{"paper_id":"42f026a3-daff-48d0-aca2-2806ec500d81","body_text":"Exosomal miR-4644 targets SPRY3 to promote proliferation and invasion of pancreatic cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Exosomal miR-4644 targets SPRY3 to promote proliferation and invasion of pancreatic cancer Xiangyu Chu, Dongqi Li, Fusheng Zhang, Yongsu Ma, Yongqi Deng, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8338211/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Tumor-derived exosomes (TDEs) can carry diverse genetic material that modulates pancreatic cancer (PC) proliferation and invasion. Despite this, the involvement of microRNAs (miRNAs) in exosome-mediated tumor progression in PC remains inadequately explored. This study demonstrates that miR-4644 upregulation in exosomes derived from PC promotes both proliferation and invasion, while its inhibition suppresses tumor progression. SPRY3, a downstream target of miR-4644, acts to mitigate PC malignancy when overexpressed. Mechanistically, elevated miR-4644 in PC-derived exosomes fosters tumor growth and invasion through the suppression of SPRY3. Collectively, these findings indicate that high miR-4644 expression in pancreatic cancer exosomes correlates with poor patient prognosis, highlighting its potential as a biomarker for early diagnosis and prognostic assessment of PC. Health sciences/Biomarkers Biological sciences/Cancer Health sciences/Oncology Pancreatic cancer Tumor-derived exosomes Biological behavior Early diagnosis Prognostic evaluation SPRY3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Pancreatic cancer (PC) is a highly aggressive gastrointestinal (GI) malignancy, characterized by a five-year survival rate of less than 10%[ 1 ]. Its rapid progression and high propensity for distant metastasis significantly contribute to the substantial disease burden[ 2 ]. Notably, due to the lack of effective diagnostic and therapeutic markers, many patients with PC experience disease progression by the time of diagnosis. While cancer antigen 199 (CA199) is a widely used marker for PC diagnosis, its sensitivity and specificity are limited. Consequently, a deeper understanding of the molecular mechanisms driving PC progression is crucial for identifying novel therapeutic targets and biomarkers for early diagnosis and prognosis. Exosomes, 40–160 nm vesicles (average 100 nm) secreted by various cell types, contain diverse molecular cargo, including DNAs, non-coding RNAs (ncRNAs), lipids, proteins, and metabolites[ 3 ]. Tumor-derived exosomes (TDEs) are readily internalized by recipient tumor cells, where they facilitate malignancy progression. For example, colon cancer cells harboring mutant Kirsten rat sarcoma virus (KRAS) release exosomes containing mutant KRAS and epidermal growth factor receptor (EGFR), promoting the intercellular transfer of oncogenic signals[ 4 ]. Exosomes have been shown to regulate PC progression and intercellular communication, primarily through their molecular contents such as medium-chain acyl-CoA dehydrogenase (ACADM) and macrophage migration inhibitory factor (MIF) [ 5 , 6 ]. Exosomal microRNAs (miRNAs), 18–22 nucleotide-long endogenous ncRNAs, play key roles in modulating target gene expression and influencing PC progression [ 7 , 8 ]. For instance, exosomal miR-30b-5p, upregulated under hypoxic conditions, promotes angiogenesis in PC by inhibiting gap junction protein 1 (GJA1)[ 9 ]. Liu et al.[ 10 ] reported that reduced expression of miR-485-3p correlates with stemness and chemoresistance in PC. miR-4644, upregulated in serum-derived exosomes from patients with PC has shown high sensitivity and specificity for diagnosing PC[ 11 ]. Subsequent studies have linked miR-4644 to tumor progression, positioning it as a promising diagnostic biomarker for PC[ 11 , 12 ]. While miR-4644 has been implicated in the progression of bladder cancer and colorectal adenocarcinoma (CRC)[ 13 – 15 ], the precise mechanisms by which exosomal miR-4644 modulates PC progression remain unclear. Thus, this study seeks to investigate the underlying mechanisms through which exosomal miR-4644 contributes to PC progression. MiRNAs regulate protein-coding gene expression by binding to their target mRNAs[ 16 ]. Sprouty (SPRY) proteins, known to be modulated by miRNAs, are pivotal regulators of the Receptor Tyrosine Kinase/Rat Sarcoma Virus/Mitogen-Activated Protein Kinase (RTK/Ras/MAPK) signaling pathway. The downregulation of SPRY proteins is commonly associated with tumor progression[ 17 ]. Activation of the RTK/Ras/MAPK pathway is a well-established mechanism driving PC progression. However, the specific role of SPRY RTK Signaling Antagonist 3 (SPRY3), a key RTK signaling antagonist, in promoting PC progression remains poorly understood. Additionally, silencing SPRY3 has been shown to facilitate the malignant transformation of cancers. For instance, nasopharyngeal carcinoma (NPC)-derived exosomal miR-10-5p and miR-18a upregulated the expression of vascular endothelial growth factor (VEGF) and Hypoxia-inducible factor 1-alpha (HIF1-α) by silencing SPRY3 to promote angiogenesis in vitro and in vivo[ 18 ]. Despite these observations, the mechanism by which miR-4644 regulates SPRY3 and influences PC progression remains to be fully elucidated. This study revealed that miR-4644 is highly expressed in exosomes derived from PC cells and promotes both cell proliferation and invasion. Further investigation identified SPRY3 as a direct target of miR-4644, with SPRY3 overexpression mitigating the aggressive behavior of PC cells. Exosomal miR-4644 drives PC progression by downregulating SPRY3. These findings position miR-4644 as a potential therapeutic target and diagnostic biomarker for PC. Materials and methods Biological tissue samples The 32 pairs of PC and adjacent non-tumor tissues were obtained from Peking University First Hospital (Beijing, China), with sample collection approved by the Peking University First Hospital Ethics Committee (NO: 2024194). The study was conducted in accordance with the Declaration of Helsinki, and all participants provided written informed consent. Cell culture The PC cell lines AsPC-1 and BxPC-3, along with the pancreatic ductal epithelial cell (hTERT-HPNE) were acquired from the American Type Culture Collection (ATCC, Manassas, USA). HEK-293T cells were generously donated by the Department of Biochemistry and Molecular Biology at Peking University. For cell culture, HEK-293T, AsPC-1, and hTERT-HPNE cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, USA), while BxPC-3 cells were cultured in RPMI 1640 Medium (Gibco, USA). All culture media contained with 10% fetal bovine serum (FBS; Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA). All cells were cultured at 37 ℃ in an incubator containing 5% CO2. Western blotting (WB) Western blotting (WB) Firstly, washed tumor cells twice with PBS, and lysed in Pierce IP lysis buffer (ThermoFisher Scientific, USA) containing protease inhibitors (87785, ThermoFisher Scientific, USA) and phosphatase inhibitors (A32957, ThermoFisher Scientific, USA) to extract total proteins. Next, the total protein concentrations were quantified using the BCA assay, followed by adding 5 × loading buffer. A total of 20µg protein of each sample was loaded onto a 10% Tris-HCl gradient gel (Invitrogen, USA) and subjected to electrophoresis. The proteins were then transferred to a PVDF membrane. Then, blocked the membrane with 5% skimmed milk, and incubated it with primary antibodies: Calnexin (10427-2-AP, Proteintech), CD9 (ab307085, Abcam), HSP70 (ab181606, Abcam), TSG101 (ab125011, Abcam). The corresponding protein bands were detected following incubation with appropriate secondary antibodies. Exosome isolation and characterization First, AsPC-1, BxPC-3, and hTERT-HPNE cells were cultured in 10% exosome-depleted FBS medium. Exosomes were then enriched through differential centrifugation with following steps: 1,500 g for 5 min at 4°C, 2,500 g for 20–30 min at 4°C, and finally, 100,000 g for 90 min twice at 4°C. Then, characterized isolated exosomes. Physical characterization: Exosome size and concentration were examined using nanoparticle tracking analysis (NTA, NanoSight NS3000, UK). Exosome morphology was analyzed by transmission electron microscopy (TEM, HT-7700, Japan). Briefly, exosomes were diluted in PBS, applied to carbon-coated copper grids, and stained with 2.5% uranyl acetate for 10 min. TEM images were captured using a Hitachi H-7700 electron microscope[ 19 , 20 ]. Biochemical validation: Positive identification was confirmed through detection of exosomal markers (CD9, TSG101, HSP70), and cellular contamination was excluded by the absence of the endoplasmic reticulum marker (Calnexin)[ 21 ]. Exosome uptake assay Exosomes were fluorescently labeled with PKH67 green fluorescent dye (Sigma, USA), and the reaction was terminated by adding 0.3% bovine serum albumin (BSA). The PKH67-labeled exosomes were subsequently purified through ultracentrifugation at 100,000g for 70 min[ 22 ]. For cellular uptake assay, these PKH67-labeled exosomes were co-incubated with AsPC-1 and BxPC-3 cells. After incubation, fixed cells with 4% paraformaldehyde (PFA) for 15 min at room temperature, stained nuclei with 4',6-diamidino-2-phenylindole (DAPI, Invitrogen, USA), then washed three times with PBS to remove excess stain[ 23 , 24 ]. Representative images were captured through confocal microscope (Leica, Germany). Total RNA isolation and quantitative real-time PCR (qRT-PCR) Total exosomal RNA was isolated from exosomes derived from AsPC-1, BxPC-3, and hTERT-HPNE cells using the miRNeasy Mini Kit (QIAGEN, Germany), and cellular RNA was isolated using Trizol reagent (Invitrogen, USA). For cDNA synthesis, 2 µg total RNA was reverse transcribed using the ReverseTra Ace qRT-PCR kit (FSQ-101/FSQ-201, TOYOBO, Japan). Next, qRT-PCR was performed using the SYBR Green Realtime PCR Master Mix (Q711-02, Vazyme Biotech, China). Target genes or miRNAs expression quantification was performed using the 2^(-ΔΔCT) method, and the endogenous controls were GAPDH for cellular RNA, U6 for cellular miRNA, and miR-39a-3p for exosomal miRNA. The primers used for qRT-PCR are listed as follows: Primers miR-4644-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTCTG U6-F CTCGCTTCGGCAGCACA U6-R AACGCTTCACGAATTTGCGT miR-39a-3p UCACCGGGUGUAAAUCAGCUUG miR-4644-F CGCGTGGAGAGAGAAAAGAGA miR-4644-R AGTGCAGGGTCCGAGGTATT GAPDH-F GTATTGGGCGCCTGGTCACC GAPDH-R CGCTCCTGGAAGATGGTGATGG SPRY3-F CAATCTAGCATTGCCAGCTCAA SPRY3-R CTTCAGAGCACCATCAGCCTTT MiRNA Transfection MiRNA mimics and inhibitors (NC/miR-4644) were purchased from Ribio (Guangzhou, Guangdong, China). Each miRNA mimics and inhibitors (5 nM) were transfected into AsPC-1 and BxPC-3 cells using Lipofectamine RNAiMAX Reagent (ThermoFisher Scientific, USA)[ 25 ]. Briefly, 5 nM miRNA mimics or inhibitors were mixed with 5 µl RNAiMAX Reagent and 125 µl Opti-MEM medium (Gibco, USA) before transfection. Following 6–8 hours incubation at 37°C, the transfection mixture was replaced with complete medium. Cells were collected for subsequent experiments after 48 hours. Plasmid transfection The SPRY3 overexpression (OE) plasmid and corresponding negative control (NC) were purchased from Syngenbio (Qingdao, China). Transfection was performed using 5 ng plasmid DNA with 5 µl Lipofectamine 3000 (ThermoFisher Scientific, USA) according to the manufacturer's protocol. Following 6–8 hours incubation at 37°C, the transfection mixture was replaced with complete medium. Transfected cells were collected for subsequent experiments after 48 hours. Dual luciferase report assay A dual-luciferase reporter vector containing the SPRY3 3' UTR (wild-type/mutant) was constructed by Syngenbio (Qingdao, China). HEK-293T cells were transfected with miR-4644 mimics and the constructed reporter vector using Lipofectamine 3000. After transfecting 48 hours, quantified luciferase activity using the Dual-Luciferase Reporter Assay Kit (Beyotime Biotechnology, China) according to the manufacturer's protocol. Finally, measured firefly luciferase activity versus renilla luciferase activity for each sample using a chemiluminescence instrument (Molecular Devices, USA), and normalized these values[ 26 ]. Cell Counting Kit-8 assay Cell proliferation was measured through Cell Counting Kit-8 (CCK-8, Dojindo Molecular Technologies, Japan). Firstly, seeded AsPC-1 and BxPC-3 cells in 96-well plates at a density of 1×10⁴ cells/well (100 µL/well) and cultured them under standard conditions. After incubating for 24, 48, and 72 hours, diluted the CCK-8 solution with FBS-free medium to 10%, and added 100 µl to the wells. Following another 2-hour incubation, measured the absorbance at 450 nm and 630 nm using a chemiluminescence instrument (Molecular Devices, SpectraMax i3). Cell colony formation assay For the colony formation assay, 1 × 10 3 AsPC-1 or BxPC-3 cells were plated in six-well plates and cultured with fresh medium every 2–3 days. After 14-days incubation, cells were processed as follows: (1) Washed them twice with PBS. (2) Fixed them with 4% PFA for 15 min at room temperature. (3) Stained them with 0.1% crystal violet solution for 15 min. (4) Washed another three times with PBS to remove excess stain. Finally, colony numbers containing > 50 cells were counted using Image J software. Cell migration/invasion assay Cell migration and invasion capacities were evaluated using 8 µm pore-size transwell models (Corning, NY, USA). The details are as follows: (1) Cell Preparation: Suspend BxPC-3 and AsPC-1 cells in serum-free medium at a concentration of 5 × 10⁵ cells/mL, then loaded 200 µL cell suspension (1×10⁵ cells/well) into the upper chamber of the transwell model. (2) Matrix Coating (invasion only): Pre-coated membranes with 100 µL Matrigel Matrix (1:8 dilution in PBS; Corning, NY, USA), then polymerize at 37 ℃ for 1 hour. (3) Lower Chamber Preparation: Added 600 µL medium to the lower chamber with 10% FBS for cell migration, and 600 µL medium with 20% FBS for cell invasion. (4) Quantification. After 48 hours incubation, washed the membranes twice with PBS, fixed them with 4% PFA for 15 min at room temperature, stained them with 0.1% crystal violet solution for 15 min, then washed another three times with PBS to remove excess stain, and obtained representative images under a microscope. Finally, counted migrated cells using Image J software. Flow cytometry Firstly, digested AsPC-1 and BxPC-3 cells by using 0.25% trypsin-EDTA (Gibco, USA), fixed them with 4% PFA for 15 min at room temperature, permeabilized them using a 1% perforation solution for 10 min at 4°C, then blocked cells with 5% BSA for 30 min at 4°C. Then, incubated cells with anti-SPRY3 primary antibody (1:200 dilution, 17932-1-AP, Proteintech) in 1% BSA/PBS overnight at 4°C. Next, washed cells three times with PBS, and incubated them with Alexa Fluor 647-conjugated secondary antibody (1:1000, A-21244, ThermoFisher Scientific) for 1 hour at room temperature. After washing the cells three times with PBS, acquired 10,000 single-cell events per sample and assessed the expression of SPRY3 using flow cytometry. Establishment of in situ xenograft nude mouse model Six-week-old nude mice were sourced from Charles River Co., Ltd. (Beijing). All procedures adhered to protocols approved by the Ethics Committee of the National Centre for Nanoscience and Technology. Briefly, the left epigastrium was sterilized with 75% ethanol, and a 1 cm incision was made to expose the tail of the pancreas. Then, slowly injected 50 µL of AsPC-1 or BxPC-3 cell suspension (5×10 6 cells/mL in PBS/Matrigel [1:1]) into the pancreas using an insulin syringe, and sutured the wound. After 21 days, the mice were euthanized by 40% CO 2 asphyxiation, and measured tumor weights (g) and animal weights (g). All methods were carried out in accordance with relevant guidelines and regulations. All methods are reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org ). Immunohistochemistry (IHC) Tissue sections were deparaffinized in xylene after fixation in 4% PFA, rehydrated with ethanol, and rinsed with PBS. Next, blocked endogenous peroxidase activity with 3% H 2 O 2 in methanol for 15 min, performed heat-induced epitope retrieval in 0.01 M citrate buffer (pH 6.0) at 95℃ for 20 min, and cooled to room temperature (about 30 min). After cooling, blocked sections with 10% goat serum for 1 hour at room temperature, and incubated with primary antibodies against SPRY3 (17932-1-AP, Proteintech) or Ki-67 overnight at 4 ℃. Afterward, washed sections with PBS + 0.1% Tween-20 (3 × 5 min), and incubated with HRP-conjugated secondary antibody (1:500) for 1 hour at room temperature. Then, stained them with diaminobenzidine (DAB) for 5 min. Nuclei were counterstained with Mayer’s hematoxylin (Biodee, China). Five random images per section were captured, and the expression of SPRY3 and Ki-67 was quantified. Statistical analysis Data from three independent experiments were analyzed using GraphPad Prism 9.5.0 software. Results are presented as mean ± standard deviation (SD). Comparisons between two groups were performed using non-parametric tests or independent samples t-tests, while multiple comparisons were performed using one-way ANOVA, Bonferroni or Dunnett tests. All tests were two-tailed, and differences are statistically significant at ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001, ns means no significance. Results 1. Isolation and identification of exosomes from PC cells TDEs facilitate intercellular communication, promoting tumor cell proliferation and metastasis[27]. To explore the regulatory mechanisms of exosomes in PC cells, TDEs (Exo (A) and Exo (B)) were isolated from AsPC-1 and BxPC-3 cells and characterized using TEM and NTA[20]. The size of the TDEs was found to be approximately 150 nm (Fig. 1A, Fig. S1A) . Western blot analysis further confirmed the presence of exosomal markers, such as CD9, TSG101, and HSP70, along with the negative marker Calnexin (Fig. S1B) . 2. PC cell-derived exosomes facilitate the proliferation, migration, and invasion of pancreatic cancer To investigate the impact of TDEs on PC progression, whether exosomes could be internalized by PC cells was determined. After co-incubating PKH67-labeled exosomes with AsPC-1 and BxPC-3 cells, a strong green fluorescent signal was observed in the PC cells (Fig. 1B) . To examine the effect of TDEs on PC progression, AsPC-1 and BxPC-3 cells were treated with isolated TDEs. CCK-8 and colony formation assays demonstrated that TDEs significantly enhanced PC cell proliferation compared to the control group (Ctrl) (Fig. 1C-D) . Additionally, transwell assays confirmed that TDEs promoted PC cell migration and invasion (Fig. 1E-F) . Collectively, these results suggest that TDEs are internalized by PC cells and markedly increase their proliferation, migration, and invasion capabilities. 3. MiR-4644 is enriched in PC-derived exosomes and acts as an oncogenic miRNA in PC progression Exosomal miRNAs play a pivotal role in mediating intercellular communication. To further elucidate the mechanisms by which exosomal miRNAs regulate PC progression, highly expressed serum exosomal miRNAs were identified from patients with PC using the GEO online database (GSE50632). Among these, miR-4644 was notably upregulated in serum exosomes of patients with PC (Fig. 2A) . Notably, elevated expression of miR-4644 was strongly correlated with poor prognosis in patients with PC, as confirmed through online survival analysis (https://www.kmplot.com/analysis/) (Fig. 2B) . The differential miRNAs were further analyzed using KEGG and GO enrichment analysis (Fig. 2C-D) [28]. These results revealed that these upregulated miRNAs are predominantly enriched in cancer-related pathways, including the Hippo signaling pathway and the Neurotrophic receptor tyrosine kinase (NTRK) receptor signaling pathway[29, 30]. Moreover, the expression levels of cellular and exosomal miR-4644 in hTERT-HPNE, AsPC-1, and BxPC-3 cells were assessed. qRT-PCR analysis revealed that, compared to miR-4644 expression in hTERT-HPNE cells and Exo (H), miR-4644 was highly expressed in AsPC-1 cells but at relatively low levels in Exo (A). Conversely, Exo (B) exhibited significantly higher levels of miR-4644, despite lower expression in BxPC-3 cells (Fig. 2E-F) . These results suggest that miR-4644, as an oncogenic miRNA, may contribute to PC progression by accumulating in TDEs. 4. PC cell-derived exosomal miR-4644 facilitates proliferation, migration, and invasion. To explore the role of miR-4644 in PC progression, miR-4644 mimics and inhibitors (miR-4644/miR-4644i) were transfected into AsPC-1 and BxPC-3 cells. Transfection efficiency was confirmed via qRT-PCR (Fig. S2A) . Subsequent biological assessments of miR-4644/miR-4644i effects on PC cells revealed that miR-4644 promoted cell proliferation, whereas miR-4644i suppressed growth (Fig. 3A, Fig. S2B) . Plate cloning assays further showed that miR-4644 overexpression enhanced clonogenic capacity, while inhibition of miR-4644 diminished clonogenic activity (Fig. 3C, Fig. S2C) . Additionally, miR-4644 was found to significantly promote PC cell migration and invasion (Fig. 3E-F, Fig. S2D-E) . Notably, no significant effects were observed in control groups (negative control mimic (NC), NC inhibitor (NCi), or blank Ctrl), confirming the specificity of miR-4644/miR-4644i effects (Fig. S3A-D) . To further investigate the role of exosomal miR-4644 in PC progression, exosome rescue assays were designed, where AsPC-1 and BxPC-3 cells were co-cultured with exosomes (Exo (A) and Exo (B)) and NCi/miR-4644i. CCK-8 and plate cloning assays revealed that inhibiting miR-4644 partially reduced the proliferative effects of TDEs on AsPC-1 and BxPC-3 cells (Fig. 3B, D) . Additionally, miR-4644i reduced the motility of TDEs on AsPC-1 and BxPC-3 cells (Fig. 3G, Fig. S2F) . These results suggest that exosomal miR-4644, encapsulated in PC cell-derived exosomes, contributes to PC cell proliferation, migration, and invasion. 5. SPRY3 was the target gene of miR-4644. To predict the target genes of miR-4644, we firstly analyzed downstream pathways by miRPath v3.0, revealing its involvement in the PI3K-Akt and MAPK signaling pathways (Fig. 4A) [31]. Additional bioinformatics tools, including mirDP, miRDB, miRWalk, miRgator, and miRPathDB, identified 127 common target genes (Fig. 4B) [32]. GO enrichment analysis showed that these target genes were enriched in cell adhesion and cancer-related pathways (Fig. S4A) . Further qRT-PCR analysis of the top-ranked genes revealed SPRY3 as the most significantly affected target of miR-4644 (Fig. S4B) . SPRY proteins are known inhibitors of the MAPK pathway, and bioinformatics analysis suggested that miR-4644 could bind to the 3'-untranslated region (3'-UTR) of SPRY3[33, 34]. Next, we examined the expression of SPRY3 in hTERT-HPNE, AsPC-1 and BxPC-3 cells, the result showed a significant negative correlation with the expression of exosomal miR-4644 compared to hTERT-HPNE exosomes (Fig. 4C) . The luciferase reporter assay further validated that miR-4644 could directly target the 3ʹ-UTR of SPRY3 (Fig. 4D) . Additionally, qRT-PCR results showed that miR-4644 silenced SPRY3 expression in AsPC-1 and BxPC-3 cells, with the inhibition of miR-4644 reversing this downregulation induced by Exo (A/B) (Fig. 4E, Fig. S4C) . Flow cytometry also demonstrated the downregulation of SPRY3 after transfecting miR-4644 (Fig. 4F, Fig. S4D) , while miR-4644i enhanced the expression of SPRY3 (Fig. 4G, Fig. S4E) . Notably, miR-4644i partially reversed the Exo (A/B)-mediated suppression of SPRY3 (Fig. 4H, Fig. S4F). These results demonstrate that miR-4644 directly modulates SPRY3 expression, which plays a pivotal role in PC progression. 6. PC cell-derived exosomal-miR-4644 promotes proliferation, migration, and invasion via targeting SPRY3 SPRY3 is reported to be the direct target of miR-4644, and the rescue experiment was performed to validate whether miR-4644 influences PC progression by targeting SPRY3. Firstly, SPRY3-overexpressing PC cells were successfully constructed and confirmed by qRT-PCR and gel electrophoresis (Fig. 5A, Fig. S5A) . The flow cytometry results also showed a significant upregulation of SPRY3 after transfecting the SPRY3 OE plasmid, but its expression was reduced following transfection with miR-4644 mimics (OE+miR-4644) (Fig. 5B, Fig. S5B) . Subsequent CCK-8 and colony formation assays demonstrated that PC cell proliferation was significantly suppressed in the OE group, but miR-4644 reversed the inhibitory effect of SPRY3 (Fig. 5C-D) . Transwell assays demonstrated that migration and invasion were significantly reduced in SPRY3-OE cells compared to the NC group (Fig. 5E, Fig. S5C) . Collectively, these findings indicate that miR-4644 effectively counteracts the inhibition of PC cell proliferation, migration, and invasion caused by overexpressing SPRY3, suggesting that miR-4644 promotes PC progression by silencing SPRY3. 7. PC TDEs miR-4644 promote proliferation by targeting SPRY3 in vivo The in-situ xenograft models were established to investigate the roles of miR-4644 and SPRY3 in PC. The result showed that tumor weight was smaller in the SPRY3-OE group than in NC group (Fig. 6A-B) The tumor weight in the SPRY3-OE+miR-4644 group was bigger than the SPRY3-OE group, which implied that the miR-4644 could promote the progression of PC (Fig. 6A-B) . Notably, miR-4644 promoted PC growth without affecting body weight (Fig. 6C) . Further IHC analysis revealed upregulation of SPRY3 in the SPRY3-OE group and the downregulation of SPRY3 in SPRY3-OE+miR-4644 group implied that miR-4644 could inhibit the expression of SPRY3 (Fig. S5D) . The Ki67 expression in the decreased in the SPRY3-OE group than the NC group. Conversely, there was a notable increase in Ki67 expression after miR-4644 treatment, which further supported that SPRY3 was the target of miR-4644 (Fig. 6D) . To explore the clinical relevance of SPRY3, we examined SPRY3 expression in 32 PC tissues and adjacent normal tissues (Table 1) . The qRT-PCR results revealed that SPRY3 expression was significantly lower in PC tissues (Fig. 6E) . Moreover, high SPRY3 expression in tumors correlated to better prognosis in PC patients (Fig. 6F) . In summary, TDE miR-4644 promotes PC progression by targeting SPRY3, highlighting its potential as both a therapeutic target and diagnostic biomarker for PC (Fig. 7) . Conclusion and Discussion TDEs are advantageous for tumor utilization due to their organ-targeting properties and thus participate in cancer initiation and progression, including tumor microenvironment (TME) remodeling, angiogenesis, invasion, metastasis, and drug resistance. Notably, increasing evidence suggested that dysregulation of exosomal miRNAs played important roles in affecting tumor progression[35, 36]. MiR-4644, particularly exosomal miR-4644, has been reported to be associated with the advancement of multiple malignancies. For example, miR-4644 competitively bound to Tripartite Motif Containing 44 (TRIM44) via the long non-coding RNA (lncRNA) ELFN1-AS1, promoting pro-proliferative, anti-apoptotic, and pro-migratory effects in CRC cells[13, 37]. Wu et al.[14] further demonstrated that miR-4644 is significantly associated with distant metastasis in CRC. Remarkably, exosomal miR-4644 had been shown to facilitate proliferation and invasion in bladder cancer by targeting UbiA prenyltransferase domain-containing protein 1 (UBIAD1)[15]. However, there is little evidence on how miR-4644 affects the biological behavior of PC, and our study compensate the inadequacy by validating the oncogenic role of exosomal miR-4644 on PC progression. In addition, prior studies on exosomal miR-4644 have primarily focused on its diagnostic significance in GI tumors. For example, miR-4644 exhibited higher stability and expression levels in hepatocellular carcinoma (HCC), and was predicted to be a promising biomarker for early diagnosis of lenvatinib resistance in HCC[38, 39]. Another meta-analysis on exosomal miRNA expression in GI cancers identified miR-4644 as a minimally invasive biomarker for GI tumor diagnosis[40]. Additionally, the upregulated miR-4644 was verified in gemcitabine-resistant pancreatic cell line (SW1990/GEM), suggesting its utility in detecting drug resistance in PC patients[41]. Therefore, high-expressed miR-4644 is an important marker of GI tumors. For investigating the regulatory mechanism of miR-4644 on PC progression, we utilized CCK8, plate cloning and transwell assays in both AsPC-1 and BxPC-3 cells to confirm that miR-4644 promoted PC proliferation, migration and invasion. Next, we explored target genes of miR-4644 through bioinformatics databases, and identified that miR-4644 bound to the 3'UTR of SPRY3 by dual luciferase reporter gene assay. SPRY family members are lipid-acylated phosphoproteins that act as inhibitors of RTK signaling cascades, such as those involving the epidermal growth factor (EGF) and fibroblast growth factor (FGF) receptor families[42-44]. As a member of SPRY family, the downregulated SPRY3 is related to tumor progression. For example, SPRY3 was reported to enhance the sensitivity of primary acute myeloid leukemia (AML) cells to Quizartinib (AC220), a potent and selective second-generation FMS-like tyrosine kinase 3 (FLT3) inhibitor[45]. However, the mechanisms of how SPRY3 contributes to PC progression remain unclear. In this study, we established stably overexpressed SPRY3 PC cells, and found that SPRY3 suppressed PC cell proliferation, migration, and invasion in vitro, as well as inhibiting PC tumor growth in vivo. Finally, we conducted rescue assays, and the results suggested that miR-4644 targeted SPRY3 to promote PC proliferation, migration and invasion. Despite the evidence that miR-4644 promotes PC progression in this study, more details need to be verified. Firstly, it is necessary to enrich serum exosomes from PC patients and verify the high expression of miR-4644 by further sequencing data to prove its oncogenic role. Next, the present evidence cannot support the early diagnostic value of miR-4644 for PC. Therefore, it is necessary to enrich serum exosomes from PC patients and healthy people, to explore the value of miR-4644 in PC early diagnosis. Further, SPRY3 was verified modulating the RTK/Ras/MAPK pathway, and its downregulation is related to tumor progression[46]. In our study, we confirmed that miR-4644 targets SPRY3, but the specific molecular pathway was not validated. In conclusion, our study illustrates that exosomal miR-4644 promotes PC progression by targeting SPRY3. This finding suggests that miR-4644 could serve as a valuable biomarker for early PC detection and as a potential therapeutic target for PC. Abbreviations DAPI: 4',6-diamidino-2-phenylindole ACADM: medium-chain acyl-CoA dehydrogenase AML: acute myeloid leukemia ATCC: American Type Culture Collection BSA: bovine serum albumin CA199: cancer antigen 199 CCK-8: Cell counting Kit-8 CHB: chronic hepatitis B CRC: colorectal adenocarcinoma DAB: diaminobenzidine EGF: epidermal growth factor EGFR: epidermal growth factor receptor FGF: fibroblast growth factor FLT3: FMS-like tyrosine kinase 3 GI: gastrointestinal GJA1: the gap junction 1 HCC: hepatocellular carcinoma HIF1-α: Hypoxia-inducible factor 1-alpha HSP70: heat shock protein 70 IHC: Immunohistochemical KRAS: Kirsten rat sarcoma virus lncRNA: long non-coding RNA MAPK: Mitogen-activated Protein Kinase MIF: migration inhibitory factor miRNAs: microRNAs ncRNAs: non-coding RNAs NPC: nasopharyngeal carcinoma NTA: nanoparticle tracking analysis NTRK: Neurotrophic receptor tyrosine kinase PC: Pancreatic cancer PDAC: pancreatic ductal adenocarcinoma PFA: paraformaldehyde Ras: Rat Sarcoma Virus RTK: receptor tyrosine kinase qRT-PCR: quantitative real-time PCR SD: standard deviation SPRY: Sprouty SPRY3: SPRY RTK Signaling Antagonist 3 TDEs: Tumor-derived exosomes TEM: transmission electron microscopy TSG101: tumor susceptibility gene 101 TME: tumor microenvironment TRIM44: Tripartite Motif Containing 44 UBIAD1: UbiA prenyltransferase domain-containing protein 1 VEGF: vascular endothelial growth factor WB: Western blotting Declarations Acknowledgements: We thank Mingjie Chen (Shanghai NewCore Biotechnology Co., Ltd.) for providing data analysis and visualization support. Funding: This study was supported by National Natural Science Foundation of China (NO. 82171722, 82271764), Beijing Municipal Natural Science Foundation (7212111), the National Key Research and Development Program of China (2021YFA0909900, 2023YFF0714500). The “Seed Program” in Beijing Friendship Hospital (No. YYZZ202419) Availability of data and materials Not applicable. Authors’ contributions Dongqi Li and Xiangyu Chu operate this work and designed all figures; Yongsu Ma, Fusheng Zhang and yongqi Deng provided technical support; Yinmo Yang, Yanlian Yang, Chen Wang and Xiaodong Tian provided the design and revision of the manuscript; Yinmo Yang, Xiaodong Tian, Yanlian Yang and Xiangyu Chu obtain funding supports. All authors made substantial, direct and intellectual contribution to the review. All authors read and approved the final manuscript. Ethics approval and consent to participate Not applicable. Consent for publication The authors have consented to publish this article. Competing interests The authors declare that they have no competing interests. References Siegel, R. L., Giaquinto, A. N. & Jemal, A. Cancer statistics, 2024. CA Cancer J. Clin. 74 (1), 12–49 (2024). Closa, D. Pancreatic cancer, stroma, and exosomes. J. Physiol. Biochem. 79 (1), 205–211 (2023). Tien, S. C. et al. Exosomal miRNA 16-5p/29a-3p from pancreatic cancer induce adipose atrophy by inhibiting adipogenesis and promoting lipolysis. iScience, 27(7): p. 110346. (2024). Demory Beckler, M. et al. Proteomic analysis of exosomes from mutant KRAS colon cancer cells identifies intercellular transfer of mutant KRAS. Mol. Cell. Proteom. 12 (2), 343–355 (2013). Fenu, G. et al. Unveiling the microRNA landscape in pancreatic ductal adenocarcinoma patients and cancer cell models. BMC Cancer . 24 (1), 1308 (2024). Agrawal, P. et al. Characterizing the role of exosomal miRNAs in metastasis . bioRxiv , (2024). Yin, Z. et al. Macrophage-derived exosomal microRNA-501-3p promotes progression of pancreatic ductal adenocarcinoma through the TGFBR3-mediated TGF-β signaling pathway . J. Experimental Clin. Cancer Res. , 38. (2019). Farazi, T. A., Hoell, J. I., Morozov, P. & Tuschl, T. MicroRNAs in human cancer. Adv. Exp. Med. Biol. 774 , 1–20 (2013). Chen, K. et al. Hypoxic pancreatic cancer derived exosomal miR-30b-5p promotes tumor angiogenesis by inhibiting GJA1 expression. Int. J. Biol. Sci. 18 (3), 1220–1237 (2022). Liu, X. et al. Hypoxia-induced epigenetic regulation of miR-485-3p promotes stemness and chemoresistance in pancreatic ductal adenocarcinoma via SLC7A11-mediated ferroptosis. Cell. Death Discov . 10 (1), 262 (2024). Madhavan, B. et al. Combined evaluation of a panel of protein and miRNA serum-exosome biomarkers for pancreatic cancer diagnosis increases sensitivity and specificity. Int. J. Cancer . 136 (11), 2616–2627 (2015). Machida, T. et al. miR–1246 and miR–4644 in salivary exosome as potential biomarkers for pancreatobiliary tract cancer. Oncol. Rep. 36 (4), 2375–2381 (2016). Lei, R., Feng, L. & Hong, D. ELFN1-AS1 accelerates the proliferation and migration of colorectal cancer via regulation of miR-4644/TRIM44 axis. Cancer Biomark. 27 (4), 433–443 (2020). Wu, N. et al. Identification of AP002498.1 and LINC01871 as prognostic biomarkers and therapeutic targets for distant metastasis of colorectal adenocarcinoma. Cancer Med. 13 (1), e6823 (2024). Yan, L., Li, Q., Sun, K. & Jiang, F. MiR-4644 is upregulated in plasma exosomes of bladder cancer patients and promotes bladder cancer progression by targeting UBIAD1. Am. J. Transl Res. 12 (10), 6277–6289 (2020). Do, D. N. et al. miRNA Regulatory Functions in Farm Animal Diseases, and Biomarker Potentials for Effective Therapies . Int. J. Mol. Sci. , 22 (6). (2021). Sirivatanauksorn, Y. et al. Differential expression of sprouty genes in hepatocellular carcinoma. J. Surg. Oncol. 105 (3), 273–276 (2012). Wang, J. et al. Exosomal Delivery of AntagomiRs Targeting Viral and Cellular MicroRNAs Synergistically Inhibits Cancer Angiogenesis. Mol. Ther. Nucleic Acids . 22 , 153–165 (2020). Liu, B., Rui, Y., Li, M. & Huang, L. Cancer cell-derived exosomes promote NSCLC progression via the miR-199b-5p/HIF1AN axis. Mol. Immunol. 174 , 32–40 (2024). Wu, X. et al. Exosomes Extraction and Identification. Methods Mol Biol, 2054: pp. 81–91. (2019). Trevisan, F. et al. Isolation and Characterization of Salivary Exosomes for Cancer Biomarker Discovery. Methods Mol. Biol. 2504 , 101–112 (2022). Gonda, A. et al. Exosomal survivin facilitates vesicle internalization. Oncotarget 9 (79), 34919–34934 (2018). Zhai, K. et al. Extracellular vesicle-derived miR-146a as a novel crosstalk mechanism for high-fat induced atherosclerosis by targeting SMAD4 . J. Adv. Res. , (2024). Liu, F. et al. Preliminary study on the mechanism by which exosomes derived from human exfoliated deciduous teeth improve the proliferation and osteogenic inhibitory effect of glucocorticoid-induced BMSCs. Gene 923 , 148575 (2024). Bai, J. et al. MicroRNA-300 inhibits the growth of hepatocellular carcinoma cells by downregulating CREPT/Wnt/beta-catenin signaling. Oncol. Lett. 18 (4), 3743–3753 (2019). Xiong, Y. et al. miRNA transcriptomics analysis shows miR-483-5p and miR-503-5p targeted miRNA in extracellular vesicles from severe acute pancreatitis-associated lung injury patients. Int Immunopharmacol, 125(Pt A): p. 111075. (2023). Chen, K. et al. The Role of Exosomes in Pancreatic Cancer From Bench to Clinical Application: An Updated Review . Front. Oncol. , 11. (2021). Tang, D. et al. SRplot: A free online platform for data visualization and graphing. PLoS One . 18 (11), e0294236 (2023). Cai, S. et al. Atorvastatin inhibits pancreatic cancer cells proliferation and invasion likely by suppressing neurotrophin receptor signaling. Transl Cancer Res. 9 (3), 1439–1447 (2020). Ansari, D. et al. The Hippo Signaling Pathway in Pancreatic Cancer. Anticancer Res. 39 (7), 3317–3321 (2019). Vlachos, I. S. et al. DIANA-miRPath v3.0: deciphering microRNA function with experimental support. Nucleic Acids Res. 43 (W1), W460–W466 (2015). Shi, T., Hu, Z., Tian, L. & Yang, Y. Pan-cancer landscape of CENPO and its underlying mechanism in LUAD. Respir Res. 24 (1), 113 (2023). Celik-Selvi, B. E. et al. Sprouty3 and Sprouty4, Two Members of a Family Known to Inhibit FGF-Mediated Signaling, Exert Opposing Roles on Proliferation and Migration of Glioblastoma-Derived Cells . Cells , 8 (8). (2019). McGeary, S. E. et al. The biochemical basis of microRNA targeting efficacy . Science , 366 (6472). (2019). Romano, R. et al. Extracellular Vesicles and Pancreatic Cancer: Insights on the Roles of miRNA, lncRNA, and Protein Cargos in Cancer Progression . Cells , 10 (6). (2021). Daoud, A. Z., Mulholland, E. J., Cole, G. & McCarthy, H. O. MicroRNAs in Pancreatic Cancer: biomarkers, prognostic, and therapeutic modulators. BMC Cancer . 19 (1), 1130 (2019). Ma, B., Wang, J. & Yusufu, P. Tumor-derived exosome ElNF1-AS1 affects the progression of gastric cancer by promoting M2 polarization of macrophages. Environ. Toxicol. 38 (9), 2228–2239 (2023). Zhao, J. et al. Identification of miR-4644 as a suitable endogenous normalizer for circulating miRNA quantification in hepatocellular carcinoma. J. Cancer . 11 (23), 7032–7044 (2020). Gao, C. et al. AKR1C1 overexpression leads to lenvatinib resistance in hepatocellular carcinoma. J. Gastrointest. Oncol. 14 (3), 1412–1433 (2023). Wei, C. et al. Exosomal miR-1246 in body fluids is a potential biomarker for gastrointestinal cancer. Biomark. Med. 12 (10), 1185–1196 (2018). Shen, Y. et al. Identifying microRNA-mRNA regulatory network in gemcitabine-resistant cells derived from human pancreatic cancer cells. Tumour Biol. 36 (6), 4525–4534 (2015). Knosp, W. M. et al. Submandibular Parasympathetic Gangliogenesis Requires Sprouty-Dependent Wnt Signals from Epithelial Progenitors. Dev. Cell . 32 (6), 667–677 (2015). Yang, X., Li, Z., Zhang, J. & Zhao, W. Identification of two SPRY isoforms SPRY1 and SPRY3 by atomic force microscopy at the single-molecule level. Analyst 147 (24), 5694–5700 (2022). Katoh, Y. & Katoh, M. FGF signaling inhibitor, SPRY4, is evolutionarily conserved target of WNT signaling pathway in progenitor cells. Int. J. Mol. Med. 17 (3), 529–532 (2006). Hou, P. P. et al. A Genome-Wide CRISPR Screen Identifies Genes Critical for Resistance to FLT3 Inhibitor AC220. Cancer Res. 77 (16), 4402–4413 (2017). Cabrita, M. A. & Christofori, G. Sprouty proteins: antagonists of endothelial cell signaling and more. Thromb. Haemost . 90 (4), 586–590 (2003). Tables Table 1. Clinical data of 32 patients with pancreatic cancer Variables High Expression Low Expression P value Number of patients 22 10 Sex (Male: Female) 13:9 5:5 0.712 Ages ≥ 60 < 60 15 7 7 3 1.000 BMI ≥ 24.0 < 24 8 14 6 4 0.267 CA199 High Low 19 3 9 1 1.000 T Stage 1-2 3-4 16 6 3 7 0.049* N Stages 0 1-2 11 11 6 4 0.712 M Stage 0 1 22 0 10 0 —— AJCC Stages Ⅰ-Ⅱ Ⅲ-Ⅳ 20 2 9 1 1.000 lymphatic nodes metastasis 0 ≥1 17 5 2 8 0.005** Additional Declarations No competing interests reported. Supplementary Files S2rawimages.docx Supplements.docx data.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8338211\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":569092297,\"identity\":\"af684efc-e87a-44d5-b6e5-4eb3b0ad06ed\",\"order_by\":0,\"name\":\"Xiangyu Chu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Capital Medical University, National Clinical Research Center for Digestive Diseases\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiangyu\",\"middleName\":\"\",\"lastName\":\"Chu\",\"suffix\":\"\"},{\"id\":569092300,\"identity\":\"eecab206-76f2-4854-a73d-36454c4ec9ac\",\"order_by\":1,\"name\":\"Dongqi Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Peking University First Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dongqi\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":569092301,\"identity\":\"0bd3db78-82f1-4b20-a64c-c3e5f13c4cb4\",\"order_by\":2,\"name\":\"Fusheng Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Peking University First Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fusheng\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":569092303,\"identity\":\"e769b899-a3cc-48ae-95bd-e23237c053cd\",\"order_by\":3,\"name\":\"Yongsu Ma\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Peking University First Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yongsu\",\"middleName\":\"\",\"lastName\":\"Ma\",\"suffix\":\"\"},{\"id\":569092305,\"identity\":\"a9663beb-64f1-4aed-9db4-493215a98f83\",\"order_by\":4,\"name\":\"Yongqi Deng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Peking University First Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yongqi\",\"middleName\":\"\",\"lastName\":\"Deng\",\"suffix\":\"\"},{\"id\":569092307,\"identity\":\"a6a37f2a-9958-49fd-b81a-6a1874ae4bb3\",\"order_by\":5,\"name\":\"Chen Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"CAS Key Laboratory of Standardization and Measurement for Nanotechnology, National Center for Nanoscience and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chen\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":569092310,\"identity\":\"21d0dc77-9c49-4cf5-b20e-f5096e82a375\",\"order_by\":6,\"name\":\"Xiaodong Tian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Peking University First Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaodong\",\"middleName\":\"\",\"lastName\":\"Tian\",\"suffix\":\"\"},{\"id\":569092311,\"identity\":\"52131e4c-8e4f-4b8c-9786-5402ce1cfbde\",\"order_by\":7,\"name\":\"Yanlian Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"CAS Key Laboratory of Standardization and Measurement for Nanotechnology, National Center for Nanoscience and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yanlian\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":569092312,\"identity\":\"bc74b002-b6c6-495d-93bf-9eceab0fe815\",\"order_by\":8,\"name\":\"Yinmo Yang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYNACAwh14GMDG5ghQbSWgzOJ1wIFzLwNDIS1GBw/e/g1T8GdaH7+ww8P2+7gizY4wHzwNg+DXR5OLWfy0qx5DJ7lzpyRZnA49wxb7oYDbMnWPAzJxTi1HMgxM+YBKt5wg4fhcG4bSAuPmTQPw4HEBlxazr+Bajl/huGwJVgL/zf8Wm7kGD8GazmQw3CYEWILG14tkjfemDHOAWoB+eVgL9AvMw+zGVvOMUjGqYXvfI7xhzd/Duf28x9+/OHnjmO5fcebH954U2GHU4vCAQY2KR4E/xgwdsAOxqEeCOQbGJg//kDwa3ArHQWjYBSMghELABvtYOEQL/sTAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Peking University First Hospital\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yinmo\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-12-11 15:23:19\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8338211/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8338211/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":99513873,\"identity\":\"e66aef0e-9a5e-44f5-a400-7ce95da0cef2\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":8623763,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Manuscript.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/5fab185801525c15d2b0c2df.docx\"},{\"id\":99513870,\"identity\":\"ea8a72ce-479a-4ef5-a888-d632530604a4\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"json\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":8924,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"185d52cec73c45bab79afcb6148f4de1.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/54d9b68a989c4e448dd29580.json\"},{\"id\":99513874,\"identity\":\"c769c597-e39c-4e18-ab15-6167e5dedb12\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":827991,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S2rawimages.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/4ffaaada89bc7293267f7873.docx\"},{\"id\":99792095,\"identity\":\"f21bb2d8-5dc8-4fad-ae7d-42ca562d34c4\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:14:34\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":5916604,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplements.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/8bd8a4a26ca4d303fbc7713d.docx\"},{\"id\":99513877,\"identity\":\"b34c2dd3-e9ff-4ed3-97d6-af40588b643b\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"xlsx\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":28300,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"data.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/343927816b7c3272acdeaa1d.xlsx\"},{\"id\":99513881,\"identity\":\"f256e74b-245b-4115-b749-4722798ed5c7\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"xml\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":118497,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"185d52cec73c45bab79afcb6148f4de11enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/183f80c4d217ec4f8275fc9b.xml\"},{\"id\":99791439,\"identity\":\"9c1e9acd-595d-44f0-9f3f-c9bd3ae16d21\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:59:52\",\"extension\":\"png\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":546292,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/d949a817b55bc551d87e52e9.png\"},{\"id\":99790995,\"identity\":\"68fcdda6-ada2-41f3-8fc9-809b3369687d\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:55\",\"extension\":\"png\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":125470,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/fe128e217ee950d5f7aa4ac7.png\"},{\"id\":99513886,\"identity\":\"5d23cc67-ffd4-4d68-b087-8a7fa7bc97e0\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"png\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":839300,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/5fc788a89ca7326adf7ea117.png\"},{\"id\":99790870,\"identity\":\"b8282596-ff80-4444-a74f-c87944277cd9\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:48\",\"extension\":\"png\",\"order_by\":16,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":361414,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/3d3f7dde897f7f4e46ba785b.png\"},{\"id\":99790886,\"identity\":\"e50afe6b-7bf4-425c-8fda-718428807290\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:48\",\"extension\":\"png\",\"order_by\":17,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":513165,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/daa076f708e7aa6aaefb93e0.png\"},{\"id\":99791791,\"identity\":\"d024f34a-fb9d-484e-bbd1-3797c98f20fe\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:10:25\",\"extension\":\"png\",\"order_by\":18,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":532933,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/e62464cdf9a64d425d582179.png\"},{\"id\":99791456,\"identity\":\"4c03ac36-6494-40f9-ae42-85687a1ab878\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:59:56\",\"extension\":\"png\",\"order_by\":19,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":223406,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/47b027b55b582ca316b586a5.png\"},{\"id\":99513894,\"identity\":\"81e29de9-be91-4a46-960d-227bcb53dec4\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"xml\",\"order_by\":20,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":117402,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"185d52cec73c45bab79afcb6148f4de11structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/2da5a5f8e06dc071bbab7311.xml\"},{\"id\":99513895,\"identity\":\"003e8ed7-9a7d-4093-969b-4dca71343deb\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"html\",\"order_by\":21,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":131454,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/26f7fa36135b05e57b74ec28.html\"},{\"id\":99790865,\"identity\":\"18b4524e-7ca0-4a13-bb05-44c089fdf829\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:47\",\"extension\":\"jpeg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1068105,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTDEs facilitate PC cell proliferation, migration, and invasion. (A) Transmission electron micrographs of exosomes isolated from different PC cell lines, scale bar = 100 nm. (B) PKH67-labeled TDEs (green) co-incubated with AsPC-1 and BxPC-3 cells (nuclei stained with DAPI, blue), scale bar = 10 μm. (C) CCK-8 assays assessing the proliferative capacity of PC cells with or without exosome treatment. (D) Representative images of colony formation assays for each cell line. (E-F) Migration and invasion assays with or without Exo treatment, statistical results shown, scale bar = 100 μm. All experiments were performed with 3 independent replicates. The student’s t-test was performed to assess the mean differences between groups. ∗p \\u0026lt; 0.05, ∗∗p \\u0026lt; 0.01, ∗∗∗p \\u0026lt; 0.001, ∗∗∗∗p \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/f108a8ec24b83161baacc215.jpeg\"},{\"id\":99791766,\"identity\":\"4f6b4382-7608-4cf3-884f-9850d174803e\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:09:45\",\"extension\":\"jpeg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":435912,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMiR-4644 is enriched in PC-derived exosomes and acts as an oncogenic miRNA. (A) Volcano plot illustrating the expression of candidate miRNAs from the GEO database, highlighting the elevated expression of miR-4644 in PC cells. (B) Kaplan-Meier survival curves comparing patient outcomes based on miR-4644 levels, with statistical significance determined by the Log-rank test (p \\u0026lt; 0.01). (C-D) KEGG (C) and GO (D) enrichment analyses of highly expressed miRNAs. (E) qRT-PCR analysis of cellular miR-4644 expression, with U6 as the endogenous control. (F) Relative expression of miR-4644 in exosomes derived from hTERT-HPNE, AsPC-1, and BxPC-3 cells, with miR-39a-3p as the endogenous control. All experiments were performed with 3 independent replicates. The One-way ANOVA was performed to assess the mean differences among groups. ∗p \\u0026lt; 0.05, ∗∗p \\u0026lt; 0.01, ∗∗∗p \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/1f3618ab24aa6e65cadce5b7.jpeg\"},{\"id\":99792139,\"identity\":\"08cf91c4-6caa-466f-9f7a-c1e4b7914e84\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:15:33\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1512478,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUpregulation of miR-4644 enhances PC cell proliferation, migration, and invasion. (A-B) CCK-8 assays evaluating the effects of miR-4644 overexpression and silencing on the proliferative capacity of AsPC-1 and BxPC-3 cells (A), and the impact of miR-4644 inhibition on PC cell proliferation after treatment with exosomes derived from AsPC-1 or BxPC-3 cells (B). (C-D) Representative images and statistical data from colony formation assays of AsPC-1 and BxPC-3 cells overexpressing or silencing miR-4644 (C), and the effect of miR-4644 inhibition on the clonogenic ability of PC cells treated with exosomes (D). (E-F) Migration and invasion assays of AsPC-1 and BxPC-3 cells overexpressing or silencing exosomal miR-4644, with respective statistical results, scale bar = 100 μm. (G) Representative images and statistical data on the effect of miR-4644 inhibition on the migration of AsPC-1 and BxPC-3 cells pre-treated with exosomes derived from AsPC-1 and BxPC-3 cells, scale bar = 100 μm. All experiments were performed with 3 independent replicates. The student’s t-test was performed to assess the mean differences between groups, and One-way ANOVA was used to assess the differences among three groups. ∗p \\u0026lt; 0.05, ∗∗p \\u0026lt; 0.01, ∗∗∗p \\u0026lt; 0.001, ∗∗∗∗p \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/68424d237080e775c25b1268.jpeg\"},{\"id\":99513891,\"identity\":\"41fae6b9-9e5c-4f59-be5a-19c2b9568311\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1098092,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMiR-4644 directly binds to SPRY3’ 3′UTR and downregulates its expression. (A) KEGG pathway enrichment analysis of downstream pathways regulated by miR-4644, conducted using DIANA-miRPath v.30. (B) Venn diagram illustrating the overlap of miR-4644 target genes across five publicly available bioinformatics algorithms (miRDB, miRPathDB, miRWalk, miRgator, miR-DIP). (C) SPRY3 expression in hTERT-HPNE, AsPC-1, and BxPC-3 cells, measured by qRT-PCR, with GAPDH as the endogenous control. (D) Binding sites of miR-4644 within the 3′UTR of SPRY3 and dual luciferase reporter assay evaluating relative luciferase activity between groups. (E) SPRY3 expression levels in AsPC-1 cells transfected with miR-4644 mimic, and the effect of miR-4644 inhibitor on SPRY3 expression in AsPC-1 cells treated with TDEs, as assessed by qRT-PCR, with GAPDH as the endogenous control. (F-H) Flow cytometry assays analyzing SPRY3 expression in AsPC-1 cells after overexpression (F) or inhibition (G) of miR-4644, and the effect of miR-4644 inhibitor on SPRY3 expression in AsPC-1 cells treated with TDEs (H). All experiments were performed with 3 independent replicates. The student’s t-test was performed to assess the mean differences between groups, and One-way ANOVA was used to assess the differences among three groups. ∗p \\u0026lt; 0.05, ∗∗p \\u0026lt; 0.01, ∗∗∗p \\u0026lt; 0.001, ∗∗∗∗p \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/5201598df2456952f7a4a3c4.jpeg\"},{\"id\":99790930,\"identity\":\"f203e788-14b9-4e96-ae17-8f5430e93a70\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:52\",\"extension\":\"jpeg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2077587,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOverexpression of SPRY3 suppresses PC cell proliferation, migration, and invasion. (A) SPRY3 expression levels in AsPC-1 cells after transfection with a lentiviral plasmid overexpressing SPRY3, measured by qRT-PCR, with GAPDH as the endogenous control. NC denotes the negative control group, and OE represents the SPRY3 overexpression group. (B) Flow cytometry analysis of SPRY3 expression after transfection with the lentiviral plasmid overexpressing SPRY3 and miR-4644 mimics. (C) CCK-8 assay assessing the proliferation of AsPC-1 and BxPC-3 cells. (D) Representative images from colony formation assays for each cell line. (E) Migration assay results following co-transfection with miR-4644 mimics and SPRY3 overexpression vectors, scale bar = 100 μm. All experiments were performed with 3 independent replicates. The student’s t-test was performed to assess the mean differences between groups, and One-way ANOVA was used to assess the differences among three groups. ∗p \\u0026lt; 0.05, ∗∗p \\u0026lt; 0.01, ∗∗∗p \\u0026lt; 0.001, ∗∗∗∗p \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/c47cad395fbfc596b43ee494.jpeg\"},{\"id\":99791931,\"identity\":\"6e3ebe47-95b2-4c96-b819-8f7789ac3e6a\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:11:47\",\"extension\":\"jpeg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":855140,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExosomal miR-4644 promotes tumor proliferation by targeting SPRY3 in vivo. (A) Representative images of AsPC-1 and BxPC-3 xenografts. NC refers to the negative control group, and OE denotes the SPRY3 overexpression group (n=5). (B) Tumor weight statistics (n=5). (C) Body weight statistics of mice (n=5). (D) IHC analysis of Ki67 expression, scale bar, 100μm. (E) SPRY3 expression in 32 PC tissues and adjacent normal tissues, GAPDH was acted as the endogenous control (n=3). (F) Survival analysis based on low/high SPRY3 expression in 32 patients with PC. Welch correction test was performed to assess the mean differences between groups, and One-way ANOVA was used to assess the differences among three groups. ∗p \\u0026lt; 0.05, ∗∗p \\u0026lt; 0.01, ∗∗∗p \\u0026lt; 0.001, ∗∗∗∗p \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/fe5b0611c5a57c0022f80adf.jpeg\"},{\"id\":99792207,\"identity\":\"8040f9bc-df1f-4109-877a-3fa4f6666e8e\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:16:15\",\"extension\":\"jpeg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1437149,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSchematic diagram illustrating how pancreatic cancer cell-derived exosomal miR-4644 promotes tumor progression by targeting SPRY3.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/0e2c538317c753f7c6b232af.jpeg\"},{\"id\":102297722,\"identity\":\"8b936f75-47fd-45c0-bec4-0f20c8733ff8\",\"added_by\":\"auto\",\"created_at\":\"2026-02-10 10:28:57\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":9745238,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/cc248dc4-b5fd-427b-aac0-a697528fdd16.pdf\"},{\"id\":99513872,\"identity\":\"04f1aee5-a293-4d26-9902-840152c35348\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 09:58:16\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":827991,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S2rawimages.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/e18f06a837a250a34ead9106.docx\"},{\"id\":99790853,\"identity\":\"c7eb3385-085e-4769-9a82-39ec08745276\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:45\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":5916604,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplements.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/9b650a87e41ab6d496cb3837.docx\"},{\"id\":99790992,\"identity\":\"d8c3c10d-5ff8-498e-ae5c-3068e77e5609\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:55\",\"extension\":\"xlsx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":28300,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"data.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8338211/v1/153d6472f50c1aeb690addf0.xlsx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Exosomal miR-4644 targets SPRY3 to promote proliferation and invasion of pancreatic cancer\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003ePancreatic cancer (PC) is a highly aggressive gastrointestinal (GI) malignancy, characterized by a five-year survival rate of less than 10%[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Its rapid progression and high propensity for distant metastasis significantly contribute to the substantial disease burden[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Notably, due to the lack of effective diagnostic and therapeutic markers, many patients with PC experience disease progression by the time of diagnosis. While cancer antigen 199 (CA199) is a widely used marker for PC diagnosis, its sensitivity and specificity are limited. Consequently, a deeper understanding of the molecular mechanisms driving PC progression is crucial for identifying novel therapeutic targets and biomarkers for early diagnosis and prognosis.\\u003c/p\\u003e \\u003cp\\u003eExosomes, 40\\u0026ndash;160 nm vesicles (average 100 nm) secreted by various cell types, contain diverse molecular cargo, including DNAs, non-coding RNAs (ncRNAs), lipids, proteins, and metabolites[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Tumor-derived exosomes (TDEs) are readily internalized by recipient tumor cells, where they facilitate malignancy progression. For example, colon cancer cells harboring mutant Kirsten rat sarcoma virus (KRAS) release exosomes containing mutant KRAS and epidermal growth factor receptor (EGFR), promoting the intercellular transfer of oncogenic signals[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Exosomes have been shown to regulate PC progression and intercellular communication, primarily through their molecular contents such as medium-chain acyl-CoA dehydrogenase (ACADM) and macrophage migration inhibitory factor (MIF) [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Exosomal microRNAs (miRNAs), 18\\u0026ndash;22 nucleotide-long endogenous ncRNAs, play key roles in modulating target gene expression and influencing PC progression [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. For instance, exosomal miR-30b-5p, upregulated under hypoxic conditions, promotes angiogenesis in PC by inhibiting gap junction protein 1 (GJA1)[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Liu et al.[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e] reported that reduced expression of miR-485-3p correlates with stemness and chemoresistance in PC. miR-4644, upregulated in serum-derived exosomes from patients with PC has shown high sensitivity and specificity for diagnosing PC[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Subsequent studies have linked miR-4644 to tumor progression, positioning it as a promising diagnostic biomarker for PC[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. While miR-4644 has been implicated in the progression of bladder cancer and colorectal adenocarcinoma (CRC)[\\u003cspan additionalcitationids=\\\"CR14\\\" citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], the precise mechanisms by which exosomal miR-4644 modulates PC progression remain unclear. Thus, this study seeks to investigate the underlying mechanisms through which exosomal miR-4644 contributes to PC progression.\\u003c/p\\u003e \\u003cp\\u003eMiRNAs regulate protein-coding gene expression by binding to their target mRNAs[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Sprouty (SPRY) proteins, known to be modulated by miRNAs, are pivotal regulators of the Receptor Tyrosine Kinase/Rat Sarcoma Virus/Mitogen-Activated Protein Kinase (RTK/Ras/MAPK) signaling pathway. The downregulation of SPRY proteins is commonly associated with tumor progression[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Activation of the RTK/Ras/MAPK pathway is a well-established mechanism driving PC progression. However, the specific role of SPRY RTK Signaling Antagonist 3 (SPRY3), a key RTK signaling antagonist, in promoting PC progression remains poorly understood. Additionally, silencing SPRY3 has been shown to facilitate the malignant transformation of cancers. For instance, nasopharyngeal carcinoma (NPC)-derived exosomal miR-10-5p and miR-18a upregulated the expression of vascular endothelial growth factor (VEGF) and Hypoxia-inducible factor 1-alpha (HIF1-α) by silencing SPRY3 to promote angiogenesis in vitro and in vivo[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Despite these observations, the mechanism by which miR-4644 regulates SPRY3 and influences PC progression remains to be fully elucidated.\\u003c/p\\u003e \\u003cp\\u003eThis study revealed that miR-4644 is highly expressed in exosomes derived from PC cells and promotes both cell proliferation and invasion. Further investigation identified SPRY3 as a direct target of miR-4644, with SPRY3 overexpression mitigating the aggressive behavior of PC cells. Exosomal miR-4644 drives PC progression by downregulating SPRY3. These findings position miR-4644 as a potential therapeutic target and diagnostic biomarker for PC.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBiological tissue samples\\u003c/h2\\u003e \\u003cp\\u003eThe 32 pairs of PC and adjacent non-tumor tissues were obtained from Peking University First Hospital (Beijing, China), with sample collection approved by the Peking University First Hospital Ethics Committee (NO: 2024194). The study was conducted in accordance with the Declaration of Helsinki, and all participants provided written informed consent.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCell culture\\u003c/h3\\u003e\\n\\u003cp\\u003eThe PC cell lines AsPC-1 and BxPC-3, along with the pancreatic ductal epithelial cell (hTERT-HPNE) were acquired from the American Type Culture Collection (ATCC, Manassas, USA). HEK-293T cells were generously donated by the Department of Biochemistry and Molecular Biology at Peking University. For cell culture, HEK-293T, AsPC-1, and hTERT-HPNE cells were cultured in Dulbecco\\u0026rsquo;s Modified Eagle Medium (DMEM; Gibco, USA), while BxPC-3 cells were cultured in RPMI 1640 Medium (Gibco, USA). All culture media contained with 10% fetal bovine serum (FBS; Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA). All cells were cultured at 37 ℃ in an incubator containing 5% CO2.\\u003c/p\\u003e\\n\\u003ch3\\u003eWestern blotting (WB)\\u003c/h3\\u003e\\n\\u003cdiv class=\\\"Heading\\\"\\u003eWestern blotting (WB)\\u003c/div\\u003e \\u003cp\\u003eFirstly, washed tumor cells twice with PBS, and lysed in Pierce IP lysis buffer (ThermoFisher Scientific, USA) containing protease inhibitors (87785, ThermoFisher Scientific, USA) and phosphatase inhibitors (A32957, ThermoFisher Scientific, USA) to extract total proteins. Next, the total protein concentrations were quantified using the BCA assay, followed by adding 5 \\u0026times; loading buffer. A total of 20\\u0026micro;g protein of each sample was loaded onto a 10% Tris-HCl gradient gel (Invitrogen, USA) and subjected to electrophoresis. The proteins were then transferred to a PVDF membrane. Then, blocked the membrane with 5% skimmed milk, and incubated it with primary antibodies: Calnexin (10427-2-AP, Proteintech), CD9 (ab307085, Abcam), HSP70 (ab181606, Abcam), TSG101 (ab125011, Abcam). The corresponding protein bands were detected following incubation with appropriate secondary antibodies.\\u003c/p\\u003e\\n\\u003ch3\\u003eExosome isolation and characterization\\u003c/h3\\u003e\\n\\u003cp\\u003eFirst, AsPC-1, BxPC-3, and hTERT-HPNE cells were cultured in 10% exosome-depleted FBS medium. Exosomes were then enriched through differential centrifugation with following steps: 1,500 g for 5 min at 4\\u0026deg;C, 2,500 g for 20\\u0026ndash;30 min at 4\\u0026deg;C, and finally, 100,000 g for 90 min twice at 4\\u0026deg;C. Then, characterized isolated exosomes. Physical characterization: Exosome size and concentration were examined using nanoparticle tracking analysis (NTA, NanoSight NS3000, UK). Exosome morphology was analyzed by transmission electron microscopy (TEM, HT-7700, Japan). Briefly, exosomes were diluted in PBS, applied to carbon-coated copper grids, and stained with 2.5% uranyl acetate for 10 min. TEM images were captured using a Hitachi H-7700 electron microscope[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Biochemical validation: Positive identification was confirmed through detection of exosomal markers (CD9, TSG101, HSP70), and cellular contamination was excluded by the absence of the endoplasmic reticulum marker (Calnexin)[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e].\\u003c/p\\u003e\\n\\u003ch3\\u003eExosome uptake assay\\u003c/h3\\u003e\\n\\u003cp\\u003eExosomes were fluorescently labeled with PKH67 green fluorescent dye (Sigma, USA), and the reaction was terminated by adding 0.3% bovine serum albumin (BSA). The PKH67-labeled exosomes were subsequently purified through ultracentrifugation at 100,000g for 70 min[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. For cellular uptake assay, these PKH67-labeled exosomes were co-incubated with AsPC-1 and BxPC-3 cells. After incubation, fixed cells with 4% paraformaldehyde (PFA) for 15 min at room temperature, stained nuclei with 4',6-diamidino-2-phenylindole (DAPI, Invitrogen, USA), then washed three times with PBS to remove excess stain[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Representative images were captured through confocal microscope (Leica, Germany).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTotal RNA isolation and quantitative real-time PCR (qRT-PCR)\\u003c/h2\\u003e \\u003cp\\u003eTotal exosomal RNA was isolated from exosomes derived from AsPC-1, BxPC-3, and hTERT-HPNE cells using the miRNeasy Mini Kit (QIAGEN, Germany), and cellular RNA was isolated using Trizol reagent (Invitrogen, USA). For cDNA synthesis, 2 \\u0026micro;g total RNA was reverse transcribed using the ReverseTra Ace qRT-PCR kit (FSQ-101/FSQ-201, TOYOBO, Japan). Next, qRT-PCR was performed using the SYBR Green Realtime PCR Master Mix (Q711-02, Vazyme Biotech, China). Target genes or miRNAs expression quantification was performed using the 2^(-ΔΔCT) method, and the endogenous controls were GAPDH for cellular RNA, U6 for cellular miRNA, and miR-39a-3p for exosomal miRNA. The primers used for qRT-PCR are listed as follows:\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimers\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003emiR-4644-RT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eU6-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTCGCTTCGGCAGCACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eU6-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAACGCTTCACGAATTTGCGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003emiR-39a-3p\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eUCACCGGGUGUAAAUCAGCUUG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003emiR-4644-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGCGTGGAGAGAGAAAAGAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003emiR-4644-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGTGCAGGGTCCGAGGTATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTATTGGGCGCCTGGTCACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGCTCCTGGAAGATGGTGATGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSPRY3-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAATCTAGCATTGCCAGCTCAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSPRY3-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTTCAGAGCACCATCAGCCTTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eMiRNA Transfection\\u003c/h3\\u003e\\n\\u003cp\\u003eMiRNA mimics and inhibitors (NC/miR-4644) were purchased from Ribio (Guangzhou, Guangdong, China). Each miRNA mimics and inhibitors (5 nM) were transfected into AsPC-1 and BxPC-3 cells using Lipofectamine RNAiMAX Reagent (ThermoFisher Scientific, USA)[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Briefly, 5 nM miRNA mimics or inhibitors were mixed with 5 \\u0026micro;l RNAiMAX Reagent and 125 \\u0026micro;l Opti-MEM medium (Gibco, USA) before transfection. Following 6\\u0026ndash;8 hours incubation at 37\\u0026deg;C, the transfection mixture was replaced with complete medium. Cells were collected for subsequent experiments after 48 hours.\\u003c/p\\u003e\\n\\u003ch3\\u003ePlasmid transfection\\u003c/h3\\u003e\\n\\u003cp\\u003eThe SPRY3 overexpression (OE) plasmid and corresponding negative control (NC) were purchased from Syngenbio (Qingdao, China). Transfection was performed using 5 ng plasmid DNA with 5 \\u0026micro;l Lipofectamine 3000 (ThermoFisher Scientific, USA) according to the manufacturer's protocol. Following 6\\u0026ndash;8 hours incubation at 37\\u0026deg;C, the transfection mixture was replaced with complete medium. Transfected cells were collected for subsequent experiments after 48 hours.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDual luciferase report assay\\u003c/h2\\u003e \\u003cp\\u003eA dual-luciferase reporter vector containing the SPRY3 3' UTR (wild-type/mutant) was constructed by Syngenbio (Qingdao, China). HEK-293T cells were transfected with miR-4644 mimics and the constructed reporter vector using Lipofectamine 3000. After transfecting 48 hours, quantified luciferase activity using the Dual-Luciferase Reporter Assay Kit (Beyotime Biotechnology, China) according to the manufacturer's protocol. Finally, measured firefly luciferase activity versus renilla luciferase activity for each sample using a chemiluminescence instrument (Molecular Devices, USA), and normalized these values[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell Counting Kit-8 assay\\u003c/h2\\u003e \\u003cp\\u003eCell proliferation was measured through Cell Counting Kit-8 (CCK-8, Dojindo Molecular Technologies, Japan). Firstly, seeded AsPC-1 and BxPC-3 cells in 96-well plates at a density of 1\\u0026times;10⁴ cells/well (100 \\u0026micro;L/well) and cultured them under standard conditions. After incubating for 24, 48, and 72 hours, diluted the CCK-8 solution with FBS-free medium to 10%, and added 100 \\u0026micro;l to the wells. Following another 2-hour incubation, measured the absorbance at 450 nm and 630 nm using a chemiluminescence instrument (Molecular Devices, SpectraMax i3).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell colony formation assay\\u003c/h2\\u003e \\u003cp\\u003eFor the colony formation assay, 1 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e AsPC-1 or BxPC-3 cells were plated in six-well plates and cultured with fresh medium every 2\\u0026ndash;3 days. After 14-days incubation, cells were processed as follows: (1) Washed them twice with PBS. (2) Fixed them with 4% PFA for 15 min at room temperature. (3) Stained them with 0.1% crystal violet solution for 15 min. (4) Washed another three times with PBS to remove excess stain. Finally, colony numbers containing\\u0026thinsp;\\u0026gt;\\u0026thinsp;50 cells were counted using Image J software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell migration/invasion assay\\u003c/h2\\u003e \\u003cp\\u003eCell migration and invasion capacities were evaluated using 8 \\u0026micro;m pore-size transwell models (Corning, NY, USA). The details are as follows: (1) Cell Preparation: Suspend BxPC-3 and AsPC-1 cells in serum-free medium at a concentration of 5 \\u0026times; 10⁵ cells/mL, then loaded 200 \\u0026micro;L cell suspension (1\\u0026times;10⁵ cells/well) into the upper chamber of the transwell model. (2) Matrix Coating (invasion only): Pre-coated membranes with 100 \\u0026micro;L Matrigel Matrix (1:8 dilution in PBS; Corning, NY, USA), then polymerize at 37 ℃ for 1 hour. (3) Lower Chamber Preparation: Added 600 \\u0026micro;L medium to the lower chamber with 10% FBS for cell migration, and 600 \\u0026micro;L medium with 20% FBS for cell invasion. (4) Quantification. After 48 hours incubation, washed the membranes twice with PBS, fixed them with 4% PFA for 15 min at room temperature, stained them with 0.1% crystal violet solution for 15 min, then washed another three times with PBS to remove excess stain, and obtained representative images under a microscope. Finally, counted migrated cells using Image J software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFlow cytometry\\u003c/h2\\u003e \\u003cp\\u003eFirstly, digested AsPC-1 and BxPC-3 cells by using 0.25% trypsin-EDTA (Gibco, USA), fixed them with 4% PFA for 15 min at room temperature, permeabilized them using a 1% perforation solution for 10 min at 4\\u0026deg;C, then blocked cells with 5% BSA for 30 min at 4\\u0026deg;C. Then, incubated cells with anti-SPRY3 primary antibody (1:200 dilution, 17932-1-AP, Proteintech) in 1% BSA/PBS overnight at 4\\u0026deg;C. Next, washed cells three times with PBS, and incubated them with Alexa Fluor 647-conjugated secondary antibody (1:1000, A-21244, ThermoFisher Scientific) for 1 hour at room temperature. After washing the cells three times with PBS, acquired 10,000 single-cell events per sample and assessed the expression of SPRY3 using flow cytometry.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEstablishment of in situ xenograft nude mouse model\\u003c/h2\\u003e \\u003cp\\u003eSix-week-old nude mice were sourced from Charles River Co., Ltd. (Beijing). All procedures adhered to protocols approved by the Ethics Committee of the National Centre for Nanoscience and Technology. Briefly, the left epigastrium was sterilized with 75% ethanol, and a 1 cm incision was made to expose the tail of the pancreas. Then, slowly injected 50 \\u0026micro;L of AsPC-1 or BxPC-3 cell suspension (5\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL in PBS/Matrigel [1:1]) into the pancreas using an insulin syringe, and sutured the wound. After 21 days, the mice were euthanized by 40% CO\\u003csub\\u003e2\\u003c/sub\\u003e asphyxiation, and measured tumor weights (g) and animal weights (g). All methods were carried out in accordance with relevant guidelines and regulations. All methods are reported in accordance with ARRIVE guidelines (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://arriveguidelines.org\\u003c/span\\u003e\\u003cspan address=\\\"https://arriveguidelines.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemistry (IHC)\\u003c/h2\\u003e \\u003cp\\u003eTissue sections were deparaffinized in xylene after fixation in 4% PFA, rehydrated with ethanol, and rinsed with PBS. Next, blocked endogenous peroxidase activity with 3% H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e in methanol for 15 min, performed heat-induced epitope retrieval in 0.01 M citrate buffer (pH 6.0) at 95℃ for 20 min, and cooled to room temperature (about 30 min). After cooling, blocked sections with 10% goat serum for 1 hour at room temperature, and incubated with primary antibodies against SPRY3 (17932-1-AP, Proteintech) or Ki-67 overnight at 4 ℃. Afterward, washed sections with PBS\\u0026thinsp;+\\u0026thinsp;0.1% Tween-20 (3 \\u0026times; 5 min), and incubated with HRP-conjugated secondary antibody (1:500) for 1 hour at room temperature. Then, stained them with diaminobenzidine (DAB) for 5 min. Nuclei were counterstained with Mayer\\u0026rsquo;s hematoxylin (Biodee, China). Five random images per section were captured, and the expression of SPRY3 and Ki-67 was quantified.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eData from three independent experiments were analyzed using GraphPad Prism 9.5.0 software. Results are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD). Comparisons between two groups were performed using non-parametric tests or independent samples t-tests, while multiple comparisons were performed using one-way ANOVA, Bonferroni or Dunnett tests. All tests were two-tailed, and differences are statistically significant at \\u0026lowast;p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, \\u0026lowast;\\u0026lowast;p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, \\u0026lowast;\\u0026lowast;\\u0026lowast;p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, \\u0026lowast;\\u0026lowast;\\u0026lowast;\\u0026lowast;p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001, ns means no significance.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e1.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eIsolation and identification of exosomes from PC cells\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTDEs facilitate intercellular communication, promoting tumor cell proliferation and metastasis[27]. To explore the regulatory mechanisms of exosomes in PC cells, TDEs (Exo (A) and Exo (B)) were isolated from AsPC-1 and BxPC-3 cells and characterized using TEM and NTA[20]. The size of the TDEs was found to be approximately 150 nm \\u003cstrong\\u003e(Fig. 1A, Fig. S1A)\\u003c/strong\\u003e. Western blot analysis further confirmed the presence of exosomal markers, such as CD9, TSG101, and HSP70, along with the negative marker Calnexin\\u003cstrong\\u003e\\u0026nbsp;(Fig. S1B)\\u003c/strong\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003ePC cell-derived exosomes facilitate the proliferation, migration, and invasion of pancreatic cancer\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo investigate the impact of TDEs on PC progression, whether exosomes could be internalized by PC cells was determined. After co-incubating PKH67-labeled exosomes with AsPC-1 and BxPC-3 cells, a strong green fluorescent signal was observed in the PC cells\\u003cstrong\\u003e\\u0026nbsp;(Fig. 1B)\\u003c/strong\\u003e. To examine the effect of TDEs on PC progression, AsPC-1 and BxPC-3 cells were treated with isolated TDEs. CCK-8 and colony formation assays demonstrated that TDEs significantly enhanced PC cell proliferation compared to the control group (Ctrl) \\u003cstrong\\u003e(Fig. 1C-D)\\u003c/strong\\u003e. Additionally, transwell assays confirmed that TDEs promoted PC cell migration and invasion \\u003cstrong\\u003e(Fig. 1E-F)\\u003c/strong\\u003e. Collectively, these results suggest that TDEs are internalized by PC cells and markedly increase their proliferation, migration, and invasion capabilities.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eMiR-4644 is enriched in PC-derived exosomes and acts as an oncogenic miRNA in PC progression\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eExosomal miRNAs play a pivotal role in mediating intercellular communication. To further elucidate the mechanisms by which exosomal miRNAs regulate PC progression, highly expressed serum exosomal miRNAs were identified from patients with PC using the GEO online database (GSE50632). Among these, miR-4644 was notably upregulated in serum exosomes of patients with PC \\u003cstrong\\u003e(Fig. 2A)\\u003c/strong\\u003e. Notably, elevated expression of miR-4644 was strongly correlated with poor prognosis in patients with PC, as confirmed through online survival analysis (https://www.kmplot.com/analysis/) \\u003cstrong\\u003e(Fig. 2B)\\u003c/strong\\u003e. The differential miRNAs were further analyzed using KEGG and GO enrichment analysis \\u003cstrong\\u003e(Fig. 2C-D)\\u003c/strong\\u003e[28]. These results revealed that these upregulated miRNAs are predominantly enriched in cancer-related pathways, including the Hippo signaling pathway and the Neurotrophic receptor tyrosine kinase (NTRK) receptor signaling pathway[29, 30]. Moreover, the expression levels of cellular and exosomal miR-4644 in hTERT-HPNE, AsPC-1, and BxPC-3 cells were assessed. qRT-PCR analysis revealed that, compared to miR-4644 expression in hTERT-HPNE cells and Exo (H), miR-4644 was highly expressed in AsPC-1 cells but at relatively low levels in Exo (A). Conversely, Exo (B) exhibited significantly higher levels of miR-4644, despite lower expression in BxPC-3 cells \\u003cstrong\\u003e(Fig. 2E-F)\\u003c/strong\\u003e. These results suggest that miR-4644, as an oncogenic miRNA, may contribute to PC progression by accumulating in TDEs. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e4.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003ePC cell-derived exosomal miR-4644 facilitates proliferation, migration, and invasion.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo explore the role of miR-4644 in PC progression, miR-4644 mimics and inhibitors (miR-4644/miR-4644i) were transfected into AsPC-1 and BxPC-3 cells. Transfection efficiency was confirmed \\u003cem\\u003evia\\u003c/em\\u003e qRT-PCR \\u003cstrong\\u003e(Fig. S2A)\\u003c/strong\\u003e. Subsequent biological assessments of miR-4644/miR-4644i effects on PC cells revealed that miR-4644 promoted cell proliferation, whereas miR-4644i suppressed growth \\u003cstrong\\u003e(Fig. 3A, Fig. S2B)\\u003c/strong\\u003e. Plate cloning assays further showed that miR-4644 overexpression enhanced clonogenic capacity, while inhibition of miR-4644 diminished clonogenic activity \\u003cstrong\\u003e(Fig. 3C, Fig. S2C)\\u003c/strong\\u003e. Additionally, miR-4644 was found to significantly promote PC cell migration and invasion \\u003cstrong\\u003e(Fig. 3E-F, Fig. S2D-E)\\u003c/strong\\u003e. Notably, no significant effects were observed in control groups (negative control mimic (NC), NC inhibitor (NCi), or blank Ctrl), confirming the specificity of miR-4644/miR-4644i effects \\u003cstrong\\u003e(Fig. S3A-D)\\u003c/strong\\u003e. To further investigate the role of exosomal miR-4644 in PC progression, exosome rescue assays were designed, where AsPC-1 and BxPC-3 cells were co-cultured with exosomes (Exo (A) and Exo (B)) and NCi/miR-4644i. CCK-8 and plate cloning assays revealed that inhibiting miR-4644 partially reduced the proliferative effects of TDEs on AsPC-1 and BxPC-3 cells \\u003cstrong\\u003e(Fig. 3B, D)\\u003c/strong\\u003e. Additionally, miR-4644i reduced the motility of TDEs on AsPC-1 and BxPC-3 cells\\u003cstrong\\u003e\\u0026nbsp;(Fig. 3G, Fig. S2F)\\u003c/strong\\u003e. These results suggest that exosomal miR-4644, encapsulated in PC cell-derived exosomes, contributes to PC cell proliferation, migration, and invasion.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e5.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003eSPRY3 was the target gene of miR-4644.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo predict the target genes of miR-4644, we firstly analyzed downstream pathways by miRPath v3.0, revealing its involvement in the PI3K-Akt and MAPK signaling pathways \\u003cstrong\\u003e(Fig. 4A)\\u003c/strong\\u003e[31]. Additional bioinformatics tools, including mirDP, miRDB, miRWalk, miRgator, and miRPathDB, identified 127 common target genes\\u003cstrong\\u003e\\u0026nbsp;(Fig. 4B)\\u003c/strong\\u003e[32]. GO enrichment analysis showed that these target genes were enriched in cell adhesion and cancer-related pathways\\u003cstrong\\u003e\\u0026nbsp;(Fig. S4A)\\u003c/strong\\u003e. Further qRT-PCR analysis of the top-ranked genes revealed SPRY3 as the most significantly affected target of miR-4644 \\u003cstrong\\u003e(Fig. S4B)\\u003c/strong\\u003e. SPRY proteins are known inhibitors of the MAPK pathway, and bioinformatics analysis suggested that miR-4644 could bind to the 3'-untranslated region (3'-UTR) of SPRY3[33, 34].\\u003c/p\\u003e\\n\\u003cp\\u003eNext, we examined the expression of SPRY3 in hTERT-HPNE, AsPC-1 and BxPC-3 cells, the result showed a significant negative correlation with the expression of exosomal miR-4644 compared to hTERT-HPNE exosomes\\u003cstrong\\u003e\\u0026nbsp;(Fig. 4C)\\u003c/strong\\u003e. The luciferase reporter assay further validated that miR-4644 could directly target the 3ʹ-UTR of SPRY3\\u003cstrong\\u003e\\u0026nbsp;(Fig. 4D)\\u003c/strong\\u003e. Additionally, qRT-PCR results showed that miR-4644 silenced SPRY3 expression in AsPC-1 and BxPC-3 cells, with the inhibition of miR-4644 reversing this downregulation induced by Exo (A/B)\\u003cstrong\\u003e\\u0026nbsp;(Fig. 4E, Fig. S4C)\\u003c/strong\\u003e. Flow cytometry also demonstrated the downregulation of SPRY3 after transfecting miR-4644 \\u003cstrong\\u003e(Fig. 4F,\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;Fig. S4D)\\u003c/strong\\u003e, while miR-4644i enhanced the expression of SPRY3 \\u003cstrong\\u003e(Fig. 4G, Fig. S4E)\\u003c/strong\\u003e.\\u0026nbsp;Notably, miR-4644i partially reversed the Exo (A/B)-mediated suppression of SPRY3 (Fig. 4H, Fig. S4F). These results demonstrate that miR-4644 directly modulates SPRY3 expression, which plays a pivotal role in PC progression.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e6.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003ePC cell-derived exosomal-miR-4644 promotes proliferation, migration, and invasion \\u003cem\\u003evia\\u003c/em\\u003e targeting SPRY3\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSPRY3 is reported to be the direct target of miR-4644, and the rescue experiment was performed to validate whether miR-4644 influences PC progression by targeting SPRY3. Firstly, SPRY3-overexpressing PC cells were successfully constructed and confirmed by qRT-PCR and gel electrophoresis \\u003cstrong\\u003e(Fig. 5A, Fig. S5A)\\u003c/strong\\u003e. The flow cytometry results also showed a significant upregulation of SPRY3 after transfecting the SPRY3 OE plasmid, but its expression was reduced following transfection with miR-4644 mimics (OE+miR-4644) \\u003cstrong\\u003e(Fig. 5B, Fig. S5B)\\u003c/strong\\u003e. Subsequent CCK-8 and colony formation assays demonstrated that PC cell proliferation was significantly suppressed in the OE group, but miR-4644 reversed the inhibitory effect of SPRY3 \\u003cstrong\\u003e(Fig. 5C-D)\\u003c/strong\\u003e. Transwell assays demonstrated that migration and invasion were significantly reduced in SPRY3-OE cells compared to the NC group \\u003cstrong\\u003e(Fig. 5E, Fig. S5C)\\u003c/strong\\u003e. Collectively, these findings indicate that miR-4644 effectively counteracts the inhibition of PC cell proliferation, migration, and invasion caused by overexpressing SPRY3, suggesting that miR-4644 promotes PC progression by silencing SPRY3. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e7.\\u0026nbsp; \\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003ePC TDEs miR-4644 promote proliferation by targeting SPRY3 in vivo\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe in-situ xenograft models were established to investigate the roles of miR-4644 and SPRY3 in PC. The result showed that tumor weight was smaller in the SPRY3-OE group than in NC group \\u003cstrong\\u003e(Fig. 6A-B)\\u003c/strong\\u003e The tumor weight in the SPRY3-OE+miR-4644 group was bigger than the SPRY3-OE group, which implied that the miR-4644 could promote the progression of PC\\u003cstrong\\u003e\\u0026nbsp;(Fig. 6A-B)\\u003c/strong\\u003e. Notably, miR-4644 promoted PC growth without affecting body weight\\u003cstrong\\u003e\\u0026nbsp;(Fig. 6C)\\u003c/strong\\u003e. Further IHC analysis revealed upregulation of SPRY3 in the SPRY3-OE group and the downregulation of SPRY3 in SPRY3-OE+miR-4644 group implied that miR-4644 could inhibit the expression of SPRY3 \\u003cstrong\\u003e(Fig. S5D)\\u003c/strong\\u003e. The Ki67 expression in the decreased in the SPRY3-OE group than the NC group. Conversely, there was a notable increase in Ki67 expression after miR-4644 treatment, which further supported that SPRY3 was the target of miR-4644 \\u003cstrong\\u003e(Fig. 6D)\\u003c/strong\\u003e. To explore the clinical relevance of SPRY3, we examined SPRY3 expression in 32 PC tissues and adjacent normal tissues \\u003cstrong\\u003e(Table 1)\\u003c/strong\\u003e. The qRT-PCR results revealed that SPRY3 expression was significantly lower in PC tissues \\u003cstrong\\u003e(Fig. 6E)\\u003c/strong\\u003e. Moreover, high SPRY3 expression in tumors correlated to better prognosis in PC patients \\u003cstrong\\u003e(Fig. 6F)\\u003c/strong\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, TDE miR-4644 promotes PC progression by targeting SPRY3, highlighting its potential as both a therapeutic target and diagnostic biomarker for PC\\u003cstrong\\u003e\\u0026nbsp;(Fig. 7)\\u003c/strong\\u003e.\\u003c/p\\u003e\"},{\"header\":\"Conclusion and Discussion\",\"content\":\"\\u003cp\\u003eTDEs are advantageous for tumor utilization due to their organ-targeting properties and thus participate in cancer initiation and progression, including tumor microenvironment (TME) remodeling, angiogenesis, invasion, metastasis, and drug resistance. Notably, increasing evidence suggested that dysregulation of exosomal miRNAs played important roles in affecting tumor progression[35, 36]. MiR-4644, particularly exosomal miR-4644, has been reported to be associated with the advancement of multiple malignancies. For example, miR-4644 competitively bound to Tripartite Motif Containing 44 (TRIM44) via the long non-coding RNA (lncRNA) ELFN1-AS1, promoting pro-proliferative, anti-apoptotic, and pro-migratory effects in CRC cells[13, 37]. Wu et al.[14] further demonstrated that miR-4644 is significantly associated with distant metastasis in CRC.\\u0026nbsp;Remarkably, exosomal miR-4644 had been shown to facilitate proliferation and invasion in bladder cancer by targeting UbiA prenyltransferase domain-containing protein 1 (UBIAD1)[15]. However, there is little evidence on how miR-4644 affects the biological behavior of PC, and our study compensate the inadequacy by validating the oncogenic role of exosomal miR-4644 on PC progression. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eIn addition, prior studies on exosomal miR-4644 have primarily focused on its diagnostic significance in GI tumors. For example, miR-4644 exhibited higher stability and expression levels in hepatocellular carcinoma (HCC), and was predicted to be a promising biomarker for early diagnosis of lenvatinib resistance in HCC[38, 39]. Another meta-analysis on exosomal miRNA expression in GI cancers identified miR-4644 as a minimally invasive biomarker for GI tumor diagnosis[40]. Additionally, the upregulated miR-4644 was verified in gemcitabine-resistant pancreatic cell line (SW1990/GEM), suggesting its utility in detecting drug resistance in PC patients[41]. Therefore, high-expressed miR-4644 is an important marker of GI tumors. For investigating the regulatory mechanism of miR-4644 on PC progression, we utilized CCK8, plate cloning and transwell assays in both AsPC-1 and BxPC-3 cells to confirm that miR-4644 promoted PC proliferation, migration and invasion.\\u003c/p\\u003e\\n\\u003cp\\u003eNext, we explored target genes of miR-4644 through bioinformatics databases, and identified that miR-4644 bound to the 3'UTR of SPRY3 by dual luciferase reporter gene assay. SPRY family members are lipid-acylated phosphoproteins that act as inhibitors of RTK signaling cascades, such as those involving the epidermal growth factor (EGF) and fibroblast growth factor (FGF) receptor families[42-44]. As a member of SPRY family, the downregulated SPRY3 is related to tumor progression. For example, SPRY3 was reported to enhance the sensitivity of primary acute myeloid leukemia (AML) cells to Quizartinib (AC220), a potent and selective second-generation FMS-like tyrosine kinase 3 (FLT3) inhibitor[45]. However, the mechanisms of how SPRY3 contributes to PC progression remain unclear. In this study, we established stably overexpressed SPRY3 PC cells, and found that SPRY3 suppressed PC cell proliferation, migration, and invasion in vitro, as well as inhibiting PC tumor growth in vivo. Finally, we conducted rescue assays, and the results suggested that miR-4644 targeted SPRY3 to promote PC proliferation, migration and invasion.\\u003c/p\\u003e\\n\\u003cp\\u003eDespite the evidence that miR-4644 promotes PC progression in this study, more details need to be verified. Firstly, it is necessary to enrich serum exosomes from PC patients and verify the high expression of miR-4644 by further sequencing data to prove its oncogenic role. Next, the present evidence cannot support the early diagnostic value of miR-4644 for PC. Therefore, it is necessary to enrich serum exosomes from PC patients and healthy people, to explore the value of miR-4644 in PC early diagnosis. Further, SPRY3 was verified modulating the RTK/Ras/MAPK pathway, and its downregulation is related to tumor progression[46]. In our study, we confirmed that miR-4644 targets SPRY3, but the specific molecular pathway was not validated.\\u003c/p\\u003e\\n\\u003cp\\u003eIn conclusion, our study illustrates that exosomal miR-4644 promotes PC progression by targeting SPRY3. This finding suggests that miR-4644 could serve as a valuable biomarker for early PC detection and as a potential therapeutic target for PC.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003eDAPI: 4',6-diamidino-2-phenylindole\\u003c/p\\u003e\\n\\u003cp\\u003eACADM: medium-chain acyl-CoA dehydrogenase\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eAML: acute myeloid leukemia\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eATCC: American Type Culture Collection\\u003c/p\\u003e\\n\\u003cp\\u003eBSA: bovine serum albumin\\u003c/p\\u003e\\n\\u003cp\\u003eCA199: cancer antigen 199\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eCCK-8: Cell counting Kit-8\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eCHB: chronic hepatitis B\\u003c/p\\u003e\\n\\u003cp\\u003eCRC: colorectal adenocarcinoma\\u003c/p\\u003e\\n\\u003cp\\u003eDAB: diaminobenzidine\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eEGF: epidermal growth factor\\u003c/p\\u003e\\n\\u003cp\\u003eEGFR: epidermal growth factor receptor\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eFGF: fibroblast growth factor\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eFLT3: FMS-like tyrosine kinase 3\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eGI: gastrointestinal\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eGJA1: the gap junction 1\\u003c/p\\u003e\\n\\u003cp\\u003eHCC: hepatocellular carcinoma\\u003c/p\\u003e\\n\\u003cp\\u003eHIF1-α: Hypoxia-inducible factor 1-alpha\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eHSP70: heat shock protein 70\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eIHC: Immunohistochemical\\u003c/p\\u003e\\n\\u003cp\\u003eKRAS: Kirsten rat sarcoma virus\\u003c/p\\u003e\\n\\u003cp\\u003elncRNA: long non-coding RNA\\u003c/p\\u003e\\n\\u003cp\\u003eMAPK: Mitogen-activated Protein Kinase\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eMIF: migration inhibitory factor\\u003c/p\\u003e\\n\\u003cp\\u003emiRNAs: microRNAs\\u003c/p\\u003e\\n\\u003cp\\u003encRNAs: non-coding RNAs\\u003c/p\\u003e\\n\\u003cp\\u003eNPC: nasopharyngeal carcinoma\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eNTA: nanoparticle tracking analysis\\u003c/p\\u003e\\n\\u003cp\\u003eNTRK: Neurotrophic receptor tyrosine kinase\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePC: Pancreatic cancer\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePDAC: pancreatic ductal adenocarcinoma\\u003c/p\\u003e\\n\\u003cp\\u003ePFA: paraformaldehyde\\u003c/p\\u003e\\n\\u003cp\\u003eRas: Rat Sarcoma Virus\\u003c/p\\u003e\\n\\u003cp\\u003eRTK: receptor tyrosine kinase\\u003c/p\\u003e\\n\\u003cp\\u003eqRT-PCR: quantitative real-time PCR\\u003c/p\\u003e\\n\\u003cp\\u003eSD: standard deviation\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eSPRY: Sprouty\\u003c/p\\u003e\\n\\u003cp\\u003eSPRY3: SPRY RTK Signaling Antagonist 3\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTDEs: Tumor-derived exosomes\\u003c/p\\u003e\\n\\u003cp\\u003eTEM: transmission electron microscopy\\u003c/p\\u003e\\n\\u003cp\\u003eTSG101: tumor susceptibility gene 101\\u003c/p\\u003e\\n\\u003cp\\u003eTME: tumor microenvironment\\u003c/p\\u003e\\n\\u003cp\\u003eTRIM44: Tripartite Motif Containing 44\\u003c/p\\u003e\\n\\u003cp\\u003eUBIAD1: UbiA prenyltransferase domain-containing protein 1\\u003c/p\\u003e\\n\\u003cp\\u003eVEGF: vascular endothelial growth factor\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eWB: Western blotting\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements:\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Mingjie Chen (Shanghai NewCore Biotechnology Co., Ltd.) for providing data analysis and visualization support.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was supported by National Natural Science Foundation of China (NO. 82171722, 82271764), Beijing Municipal Natural Science Foundation (7212111), the National Key Research and Development Program of China (2021YFA0909900, 2023YFF0714500).\\u0026nbsp;The “Seed Program” in Beijing Friendship Hospital (No. YYZZ202419)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors’ contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDongqi Li and Xiangyu Chu operate this work and designed all figures; Yongsu Ma, Fusheng Zhang and yongqi Deng provided technical support; Yinmo Yang, Yanlian Yang, Chen Wang and Xiaodong Tian provided the design and revision of the manuscript; Yinmo Yang, Xiaodong Tian, Yanlian Yang and Xiangyu Chu obtain funding supports. All authors made substantial, direct and intellectual contribution to the review. All authors read and approved the final manuscript.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors have consented to publish this article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eSiegel, R. L., Giaquinto, A. N. \\u0026amp; Jemal, A. Cancer statistics, 2024. \\u003cem\\u003eCA Cancer J. Clin.\\u003c/em\\u003e \\u003cb\\u003e74\\u003c/b\\u003e (1), 12\\u0026ndash;49 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eClosa, D. Pancreatic cancer, stroma, and exosomes. \\u003cem\\u003eJ. Physiol. Biochem.\\u003c/em\\u003e \\u003cb\\u003e79\\u003c/b\\u003e (1), 205\\u0026ndash;211 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTien, S. C. et al. \\u003cem\\u003eExosomal miRNA 16-5p/29a-3p from pancreatic cancer induce adipose atrophy by inhibiting adipogenesis and promoting lipolysis.\\u003c/em\\u003e iScience, 27(7): p. 110346. (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDemory Beckler, M. et al. Proteomic analysis of exosomes from mutant KRAS colon cancer cells identifies intercellular transfer of mutant KRAS. \\u003cem\\u003eMol. Cell. Proteom.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e (2), 343\\u0026ndash;355 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFenu, G. et al. Unveiling the microRNA landscape in pancreatic ductal adenocarcinoma patients and cancer cell models. \\u003cem\\u003eBMC Cancer\\u003c/em\\u003e. \\u003cb\\u003e24\\u003c/b\\u003e (1), 1308 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAgrawal, P. et al. \\u003cem\\u003eCharacterizing the role of exosomal miRNAs in metastasis\\u003c/em\\u003e. \\u003cem\\u003ebioRxiv\\u003c/em\\u003e, (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYin, Z. et al. \\u003cem\\u003eMacrophage-derived exosomal microRNA-501-3p promotes progression of pancreatic ductal adenocarcinoma through the TGFBR3-mediated TGF-β signaling pathway\\u003c/em\\u003e. \\u003cem\\u003eJ. Experimental Clin. Cancer Res.\\u003c/em\\u003e, 38. (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFarazi, T. A., Hoell, J. I., Morozov, P. \\u0026amp; Tuschl, T. MicroRNAs in human cancer. \\u003cem\\u003eAdv. Exp. Med. Biol.\\u003c/em\\u003e \\u003cb\\u003e774\\u003c/b\\u003e, 1\\u0026ndash;20 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, K. et al. Hypoxic pancreatic cancer derived exosomal miR-30b-5p promotes tumor angiogenesis by inhibiting GJA1 expression. \\u003cem\\u003eInt. J. Biol. Sci.\\u003c/em\\u003e \\u003cb\\u003e18\\u003c/b\\u003e (3), 1220\\u0026ndash;1237 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, X. et al. Hypoxia-induced epigenetic regulation of miR-485-3p promotes stemness and chemoresistance in pancreatic ductal adenocarcinoma via SLC7A11-mediated ferroptosis. \\u003cem\\u003eCell. Death Discov\\u003c/em\\u003e. \\u003cb\\u003e10\\u003c/b\\u003e (1), 262 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMadhavan, B. et al. Combined evaluation of a panel of protein and miRNA serum-exosome biomarkers for pancreatic cancer diagnosis increases sensitivity and specificity. \\u003cem\\u003eInt. J. Cancer\\u003c/em\\u003e. \\u003cb\\u003e136\\u003c/b\\u003e (11), 2616\\u0026ndash;2627 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMachida, T. et al. miR\\u0026ndash;1246 and miR\\u0026ndash;4644 in salivary exosome as potential biomarkers for pancreatobiliary tract cancer. \\u003cem\\u003eOncol. Rep.\\u003c/em\\u003e \\u003cb\\u003e36\\u003c/b\\u003e (4), 2375\\u0026ndash;2381 (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLei, R., Feng, L. \\u0026amp; Hong, D. ELFN1-AS1 accelerates the proliferation and migration of colorectal cancer via regulation of miR-4644/TRIM44 axis. \\u003cem\\u003eCancer Biomark.\\u003c/em\\u003e \\u003cb\\u003e27\\u003c/b\\u003e (4), 433\\u0026ndash;443 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, N. et al. Identification of AP002498.1 and LINC01871 as prognostic biomarkers and therapeutic targets for distant metastasis of colorectal adenocarcinoma. \\u003cem\\u003eCancer Med.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e (1), e6823 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYan, L., Li, Q., Sun, K. \\u0026amp; Jiang, F. MiR-4644 is upregulated in plasma exosomes of bladder cancer patients and promotes bladder cancer progression by targeting UBIAD1. \\u003cem\\u003eAm. J. Transl Res.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e (10), 6277\\u0026ndash;6289 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDo, D. N. et al. \\u003cem\\u003emiRNA Regulatory Functions in Farm Animal Diseases, and Biomarker Potentials for Effective Therapies\\u003c/em\\u003e. \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e, \\u003cb\\u003e22\\u003c/b\\u003e(6). (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSirivatanauksorn, Y. et al. Differential expression of sprouty genes in hepatocellular carcinoma. \\u003cem\\u003eJ. Surg. Oncol.\\u003c/em\\u003e \\u003cb\\u003e105\\u003c/b\\u003e (3), 273\\u0026ndash;276 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, J. et al. Exosomal Delivery of AntagomiRs Targeting Viral and Cellular MicroRNAs Synergistically Inhibits Cancer Angiogenesis. \\u003cem\\u003eMol. Ther. Nucleic Acids\\u003c/em\\u003e. \\u003cb\\u003e22\\u003c/b\\u003e, 153\\u0026ndash;165 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, B., Rui, Y., Li, M. \\u0026amp; Huang, L. Cancer cell-derived exosomes promote NSCLC progression via the miR-199b-5p/HIF1AN axis. \\u003cem\\u003eMol. Immunol.\\u003c/em\\u003e \\u003cb\\u003e174\\u003c/b\\u003e, 32\\u0026ndash;40 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, X. et al. \\u003cem\\u003eExosomes Extraction and Identification.\\u003c/em\\u003e Methods Mol Biol, 2054: pp. 81\\u0026ndash;91. (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTrevisan, F. et al. Isolation and Characterization of Salivary Exosomes for Cancer Biomarker Discovery. \\u003cem\\u003eMethods Mol. Biol.\\u003c/em\\u003e \\u003cb\\u003e2504\\u003c/b\\u003e, 101\\u0026ndash;112 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGonda, A. et al. Exosomal survivin facilitates vesicle internalization. \\u003cem\\u003eOncotarget\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e (79), 34919\\u0026ndash;34934 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhai, K. et al. \\u003cem\\u003eExtracellular vesicle-derived miR-146a as a novel crosstalk mechanism for high-fat induced atherosclerosis by targeting SMAD4\\u003c/em\\u003e. \\u003cem\\u003eJ. Adv. Res.\\u003c/em\\u003e, (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, F. et al. Preliminary study on the mechanism by which exosomes derived from human exfoliated deciduous teeth improve the proliferation and osteogenic inhibitory effect of glucocorticoid-induced BMSCs. \\u003cem\\u003eGene\\u003c/em\\u003e \\u003cb\\u003e923\\u003c/b\\u003e, 148575 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBai, J. et al. MicroRNA-300 inhibits the growth of hepatocellular carcinoma cells by downregulating CREPT/Wnt/beta-catenin signaling. \\u003cem\\u003eOncol. Lett.\\u003c/em\\u003e \\u003cb\\u003e18\\u003c/b\\u003e (4), 3743\\u0026ndash;3753 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXiong, Y. et al. \\u003cem\\u003emiRNA transcriptomics analysis shows miR-483-5p and miR-503-5p targeted miRNA in extracellular vesicles from severe acute pancreatitis-associated lung injury patients.\\u003c/em\\u003e Int Immunopharmacol, 125(Pt A): p. 111075. (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, K. et al. \\u003cem\\u003eThe Role of Exosomes in Pancreatic Cancer From Bench to Clinical Application: An Updated Review\\u003c/em\\u003e. \\u003cem\\u003eFront. Oncol.\\u003c/em\\u003e, 11. (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTang, D. et al. SRplot: A free online platform for data visualization and graphing. \\u003cem\\u003ePLoS One\\u003c/em\\u003e. \\u003cb\\u003e18\\u003c/b\\u003e (11), e0294236 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCai, S. et al. Atorvastatin inhibits pancreatic cancer cells proliferation and invasion likely by suppressing neurotrophin receptor signaling. \\u003cem\\u003eTransl Cancer Res.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e (3), 1439\\u0026ndash;1447 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAnsari, D. et al. The Hippo Signaling Pathway in Pancreatic Cancer. \\u003cem\\u003eAnticancer Res.\\u003c/em\\u003e \\u003cb\\u003e39\\u003c/b\\u003e (7), 3317\\u0026ndash;3321 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVlachos, I. S. et al. DIANA-miRPath v3.0: deciphering microRNA function with experimental support. \\u003cem\\u003eNucleic Acids Res.\\u003c/em\\u003e \\u003cb\\u003e43\\u003c/b\\u003e (W1), W460\\u0026ndash;W466 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi, T., Hu, Z., Tian, L. \\u0026amp; Yang, Y. Pan-cancer landscape of CENPO and its underlying mechanism in LUAD. \\u003cem\\u003eRespir Res.\\u003c/em\\u003e \\u003cb\\u003e24\\u003c/b\\u003e (1), 113 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCelik-Selvi, B. E. et al. \\u003cem\\u003eSprouty3 and Sprouty4, Two Members of a Family Known to Inhibit FGF-Mediated Signaling, Exert Opposing Roles on Proliferation and Migration of Glioblastoma-Derived Cells\\u003c/em\\u003e. \\u003cem\\u003eCells\\u003c/em\\u003e, \\u003cb\\u003e8\\u003c/b\\u003e(8). (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMcGeary, S. E. et al. \\u003cem\\u003eThe biochemical basis of microRNA targeting efficacy\\u003c/em\\u003e. \\u003cem\\u003eScience\\u003c/em\\u003e, \\u003cb\\u003e366\\u003c/b\\u003e(6472). (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRomano, R. et al. \\u003cem\\u003eExtracellular Vesicles and Pancreatic Cancer: Insights on the Roles of miRNA, lncRNA, and Protein Cargos in Cancer Progression\\u003c/em\\u003e. \\u003cem\\u003eCells\\u003c/em\\u003e, \\u003cb\\u003e10\\u003c/b\\u003e(6). (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDaoud, A. Z., Mulholland, E. J., Cole, G. \\u0026amp; McCarthy, H. O. MicroRNAs in Pancreatic Cancer: biomarkers, prognostic, and therapeutic modulators. \\u003cem\\u003eBMC Cancer\\u003c/em\\u003e. \\u003cb\\u003e19\\u003c/b\\u003e (1), 1130 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa, B., Wang, J. \\u0026amp; Yusufu, P. Tumor-derived exosome ElNF1-AS1 affects the progression of gastric cancer by promoting M2 polarization of macrophages. \\u003cem\\u003eEnviron. Toxicol.\\u003c/em\\u003e \\u003cb\\u003e38\\u003c/b\\u003e (9), 2228\\u0026ndash;2239 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao, J. et al. Identification of miR-4644 as a suitable endogenous normalizer for circulating miRNA quantification in hepatocellular carcinoma. \\u003cem\\u003eJ. Cancer\\u003c/em\\u003e. \\u003cb\\u003e11\\u003c/b\\u003e (23), 7032\\u0026ndash;7044 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGao, C. et al. AKR1C1 overexpression leads to lenvatinib resistance in hepatocellular carcinoma. \\u003cem\\u003eJ. Gastrointest. Oncol.\\u003c/em\\u003e \\u003cb\\u003e14\\u003c/b\\u003e (3), 1412\\u0026ndash;1433 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWei, C. et al. Exosomal miR-1246 in body fluids is a potential biomarker for gastrointestinal cancer. \\u003cem\\u003eBiomark. Med.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e (10), 1185\\u0026ndash;1196 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShen, Y. et al. Identifying microRNA-mRNA regulatory network in gemcitabine-resistant cells derived from human pancreatic cancer cells. \\u003cem\\u003eTumour Biol.\\u003c/em\\u003e \\u003cb\\u003e36\\u003c/b\\u003e (6), 4525\\u0026ndash;4534 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKnosp, W. M. et al. Submandibular Parasympathetic Gangliogenesis Requires Sprouty-Dependent Wnt Signals from Epithelial Progenitors. \\u003cem\\u003eDev. Cell\\u003c/em\\u003e. \\u003cb\\u003e32\\u003c/b\\u003e (6), 667\\u0026ndash;677 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang, X., Li, Z., Zhang, J. \\u0026amp; Zhao, W. Identification of two SPRY isoforms SPRY1 and SPRY3 by atomic force microscopy at the single-molecule level. \\u003cem\\u003eAnalyst\\u003c/em\\u003e \\u003cb\\u003e147\\u003c/b\\u003e (24), 5694\\u0026ndash;5700 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKatoh, Y. \\u0026amp; Katoh, M. FGF signaling inhibitor, SPRY4, is evolutionarily conserved target of WNT signaling pathway in progenitor cells. \\u003cem\\u003eInt. J. Mol. Med.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e (3), 529\\u0026ndash;532 (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHou, P. P. et al. A Genome-Wide CRISPR Screen Identifies Genes Critical for Resistance to FLT3 Inhibitor AC220. \\u003cem\\u003eCancer Res.\\u003c/em\\u003e \\u003cb\\u003e77\\u003c/b\\u003e (16), 4402\\u0026ndash;4413 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCabrita, M. A. \\u0026amp; Christofori, G. Sprouty proteins: antagonists of endothelial cell signaling and more. \\u003cem\\u003eThromb. Haemost\\u003c/em\\u003e. \\u003cb\\u003e90\\u003c/b\\u003e (4), 586\\u0026ndash;590 (2003).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003eTable 1. Clinical data of 32 patients with pancreatic cancer\\u003c/p\\u003e\\n\\u003cdiv align=\\\"center\\\"\\u003e\\n \\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"106%\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eVariables\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003eHigh Expression\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003eLow Expression\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003eP value\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eNumber of patients\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e22\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eSex (Male: Female)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e13:9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e5:5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e0.712\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eAges\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026ge; 60\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026lt; 60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003cp\\u003e7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e7\\u003c/p\\u003e\\n \\u003cp\\u003e3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e1.000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eBMI\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026ge; 24.0\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026lt; 24\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e8\\u003c/p\\u003e\\n \\u003cp\\u003e14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003cp\\u003e4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e0.267\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eCA199\\u003c/p\\u003e\\n \\u003cp\\u003eHigh\\u003c/p\\u003e\\n \\u003cp\\u003eLow\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e19\\u003c/p\\u003e\\n \\u003cp\\u003e3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e1.000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eT Stage\\u003c/p\\u003e\\n \\u003cp\\u003e1-2\\u003c/p\\u003e\\n \\u003cp\\u003e3-4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e16\\u003c/p\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e3\\u003c/p\\u003e\\n \\u003cp\\u003e7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e0.049*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eN Stages\\u003c/p\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003cp\\u003e1-2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003cp\\u003e4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e0.712\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eM Stage\\u003c/p\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e22\\u003c/p\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026mdash;\\u0026mdash;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003eAJCC Stages\\u003c/p\\u003e\\n \\u003cp\\u003eⅠ-Ⅱ\\u003c/p\\u003e\\n \\u003cp\\u003eⅢ-Ⅳ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e20\\u003c/p\\u003e\\n \\u003cp\\u003e2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e1.000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 29.5918%;\\\"\\u003e\\n \\u003cp\\u003elymphatic nodes metastasis\\u003c/p\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026ge;1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e17\\u003c/p\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003e2\\u003c/p\\u003e\\n \\u003cp\\u003e8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" style=\\\"width: 23.4694%;\\\"\\u003e\\n \\u003cp\\u003e0.005**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n\\u003c/div\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Pancreatic cancer, Tumor-derived exosomes, Biological behavior, Early diagnosis, Prognostic evaluation, SPRY3\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8338211/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8338211/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eTumor-derived exosomes (TDEs) can carry diverse genetic material that modulates pancreatic cancer (PC) proliferation and invasion. Despite this, the involvement of microRNAs (miRNAs) in exosome-mediated tumor progression in PC remains inadequately explored. This study demonstrates that miR-4644 upregulation in exosomes derived from PC promotes both proliferation and invasion, while its inhibition suppresses tumor progression. SPRY3, a downstream target of miR-4644, acts to mitigate PC malignancy when overexpressed. Mechanistically, elevated miR-4644 in PC-derived exosomes fosters tumor growth and invasion through the suppression of SPRY3. Collectively, these findings indicate that high miR-4644 expression in pancreatic cancer exosomes correlates with poor patient prognosis, highlighting its potential as a biomarker for early diagnosis and prognostic assessment of PC.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Exosomal miR-4644 targets SPRY3 to promote proliferation and invasion of pancreatic cancer\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-01-05 09:58:11\",\"doi\":\"10.21203/rs.3.rs-8338211/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"dd2b711c-b30e-4ef8-bd11-6ae16b5afb36\",\"owner\":[],\"postedDate\":\"January 5th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":60552070,\"name\":\"Health sciences/Biomarkers\"},{\"id\":60552071,\"name\":\"Biological sciences/Cancer\"},{\"id\":60552072,\"name\":\"Health sciences/Oncology\"}],\"tags\":[],\"updatedAt\":\"2026-02-09T17:55:46+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-01-05 09:58:11\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8338211\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8338211\",\"identity\":\"rs-8338211\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}