{"paper_id":"43c5e3b1-147c-4fb8-b9c3-7b768ef442ea","body_text":"Fungal keratitis caused by Colletotrichum truncatum: a rare case report | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Case Report Fungal keratitis caused by Colletotrichum truncatum: a rare case report Jianmei Liu, Baorui Yang, Guangjuan Wu, Mei Ye, Yan Li, Min Dai, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2900515/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Fungal keratitis, caused by pathogenic fungi, features slow progressions, a long course of the disease, and a high rate of causing blindness. More than 70 cases of fungal infections have been known to cause keratitis. We report a case of fungal keratitis caused by a rare species implicated, named Colletotrichum truncatum , which belongs to Colletotrichum spp . The patient had been treated with corneal ulcer debridement combined with antifungal agents. His condition improved and the prognosis was good. Fungal keratitis Colletotrichum truncatum Antifungal agents Figures Figure 1 Introduction In recent years, the incidence of infectious keratitis has increased, fungal keratitis accounted for 61.9% of infectious keratitis [ 1 ] . Fungal keratitis ranks first as the cause of blindness in corneal diseases [ 2 ] . 922 microorganisms were isolated from corneal ulcer culture samples during 2015 to 2022 from the ophthalmology department of the Affiliated Hospital of Yunnan University, 61.5% (N = 567) of them were bacteria, while the other 38.5% (N = 355) were fungi. Among patients with fungal keratitis infection, the most common pathogen was filamentous fungal , with a total of 321 cases, the largest proportion was Fusarium with a number of 226, is the most common fungus that causes fungal keratitis, followed by Aspergillus infection (N = 57). There were some other rare filamentous fungi . Colletotrichum spp . has been recognized as an unusual cause of human infections, which can cause cutaneous mycosis [ 3 ] , arthritis, endophthalmitis [ 4 ] and keratitis [ 5 ] . In this study, we reported a case of Colletotrichum truncatum isolated from the corneal ulcer tissue of a patient with fungal keratitis from January 2021. Case presentation A 59-year-old male farm employee visited the department of ophthalmology outpatient unit at a tertiary referral center with a history of progressive pain, decreased vision, excessive tearing, and redness in the left eye for 1 month. He also pointed out an aggravated symptom since 15 days and claimed a history of body injury with pesticide. However, due to the worsening of the eye condition, he visited the ophthalmology department of our hospital. In addition, the patient was diagnosed with type Ⅱ Diabetes Mellitus (DM) 13 years ago. There was no swelling in the left eyelid, a small amount of secretion from the conjunctiva sac, mixed congestion of the conjunctiva and total corneal edema, the corneal surface was rough and had a central corneal ulcer of 6×7mm, showed in Fig. 1 A. Another examination showed that the vitreous bodies of both eyes were cloudy. Confocal microscopy showed that the cell structure of the corneal epithelium of the left eye was unclear and inflammatory cell infiltration was observed. The preliminary diagnosis was left eye keratitis and corneal ulcer, considered the possibility of fungal infection, but not exclusive to bacterial infection. To explore the microbiological characteristics of the infection, corneal scrapings were obtained. The sample was used to inoculate on Sabouraud dextrose agar (SDA-Merck, Germany) supplemented with 0.5% chloramphenicol and sheep blood agar plates, which incubated at 28°C to 37°C respectively. There was no bacterial growth on sheep blood agar for the next three days. Then corneal scraping microscopy was performed on the patient with corneal ulcers under a fluorescent microscope using lactophenol cotton blue staining. Morphological characteristics of colonies under the microscope are shown in Fig. 1 C- 1 D. The mycelium was separated by branches, the end of the mycelium was blunt, and there were many thick and round protoplasmic particles. The characteristic structure with variable morphology, appressoria, could be seen. Conidial single cells, transparent without diaphragm, crescent or capsule shape, sporulation from the conidial constellation and the sexual ascospore. The morphological characteristics of the isolate were recorded after growth on potato dextrose agar (PDA) incubated at 25℃ and were shown in Fig. 1 E and 1 F. The fungus was growing woolly on PDA, with yellow air-borne mycelium, and then became grayish-black with a dark brown underside. These results indicate that the fungal species isolated from the patient probably belongs to the genus Colletotrichum . Due to the difficulty in identifying Colletotrichum morphologically in the diagnoatic laboratory, the molecular biological method seems to be more applicable and accurate [ 6 ] . Therefore, fungal DNA was extracted using a DNA isolation kit (TIANGEN, China) according to the manufacturer’s instructions. To identify Colletotrichum species, the Internal Transcribed Spacer (ITS) region was amplified and sequenced. The primers that were used ITS-1F (TCCGTAGGTGAACCTGCGG) and ITS-4R (TCCTCCGCTTATTGATATGC) [ 7 ] . The sequence obtained was subjected to the Basic Local Alignment Search Tool (BLAST) program ( http://www.blast.ncbi.nlm.nih.gov/blast ). The analysis of the ITS gene showed that the isolate belonged to Colletotrichum truncatum species, which featured 99% similarity to the ex-type strain of the species (Accession number: GU227862). The patient was treated with voriconazole every hour and levofloxacin every 4 hours by eye drip. On the second day, the left eye was treated with a radiofrequency plasma knife for corneal ulcer debridement, burning and iodization. On day 6, pain in the left eye significantly improved and the ulcer lesion in the center of the left eye was clean and significantly limited. The central anterior chamber was shallow and the pus was below 1mm. The pupil was round and the pupil area was not oozing. One month later, the patient’s visual activity returned normal and the cornel ulcer and infection completely receded with normal eye appearance (Fig. 1 B). Discussion Colletotrichum species are common plant pathogens in tropical and subtropical regions around the world, which can cause rot or necrosis of plant stems and roots, resulting in a large amount of economic losses in agriculture. However, in recent years, there have also been reports of anthrax that causes keratitis and endophthalmitis [ 8 , 9 ] . Ocular trauma and initial spore attachment were the main risk factors for Colletotrichum keratitis. In this case, the patient had a history of pesticide-induced ocular injury during farm work, which was similar to other cases reported. The leaky corneal epithelial barrier can cause pre-existing colonization and attachment of spores, causing the onset of keratitis. It is conceivable that DM is the most important systemic risk factor for developing fungal keratitis. Hyperglycemia can reduce the immune response, as well as change the microenvironment of the ocular surface, including the commensal organisms, allowing easier fungal adhesion, proliferation and corneal colonization. Although the glycaemia level was basically normal during the hospital stay, the patient in this case was diagnosed with DM, which is at an elevated risk of developing fungal infections after ocular injury by pesticide. Species of Colletotrichum are an infrequent cause of fungal keratitis. Furthermore, if a patient has a history of diabetes or exposure to glucocorticoids, the infection is easily deteriorating or even invades the deep stroma layer of the cornea. Early diagnosis is helpful in employing specific therapy, as little information is medical documented for treatment available of Colletotrichum keratitis. In this regard, it is necessary to combine molecular biological technology to identify Colletotrichum spp . Currently, there is a lack of consensus on optimal therapy for Colletotrichum spp . associated ophthalmic infection. Few manuscripts mention the drug sensitivity test against Colletotrichum truncatum . Reported studies have indicated that most Colletotrichum isolates have a higher degree of resistance to antifungal drugs [ 7 ] . In this case, Colletotrichum truncatum showed resistance to some common antifungal drugs such as amphotericin, fluconazole, itraconazole or voriconazole et al. The combination of corneal ulcer debridement and two types of antifungal drugs leads to complete recovery of the eye lesion. Declarations Ethical Approval The data and samples analyzed in the present study were obtained in accordance with the standards and approved by the affiliated hospital of Yunnan University Biomedical Ethics Committee. Competing interest The authors have no competing interests to declare. Authors’ contributions Conceived and designed the study: Wenli Yuan and Deyao Deng. Performed the experiments: Jianmei Liu, Baorui Yang, Guangjuan Wu, Ying Hu and Wenli Yuan. Contributed reagents: Wenli Yuan. Wrote the paper: Jianmei Liu, Zi Wang Mei Ye and Wenli Yuan. Contributed clinical case and data analysis: Yan Li and Min Dai Funding This study was partially supported by the Foundation of Yunnan Health Training Project of High Level Talents (grant number: H-2019046), the Young Academic and Technical Leaders of Yunnan Province (grant number: 202305AC160072), the Association Foundation Program of Yunnan Provincial Science and Technology Department and Kunming Medical University (grant number: 202001AY070001-165) and the program of “Double tops” from Yunnan Province and Yunnan University (grant number: 202201BF070001-012). Availability of data and materials The datasets and materials used and/or analyzed in this study are available from the corresponding author on reasonable request. Acknowledgments We would like to thank Hai Liu and Ji Yang (Yunnan Eye Institute & Key Laboratory of Yunnan Province, Yunnan Eye Disease Clinical Medical Center, Affiliated Hospital of Yunnan University) for their assistance in clinical data collection. References Farah CJ, Seitz B, Hamon L, Sourlis C, Daas L. Mischinfektionen bei kontaktlinsenassoziierter mykotischer Keratitis mit Pseudomonas oder Akanthamöben [Coinfections in contact lens-associated mycotic keratitis with Pseudomonas or Acanthamoeba]. Ophthalmologe. 2021 Sep;118(9):940-943. DOI: 10.1007/s00347-020-01207-1. Lin L, Lan W, Lou B, Ke H, Yang Y, Lin X, Liang L. Genus Distribution of Bacteria and Fungi Associated with Keratitis in a Large Eye Center Located in Southern China. Ophthalmic Epidemiol. 2017 Apr;24(2):90-96.DOI: 10.1080/09286586.2016.1254250. Epub 2016 Dec 14. Figtree M, Weeks K, Chan L, Leyton A, Bowes A, Giuffre B, Sullivan M, Hudson BJ. Colletotrichum gloeosporioides sensu lato causing deep soft tissue mycosis following a penetrating injury. Med Mycol Case Rep. 2013 Feb 9;2:40-43.DOI: 10.1016/j.mmcr.2013.01.003. Shivaprakash MR, Appannanavar SB, Dhaliwal M, Gupta A, Gupta S, Gupta A, Chakrabarti A. Colletotrichum truncatum: an unusual pathogen causing mycotic keratitis and endophthalmitis. J Clin Microbiol. 2011 Aug;49(8):2894-2898. DOI: 10.1128/JCM.00151-11. Epub 2011 Jun 8. Hung N, Hsiao CH, Yang CS, Lin HC, Yeh LK, Fan YC, Sun PL. Colletotrichum keratitis: A rare yet important fungal infection of human eyes. Mycoses. 2020 Apr;63(4):407-415.DOI: 10.1111/myc.13058. Epub 2020 Feb 18. Hoffman JJ, Burton MJ, Leck A. Mycotic Keratitis-A Global Threat from the Filamentous Fungi. J Fungi (Basel). 2021 Apr 3;7(4):273.DOI: 10.3390/jof7040273. Pote ST,et al. Keratitis by a rare pathogen Colletotrichum gloeosporioides: A case report. Journal De Mycologie Médicale (2017), DOI:10.1016/j.mycmed.2017.04.009. Yang HC, Hartman GL. Methods and Evaluation of Soybean Genotypes for Resistance to Colletotrichum truncatum. Plant Dis. 2015 Jan;99(1):143-148.DOI: 10.1094/PDIS-03-14-0228-RE. Izadi A, Soleimani M, Daie Ghazvini R, Hashemi SJ, Gramishoar M, Ahmadikia K, Aminizadeh M, Ghahri M, Abedinifar Z, Barac A, Khodavaisy S. Clinical and mycological characteristics of keratitis caused by Colletotrichum gloeosporioides: A case report and review of literature. J Infect Dev Ctries. 2021 Mar 7;15(2):301-305.DOI: 10.3855/jidc.14492. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2900515\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Case Report\",\"associatedPublications\":[],\"authors\":[{\"id\":198970783,\"identity\":\"543aed1d-5a31-4d1d-bf45-c562d0611ad4\",\"order_by\":0,\"name\":\"Jianmei Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianmei\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":198970784,\"identity\":\"145db36d-e0c2-4ca2-b18d-23d5ba15126a\",\"order_by\":1,\"name\":\"Baorui Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Baorui\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":198970785,\"identity\":\"23148aaa-277a-4a52-85f7-eb77328ade67\",\"order_by\":2,\"name\":\"Guangjuan Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guangjuan\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":198970786,\"identity\":\"9b8dde29-ad2c-4154-80b6-0c2d2e7f6bc4\",\"order_by\":3,\"name\":\"Mei Ye\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mei\",\"middleName\":\"\",\"lastName\":\"Ye\",\"suffix\":\"\"},{\"id\":198970787,\"identity\":\"1696f8c7-7fd6-4b2b-9f1a-051cdb93fa73\",\"order_by\":4,\"name\":\"Yan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan Eye Disease Clinical Medical Center, Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":198970788,\"identity\":\"97389d04-84f0-4449-a356-cb32e08279e1\",\"order_by\":5,\"name\":\"Min Dai\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yunnan Eye Disease Clinical Medical Center, Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Min\",\"middleName\":\"\",\"lastName\":\"Dai\",\"suffix\":\"\"},{\"id\":198970789,\"identity\":\"7127577e-5e53-4e88-b8be-bd4aca6b4df2\",\"order_by\":6,\"name\":\"Zi Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zi\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":198970790,\"identity\":\"ba4ddb7b-d93a-489a-b978-f56e9637ed5a\",\"order_by\":7,\"name\":\"Ying Hu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Affiliated Hospital of Kunming Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ying\",\"middleName\":\"\",\"lastName\":\"Hu\",\"suffix\":\"\"},{\"id\":198970791,\"identity\":\"a95766aa-f676-49fb-9c02-ed2f252afa70\",\"order_by\":8,\"name\":\"Deyao Deng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Deyao\",\"middleName\":\"\",\"lastName\":\"Deng\",\"suffix\":\"\"},{\"id\":198970792,\"identity\":\"6bdc8daf-a39f-4680-a5e9-b6464136cdd9\",\"order_by\":9,\"name\":\"Wenli Yuan\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYBACxmYIbQAmH1RAeBLEa0k4Q4QWGIBoSWwjQgtzO/Ozxzw1d4z5GXjMJBLnHc4zOMB88DYPg10eboexmRvzHHtmJtkA0rLtcLHBAbZkax6G5GI8fjGT5mE7bGNwgMfsBlBL4gYgQ5qH4UBiA04t7N+kef4dtrEHa5kD0sL/jYAWoJm8bYfNDBhAWhrAtrAR0lImObfvsLHEAbbyHwnH0hNnHmYztpxjkIxTi2H/8W0Sb74dNuxvYN5s8KHGOrHvePPDG28q7HBrAUow8YBY8i9AcQOMWWYQzwCHepBCkON+gJnsD4BEHW6lo2AUjIJRMGIBAPevVjYVFpDJAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"The Affiliated Hospital of Yunnan University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wenli\",\"middleName\":\"\",\"lastName\":\"Yuan\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-05-06 06:14:22\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2900515/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2900515/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":36959538,\"identity\":\"fe946e30-35d9-4dce-b2f9-0136fea843a4\",\"added_by\":\"auto\",\"created_at\":\"2023-05-12 14:58:03\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1043049,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eClinical images, colony, and microscopic morphological characteristics of\\u003cem\\u003e Colletotrichum truncatum\\u003c/em\\u003e infections from a case. A) The left eye of the patient before treatment under the confocal microscope, the cornelrevealed was gray-white in color. B) After treatment the normal appearance of the cornel. C) And D) Lactophenol cotton blue staining of growth in PDA. E) And F) Growth of \\u003cem\\u003eColletotrichum truncatum \\u003c/em\\u003eas noted in PDA after 3 days and 6 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2900515/v1/0f34f2528c21a2f69b5b5454.png\"},{\"id\":38157207,\"identity\":\"49ede661-d598-402c-a2c2-62a59292cff8\",\"added_by\":\"auto\",\"created_at\":\"2023-06-07 11:44:39\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1114507,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2900515/v1/7e870144-3fbd-4ed5-84c3-919a13021b46.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Fungal keratitis caused by Colletotrichum truncatum: a rare case report\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eIn recent years, the incidence of infectious keratitis has increased, fungal keratitis accounted for 61.9% of infectious keratitis\\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u003c/sup\\u003e. Fungal keratitis ranks first as the cause of blindness in corneal diseases\\u003csup\\u003e[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. 922 microorganisms were isolated from corneal ulcer culture samples during 2015 to 2022 from the ophthalmology department of the Affiliated Hospital of Yunnan University, 61.5% (N\\u0026thinsp;=\\u0026thinsp;567) of them were bacteria, while the other 38.5% (N\\u0026thinsp;=\\u0026thinsp;355) were fungi. Among patients with fungal keratitis infection, the most common pathogen was \\u003cem\\u003efilamentous fungal\\u003c/em\\u003e, with a total of 321 cases, the largest proportion was \\u003cem\\u003eFusarium\\u003c/em\\u003e with a number of 226, is the most common fungus that causes fungal keratitis, followed by \\u003cem\\u003eAspergillus\\u003c/em\\u003e infection (N\\u0026thinsp;=\\u0026thinsp;57). There were some other rare \\u003cem\\u003efilamentous fungi\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eColletotrichum spp\\u003c/em\\u003e. has been recognized as an unusual cause of human infections, which can cause cutaneous mycosis \\u003csup\\u003e[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]\\u003c/sup\\u003e, arthritis, endophthalmitis\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e and keratitis\\u003csup\\u003e[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]\\u003c/sup\\u003e. In this study, we reported a case of \\u003cem\\u003eColletotrichum truncatum\\u003c/em\\u003e isolated from the corneal ulcer tissue of a patient with fungal keratitis from January 2021.\\u003c/p\\u003e\"},{\"header\":\"Case presentation\",\"content\":\"\\u003cp\\u003eA 59-year-old male farm employee visited the department of ophthalmology outpatient unit at a tertiary referral center with a history of progressive pain, decreased vision, excessive tearing, and redness in the left eye for 1 month. He also pointed out an aggravated symptom since 15 days and claimed a history of body injury with pesticide. However, due to the worsening of the eye condition, he visited the ophthalmology department of our hospital. In addition, the patient was diagnosed with type Ⅱ Diabetes Mellitus (DM) 13 years ago.\\u003c/p\\u003e \\u003cp\\u003eThere was no swelling in the left eyelid, a small amount of secretion from the conjunctiva sac, mixed congestion of the conjunctiva and total corneal edema, the corneal surface was rough and had a central corneal ulcer of 6\\u0026times;7mm, showed in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA. Another examination showed that the vitreous bodies of both eyes were cloudy. Confocal microscopy showed that the cell structure of the corneal epithelium of the left eye was unclear and inflammatory cell infiltration was observed. The preliminary diagnosis was left eye keratitis and corneal ulcer, considered the possibility of fungal infection, but not exclusive to bacterial infection.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo explore the microbiological characteristics of the infection, corneal scrapings were obtained. The sample was used to inoculate on Sabouraud dextrose agar (SDA-Merck, Germany) supplemented with 0.5% chloramphenicol and sheep blood agar plates, which incubated at 28\\u0026deg;C to 37\\u0026deg;C respectively. There was no bacterial growth on sheep blood agar for the next three days.\\u003c/p\\u003e \\u003cp\\u003eThen corneal scraping microscopy was performed on the patient with corneal ulcers under a fluorescent microscope using lactophenol cotton blue staining. Morphological characteristics of colonies under the microscope are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC-\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD. The mycelium was separated by branches, the end of the mycelium was blunt, and there were many thick and round protoplasmic particles. The characteristic structure with variable morphology, appressoria, could be seen. Conidial single cells, transparent without diaphragm, crescent or capsule shape, sporulation from the conidial constellation and the sexual ascospore.\\u003c/p\\u003e \\u003cp\\u003eThe morphological characteristics of the isolate were recorded after growth on potato dextrose agar (PDA) incubated at 25℃ and were shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF. The fungus was growing woolly on PDA, with yellow air-borne mycelium, and then became grayish-black with a dark brown underside. These results indicate that the fungal species isolated from the patient probably belongs to the genus \\u003cem\\u003eColletotrichum\\u003c/em\\u003e. Due to the difficulty in identifying \\u003cem\\u003eColletotrichum\\u003c/em\\u003e morphologically in the diagnoatic laboratory, the molecular biological method seems to be more applicable and accurate \\u003csup\\u003e[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, fungal DNA was extracted using a DNA isolation kit (TIANGEN, China) according to the manufacturer\\u0026rsquo;s instructions. To identify \\u003cem\\u003eColletotrichum\\u003c/em\\u003e species, the Internal Transcribed Spacer (ITS) region was amplified and sequenced. The primers that were used ITS-1F (TCCGTAGGTGAACCTGCGG) and ITS-4R (TCCTCCGCTTATTGATATGC) \\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. The sequence obtained was subjected to the Basic Local Alignment Search Tool (BLAST) program (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.blast.ncbi.nlm.nih.gov/blast\\u003c/span\\u003e\\u003cspan address=\\\"http://www.blast.ncbi.nlm.nih.gov/blast\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The analysis of the ITS gene showed that the isolate belonged to \\u003cem\\u003eColletotrichum truncatum\\u003c/em\\u003e species, which featured 99% similarity to the ex-type strain of the species (Accession number: GU227862).\\u003c/p\\u003e \\u003cp\\u003eThe patient was treated with voriconazole every hour and levofloxacin every 4 hours by eye drip. On the second day, the left eye was treated with a radiofrequency plasma knife for corneal ulcer debridement, burning and iodization. On day 6, pain in the left eye significantly improved and the ulcer lesion in the center of the left eye was clean and significantly limited. The central anterior chamber was shallow and the pus was below 1mm. The pupil was round and the pupil area was not oozing. One month later, the patient\\u0026rsquo;s visual activity returned normal and the cornel ulcer and infection completely receded with normal eye appearance (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB).\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003e \\u003cem\\u003eColletotrichum\\u003c/em\\u003e species are common plant pathogens in tropical and subtropical regions around the world, which can cause rot or necrosis of plant stems and roots, resulting in a large amount of economic losses in agriculture. However, in recent years, there have also been reports of anthrax that causes keratitis and endophthalmitis \\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. Ocular trauma and initial spore attachment were the main risk factors for \\u003cem\\u003eColletotrichum\\u003c/em\\u003e keratitis. In this case, the patient had a history of pesticide-induced ocular injury during farm work, which was similar to other cases reported. The leaky corneal epithelial barrier can cause pre-existing colonization and attachment of spores, causing the onset of keratitis. It is conceivable that DM is the most important systemic risk factor for developing fungal keratitis. Hyperglycemia can reduce the immune response, as well as change the microenvironment of the ocular surface, including the commensal organisms, allowing easier fungal adhesion, proliferation and corneal colonization. Although the glycaemia level was basically normal during the hospital stay, the patient in this case was diagnosed with DM, which is at an elevated risk of developing fungal infections after ocular injury by pesticide.\\u003c/p\\u003e \\u003cp\\u003eSpecies of \\u003cem\\u003eColletotrichum\\u003c/em\\u003e are an infrequent cause of fungal keratitis. Furthermore, if a patient has a history of diabetes or exposure to glucocorticoids, the infection is easily deteriorating or even invades the deep stroma layer of the cornea. Early diagnosis is helpful in employing specific therapy, as little information is medical documented for treatment available of \\u003cem\\u003eColletotrichum\\u003c/em\\u003e keratitis. In this regard, it is necessary to combine molecular biological technology to identify \\u003cem\\u003eColletotrichum spp\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eCurrently, there is a lack of consensus on optimal therapy for \\u003cem\\u003eColletotrichum spp\\u003c/em\\u003e. associated ophthalmic infection. Few manuscripts mention the drug sensitivity test against \\u003cem\\u003eColletotrichum truncatum\\u003c/em\\u003e. Reported studies have indicated that most \\u003cem\\u003eColletotrichum\\u003c/em\\u003e isolates have a higher degree of resistance to antifungal drugs \\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. In this case, \\u003cem\\u003eColletotrichum truncatum\\u003c/em\\u003e showed resistance to some common antifungal drugs such as amphotericin, fluconazole, itraconazole or voriconazole et al. The combination of corneal ulcer debridement and two types of antifungal drugs leads to complete recovery of the eye lesion.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthical Approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe data and samples analyzed in the present study were obtained in accordance with the standards and approved by the affiliated hospital of Yunnan University Biomedical Ethics Committee.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors have no competing interests to declare.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors’ contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceived and designed the study: Wenli Yuan and Deyao Deng.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePerformed the experiments: Jianmei Liu, Baorui Yang, Guangjuan Wu, Ying Hu and Wenli Yuan.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eContributed reagents: Wenli Yuan.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eWrote the paper: Jianmei Liu, Zi Wang Mei Ye and Wenli Yuan.\\u003c/p\\u003e\\n\\u003cp\\u003eContributed clinical case and data analysis: Yan Li and Min Dai\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was partially supported by the Foundation of Yunnan Health Training Project of High Level Talents (grant number: H-2019046), the Young Academic and Technical Leaders of Yunnan Province (grant number: 202305AC160072), the Association Foundation Program of Yunnan Provincial Science and Technology Department and Kunming Medical University (grant number: 202001AY070001-165) and the program of “Double tops” from Yunnan Province and Yunnan University (grant number: 202201BF070001-012).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets and materials used and/or analyzed in this study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe would like to thank Hai Liu and Ji Yang (Yunnan Eye Institute \\u0026amp; Key Laboratory of Yunnan Province, Yunnan Eye Disease Clinical Medical Center, Affiliated Hospital of Yunnan University) for their assistance in clinical data collection.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eFarah CJ, Seitz B, Hamon L, Sourlis C, Daas L. Mischinfektionen bei kontaktlinsenassoziierter mykotischer Keratitis mit Pseudomonas oder Akantham\\u0026ouml;ben [Coinfections in contact lens-associated mycotic keratitis with Pseudomonas or Acanthamoeba]. Ophthalmologe. 2021 Sep;118(9):940-943. DOI: 10.1007/s00347-020-01207-1. \\u003c/li\\u003e\\n\\u003cli\\u003eLin L, Lan W, Lou B, Ke H, Yang Y, Lin X, Liang L. Genus Distribution of Bacteria and Fungi Associated with Keratitis in a Large Eye Center Located in Southern China. Ophthalmic Epidemiol. 2017 Apr;24(2):90-96.DOI: 10.1080/09286586.2016.1254250. Epub 2016 Dec 14. \\u003c/li\\u003e\\n\\u003cli\\u003eFigtree M, Weeks K, Chan L, Leyton A, Bowes A, Giuffre B, Sullivan M, Hudson BJ. Colletotrichum gloeosporioides sensu lato causing deep soft tissue mycosis following a penetrating injury. Med Mycol Case Rep. 2013 Feb 9;2:40-43.DOI: 10.1016/j.mmcr.2013.01.003.\\u003c/li\\u003e\\n\\u003cli\\u003eShivaprakash MR, Appannanavar SB, Dhaliwal M, Gupta A, Gupta S, Gupta A, Chakrabarti A. Colletotrichum truncatum: an unusual pathogen causing mycotic keratitis and endophthalmitis. J Clin Microbiol. 2011 Aug;49(8):2894-2898. DOI: 10.1128/JCM.00151-11. Epub 2011 Jun 8. \\u003c/li\\u003e\\n\\u003cli\\u003eHung N, Hsiao CH, Yang CS, Lin HC, Yeh LK, Fan YC, Sun PL. Colletotrichum keratitis: A rare yet important fungal infection of human eyes. Mycoses. 2020 Apr;63(4):407-415.DOI: 10.1111/myc.13058. Epub 2020 Feb 18. \\u003c/li\\u003e\\n\\u003cli\\u003eHoffman JJ, Burton MJ, Leck A. Mycotic Keratitis-A Global Threat from the Filamentous Fungi. J Fungi (Basel). 2021 Apr 3;7(4):273.DOI: 10.3390/jof7040273. \\u003c/li\\u003e\\n\\u003cli\\u003ePote ST,et al. Keratitis by a rare pathogen Colletotrichum gloeosporioides: A case report. Journal De Mycologie M\\u0026eacute;dicale (2017), DOI:10.1016/j.mycmed.2017.04.009.\\u003c/li\\u003e\\n\\u003cli\\u003eYang HC, Hartman GL. Methods and Evaluation of Soybean Genotypes for Resistance to Colletotrichum truncatum. Plant Dis. 2015 Jan;99(1):143-148.DOI: 10.1094/PDIS-03-14-0228-RE.\\u003c/li\\u003e\\n\\u003cli\\u003eIzadi A, Soleimani M, Daie Ghazvini R, Hashemi SJ, Gramishoar M, Ahmadikia K, Aminizadeh M, Ghahri M, Abedinifar Z, Barac A, Khodavaisy S. Clinical and mycological characteristics of keratitis caused by Colletotrichum gloeosporioides: A case report and review of literature. J Infect Dev Ctries. 2021 Mar 7;15(2):301-305.DOI: 10.3855/jidc.14492.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Fungal keratitis, Colletotrichum truncatum, Antifungal agents\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2900515/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2900515/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eFungal keratitis, caused by pathogenic fungi, features slow progressions, a long course of the disease, and a high rate of causing blindness. More than 70 cases of fungal infections have been known to cause keratitis. We report a case of fungal keratitis caused by a rare species implicated, named \\u003cem\\u003eColletotrichum truncatum\\u003c/em\\u003e, which belongs to \\u003cem\\u003eColletotrichum spp\\u003c/em\\u003e. The patient had been treated with corneal ulcer debridement combined with antifungal agents. His condition improved and the prognosis was good.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Fungal keratitis caused by Colletotrichum truncatum: a rare case report\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-05-12 14:57:58\",\"doi\":\"10.21203/rs.3.rs-2900515/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"5d4868ca-9913-4ecd-ac40-c2691ede1b5d\",\"owner\":[],\"postedDate\":\"May 12th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-06-07T11:44:28+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-05-12 14:57:58\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2900515\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2900515\",\"identity\":\"rs-2900515\",\"version\":[\"v1\"]},\"buildId\":\"ehx78VzkSd0WSzXnipQa-\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}