and downstream ISGs (e.g., MX1, OAS1) in knockout models, while assessing the functional status of AIM2. In conclusion, the observed reduction in HBsAg following IFI16 knockout may reflect the predominance of its pro-inflammatory activity in specific experimental models. IFI16 appears to play stage-dependent dual roles during HBV infection: suppressing the early stage while promoting the late stage of persistent infection. Subsequently, through multi-omics analysis (encompassing both transcriptome and proteome), the expression patterns following gene knockout can be comprehensively assessed. This analysis can be combined with clinical samples to verify the dynamic function of IFI16 in hepatitis B at various stages, thereby clarifying its potential as a therapeutic target. Our results also revealed that overexpression of IFI16 significantly increased the expression levels of ALT and AST, suggesting that overexpression of IFI16 activates the release of inflammatory factors and is accompanied by abnormal increases in ALT and AST, thereby revealing its pro-inflammatory and damaging pathological effects. Experimental data demonstrate that forced IFI16 expression elevates serum ALT and AST levels by 3.2 and 2.7-fold respectively, indicative of hepatocellular injury [ 41 ]. This observation aligns with preclinical evidence from HBV-transgenic murine models, where IFI16 overexpression induced a 2.3-fold increase in hepatic reactive oxygen species (ROS) accumulation and peak ALT values reaching 5–8 times baseline levels. Clinical cohort analysis found that in liver biopsy specimens of patients with high IFI16 expression, the density of inflammatory cell infiltration was positively correlated with the ALT level (r = 0.62, p < 0.01) [ 42 ]. Of course, there are studies that have confirmed that short-term activation of IFI16 may clear free virus particles through \"immune oscillation\", but long-term over-activation may induce hepatic stellate cells (HSCs) to transform into myofibroblasts, accelerating the fibrosis process [ 43 ]. In conclusion, an elevated ALT level is not only a result of liver damage, but also a biomarker indicating the continuous activation of the IFI16 pathway, which drives the malignant cycle of virus integration-inflammation regeneration. IFI16 plays a dual role as a \"defender first, rebel later\" in anti-HBV immunity through the STING-IRF3 pathway-the inflammatory response it induces aims to eliminate the virus, but due to promoting HBV DNA integration escape and triggering the liver cell damage-regeneration cycle, it ultimately leads to the continuous production of HBsAg and an increase in ALT. In the future, the treatment approach should adopt a dual-track strategy of \"rupture (malignant cycle) + elimination (integration fragment)\", and through a combined plan targeting the IFI16 pathway and silencing viral transcription, the coordinated goals of hepatitis control and virus elimination can be achieved. The core mechanism of liver fibrosis is related to chronic inflammation and the activation of hepatic stellate cells (HSCs). In this study,we found that in HBV infection, overexpression of IFI16 could mediate the release of IFN-β and IL-29 through the STING-IRF3 pathway, thereby aggravating the degree of liver fibrosis. This suggests a significant correlation between the expression of IFI16 in the liver tissues of patients with chronic hepatitis B and the degree of fibrosis, aligning with the findings of Pang et al., the intrahepatic IFI16 expression in patients of F4 was significantly higher than in F0 to F2 [ 43 ]. Experimental studies in HBV-infected mice reveal that IFI16 overexpression elevates hepatic IL-29 levels by 4.2-fold, correlating with increased α-SMA + cell density. Mechanistically, IL-29 binds its receptor on hepatic stellate cells (HSCs), activating the PI3K/Akt/mTOR pathway to drive their differentiation into myofibroblasts (MFBs) [ 44 ]. Experimental evidence indicates IFN-β and IL-29 synergistically drive Kupffer cell polarization toward an M2 phenotype, characterized by IL-10 and PDGF-BB secretion. This dual action suppresses CD8 + T cell antiviral activity while activating the PDGFR-β pathway in hepatic stellate cells (HSCs) [ 43 ]. In terms of inflammation re-circulation, the immune response mediated by IFN-β/IL-29 eliminates hepatocytes containing cccDNA, but hepatocytes containing integrated HBV DNA evade immune recognition, continuously express HBsAg, and the damaged area retains compensatory proliferation of liver cells. If carrying integrated viral fragments, HBsAg is continuously secreted, maintaining the inflammatory signal. Regenerated liver cells are more prone to damage due to increased metabolic load, releasing ROS and DAMPs, which further activates HSC. Conclusions The comprehensive analysis indicates that the IFI16-STING-IRF3 pathway serves as the core mechanism by which the host perceives and responds to HBV invasion. By inducing the production of IFNβ and IL-29, this mechanism inherently possesses pro-inflammatory properties, making it a key driver of HBV-related liver cell inflammation. Particularly noteworthy is that during chronic infection, HBV evades immune clearance by down-regulating IFI16 expression and promoting DNA integration, while maintaining HBsAg production, thereby forming a vicious cycle of \"inflammation - persistent virus\". The future treatment strategies should focus on balancing the antiviral efficacy and immune pathological damage, and developing precise intervention methods targeting the IFI16 pathway. Combining direct antiviral drugs (such as siRNA), immunomodulators (such as STING agonists), and adjunctive therapies (such as probiotics/spermidine), and conducting precise stratification based on patients' baseline characteristics (such as HBsAg level, HBV integration status), it is expected to achieve functional cure of chronic hepatitis B. The achievement of this goal will significantly reduce the risk of liver cirrhosis and HCC, and bring fundamental improvement hope to the 296 million chronic HBV-infected individuals worldwide. Abbreviations HBV：Hepatitis B virus；CHB: chronic hepatitis B; HCC: hepatocellular carcinoma; IFI16: Interferon-γ-inducible protein 16; NAs: nucleos(t)ide analogues. Declarations Acknowledgments The authors are grateful to Dr. Edward C. Mignot, Shandong University, for linguistic advice. Author contributions Study concept and design: DWJ, Acquisition of data: DWJ and LXY, Analysis and interpretation of data: LXY and LC , Drafting of the manuscript: LXY, Critical revision of the manuscript for important intellectual content: DWJ, Statistical analysis: MSM, Administrative, technical or material support: BXH, LXY and XSS, Study supervision: DWJ. All authors read and approved the final manuscript. Authors ’ information See information below the heading. Funding This project was supported by a Grant from Natural Science Foundation of Shandong, China (No. ZR2023MH143). Availability of data and materials The data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Consent for publication Not applicable. Competing interests None of the authors has an affiliation or conflict of interests. References Zhenqiu Liu,Chunqing Lin, Xianhua Mao, et al. Changing prevalence of chronic hepatitis B virus infection in China between 1973 and 2021: a systematic literature review and meta-analysis of 3740 studies and 231 million people. Gut. 2023 Nov 24;72(12):2354-2363. doi: 10.1136/gutjnl-2023-330691. Jinfeng Liu, Qinglei Zeng, Fanpu Ji, et al. Chinese clinical practice guidelines for the prevention and treatment of mother-to-child transmission of HBV (version 2024).J Clin Transl Hepatol. 2024 Nov 28;12(11):975-983. doi: 10.14218/JCTH.2024.00258. Norah A Terrault, Anna S F Lok, Brian J McMahon, et al. Update on prevention, diagnosis, and treatment of chronic hepatitis B: AASLD 2023 guidelines.Clin Liver Dis (Hoboken). 2018 Aug 22;12(1):33-34. doi: 10.1002/cld.728. Shiou-Hwei Yeh, Chiao-Ling Li, You-Yu Lin, et al. Hepatitis B Virus DNA Integration Drives Carcinogenesis and Provides a New Biomarker for HBV-related HCC.Cell Mol Gastroenterol Hepatol. 2023;15(4):921-929. doi: 10.1016/j.jcmgh.2023.01.001. Anna S F Lok, Brian J McMahon. AASLD Practice Guidelines. Chronic hepatitis B: update of therapeutic guidelines.Rom J Gastroenterol. 2004 Jun;13(2):150-4. doi: 10.1002/hep.21756. Yuqing Zhao,Yingying Song, Huan Zhang, et al. Efficacy of nucleos(t)ide analogues(NAs) in preventing virus reactivation in oncology patients with HBV infection after chemotherapy or surgery: A network meta-analysis.Front Oncol. 2023 Jan 16:12:1050714. doi: 10.3389/fonc.2022.1050714. Osamu Takeuchi, Shizuo Akira. Pattern recognition receptors and inflammation. Cell. 2010 Mar 19;140(6):805-20. doi: 10.1016/j.cell.2010.01.022. Ming Ma, Wei Jiang, Rongbin Zhou. DAMPs and DAMP-sensing receptors in inflammation and diseases. Immunity. 2024 Apr 9;57(4):752-771. doi: 10.1016/j.immuni.2024.03.002. Mahla RS, Reddy CM, Prasad D, et al. Sweeten PAMPs: role of sugar complexed PAMPs in innate immunity and vaccine biology. Front Immunol.2013;4:248. doi: 10.3389/fimmu.2013.00248. H Hemmi, O Takeuchi, T Kawai, et al. A Toll-like receptor recognizes bacterial DNA.Nature. 2000 Dec 7;408(6813):740-5. doi: 10.1038/35047123. Qi Chen, Lijun Sun, Zhijian J Chen. Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing.Nat Immunol. 2016 Sep 20;17(10):1142-9. doi: 10.1038/ni.3558. Hiroki Ishikawa, Glen N Barber. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling.Nature. 2008 Oct 2;455(7213):674-8. doi: 10.1038/nature07317. Dara L Burdette, Kathryn M Monroe, Katia Sotelo-Troha, Jeff S Iwig, Barbara Eckert，et al. STING is a direct innate immune sensor of cyclic di-GMP. Nature. 2011 Sep 25;478(7370):515-8. doi: 10.1038/nature10429. Tomohiko Taguchi, Kojiro Mukai. Innate immunity signalling and membrane trafficking. Curr Opin Cell Biol. 2019 Aug:59:1-7. doi: 10.1016/j.ceb.2019.02.002. Conggang Zhang, Guijun Shang, Xiang Gui, et al.. Structural basis of STING binding with and phosphorylation by TBK1.Nature. 2019 Mar;567(7748):394-398. doi: 10.1038/s41586-019-1000-2. Magda Rybicka, Anna Woziwodzka, Tomasz Romanowski, Piotr Stalke, Marcin Dręczewski, Krzysztof Piotr Bielawski. Differences in sequences between HBV-relaxed circular DNA and covalently closed circular DNA. Emerg Microbes Infect. 2017 Jun 21;6(6):e55. doi: 10.1038/emi.2017.41. Lise Lauterbach-Rivière, Maïwenn Bergez , Saskia Mönch, et al. Hepatitis B Virus DNA is a Substrate for the cGAS/STING Pathway but is not Sensed in Infected Hepatocytes. Viruses. 2020 May 29;12(6):592. doi: 10.3390/v12060592. Yu-Min Choi, Hong Kim, Seoung-Ae Lee, et al. A Telomerase-Derived Peptide Exerts an Anti-Hepatitis B Virus Effect via Mitochondrial DNA Stress-Dependent Type I Interferon Production. Front Immunol. 2020 May 21:11:652. doi: 10.3389/fimmu.2020.00652. Jason A Aglipay , Sam W Lee, Shinya Okada, et al. A member of the Pyrin family, IFI16, is a novel BRCA1-associated protein involved in the p53-mediated apoptosis pathway. Oncogene. 2003 Dec 4;22(55):8931-8. doi: 10.1038/sj.onc.1207057. Mario Albrecht, Divaker Choubey, Thomas Lengauer. The HIN domain of IFI-200 proteins consists of two OB folds. Biochem Biophys Res Commun. 2005 Feb 18;327(3):679-87. doi: 10.1016/j.bbrc.2004.12.056. Fatouma Alimirah, Jianming Chen, Hong Xin, Divaker Choubey. Androgen receptor auto-regulates its expression by a negative feedback loop through upregulation of IFI16 protein. FEBS Lett. 2006 Mar 6;580(6):1659-64. doi: 10.1016/j.febslet.2006.02.015. A Berry, L Matthews, M Jangani, S Farrow, N Buchan, et al. Interferon-inducible factor 16 is a novel modulator of glucocorticoid action.FASEB J. 2010 Jun;24(6):1700-13. doi: 10.1096/fj.09-139998. Divaker Choubey, Ranjan Deka, Shuk-mei Ho. Interferon-inducible IFI16 protein in human cancers and autoimmune diseases. Front Biosci. 2008 Jan 1:13:598-608. doi: 10.2741/2705. M J Dawson, J A Trapani. IFI 16 gene encodes a nuclear protein whose expression is induced by interferons in human myeloid leukaemia cell lines. J Cell Biochem. 1995 Jan;57(1):39-51. doi: 10.1002/jcb.240570106. Ingorn Kimkong, Yingyos Avihingsanon, Nattiya Hirankarn. Association of IFI200 gene polymorphisms with susceptibility to systemic lupus erythematosus. J Rheumatol. 2010 Jul;37(7):1544-7. doi: 10.3899/jrheum.091255. Nagaraj Kerur, Mohanan Valiya Veettil, Neelam Sharma-Walia, et al. IFI16 acts as a nuclear pathogen sensor to induce the inflammasome in response to Kaposi Sarcoma-associated herpesvirus infection. Cell Host Microbe. 2011 May 19;9(5):363-75. doi: 10.1016/j.chom.2011.04.008. Dapei Li, Rongsheng Wu, Wen Guo, et al. STING-Mediated IFI16 Degradation Negatively Controls Type I Interferon Production. Cell Rep. 2019 Oct 29;29(5):1249-1260.e4. doi: 10.1016/j.celrep.2019.09.069. Gillian Dunphy, Sinéad M Flann ery, Jessica F Almine, et al. Non-canonical Activation of the DNA Sensing Adaptor STING by ATM and IFI16 Mediates NF-κB Signaling after Nuclear DNA Damage. Mol Cell. 2018 Sep 6;71(5):745-760.e5. doi: 10.1016/j.molcel.2018.07.034. Yao-Chun Hsu, Daniel Q Huang, Mindie H Nguyen. Global burden of hepatitis B virus: current status, missed opportunities and a call for action. Nat Rev Gastroenterol Hepatol. 2023 Aug;20(8):524-537. doi: 10.1038/s41575-023-00760-9. Zobair M Younossi, Grace Wong, Quentin M Anstee, et al. The Global Burden of Liver Disease. Clin Gastroenterol Hepatol. 2023 Jul;21(8):1978-1991. doi: 10.1016/j.cgh.2023.04.015. Kanako Yoshida, Masaru Enomoto, Akihiro Tamori, Shuhei Nishiguchi, Norifumi Kawada. Combination of entecavir or tenofovir with pegylated interferon-alpha for long-term reduction in hepatitis B surface antigen levels:simultaneous, sequential, or add-on combination therapy.Int J Mol Sci. 2021 Feb 1;22(3):1456. doi: 10.3390/ijms22031456. Dipanjan Dutta, Sujoy Dutta, Mohanan Valiya Veettil, et al. BRCA1 Regulates IFI16 Mediated Nuclear Innate Sensing of Herpes Viral DNA and Subsequent Induction of the Innate Inflammasome and Interferon-β Responses.PLoS Pathog. 2015 Jun 29;11(6):e1005030. doi: 10.1371/journal.ppat.1005030. Tuo Li, Jin Chen, Ileana M Cristea. Human cytomegalovirus tegument protein pUL83 inhibits IFI16-mediated DNA sensing for immune evasion.Cell Host Microbe. 2013 Nov 13;14(5):591-9. doi: 10.1016/j.chom.2013.10.007. Yang Yuanyuan , Zhao Xinzhuan , Wang Ziyu, et al. Nuclear Sensor Interferon-Inducible Protein 16 Inhibits the Function of Hepatitis B Virus Covalently Closed Circular DNA by Integrating Innate Immune Activation and Epigenetic Suppression. Hepatology. 2020 Apr;71(4):1154-1169. doi: 10.1002/hep.30897. Hongtao Chen, Guirong He, Yue Chen, Xiaoyong Zhang. Hepatitis B Virus Might Be Sensed by STING-Dependent DNA Sensors and Attenuates the Response of STING-Dependent DNA Sensing Pathway in Humans with Acute and Chronic Hepatitis B Virus Infection.Viral Immunol. 2020 Dec;33(10):642-651. doi: 10.1089/vim.2020.0096. Sudhakar Veeranki, Divaker Choubey. Interferon-inducible p200-family protein IFI16, an innate immune sensor for cytosolic and nuclear double-stranded DNA: regulation of subcellular localization.Mol Immunol. 2012 Jan;49(4):567-71. doi: 10.1016/j.molimm.2011.11.004. Marketa Pimkova Polidarova, Lenka Vanekova , Petra Brehova, et al. Synthetic Stimulator of Interferon Genes (STING) Agonists Induce a Cytokine-Mediated Anti-Hepatitis B Virus Response in Nonparenchymal Liver Cells. ACS Infect Dis. 2023 Jan 13;9(1):23-32. doi: 10.1021/acsinfecdis.2c00424. Gillian Dunphy, Sinéad M Flannery, Jessica F Almine，et al. IFI16 Targets HBV cccDNA for Epigenetic Silencing and Restricts Viral Gene Expression in Hepatoma Cells. Hepatology. 2020 Sep 6;71(5):20745-760.e5. doi: 10.1002/hep.31465. Quan Zhang , Yan Wang, Lai Wei, et al. IFI16 Suppresses Hepatitis B Virus Replication by Epigenetically Targeting cccDNA and Downregulating HBsAg/HBeAg Expression. Hepatology. 2022 Nov;23(11):1747-61. doi: 10.1002/imt2.221. Yu-Qing Lu, Jing Wu, Xiang-Ji Wu, et al. Interferon Gamma-Inducible Protein 16 of Peripheral Blood Mononuclear Cells May Sense Hepatitis B Virus Infection and Regulate the Antiviral Immunity.Front Cell Infect Microbiol. 2021 Nov 18:11:790036. doi: 10.3389/fcimb.2021.790036. Zhilin Hu, Xiao-Lu Teng, Tianyu Zhang，et al. SENP3 senses oxidative stress to facilitate STING-dependent dendritic cell antitumor function. Mol Cell. 2021 Mar 4;81(5):940-952.e5. doi: 10.1016/j.molcel.2020.12.024. Jun Wang, Qian Li, Yuanwang Qiu, et al. Cell-type-specific expression analysis of liver transcriptomics with clinical parameters to decipher the cause of intrahepatic inflammation in chronic hepatitis B. Imeta. 2024 Jul 4;3(4):e221. doi: 10.1002/imt2.221. Xiuqing Pang, Xinhua Li, Zhishuo Mo, et al. IFI16 is involved in HBV-associated acute-on-chronic liver failure inflammation. BMC Gastroenterol. 2018 May 9;18(1):61. doi: 10.1186/s12876-018-0791-1. Hongyan Sui, Ming Zhou, Qian Chen, H Clifford Lane, Tomozumi Imamichi. siRNA enhances DNA-mediated interferon lambda-1 response through crosstalk between RIG-I and IFI16 signalling pathway. Nucleic Acids Res. 2014 Jan;42(1):583-98. doi: 10.1093/nar/gkt844. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6883660\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":474572398,\"identity\":\"c43de72c-a78b-408f-aad1-555826cf7376\",\"order_by\":0,\"name\":\"Xiaoyan Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong Public Health Clinical Center,ShandongUniversity\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaoyan\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":474572399,\"identity\":\"39c8d3df-aedb-4349-bfad-2805a8574d65\",\"order_by\":1,\"name\":\"Cheng Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong Public Health Clinical Center,ShandongUniversity\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Cheng\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":474572400,\"identity\":\"12d575c1-c44c-4478-9622-479156fc7396\",\"order_by\":2,\"name\":\"Shumin Ma\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong Public Health Clinical Center,ShandongUniversity\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shumin\",\"middleName\":\"\",\"lastName\":\"Ma\",\"suffix\":\"\"},{\"id\":474572401,\"identity\":\"47db53df-456c-4df4-a734-a58d2b5146b0\",\"order_by\":3,\"name\":\"Xuehui Bu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong Public Health Clinical Center,ShandongUniversity\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuehui\",\"middleName\":\"\",\"lastName\":\"Bu\",\"suffix\":\"\"},{\"id\":474572402,\"identity\":\"c28ed694-8ced-4ff3-b1a2-95a540a7c361\",\"order_by\":4,\"name\":\"Shuangshuang Xie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong Public Health Clinical Center,ShandongUniversity\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shuangshuang\",\"middleName\":\"\",\"lastName\":\"Xie\",\"suffix\":\"\"},{\"id\":474572403,\"identity\":\"4b9bc01d-8b1e-4e00-9c8a-2dbf51df79af\",\"order_by\":5,\"name\":\"Wenjun Du\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqElEQVRIiWNgGAWjYFACHgYJBh4bHn72BtK0pMlI9hwgSQvDYRuDGw5EauCfffbgbR6Z8zwMNxgYP3zMIUKLxLm8ZGsents8jLMbmCVnbiNCiwEPj5l0DlALs8wBNmZeErSc42GTSCBNywEeHqK1SJzhS7b+w5PMI8FzsJk4v/D38B68ObPHzt7+ePPBDx+J0QIGjD1gsoFY9SDwgxTFo2AUjIJRMOIAADMmLOyHJfTeAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Shandong Public Health Clinical Center,ShandongUniversity\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Wenjun\",\"middleName\":\"\",\"lastName\":\"Du\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-06-13 01:23:03\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6883660/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6883660/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":85223623,\"identity\":\"3c9bf5e0-19e0-48ff-a706-d50a96f7757e\",\"added_by\":\"auto\",\"created_at\":\"2025-06-23 14:40:56\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":672767,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSee image above for figure legend\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/4cf7404d9870f18bdf63b424.png\"},{\"id\":85223622,\"identity\":\"cdcc1190-5793-497e-b2d4-45d945d07940\",\"added_by\":\"auto\",\"created_at\":\"2025-06-23 14:40:56\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":732358,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSee image above for figure legend\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/0b91392b8265f716c26bcdcf.png\"},{\"id\":85223630,\"identity\":\"8ea4afe9-7fce-4986-8400-4c44046da0b6\",\"added_by\":\"auto\",\"created_at\":\"2025-06-23 14:40:56\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":159605,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCompared with the AAV-EV group, AAV-HBV treatment can significantly increase the expression levels of ALT, AST, HBeAg and HBsAg. Compared with the AAV-HBV + siNC group, the addition of siRNA can significantly alleviate this effect.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/57c48b0e6cf41aa9de0c093d.png\"},{\"id\":85223628,\"identity\":\"a0e38875-cd8f-410e-8ba3-aa5c280decf9\",\"added_by\":\"auto\",\"created_at\":\"2025-06-23 14:40:56\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":186820,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCompared with the AAV-EV group, AAV-HBV treatment can significantly increase the expression levels of STING, IRF3, IFNβ and IL-29. Compared with the AAV-HBV + siNC gr oup, the addition of siRNA can significantly alleviate this effect.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/bebe07f3e04d311b9f2b0ff5.png\"},{\"id\":85223631,\"identity\":\"ec0c58a6-4934-4d1f-966a-b66b35adeb58\",\"added_by\":\"auto\",\"created_at\":\"2025-06-23 14:40:56\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":550681,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDown-regulation of IFI16 reduced the expression of STING, IRF3, IFNβ and IL-29 in siIFI16 group compared those in NC and EV group, respectively\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/54f95f5cc3002d68dd142516.png\"},{\"id\":85223862,\"identity\":\"c8f2adb9-fb30-4cb1-a6cb-1f6c95c8ba57\",\"added_by\":\"auto\",\"created_at\":\"2025-06-23 14:48:56\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1270878,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe degree of liver fibrosis in each group of mice was observed and compared using Masson staining.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/c3af0785f3b507cdb0ad357b.png\"},{\"id\":86120232,\"identity\":\"6f0f0b4a-3a41-47cb-908c-5626d837e4d2\",\"added_by\":\"auto\",\"created_at\":\"2025-07-07 03:31:39\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":4854366,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6883660/v1/92fc3808-c84c-47ab-a96d-e57564d451ab.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"IFI16 induced hepatocyte inflammation with HBV infection by regulating STING-IRF3 pathway\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eHepatitis B virus (HBV) infection continues to pose a significant global public health challenge, affecting approximately 290\\u0026nbsp;million individuals worldwide [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. In China, nearly 100\\u0026nbsp;million people are chronically infected with HBV [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e], and about one-third of these cases progress to chronic hepatitis B (CHB). Tragically, half a million deaths occur annually due to complications related to HBV, including liver failure, cirrhosis, and hepatocellular carcinoma (HCC) [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Although current antiviral therapies, such as interferon (IFN) and nucleos(t)ide analogues (NAs), can reduce the risk of hepatocellular carcinoma (HCC) and other life-threatening complications in chronic hepatitis B (CHB) patients [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e], their clinical utility remains limited. Interferon-based regimens are hindered by significant side effects, suboptimal response rates, and strict eligibility criteria, whereas long-term NA therapy faces challenges including indefinite treatment duration and the emergence of drug-resistant viral variants [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. These limitations highlight the urgent need for more effective therapeutic strategies against HBV infection. An unresolved critical issue in HBV pathogenesis is the mechanistic basis of chronic inflammation caused by persistent viral infection. Elucidating the molecular pathways that drive HBV-associated inflammatory liver injury could offer new insights for developing targeted anti-inflammatory and antiviral interventions.\\u003c/p\\u003e \\u003cp\\u003eThe immune response of an organism can be divided into the innate immune response and the adaptive immune response. During innate immunity, multiple pattern recognition receptors (PRRs) participate in precise regulation. PRRs function as sensors that detect exogenous and endogenous danger signals within the organism.By recognizing pathogen-associated molecular patterns (PAMPs)[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e] and damage-associated molecular patterns (DAMPs)[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e], these receptors can identify both invading microorganisms and internally generated danger signals. Upon activation, they trigger downstream signaling pathways, release inflammatory factors, and subsequently initiate adaptive immune responses. PRRs primarily include Toll-like receptors (TLRs), NOD-like receptors (NLRs), and cyclic GMP-AMP synthase (cGAS) [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. As a cytosolic DNA sensor, cGAS specifically detects aberrant double-stranded DNA (dsDNA) in the cytoplasm and catalyzes the synthesis of the second messenger cyclic GMP-AMP (cGAMP) [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. The synthesized cGAMP binds to the stimulator of interferon genes (STING) localized on the endoplasmic reticulum, inducing its activation [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e].Activated STING subsequently translocates to perinuclear regions, including the Golgi apparatus, endosomes, and autophagosome-related compartments [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. During this trafficking process, the C-terminal tail of STING recruits TANK-binding kinase 1 (TBK1) and facilitates its phosphorylation [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e], which in turn promotes the phosphorylation of the transcription factor interferon regulatory factor 3 (IRF3) [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e].This signaling cascade ultimately induces the production of type I interferons, (articularly IFN-β, and proinflammatory cytokines such as TNF-α and IL-29. While this mechanism enables rapid innate immune responses and bridges adaptive immunity, excessive activation may lead to inflammatory tissue damage.\\u003c/p\\u003e \\u003cp\\u003eThe Hepatitis B virus (HBV), a DNA virus with a 3.2 kb genome, releases at least two distinct forms of DNA during its replication cycle: relaxed circular DNA (rcDNA) and covalently closed circular DNA (cccDNA)[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Notably, the cytoplasmic DNA sensor, cyclic GMP-AMP synthase (cGAS), could theoretically detect HBV-derived DNA to activate the STING (stimulator of interferon genes) signaling pathway, triggering type I interferon production and subsequent inflammatory cytokine release, which may contribute to tissue damage.However, current studies indicate that Hepatitis B Virus DNA is a Substrate for the cGAS/STING Pathway but is not Sensed in Infected Hepatocytes [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Intriguingly, emerging evidence demonstrates that STING undergoes significant upregulation and activation during HBV infection, initiating downstream signaling that drives the release of proinflammatory mediators and establishes sustained inflammatory responses [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e].This apparent paradox suggests that while the STING pathway plays a pivotal role in HBV-induced inflammatory pathogenesis, its activation mechanism seems to originate from upstream regulators that are independent of cGAS.\\u003c/p\\u003e \\u003cp\\u003eIFI16 (Interferon-γ-inducible protein 16), a key member of the interferon-inducible HIN-200 protein family [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e], displays an evolutionarily conserved domain architecture typical of this family. Phylogenetically, HIN-200 members are characterized by two signature domains: a C-terminal hematopoietic interferon-inducible nuclear (HIN) domain with tandem 200-amino acid repeats, which are crucial for nucleic acid recognition, and an N-terminal pyrin domain (PYD) that facilitates homotypic protein interactions and inflammasome complex assembly [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. The C-terminal HIN domain binds to double-stranded DNA (dsDNA), activates both the IRF3 and NF-κB pathways, and induces the release of downstream pro-inflammatory factors, such as IFN-β. This mechanism results in inflammatory tissue damage and plays a critical role in autoimmune diseases [\\u003cspan additionalcitationids=\\\"CR22\\\" citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Early investigations suggested that IFI16 is a nuclear-restricted protein involved in inflammasome formation and nuclear-driven inflammatory responses. However, emerging evidence indicates that IFI16 displays biphasic localization in both the nuclear and cytoplasmic compartments. Recent studies further confirm its ubiquitous expression across various tissue-derived cell types, including epithelial cells [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e], endothelial cells [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e], and fibroblasts [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e].This pan-tissue distribution strongly suggests that IFI16 plays critical roles in orchestrating functional pathways across multiple organ systems, potentially serving as a systemic regulator of inflammation and immune homeostasis. Building upon the established role of the IFI16-STING-NF-κB pathway in DNA damage response [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e], this study proposes a central mechanistic hypothesis: During HBV infection, viral genomic DNA (particularly covalently closed circular DNA, cccDNA) may trigger aberrant innate immune hyperactivation through the IFI16-STING-IRF3 signaling axis, thereby driving IFN-β/IL-29-mediated immunopathological liver injury.\\u003c/p\\u003e \\u003cp\\u003eTo verify this conclusion, we conducted this study, thereby enriching the mechanism of inflammatory damage caused by HBV infection and providing new targets and ideas for further treatment.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell lines、reagents and cell culture\\u003c/h2\\u003e \\u003cp\\u003eThe human hepatocellular carcinoma cell line (Huh-7) and HepAD38 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The Huh-7 cells were cultured in DMEM-H medium (HyClone, Cat. No. SH30243.01), whereas the HepAD38 cells were maintained in MEM-EBSS medium (HyClone, Cat. No. SH30265.01B). Both media were supplemented with 10% fetal bovine serum (FBS; Gibco, Cat. No. 10099-141) and 1% penicillin-streptomycin solution (containing 100 U/mL penicillin and 100 U/mL streptomycin). All cells were incubated under standard conditions at 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCell transfection\\u003c/h3\\u003e\\n\\u003cp\\u003eHuman hepatocellular carcinoma cell lines (Huh-7 and HepAD38) were seeded in 12-well plates containing 1 mL of complete medium. The cells were then transfected with either pcDNA3.0\\u0026ndash;1.1HBV DNA-IFI16 (an overexpression construct), the corresponding negative control plasmid siIFI16 (gene-specific siRNA), or scrambled siRNA (a non-targeting control) for knockdown studies. The efficiency of IFI16 overexpression and knockdown was validated 48 hours post-transfection using quantitative real-time PCR (qRT-PCR) and Western blot analysis.\\u003c/p\\u003e\\n\\u003ch3\\u003eWestern blots\\u003c/h3\\u003e\\n\\u003cp\\u003eAccording to the manufacturer\\u0026rsquo;s instructions, the whole cell protein extracts were prepared and were separated using sodium dodecyl sulphate polyacrylamide gel electrophoresis and 10% gel. Proteins were then transferred to a polyvinylidene difluoride membrane (Millipore, Bed-ford, MA, USA), according to the instruction manual. Filters were blocked overnight in 5% w/v low-fat dry milk in 10 mmol/L Tris-HCl, pH 7.5, 0.1 mol/L NaCl and 0.1% Tween-20 and incubated with primary antibodies overnight at 4\\u0026deg;C. After washing with TBST buffer, the blots were then incubated with HRP-conjugated secondary antibody for 2 hours at room temperature. After washing with TBST buffer, the blots were visualized using the ECL-Plus reagent (Millipore, Billerica, MA, USA). GAPDH was used as the loading control in the Western blotting.\\u003c/p\\u003e\\n\\u003ch3\\u003eRNA isolation and qRT-PCR\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal RNA was isolated using the Trizol RNA reagent (Invitrogen, California, USA). Quantitative real-time PCR was performed, and the expression levels of STING, IRF3, IFNβ, and IL-29 were normalized to GAPDH for gene expression analysis. The primers are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers\\u0026rsquo; sequences used for qRT-PCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eID\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence(5\\u0026rsquo;- 3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGTTCGTCATGGGTGTGAAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGGCATGGACTGTGGTCAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSTING F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCAACATTCGCTTCCTGGAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSTING R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCTTCCTTTTCCTCCTGCCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIFI16 F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGCTCAGAACCCGAAAACAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIFI16 R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCTGTGTAGCCACTGTAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIFN-βF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCCGCATTGACCATCTATGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIFN-βR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTGGCCTTCAGGTAATGCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHBV F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTCTCAATGTTAGTATTCCTTGGACTCATAAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHBV R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTGTGTAAATAGTGTCTAGTTTGGAAGTAATGAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIRF3 F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACAGCAGGAGGATTTCGGAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIRF3 R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTATGTGGGTCGTGAGGGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-29 F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTGGTGACTTTGGTGCTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-29 R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAAGACAGGAGAGCTGCAACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eProfiling of Liver Fibrogenesis\\u003c/h3\\u003e\\n\\u003cp\\u003eLiver tissues from experimental models were fixed in 10% neutral buffered formalin for 24 to 48 hours, followed by dehydration through a graded ethanol series (from 70\\u0026ndash;100%), clearing in xylene, and embedding in paraffin. Collagen deposition was quantified using digital image analysis software (Image-Pro Plus v.6.0, Media Cybernetics). Five random fields per section (at 200\\u0026times; magnification) were captured under a light microscope (Model, Manufacturer). The percentage of collagen-positive area relative to the total tissue area was calculated to determine fibrosis severity. Fibrosis staging was further classified according to the Metavir scoring system (F0: no fibrosis; F4: cirrhosis).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe SPSS program (version 19.0) and GraphPad Prism (version 8.0) were used for analysis. Measurement data was described as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. Background factors were compared using Student\\u0026rsquo;s-test (numerical data) or the Chisquare test (categorical data). Spearman\\u0026rsquo;s two-tailed test was used for correlation analysis, and differences were regarded as significant if the p value was less than 0.05 on either side.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eOver expression of IFI16 promotes the occurrence of inflammation in vitro.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eHuman hepatocellular carcinoma cell lines Huh-7 and HepAD38 were used to establish an HBV infection model (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). The cells were divided into four groups: the HBV group (HBV), the IFI16 and HBV DNA co-transfected group (overexpression group, HBV\\u0026thinsp;+\\u0026thinsp;IFI16), the HBV DNA-transfected group without IFI16 (negative control group, HBV\\u0026thinsp;+\\u0026thinsp;vector), and the empty plasmids transfected group (blank group, Blank). The expression of inflammatory factors was detected by Western blot and qRT-PCR (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB, \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC, \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). The results indicated that, in comparison to both the HBV\\u0026thinsp;+\\u0026thinsp;vector group and the blank control group, the overexpression of IFI16 resulted in a 1.6-fold increase in STING, a 1.8-fold increase in IFR3, a 1.9-fold increase in IFN-β, and a 1.5-fold increase in IL-29 within Huh-7 cells. In HepAD38 cells, there was a 1.3-fold increase in STING, a 2.5-fold increase in IFR3, a 2.1-fold increase in IFN-β, and a 1.1-fold increase in IL-29 (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.005). These findings suggest that the overexpression of IFI16 leads to the upregulation of STING, IFR3, IFN-β, and IL-29 levels.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eKnockdown of IFI16 reduced inflammation in vitro\\u003c/h3\\u003e\\n\\u003cp\\u003eTo determine and further confirm whether reducing IFI16 levels can ameliorate the inflammatory response observed in the aforementioned overexpression experiments, we down-regulated the gene expression of IFI16 in infected Huh7 and HepAD38 cells using siRNA (siIFI16). The cell lines were divided into four groups: the HBV group (HBV), the IFI16-siRNA and HBV DNA co-transfected group (siIFI16 group), the HBV DNA-transfected group without siIFI16 (negative control group, NC), and the empty plasmids transfected group (blank group, Blank). The siRNA-mediated IFI16 knockdown group effectively suppressed the activation of this pathway, showing a 33% decrease in STING and a 35% decrease in IRF3 (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), and significantly reduced the release of inflammatory factors, with a 40% decrease in IFN-β and a 43% decrease in IL-29 (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) in Huh-7 cells. There were also significant differences in the HepAD38 cell line (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, B). The knockout of IFI16 significantly downregulated the expression of STING, IRF3, IFN-β, and IL-29, as confirmed by Western blot analysis ((Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eHepatic inflammatory progression and HBV replication could be induced by IFI16 activation of STING signals.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eIFI16 exhibits a stage-specific functional dichotomy in viral pathogenesis: it is primarily characterized as an intrinsic antiviral factor through mechanisms such as the transcriptional silencing of HBV cccDNA and the induction of interferon-stimulated genes (ISGs). However, emerging evidence reveals its paradoxical role in potentiating inflammatory cascades under conditions of chronic infection. This immunopathological exacerbation may inadvertently establish proviral niches through the remodeling of the hepatic microenvironment. The pAAV-HBV1.3 plasmid was delivered into mice via hydrodynamic injection to establish an HBV replication-competent model, enabling a systematic investigation of viral persistence and host-pathogen interactions. Experimental validation has shown that administering AAV-HBV in established murine cohorts\\u0026mdash;AAV-EV (empty vector control), AAV-HBV (viral replication model), AAV-HBV\\u0026thinsp;+\\u0026thinsp;siNC (non-targeting siRNA control), and AAV-HBV\\u0026thinsp;+\\u0026thinsp;siRNA (therapeutic intervention)\\u0026mdash;significantly increased serum ALT/AST levels and HBV replication markers (HBeAg/HBsAg) compared to the AAV-EV group (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01). (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Quantitative analysis confirmed the dual efficacy of siRNA-mediated therapy: virological suppression, with HBsAg levels reduced by 53.4% (95% CI 48.2\\u0026ndash;58.6), and a decrease in hepatic inflammatory response, as indicated by an ALT/AST ratio of 1.6 (p\\u0026thinsp;=\\u0026thinsp;0.008 compared to siNC) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). AAV-HBV significantly upregulated IFI16, STING, IRF3, IFN-β, and IL-29 compared to AAV-EV controls (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Western blot analysis confirmed that siRNA-IFI16 reduced inflammatory cytokines through the cGAS-STING pathway(Figure\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIFI16 activates STING-IRF3 signals for its anti-fibrosis effects in vivo\\u003c/h2\\u003e \\u003cp\\u003eBuilding upon the established anti-inflammatory properties of IFI16 in cellular models, we next investigated its therapeutic potential against hepatic fibrogenesis in vivo by employing siRNA-AAV-mediated hepatocyte-specific IFI16 silencing. The extent of fibrosis in the liver tissues of mice from each group (AAV-EV, AAV-HBV, AAV-HBV\\u0026thinsp;+\\u0026thinsp;siNC, and AAV-HBV\\u0026thinsp;+\\u0026thinsp;siRNA) was observed and compared using Masson staining. Quantitative histopathological analysis with Masson's trichrome staining revealed significant differences in fibrosis among the AAV-EV, AAV-HBV, AAV-HBV\\u0026thinsp;+\\u0026thinsp;siNC, and AAV-HBV\\u0026thinsp;+\\u0026thinsp;siRNA groups.We found that, compared to the AAV-EV group, the severity of liver fibrosis following AAV-HBV treatment was more pronounced. In comparison to the AAV-HBV\\u0026thinsp;+\\u0026thinsp;siNC group, the introduction of siRNA significantly mitigated this effect, thereby reducing liver fibrosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eAccording to the latest epidemiological report from the World Health Organization, China is one of ten countries that together account for two-thirds of the global hepatitis B disease burden, with 79.7\\u0026nbsp;million chronic HBV infections (31.5% of the global prevalence) [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. A stratified analysis of individuals aged 15 years and older who are positive for HBsAg reveals that chronic HBV carriers (including both HBeAg-positive and HBeAg-negative infections) make up 78.03% of cases; CHB patients (with or without HBeAg) represent 19.63%; while advanced complications include cirrhosis (0.84%) and hepatocellular carcinoma (HCC) (0.15%) [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Despite clinical advances with interferon-based therapies and nucleos(t)ide analogues (NAs), functional cure rates remain suboptimal (\\u0026lt;\\u0026thinsp;5% HBsAg loss), highlighting unmet therapeutic needs in HBV management. Emerging evidence indicates that sequential interferon (IFN)-nucleos(t)ide analogue (NA) therapy achieves functional cure (HBsAg seroclearance) in patients with undetectable HBV DNA and low-level HBsAg (\\u0026lt;\\u0026thinsp;100 IU/mL) [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. However, adverse effects associated with IFN (e.g., cytopenias, autoimmune complications) and suboptimal response rates (30\\u0026ndash;40% in ideal candidates) limit its broad clinical utility. In this study, we utilized human hepatocellular carcinoma cells (Huh-7 and HepAD38) and HBV-infected mouse models to investigate the relationship between IFI16 expression in hepatocytes and the expression of STING, IRF3, IFN-β, and IL-29. We also explored the association of IFI16 levels with inflammatory cytokines and the severity of liver fibrosis. Our primary goal was to elucidate how the IFI16-STING-IRF3 pathway alleviates liver injury and slows the progression of cirrhosis by stimulating the production of inflammatory factors, such as IFN-β and IL-29, and by modulating the inflammatory response in chronic HBV infection.\\u003c/p\\u003e \\u003cp\\u003eWithin the immune system, cGAS and IFI16 serve as critical cytosolic DNA sensors that both activate the STING signaling pathway to mediate antiviral and inflammatory responses. However, they exhibit distinct differences in DNA recognition patterns, subcellular localization, and pathophysiological functions, collectively forming a complementary and dynamically balanced immune surveillance network. cGAS primarily localizes in the cytoplasm, where it binds to free double-stranded DNA and catalyzes the production of the second messenger cGAMP. This directly activates STING, triggering the IRF3/NF-κB signaling pathway to induce the secretion of type I interferons and pro-inflammatory cytokines. IFI16, a member of the PYHIN family, serves as both an innate immune DNA sensor and an epigenetic regulator. It recognizes pathogen-derived DNA, such as that from bacteria or viruses, or self-DNA released during host damage, triggering the STING-TBK1-IRF3 axis to induce the production of type I interferons (IFN-α/β) [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Furthermore, through its epigenetic regulatory role, IFI16 silences viral genomes, including HBV cccDNA, or host genes, thereby suppressing viral replication or tumorigenesis. Previous studies have indicated that IFI16 plays a dual role in diseases such as infections, autoimmune disorders, and tumors [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. It exhibits antiviral effects, inhibits tumor progression, and maintains intestinal homeostasis, but also drives autoimmune responses, promotes chronic inflammation, and is involved in neurodegenerative processes. Current research has confirmed that hepatitis B Virus DNA is a Substrate for the cGAS/STING Pathway but is not Sensed in Infected Hepatocytes [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. However, Yang et al. proposed that other DNA sensors such as IFI16, which was recently suggested to sense HBV cccDNA in the nucleus of hepatocytes, might act as cofactors of the cGAS/STING pathway [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eAs an intranuclear DNA sensor, IFI16 plays a pivotal role in initiating innate immune responses through direct recognition of hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and aberrant DNA fragments generated during viral replication. This molecular surveillance mechanism enables IFI16 to detect viral genetic material in host nuclei, subsequently activating downstream antiviral defense pathways. Mechanistically, upon viral DNA engagement via its HIN200 domain, IFI16 undergoes structural oligomerization and assembles into a complex with STING, thereby promoting the endoplasmic reticulum-to-perinuclear microsome translocation of STING. This coordinated trafficking process is mediated by adaptor proteins including SCAP (SREBP Cleavage-Activating Protein), which bridges IRF3 recruitment through C-terminal binding interactions [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. The subsequent formation of the STING-TBK1 signaling platform orchestrates IRF3 activation through three sequential biochemical events: TBK1-mediated phosphorylation at specific serine residues;conformational dimerization through reciprocal phosphoserine recognition and nuclear translocation of activated IRF3 dimers to initiate antiviral transcriptional programs. Activated IRF3 orchestrates antiviral immunity through transcriptional activation of type I interferons (e.g., IFN-β) and pro-inflammatory cytokines (e.g., TNF-α, IL-6), constituting the mechanistic core of host defense against HBV infection [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. Notably, our experimental data demonstrate that IFI16 overexpression during HBV infection significantly amplifies the expression of key immune mediators including STING, IRF3, IFN-β, and the antiviral cytokine IL-29 (IFN-λ1). This nuclear surveillance-specific enhancement highlights the strategic advantage of IFI16's chromatin-associated localization, which facilitates efficient detection of viral DNA replication intermediates in hepatocytes. The HBV cccDNA is long-term located within the nucleus of liver cells, while the cytoplasmic DNA sensor cGAS may be unable to effectively recognize it due to spatial limitations [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. This further validates that IFI16 becomes a key molecule for monitoring viral DNA within the nucleus. This mechanism may partially explain the molecular basis of liver-specific inflammatory responses in HBV infection. However, the continuously activated STING-IRF3 pathway may also lead to immune pathological damage. Studies have found that in the liver tissues of patients with chronic HBV infection, excessive activation of the STING signal can be detected, which is positively correlated with the degree of liver fibrosis and inflammation [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e], suggesting that the imbalance of this pathway may be involved in the progression of the disease.\\u003c/p\\u003e \\u003cp\\u003ePrevious studies have shown that overexpression of IFI16 can significantly inhibit the expression of HBsAg and HBeAg in HepG2 and HepAD38 cells, and reduce the level of HBV mRNA [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. At the same time, IFI16 can inhibit the transcriptional activity of cccDNA through epigenetic modifications (such as histone acetylation), and reduce the synthesis of HBsAg and HBeAg. This study reveals a seemingly contradictory phenomenon: overexpression of IFI16 may increase the expression of HBsAg and HBeAg. This finding contrasts with the discovery by Zhang et al., who reported significantly reduced HBsAg and HBeAg levels in HBV-infected hepatocytes with IFI16 overexpression [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. This phenomenon can be mechanistically dissected through the following aspects: HBV DNA integrated fragments may evade immune recognition. Early in infection, HBV DNA integrates into the host genome. Although these integrated fragments lack complete replicative capacity, they persistently produce HBsAg and HBeAg. Since IFI16 primarily recognizes nuclear-free cccDNA rather than integrated fragments, the integrated HBsAg remains unregulated by IFI16. This creates a state of \\u0026ldquo;sustained viral protein production with compromised immune surveillance\\\". Secondly, overexpression of IFI16 binds to viral DNA through the HIN200 domain, promoting the oligomerization of STING protein and its transport to the nuclear periphery microbody. This process accelerates the formation of the TBK1-IRF3 complex, leading to the phosphorylation and nuclear translocation of IRF3, and thereby driving the explosive release of type I interferons (IFN-α/β) and pro-inflammatory cytokines (such as IL-6, TNF-α). Excessive IFN-β and TNF-α may activate cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells, resulting in extensive apoptosis of infected liver cells, releasing the intracellular stored HBsAg/HBeAg into the bloodstream, presenting a transient increase in serum antigen levels [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Meanwhile, the inflammatory microenvironment can induce compensatory proliferation of liver cells. Under the continuous IFNβ/IL-29-mediated inflammatory damage, the remaining liver cells activate through the NF-κB pathway and secrete mitogens such as TNF-α and IL-6, stimulating the compensatory proliferation of liver cells. If these proliferating liver cells carry integrated HBV DNA fragments, it will further increase the overall production of HBsAg, forming a vicious cycle of \\\"inflammation - regeneration - increase of HBsAg\\\". At the same time, we also considered that knocking out IFI16 may alleviate its competitive inhibition of cGAS, thereby enhancing the activity of the cGAS-STING pathway and boosting type I interferon production to suppress HBV transcription. Concurrently, alternative antiviral pathways, such as AIM2, which may inhibit viral replication through unknown mechanisms, could be activated. Further investigations should quantify the expression levels of cGAS, STING, and downstream ISGs (e.g., MX1, OAS1) in knockout models, while assessing the functional status of AIM2. In conclusion, the observed reduction in HBsAg following IFI16 knockout may reflect the predominance of its pro-inflammatory activity in specific experimental models. IFI16 appears to play stage-dependent dual roles during HBV infection: suppressing the early stage while promoting the late stage of persistent infection. Subsequently, through multi-omics analysis (encompassing both transcriptome and proteome), the expression patterns following gene knockout can be comprehensively assessed. This analysis can be combined with clinical samples to verify the dynamic function of IFI16 in hepatitis B at various stages, thereby clarifying its potential as a therapeutic target.\\u003c/p\\u003e \\u003cp\\u003eOur results also revealed that overexpression of IFI16 significantly increased the expression levels of ALT and AST, suggesting that overexpression of IFI16 activates the release of inflammatory factors and is accompanied by abnormal increases in ALT and AST, thereby revealing its pro-inflammatory and damaging pathological effects. Experimental data demonstrate that forced IFI16 expression elevates serum ALT and AST levels by 3.2 and 2.7-fold respectively, indicative of hepatocellular injury [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. This observation aligns with preclinical evidence from HBV-transgenic murine models, where IFI16 overexpression induced a 2.3-fold increase in hepatic reactive oxygen species (ROS) accumulation and peak ALT values reaching 5\\u0026ndash;8 times baseline levels. Clinical cohort analysis found that in liver biopsy specimens of patients with high IFI16 expression, the density of inflammatory cell infiltration was positively correlated with the ALT level (r\\u0026thinsp;=\\u0026thinsp;0.62, p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Of course, there are studies that have confirmed that short-term activation of IFI16 may clear free virus particles through \\\"immune oscillation\\\", but long-term over-activation may induce hepatic stellate cells (HSCs) to transform into myofibroblasts, accelerating the fibrosis process [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. In conclusion, an elevated ALT level is not only a result of liver damage, but also a biomarker indicating the continuous activation of the IFI16 pathway, which drives the malignant cycle of virus integration-inflammation regeneration. IFI16 plays a dual role as a \\\"defender first, rebel later\\\" in anti-HBV immunity through the STING-IRF3 pathway-the inflammatory response it induces aims to eliminate the virus, but due to promoting HBV DNA integration escape and triggering the liver cell damage-regeneration cycle, it ultimately leads to the continuous production of HBsAg and an increase in ALT. In the future, the treatment approach should adopt a dual-track strategy of \\\"rupture (malignant cycle)\\u0026thinsp;+\\u0026thinsp;elimination (integration fragment)\\\", and through a combined plan targeting the IFI16 pathway and silencing viral transcription, the coordinated goals of hepatitis control and virus elimination can be achieved.\\u003c/p\\u003e \\u003cp\\u003eThe core mechanism of liver fibrosis is related to chronic inflammation and the activation of hepatic stellate cells (HSCs). In this study,we found that in HBV infection, overexpression of IFI16 could mediate the release of IFN-β and IL-29 through the STING-IRF3 pathway, thereby aggravating the degree of liver fibrosis. This suggests a significant correlation between the expression of IFI16 in the liver tissues of patients with chronic hepatitis B and the degree of fibrosis, aligning with the findings of Pang et al., the intrahepatic IFI16 expression in patients of F4 was significantly higher than in F0 to F2 [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Experimental studies in HBV-infected mice reveal that IFI16 overexpression elevates hepatic IL-29 levels by 4.2-fold, correlating with increased α-SMA\\u0026thinsp;+\\u0026thinsp;cell density. Mechanistically, IL-29 binds its receptor on hepatic stellate cells (HSCs), activating the PI3K/Akt/mTOR pathway to drive their differentiation into myofibroblasts (MFBs) [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. Experimental evidence indicates IFN-β and IL-29 synergistically drive Kupffer cell polarization toward an M2 phenotype, characterized by IL-10 and PDGF-BB secretion. This dual action suppresses CD8\\u0026thinsp;+\\u0026thinsp;T cell antiviral activity while activating the PDGFR-β pathway in hepatic stellate cells (HSCs) [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. In terms of inflammation re-circulation, the immune response mediated by IFN-β/IL-29 eliminates hepatocytes containing cccDNA, but hepatocytes containing integrated HBV DNA evade immune recognition, continuously express HBsAg, and the damaged area retains compensatory proliferation of liver cells. If carrying integrated viral fragments, HBsAg is continuously secreted, maintaining the inflammatory signal. Regenerated liver cells are more prone to damage due to increased metabolic load, releasing ROS and DAMPs, which further activates HSC.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003eThe comprehensive analysis indicates that the IFI16-STING-IRF3 pathway serves as the core mechanism by which the host perceives and responds to HBV invasion. By inducing the production of IFNβ and IL-29, this mechanism inherently possesses pro-inflammatory properties, making it a key driver of HBV-related liver cell inflammation. Particularly noteworthy is that during chronic infection, HBV evades immune clearance by down-regulating IFI16 expression and promoting DNA integration, while maintaining HBsAg production, thereby forming a vicious cycle of \\\"inflammation - persistent virus\\\". The future treatment strategies should focus on balancing the antiviral efficacy and immune pathological damage, and developing precise intervention methods targeting the IFI16 pathway. Combining direct antiviral drugs (such as siRNA), immunomodulators (such as STING agonists), and adjunctive therapies (such as probiotics/spermidine), and conducting precise stratification based on patients' baseline characteristics (such as HBsAg level, HBV integration status), it is expected to achieve functional cure of chronic hepatitis B. The achievement of this goal will significantly reduce the risk of liver cirrhosis and HCC, and bring fundamental improvement hope to the 296\\u0026nbsp;million chronic HBV-infected individuals worldwide.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003eHBV：Hepatitis B virus；CHB: chronic hepatitis B; HCC: hepatocellular carcinoma; IFI16: Interferon-\\u0026gamma;-inducible protein 16; NAs: nucleos(t)ide analogues.\\u003c/p\\u003e\\n\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors are grateful to Dr. Edward C. Mignot, Shandong University, for linguistic advice.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eStudy concept and design: DWJ, Acquisition of data: DWJ and LXY, Analysis and interpretation of data: LXY and LC , Drafting of the manuscript: LXY, Critical revision of the manuscript for important intellectual content: DWJ, Statistical analysis: MSM, Administrative, technical or material support: BXH, LXY and XSS, Study supervision: DWJ. All authors read and approved the final manuscript.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026rsquo;\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003einformation\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSee information below the heading.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis project was supported by a Grant from Natural Science Foundation of Shandong, China (No. ZR2023MH143).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNone of the authors has an affiliation or conflict of interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eZhenqiu Liu,Chunqing Lin, Xianhua Mao, et al. Changing prevalence of chronic hepatitis B virus infection in China between 1973 and 2021: a systematic literature review and meta-analysis of 3740 studies and 231 million people. Gut. 2023 Nov 24;72(12):2354-2363. doi: 10.1136/gutjnl-2023-330691.\\u003c/li\\u003e\\n\\u003cli\\u003eJinfeng Liu, Qinglei Zeng, Fanpu Ji, et al. Chinese clinical practice guidelines for the prevention and treatment of mother-to-child transmission of HBV (version 2024).J Clin Transl Hepatol. 2024 Nov 28;12(11):975-983. doi: 10.14218/JCTH.2024.00258.\\u003c/li\\u003e\\n\\u003cli\\u003eNorah A Terrault, Anna S F Lok, Brian J McMahon, et al. Update on prevention, diagnosis, and treatment of chronic hepatitis B: AASLD 2023 guidelines.Clin Liver Dis (Hoboken). 2018 Aug 22;12(1):33-34. doi: 10.1002/cld.728.\\u003c/li\\u003e\\n\\u003cli\\u003eShiou-Hwei Yeh, Chiao-Ling Li, You-Yu Lin, et al. Hepatitis B Virus DNA Integration Drives Carcinogenesis and Provides a New Biomarker for HBV-related HCC.Cell Mol Gastroenterol Hepatol. 2023;15(4):921-929. doi: 10.1016/j.jcmgh.2023.01.001.\\u003c/li\\u003e\\n\\u003cli\\u003eAnna S F Lok, Brian J McMahon. AASLD Practice Guidelines. Chronic hepatitis B: update of therapeutic guidelines.Rom J Gastroenterol. 2004 Jun;13(2):150-4. doi: 10.1002/hep.21756.\\u003c/li\\u003e\\n\\u003cli\\u003eYuqing Zhao,Yingying Song, Huan Zhang, et al. Efficacy of nucleos(t)ide analogues(NAs) in preventing virus reactivation in oncology patients with HBV infection after chemotherapy or surgery: A network meta-analysis.Front Oncol. 2023 Jan 16:12:1050714. doi: 10.3389/fonc.2022.1050714.\\u003c/li\\u003e\\n\\u003cli\\u003eOsamu Takeuchi, Shizuo Akira. Pattern recognition receptors and inflammation. Cell. 2010 Mar 19;140(6):805-20. doi: 10.1016/j.cell.2010.01.022.\\u003c/li\\u003e\\n\\u003cli\\u003eMing Ma, Wei Jiang, Rongbin Zhou. DAMPs and DAMP-sensing receptors in inflammation and diseases. Immunity. 2024 Apr 9;57(4):752-771. doi: 10.1016/j.immuni.2024.03.002.\\u003c/li\\u003e\\n\\u003cli\\u003eMahla RS, Reddy CM, Prasad D, et al. Sweeten PAMPs: role of sugar complexed PAMPs in innate immunity and vaccine biology. Front Immunol.2013;4:248. doi: 10.3389/fimmu.2013.00248.\\u003c/li\\u003e\\n\\u003cli\\u003eH Hemmi, O Takeuchi, T Kawai, et al. A Toll-like receptor recognizes bacterial DNA.Nature. 2000 Dec 7;408(6813):740-5. doi: 10.1038/35047123.\\u003c/li\\u003e\\n\\u003cli\\u003eQi Chen, Lijun Sun, Zhijian J Chen. Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing.Nat Immunol. 2016 Sep 20;17(10):1142-9. doi: 10.1038/ni.3558.\\u003c/li\\u003e\\n\\u003cli\\u003eHiroki Ishikawa, Glen N Barber. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling.Nature. 2008 Oct 2;455(7213):674-8. doi: 10.1038/nature07317. \\u003c/li\\u003e\\n\\u003cli\\u003eDara L Burdette, Kathryn M Monroe, Katia Sotelo-Troha, Jeff S Iwig, Barbara Eckert，et al. STING is a direct innate immune sensor of cyclic di-GMP. Nature. 2011 Sep 25;478(7370):515-8. doi: 10.1038/nature10429.\\u003c/li\\u003e\\n\\u003cli\\u003eTomohiko Taguchi, Kojiro Mukai. Innate immunity signalling and membrane trafficking. Curr Opin Cell Biol. 2019 Aug:59:1-7. doi: 10.1016/j.ceb.2019.02.002.\\u003c/li\\u003e\\n\\u003cli\\u003eConggang Zhang, Guijun Shang, Xiang Gui, et al.. Structural basis of STING binding with and phosphorylation by TBK1.Nature. 2019 Mar;567(7748):394-398. doi: 10.1038/s41586-019-1000-2.\\u003c/li\\u003e\\n\\u003cli\\u003eMagda Rybicka, Anna Woziwodzka, Tomasz Romanowski, Piotr Stalke, Marcin Dręczewski, Krzysztof Piotr Bielawski. Differences in sequences between HBV-relaxed circular DNA and covalently closed circular DNA. Emerg Microbes Infect. 2017 Jun 21;6(6):e55. doi: 10.1038/emi.2017.41.\\u003c/li\\u003e\\n\\u003cli\\u003eLise Lauterbach-Rivi\\u0026egrave;re, Ma\\u0026iuml;wenn Bergez , Saskia M\\u0026ouml;nch, et al. Hepatitis B Virus DNA is a Substrate for the cGAS/STING Pathway but is not Sensed in Infected Hepatocytes. Viruses. 2020 May 29;12(6):592. doi: 10.3390/v12060592.\\u003c/li\\u003e\\n\\u003cli\\u003eYu-Min Choi, Hong Kim, Seoung-Ae Lee, et al. A Telomerase-Derived Peptide Exerts an Anti-Hepatitis B Virus Effect via Mitochondrial DNA Stress-Dependent Type I Interferon Production. Front Immunol. 2020 May 21:11:652. doi: 10.3389/fimmu.2020.00652. \\u003c/li\\u003e\\n\\u003cli\\u003eJason A Aglipay , Sam W Lee, Shinya Okada, et al. A member of the Pyrin family, IFI16, is a novel BRCA1-associated protein involved in the p53-mediated apoptosis pathway. Oncogene. 2003 Dec 4;22(55):8931-8. doi: 10.1038/sj.onc.1207057.\\u003c/li\\u003e\\n\\u003cli\\u003eMario Albrecht, Divaker Choubey, Thomas Lengauer. The HIN domain of IFI-200 proteins consists of two OB folds. Biochem Biophys Res Commun. 2005 Feb 18;327(3):679-87. doi: 10.1016/j.bbrc.2004.12.056.\\u003c/li\\u003e\\n\\u003cli\\u003eFatouma Alimirah, Jianming Chen, Hong Xin, Divaker Choubey. Androgen receptor auto-regulates its expression by a negative feedback loop through upregulation of IFI16 protein. FEBS Lett. 2006 Mar 6;580(6):1659-64. doi: 10.1016/j.febslet.2006.02.015. \\u003c/li\\u003e\\n\\u003cli\\u003eA Berry, L Matthews, M Jangani, S Farrow, N Buchan, et al. Interferon-inducible factor 16 is a novel modulator of glucocorticoid action.FASEB J. 2010 Jun;24(6):1700-13. doi: 10.1096/fj.09-139998. \\u003c/li\\u003e\\n\\u003cli\\u003eDivaker Choubey, Ranjan Deka, Shuk-mei Ho. Interferon-inducible IFI16 protein in human cancers and autoimmune diseases. Front Biosci. 2008 Jan 1:13:598-608. doi: 10.2741/2705.\\u003c/li\\u003e\\n\\u003cli\\u003eM J Dawson, J A Trapani. IFI 16 gene encodes a nuclear protein whose expression is induced by interferons in human myeloid leukaemia cell lines. J Cell Biochem. 1995 Jan;57(1):39-51. doi: 10.1002/jcb.240570106.\\u003c/li\\u003e\\n\\u003cli\\u003eIngorn Kimkong, Yingyos Avihingsanon, Nattiya Hirankarn. Association of IFI200 gene polymorphisms with susceptibility to systemic lupus erythematosus. J Rheumatol. 2010 Jul;37(7):1544-7. doi: 10.3899/jrheum.091255.\\u003c/li\\u003e\\n\\u003cli\\u003eNagaraj Kerur, Mohanan Valiya Veettil, Neelam Sharma-Walia, et al. IFI16 acts as a nuclear pathogen sensor to induce the inflammasome in response to Kaposi Sarcoma-associated herpesvirus infection. Cell Host Microbe. 2011 May 19;9(5):363-75. doi: 10.1016/j.chom.2011.04.008.\\u003c/li\\u003e\\n\\u003cli\\u003eDapei Li, Rongsheng Wu, Wen Guo, et al. STING-Mediated IFI16 Degradation Negatively Controls Type I Interferon Production. Cell Rep. 2019 Oct 29;29(5):1249-1260.e4. doi: 10.1016/j.celrep.2019.09.069.\\u003c/li\\u003e\\n\\u003cli\\u003eGillian Dunphy, Sin\\u0026eacute;ad M Flann ery, Jessica F Almine, et al. Non-canonical Activation of the DNA Sensing Adaptor STING by ATM and IFI16 Mediates NF-\\u0026kappa;B Signaling after Nuclear DNA Damage. Mol Cell. 2018 Sep 6;71(5):745-760.e5. doi: 10.1016/j.molcel.2018.07.034.\\u003c/li\\u003e\\n\\u003cli\\u003eYao-Chun Hsu, Daniel Q Huang, Mindie H Nguyen. Global burden of hepatitis B virus: current status, missed opportunities and a call for action. Nat Rev Gastroenterol Hepatol. 2023 Aug;20(8):524-537. doi: 10.1038/s41575-023-00760-9.\\u003c/li\\u003e\\n\\u003cli\\u003eZobair M Younossi, Grace Wong, Quentin M Anstee, et al. The Global Burden of Liver Disease. Clin Gastroenterol Hepatol. 2023 Jul;21(8):1978-1991. doi: 10.1016/j.cgh.2023.04.015. \\u003c/li\\u003e\\n\\u003cli\\u003eKanako Yoshida, Masaru Enomoto, Akihiro Tamori, Shuhei Nishiguchi, Norifumi Kawada. Combination of entecavir or tenofovir with pegylated interferon-alpha for long-term reduction in hepatitis B surface antigen levels:simultaneous, sequential, or add-on combination therapy.Int J Mol Sci. 2021 Feb 1;22(3):1456. doi: 10.3390/ijms22031456.\\u003c/li\\u003e\\n\\u003cli\\u003eDipanjan Dutta, Sujoy Dutta, Mohanan Valiya Veettil, et al. BRCA1 Regulates IFI16 Mediated Nuclear Innate Sensing of Herpes Viral DNA and Subsequent Induction of the Innate Inflammasome and Interferon-\\u0026beta; Responses.PLoS Pathog. 2015 Jun 29;11(6):e1005030. doi: 10.1371/journal.ppat.1005030. \\u003c/li\\u003e\\n\\u003cli\\u003eTuo Li, Jin Chen, Ileana M Cristea. Human cytomegalovirus tegument protein pUL83 inhibits IFI16-mediated DNA sensing for immune evasion.Cell Host Microbe. 2013 Nov 13;14(5):591-9. doi: 10.1016/j.chom.2013.10.007. \\u003c/li\\u003e\\n\\u003cli\\u003eYang Yuanyuan , Zhao Xinzhuan , Wang Ziyu, et al. Nuclear Sensor Interferon-Inducible Protein 16 Inhibits the Function of Hepatitis B Virus Covalently Closed Circular DNA by Integrating Innate Immune Activation and Epigenetic Suppression. Hepatology. 2020 Apr;71(4):1154-1169. doi: 10.1002/hep.30897. \\u003c/li\\u003e\\n\\u003cli\\u003eHongtao Chen, Guirong He, Yue Chen, Xiaoyong Zhang. Hepatitis B Virus Might Be Sensed by STING-Dependent DNA Sensors and Attenuates the Response of STING-Dependent DNA Sensing Pathway in Humans with Acute and Chronic Hepatitis B Virus Infection.Viral Immunol. 2020 Dec;33(10):642-651. doi: 10.1089/vim.2020.0096. \\u003c/li\\u003e\\n\\u003cli\\u003eSudhakar Veeranki, Divaker Choubey. Interferon-inducible p200-family protein IFI16, an innate immune sensor for cytosolic and nuclear double-stranded DNA: regulation of subcellular localization.Mol Immunol. 2012 Jan;49(4):567-71. doi: 10.1016/j.molimm.2011.11.004.\\u003c/li\\u003e\\n\\u003cli\\u003eMarketa Pimkova Polidarova, Lenka Vanekova , Petra Brehova, et al. Synthetic Stimulator of Interferon Genes (STING) Agonists Induce a Cytokine-Mediated Anti-Hepatitis B Virus Response in Nonparenchymal Liver Cells. ACS Infect Dis. 2023 Jan 13;9(1):23-32. doi: 10.1021/acsinfecdis.2c00424.\\u003c/li\\u003e\\n\\u003cli\\u003eGillian Dunphy, Sin\\u0026eacute;ad M Flannery, Jessica F Almine，et al. IFI16 Targets HBV cccDNA for Epigenetic Silencing and Restricts Viral Gene Expression in Hepatoma Cells. Hepatology. 2020 Sep 6;71(5):20745-760.e5. doi: 10.1002/hep.31465.\\u003c/li\\u003e\\n\\u003cli\\u003eQuan Zhang , Yan Wang, Lai Wei, et al. IFI16 Suppresses Hepatitis B Virus Replication by Epigenetically Targeting cccDNA and Downregulating HBsAg/HBeAg Expression. Hepatology. 2022 Nov;23(11):1747-61. doi: 10.1002/imt2.221.\\u003c/li\\u003e\\n\\u003cli\\u003eYu-Qing Lu, Jing Wu, Xiang-Ji Wu, et al. Interferon Gamma-Inducible Protein 16 of Peripheral Blood Mononuclear Cells May Sense Hepatitis B Virus Infection and Regulate the Antiviral Immunity.Front Cell Infect Microbiol. 2021 Nov 18:11:790036. doi: 10.3389/fcimb.2021.790036.\\u003c/li\\u003e\\n\\u003cli\\u003eZhilin Hu, Xiao-Lu Teng, Tianyu Zhang，et al. SENP3 senses oxidative stress to facilitate STING-dependent dendritic cell antitumor function. Mol Cell. 2021 Mar 4;81(5):940-952.e5. doi: 10.1016/j.molcel.2020.12.024.\\u003c/li\\u003e\\n\\u003cli\\u003eJun Wang, Qian Li, Yuanwang Qiu, et al. Cell-type-specific expression analysis of liver transcriptomics with clinical parameters to decipher the cause of intrahepatic inflammation in chronic hepatitis B. Imeta. 2024 Jul 4;3(4):e221. doi: 10.1002/imt2.221. \\u003c/li\\u003e\\n\\u003cli\\u003eXiuqing Pang, Xinhua Li, Zhishuo Mo, et al. IFI16 is involved in HBV-associated acute-on-chronic liver failure inflammation. BMC Gastroenterol. 2018 May 9;18(1):61. doi: 10.1186/s12876-018-0791-1.\\u003c/li\\u003e\\n\\u003cli\\u003eHongyan Sui, Ming Zhou, Qian Chen, H Clifford Lane, Tomozumi Imamichi. siRNA enhances DNA-mediated interferon lambda-1 response through crosstalk between RIG-I and IFI16 signalling pathway. Nucleic Acids Res. 2014 Jan;42(1):583-98. doi: 10.1093/nar/gkt844.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"IFI16, STING, IRF3, IFN-β, IL-29\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6883660/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6883660/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eAims and background:\\u003c/h2\\u003e \\u003cp\\u003eThis study explores that in HBV infection, IFI16 further activates IRF3 through the STING pathway, leading to the release of inflammatory factors and thereby causing liver inflammation. This provides new ideas and theoretical basis for the inflammatory damage caused by hepatitis B virus infection, and also offers new therapeutic targets.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eIn vitro experiments were conducted using human hepatoma cell lines (Huh-7 and HepAD38) transfected with HBV DNA. IFI16 was either overexpressed or silenced, and the expression levels of IFI16, STING, IRF3, IFN-β, and IL-29 were evaluated through Western blot and qRT-PCR analyses. In vivo, an HBV-infected BALB/c mouse model was established to further validate the role of the IFI16-STING-IRF3 pathway in HBV-induced hepatic inflammation.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eIFI16 overexpression in HBV-infected Huh-7 and HepAD38 cells increased the expression of STING, IRF3, IFN-β, and IL-29. Conversely, knockdown of IFI16 using siRNA significantly suppressed the expression of these molecules. In vivo studies indicated that IFI16 overexpression elevated serum levels of ALT, AST, HBeAg, and HBsAg, as well as the expression of STING, IRF3, IFN-β, and IL-29. Furthermore, IFI16 expression correlated with the severity of HBV-associated liver fibrosis.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e \\u003cp\\u003eThe IFI16-STING pathway facilitates HBV-induced hepatic inflammation by activating IRF3 and promoting the secretion of pro-inflammatory cytokines, such as IFN-β and IL-29. These insights lay a theoretical groundwork for the development of innovative antiviral therapeutic approaches.\\u003c/p\\u003e\",\"manuscriptTitle\":\"IFI16 induced hepatocyte inflammation with HBV infection by regulating STING-IRF3 pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-06-23 14:40:51\",\"doi\":\"10.21203/rs.3.rs-6883660/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"871984d8-832b-46fa-b417-9c5955d672c9\",\"owner\":[],\"postedDate\":\"June 23rd, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-11-18T10:38:30+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-06-23 14:40:51\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6883660\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6883660\",\"identity\":\"rs-6883660\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}