{"paper_id":"4291b0a4-bad7-4b76-bb11-2fabb501a3c4","body_text":"Histone lactylation-mediated overexpression of RASD2 promotes endometriosis progression via upregulating the SUMOylation of CTPS1\nPublication: American Journal of Physiology-Cell Physiology\nVolume 328, Issue 2\nAmerican Journal of Physiology-Cell Physiology\n- Abstract\n- INTRODUCTION\n- MATERIALS AND METHODS\n- RESULTS\n- Expression Profile of Histone Lactylation in Endometriosis\n- Histone Lactylation Promotes Endometriosis Progression In Vitro\n- Identification of Target Genes for Histone Lactylation\n- Histone Lactylation Promotes Endometriosis Progression via RASD2\n- RASD2 Promotes the Protein Stability of CTPS1 by Promoting the SUMOylation of CTPS1\n- Histone Lactylation/RASD2/CTPS1 Axis Promotes the Progression of Endometriosis\n- Inhibition of Histone Lactylation by Glycolysis Inhibitors Suppresses Endometriosis Progression In Vivo\n- DISCUSSION\n- DATA AVAILABILITY\n- SUPPLEMENTAL MATERIAL\n- GRANTS\n- DISCLOSURES\n- AUTHOR CONTRIBUTIONS\n- SUPPLEMENTAL MATERIAL\n- ACKNOWLEDGMENTS\n- REFERENCES\nAbstract\nHistone lactylation is crucial in a variety of physiopathological processes; however, the function and mechanism of histone lactylation in endometriosis remain poorly understood. Therefore, the objective of this investigation was to illuminate the function and mechanism of histone lactylation in endometriosis. Immunohistochemistry was used to investigate the expression of histone lactylation. Cell Counting Kit-8 assay (CCK8), Transwell assay, and endometriosis mouse models were used to investigate the effects of histone lactylation in vitro and in vivo. Transcriptomics and immunoprecipitation-mass spectrometry (IP-MS), Western blot, co-immunoprecipitation (Co-IP), quantitative reverse transcription polymerase chain reaction (qRT-PCR), and chromatin immunoprecipitation-qPCR (ChIP-qPCR) were used to explore the intrinsic mechanisms. In this study, we found that histone lactylation was upregulated in endometriosis and could promote endometriosis progression both in vivo and in vitro. Mechanistically, histone lactylation H3K18la promoted the transcription of Ras homolog enriched in striatum (RASD2), and RASD2, in turn, increased the stability of CTP synthase 1 (CTPS1) by promoting the SUMOylation and inhibiting the ubiquitination of CTPS1, thereby promoting endometriosis progression. Overall, our findings indicated that histone lactylation could promote the progression of endometriosis through the RASD2/CTPS1 axis. This investigation uncovered a novel mechanism and identified prospective targets for endometriosis diagnosis and therapy.\nNEW & NOTEWORTHY Our finding reveals a novel mechanism that promotes the progression of endometriosis, namely the histone lactylation/RASD2/CTPS1 axis. This finding suggests that inhibiting histone lactylation or inhibiting RASD2 and CTPS1 might be a potential therapeutic strategy to inhibit endometriosis lesion growth.\nINTRODUCTION\nEndometriosis is a common reproductive endocrine disease among reproductive-aged women, affecting ∼10% of women worldwide (1, 2). The principal manifestations of endometriosis are dysmenorrhea, chronic pelvic pain, infertility, and menstrual abnormalities (3–5). Currently, the main treatments for endometriosis are medication and surgery (6–8). However, these treatments are often limited, and endometriosis is a disease that is easily recurrent. Recurrent endometriosis may cause pelvic pain and infertility, which significantly compromise the patient’s quality of life and undermine public health initiatives (9). Therefore, there is a need to comprehend the pathogenesis of endometriosis and to facilitate the early diagnosis and treatment of endometriosis.\nRecent studies have shown that lactate, traditionally regarded as a metabolic waste product, also serves as a crucial substrate in the process of histone lactylation. Histone lactylation, a novel type of histone modification, characterized by the presence of lactylation groups on histone lysine residues, is involved in the regulation of gene expression by affecting chromatin accessibility and is therefore implicated in a variety of physiopathological processes (10–13). Of interest, histone lactylation is closely associated with tumorigenesis, and numerous studies have shown that histone lactylation is increased in tumors and promotes tumor cell proliferation, migration, and invasion (14–16). However, although the biological behaviors and genetic background of endometriosis resemble those of tumors’, the role of histone lactylation in endometriosis remains poorly understood. Significantly, researches have shown that patients with endometriosis have higher serum lactate concentrations and higher lactate concentrations in endometrial stromal cells (17, 18). Consequently, we formulated the hypothesis that there was an elevation in histone lactylation levels in endometriosis, which subsequently facilitated the development of endometriosis.\nSUMOylation of proteins is a reversible process that utilizes the SUMO molecule as a substrate and is catalyzed by SUMO E1 activating enzymes, SUMO E2 conjugating enzymes, SUMO E3 ligases, and SUMO-specific proteases (19, 20). SUMOylation of proteins plays an important biological role in several physiopathological processes by affecting protein-protein interactions, protein localization, and protein stability (21–24). Ubiquitination is also an important posttranslational modification. Since the SUMOylation and the ubiquitination of proteins take place on lysine residues of proteins, the interaction between the SUMOylation and the ubiquitination of proteins has been debated (21, 25). The cross talk between the SUMOylation and ubiquitination in endometriosis is unknown. Notably, RASD2, a SUMO E3 ligase, exerts important biological effects in a variety of diseases (26–28). For example, RASD2 was demonstrated to promote cell proliferation, migration, and invasion (14). However, the role of RASD2 in endometriosis and the effect of RASD2 on protein SUMOylation and ubiquitination are unknown.\nCTPS1 is an enzyme that plays a crucial role in cellular metabolism by catalyzing the conversion of uridine triphosphate (UTP) to cytidine triphosphate (CTP). CTPS1 is essential for the biosynthesis of phospholipids and nucleic acids (29, 30). The enzyme CTPS1 is involved in maintaining the cellular CTP levels, which are necessary for cell proliferation. Therefore, dysregulation of CTPS1 has been implicated in the progression of several diseases, including cancer (31, 32). Importantly, it is widely recognized that phospholipid and nucleic acid metabolism is closely associated with endometriosis and may serve as biomarkers for endometriosis (33–35). Taken together, these findings suggest that CTPS1 might be involved in the development of endometriosis. However, the role of CTPS1 in endometriosis is unknown.\nIn this research, we aimed to elucidate the role and mechanism of histone lactylation in endometriosis. The results showed that histone lactylation promoted the transcription of RASD2, which enhanced CTPS1 stability by promoting the SUMOylation of CTPS1, thereby promoting endometriosis progression. Therefore, our findings revealed a novel mechanism by which histone lactylation promoted endometriosis progression.\nMATERIALS AND METHODS\nPatients and Specimens\nAll samples were collected at Zhongnan Hospital, Wuhan University, 2020–2022, according to the ethical guidelines of Zhongnan Hospital of Wuhan University (Ethical Approval No. 2023246 K). The normal endometrium (NC, 20 cases, 10 in the proliferation phase and 10 in the secretory phase) consisted of endometrium from women who had undergone tubal ligation in the absence of endometriosis and from women who had undergone hysterectomy for uterine fibroids. Eutopic endometrium (EU, 61 cases, 31 in the proliferation phase and 30 in the secretory phase) and ectopic endometrium (EC, 61 cases, 31 in the proliferation phase and 30 in the secretory phase) are the endometrium in situ and the cyst wall, respectively, in patients with ovarian endometriosis. All samples were histologically confirmed and classified as stage III according to the American Society for Reproductive Medicine (ASRM) staging system. Inclusion criteria include (1) women aged 20–45 yr; (2) women with regular menstrual cycles (21–35 days); and (3) women who had not used hormone therapy in the previous 3 mo. Exclusion criteria include women with comorbidities of other reproductive endocrine disorders and gynecological tumors. As patient samples were initially collected as part of standard clinical practice, informed written consent was not required for this research. The use of these samples was reviewed and approved by our institution’s Ethics Committee, ensuring compliance with ethical guidelines.\nIn Vivo Experiments\nThe animal experiments were conducted according to the ethical guidelines authorized by the Animal Research Center of Wuhan University (Ethical Approval No. ZN2023132). A total of 33 female C57BL/6 mice (IMSR_JAX:000664), aged 6 wk, were provided by Bainter Biotechnology (Jiangsu) Co. Mice were randomly grouped. Of these, 11 mice were donor mice that were euthanized to provide endometrium, and 22 mice were recipient mice that were intraperitoneally injected with endometrium. Of the 22 recipient mice, 4 mice were used to validate the endometriosis mouse models, and the remaining 18 mice were randomly divided into three groups as the experimental group. The experimental steps were as follows: after acclimatization feeding, the mice were randomly distributed into donor mice and recipient mice. After the donor mice were euthanized, the uterus was cut into ∼1 mm pieces. The pieces were then injected into the peritoneal cavities of two recipient mice in equal amounts. The whole procedure was completed in less than 5 min. Hematoxylin-eosin staining was performed to confirm the success of the endometriosis mouse models (Supplemental Fig. S1A). The mice were then randomized into control, 2-deoxy-d-glucose (2-DG), and sodium oxamate groups. Each group had six mice. The 2-DG group was injected subcutaneously with 500 mg/kg/day of 2-DG. The sodium oxamate group was injected subcutaneously with 300 mg/kg/day of sodium oxamate, and an equal volume of phosphate-buffered saline (PBS) was injected subcutaneously daily into the control group. The body weights of mice were measured daily. The mice were euthanized after 21 days. The ectopic tissues and the in situ uterus were preserved.\nCell Culture and Chemical Reagents\nImmortalized endometrial stromal cells (iESCs) were obtained from the American Type Culture Collection (SC-6000). The iESCs were incubated at 37°C in 5% CO2. 2-DG (Cat. No. S11070) and sodium oxamate (Cat. No. S30701) were purchased from Yuanye (Shanghai, China). Sodium lactate (Cat. No. HY-B2227B) and MG132 (Cat. No. HY-13259) were purchased from MedChemExpress, and cycloheximide (CHX, Cat. No. S7418) was purchased from Selleck.cn.\nImmunohistochemistry\nParaffin sections were used for immunohistochemistry. The procedure was as follows: on the first day, paraffin sections were sequentially deparaffinized, hydrated, antigen retrieved, washed with PBS, endogenous peroxidase removed, washed with PBS and blocked, and then incubated with anti-PanKla (1:200, AB_2942013), anti-H3K18la (1:800, AB_2909438), anti-H3K9la (1:400, AB_3076695), anti-PCNA (1:5,000, AB_2861664), anti-RASD2 (1:100, Solarbio, Cat. No. K107690P), and anti-CTPS1 (1:200, AB_2086513) antibodies at 4°C overnight. On the second day, the sections were washed with PBS and incubated with goat-anti-mouse-rabbit-poly-HRP-secondary-antibody (Proteintech, Cat. No. PR30009) for 30 min at 37°C. The sections were washed with PBS and then visualized with 3,3′-diaminobenzidine (ZSGB-BIO, Cat. No. ZLI-9018). Record the 3,3′-diaminobenzidine staining time and use the same 3,3′-diaminobenzidine staining time in the subsequent experiments. Next, paraffin sections were then sequentially counterstained for nuclei with hematoxylin, differentiated with hydrochloric acid ethanol differentiation solution, dehydrated in ethanol and then xylene, section sealed, and imaged. The H-score is used for the quantification of the protein expression. It is calculated using the following formula: H-score = Pi(i), where i represents the intensity of staining (0 for negative, 1 for weak positive, 2 for positive, and 3 for strong positive) and Pi represents the percentage of cells stained at each intensity level in the range 0%–100%.\nTransfection\nRASD2 overexpressing and silencing plasmids, CTPS1 overexpressing and silencing plasmids, pMD2.G plasmid (Addgene_12259) and psPAX2 plasmid (Addgene_12259) were purchased from Beijing Tsingke Biotech Co. The CTPS1 mutated plasmids were purchased from Wondersgene. The transfection process was carried out as follows: 293 T cells (CVCL_0063) were used for the packaging of lentiviral vectors with pMD2.G plasmid, psPAX2 plasmid, target plasmid, and Lipo3000 (Invitrogen, Cat. No. L3000075). iESCs were then infected with the lentiviral vectors. Stable transfected iESCs were screened with the use of puromycin and G418.\nWestern Blot\nRIPA lysis buffer (Beyotime, Cat. No. P0013B) and PMSF (Beyotime, Cat. No. ST506) were mixed and used for the lysis of cell samples. Protein samples were extracted with cell scrapers. The precipitate was removed by centrifugation. Protein concentration was then quantified by the BCA kit (Beyotime, Cat. No. P0010). Protein samples were separated using SDS-PAGE gels (Epizyme, Cat. No. PG111, PG112, PG113, PG114). Samples were transferred to polyvinylidene fluoride membrane (Millipore, Cat. No. ISEQ00005). Immunoreactive bands were probed with anti-RASD2 (1:1,000, AB_2771946), anti-CTPS1 (1:5,000, AB_2086513), anti-β-tubulin (1:5,000, AB_2210695), anti-PanKla (1:1,000, AB_2942013), anti-H3K18la (1:1,000, AB_3076698), anti-H3K14la (1:1,000, AB_3076697), anti-H3K9la (1:1,000, AB_3076695), anti-HA (1:2,000, AB_1549585), anti-Flag (1:10,000, AB_11232216), anti-SUMO1 (1:1,000, AB_2862614), anti-SUMO2/3 (1:1,000, AB_2863428), anti-ubiquitination (1:1,000, AB_2862735), and anti-H3 (1:2,000, AB_10544537) antibodies at 4°C. The immunoreactive bands were then incubated with horseradish peroxidase-conjugated secondary antibodies (1:10,000, AB_2722564). The ECL Enhanced Kit (Abclonal, Cat. No. RM00021) and ECL chemiluminescence were used to detect immunoreactive bands. The results were analyzed using Image J software (SCR_003070).\nRNA Isolation and RT-PCR\nTotal RNA was obtained using the Easyspin RNA Mini Kit (Aidlab, Cat. No. RN2802) following the manufacturer’s instructions. RNA concentration was measured with Nanodrop. cDNA was prepared according to the instructions using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Cat. No. R223-01). Real-time PCR (RT-PCR) was conducted following the instructions using ChamQ SYBR qPCR Master Mix (Vazyme, Cat. No. Q311-02) and the CFX Connect Real-Time PCR Detection System (Bio-Rad). The 2–ΔΔCt method was used for the calculation of mRNA expression levels relative to GAPDH. The primer sequences used in this research are given in Table 1.\n| Primer Sequences | |\n|---|---|\n| GAPDH-forward primer | GGAGCGAGATCCCTCCAAAAT |\n| GAPDH-reverse primer | GGCTGTTGTCATACTTCTCATGG |\n| RASD2-forward primer | GATAACCGGGAGTCCTTCGAT |\n| RASD2-reverse primer | CCGTGGTCGTTCTTGTTGC |\n| RASD2-forward primer-a | GAAAGAAGCCGTCCCTCCG |\n| RASD2-reverse primer-a | AACCCTCCTGGTCGCCTAT |\n| RASD2-forward primer-b | ACCACAGACTCTGGGAGGC |\n| RASD2-reverse primer-b | GCTCAGAGAGCTGCCTGGAA |\n| RASD2-forward primer-c | AGGCAAAGTCTGGATGTGGAA |\n| RASD2-reverse primer-c | CTAAGGGGATGTGCCCAAAGT |\n| RASD2-forward primer-d | ACTTCTGTCATTCTGTGGACCC |\n| RASD2-reverse primer-d | TGGGCCGTCATGAAAAGTCT |\n| RASD2-forward primer-e | CAGGACTTGAACGCCAGTCTC |\n| RASD2-reverse primer-e | CTACCTCATGAGAGGACGCAG |\n| RASD2-forward primer-f | TCATTTAAAGGTGGGGAGGGAG |\n| RASD2-reverse primer-f | CACCAGGTGCCTTGAGCATT |\n| RASD2-forward primer-g | GACAGGCAGGTTGGACACC |\n| RASD2-reverse primer-g | GTTCCAGCGCCCTCCTC |\n| RASD2-forward primer-h | CGCTGGGACCGTCATCA |\n| RASD2-reverse primer-h | AAGAGGTCGCTGATCCCTC |\n| RASD2-forward primer-i | GGGCCACACACAAAGTTCTC |\n| RASD2-reverse primer-i | GTTAGCATCAACCCGGCTCC |\nChromatin Immunoprecipitation\nChromatin immunoprecipitation (ChIP) experiments were conducted following the instructions of the BeyoChIP ChIP Assay Kit (Beyotime, Cat. No. P2080S). Briefly, the steps were as follows: on the first day, cells were cross-linked with paraformaldehyde at the final concentration of 1%, cross-linking was terminated with glycine, washed, then lysed using SDS lysis buffer, sonicated, centrifuged, and incubated with anti-H3K18la antibody (AB_3076698) and anti-IgG (AB_1031062) at 4°C overnight. The next day, protein A/G beads/salmon sperm DNA was added to the antigen (DNA)-antibody complex for incubation. The protein A/G beads/salmon sperm DNA-antigen (DNA)-antibody complex was then washed and uncross-linked. Subsequently, the DNA was purified and further analyzed by means of RT-PCR.\nCo-Immunoprecipitation and IP-MS\nOn day 1, cells were lysed using cell lysis buffer for Western and IP (Beyotime, Cat. No. P0013) and PMSF (Beyotime, Cat. No. ST506), scraped, vortexed, and centrifuged. The cell precipitate was discarded, and the supernatant was incubated with anti-CTPS1 (AB_2086513), anti-Flag (AB_11232216), and anti-HA (AB_1549585) antibodies overnight at 4°C. On the second day, protein A/G magnetic beads (MedChemExpress, Cat. No. HY-K0202) were incubated with the antigen-antibody complex, and the protein A/G magnetic beads-antigen-antibody complex was washed and frozen at –80°C for immunoprecipitation-mass spectrometry (IP-MS) or denatured with loading buffer for subsequent detection.\nCell Proliferation Assay\nCCK8 (Abbkine, Cat. No. BMU106) was used for proliferation assessment. Following the manufacturer’s instructions for CCK8, cells were seeded in 96-well culture plates, and CCK8 reagent was added as recommended by the CCK8 manufacturer’s instructions. The absorbance was then measured at 450 nm.\nMigration and Invision Assays\nTranswell chambers (BIOFIL, Cat. No. TCS003024) were used to assess migration and invasion abilities. The steps of the migration experiment were as follows: the lower chamber was supplemented with medium containing 20% FBS, whereas the upper chamber was seeded with 200 µL of serum-free medium containing ∼50,000–100,000 cells. The chambers were then sequentially washed, fixed using 4% paraformaldehyde, washed, stained using crystal violet, washed, and imaged under a microscope. For the invasion experiment, matrix gel (Corning, Cat. No. 35424) was added to the upper chamber in advance, and the remaining steps were identical to those of the migration experiment.\nTranscriptomics\nTranscriptomic sequencing was performed by BGI Genomics Co., Ltd. Data analysis was performed by Dr. Tom, an online website. The data were stored in the SRA database (SUB14520064, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1123147).\nStatistical Analysis\nThe data in this research were obtained from at least three independent replicate experiments and analyzed with GraphPad Prism software (v. 8.0, SCR_002798). The significance of differences between two groups was evaluated by Student’s t test. The significance of differences between three or more groups was analyzed by one-way ANOVA. Statistical results were presented as means ± standard error (means ± SE). A P value below 0.05 was considered statistically significant. ns P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.\nRESULTS\nExpression Profile of Histone Lactylation in Endometriosis\nTo explore the significance of histone lactylation in endometriosis, we examined the expression levels of PanKla, H3K18la, and H3K9la in normal endometrium (NC), eutopic endometrium (EU), and ectopic endometrium (EC) groups by immunohistochemistry. The results showed that the expression level of PanKla was slightly reduced in the EU and EC groups compared with the NC group in the proliferation phase, and there was no significant difference between the EU and EC groups (Fig. 1A). In the secretory phase, the expression level of PanKla was increased in the EU group compared with the NC and EC groups, and there was no significant difference between the NC and EC groups (Fig. 1B). In the proliferation phase, the expression level of H3K18la was significantly increased in the EU and EC groups compared with that in the NC group, but no statistically significant difference was noted between the EU and EC groups (Fig. 1C). In the secretory phase, H3K18la expression levels were significantly elevated in the EU and EC groups than those in the NC group, and the expression level of H3K18la in the EU group was slightly higher than that in the EC group (Fig. 1D). In the proliferation phase, the expression level of H3K9la in the EU group was higher than that in the NC and EC groups; however, there was no difference between the NC and EC groups (Fig. 1E). In the secretory phase, H3K9la expression levels were elevated in the NC and EU groups than those in the EC group, whereas there was no difference between the NC and EU groups (Fig. 1F).\nHistone Lactylation Promotes Endometriosis Progression In Vitro\nSodium lactate directly provides the substrate for histone lactylation; 2-DG could inhibit glycolysis and the production of lactate, the substrate for histone lactylation, by inhibiting hexokinase, and sodium oxamate could also inhibit glycolysis and the production of lactate, the substrate for histone lactylation, by selectively inhibiting LDHA; therefore, sodium lactate and glycolysis inhibitors have been widely utilized to investigate the role of histone lactylation (12, 36, 37). In addition, iESCs have been broadly applied to investigate the mechanisms of endometriosis (38–40). To investigate whether the effects of sodium lactate and glycolysis inhibitors were the consequence of histone lactylation, we evaluated the expression levels of PanKla, H3K18la, H3K14la, and H3K9la in iESCs after treated with sodium lactate and glycolysis inhibitors. The results showed that PanKla, H3K18la, H3K14la, and H3K9la levels were significantly upregulated in iESCs after treated with sodium lactate (Fig. 2A; Supplemental Fig. S1B), while significantly downregulated after treated with 2-DG and sodium oxamate (Fig. 2, B and C; Supplemental Fig. S1, C and D). To summarize, sodium lactate and glycolysis inhibitors can effectively regulate the levels of histone lactylation. Therefore, in the research, iESCs were treated with sodium lactate and glycolysis inhibitors to investigate the role and mechanism of histone lactylation in endometriosis.\nWe then investigated the biological effects of histone lactylation in vitro. CCK8 and Transwell assays were used to investigate the proliferation, migration, and invasion abilities. The results demonstrated that sodium lactate promoted the proliferation, migration, and invasion abilities of iESCs (Fig. 2, D and G), whereas the inhibitors of glycolysis, 2-DG and sodium oxamate, could inhibit the proliferation, migration, and invasion abilities of iESCs (Fig. 2, E, F, H, and I). In conclusion, these results indicated that histone lactylation promoted the proliferation, migration, and invasion abilities of iESCs in vitro.\nIdentification of Target Genes for Histone Lactylation\nNext, we used iESCs to investigate the mechanisms by which histone lactylation promoted the progression of endometriosis. First, RNA sequencing was performed after iESCs were treated with 2-DG to reveal the mechanism of how histone lactylation promoted endometriosis progression. The results showed that 822 genes were downregulated and 713 genes were upregulated after 2-DG treatment (|log2FC|>1 and P < 0.05). GSEA enrichment analysis showed that the differentially expressed genes were enriched in the HALLMARK_GLYCOLYSIS pathway (Fig. 3A). To further screen for downstream target genes of histone lactylation, we upped the screening criteria of differential expression genes to Q value > 0.001, selected the top 20 downregulated differential expression genes as potential targets of histone lactylation (Fig. 3B). Among these differential expression genes, RASD2 was reported to promote cell proliferation and migration, and its role in endometriosis is unknown (41). As expected, the expression level of RASD2 was increased after treated with sodium lactate and decreased after treated with 2-DG and sodium oxamate (Fig. 3, C and D; Supplemental Fig. S1E). Therefore, we selected RASD2 as a target gene for histone lactylation.\nSince the differential expression of H3K18la was the most pronounced and evident in endometriosis, we hypothesized that lactylation of H3K18 might play a significant role in the progression of endometriosis. We examined the enrichment level of H3K18la in the RASD2 promoter by ChIP-qPCR, and the results demonstrated that the enrichment level of H3K18la was increased after sodium lactate treatment and downregulated after 2-DG and sodium oxamate treatment (Fig. 3, E–G). Taken together, these results demonstrated that RASD2 was the target gene of histone lactylation.\nHistone Lactylation Promotes Endometriosis Progression via RASD2\nThe function of RASD2 in promoting cell proliferation and migration suggests that RASD2 might promote the progression of endometriosis; however, direct evidence linking RASD2 to endometriosis progression requires further investigation. Therefore, we performed rescue experiments to investigate whether histone lactylation promoted endometriosis progression via RASD2. First, we detected the regulatory relationship between histone lactylation and RASD2 by qRT-PCR and Western blot. The results showed that RASD2 overexpression could reverse the biological effects of 2-DG and sodium oxamate, which inhibited RASD2 expression (Fig. 4, A and B; Supplemental Fig. S1F). We then examined the changes in proliferation, migration, and invasion abilities. The results showed that RASD2 overexpression promoted the proliferation, migration, and invasion abilities of iESCs and reversed the biological effects of 2-DG and sodium oxamate, which inhibited the proliferation, migration, and invasion abilities of iESCs (Fig. 4, C–F). Collectively, these data indicated that histone lactylation promoted the progression of endometriosis via RASD2.\nRASD2 Promotes the Protein Stability of CTPS1 by Promoting the SUMOylation of CTPS1\nAs a SUMO E3 ligase, we hypothesized that RASD2 might promote the progression of endometriosis by participating in the SUMOylation of proteins. To confirm this hypothesis, we performed IP-MS after overexpression of RASD2 to identify the proteins that interacted with RASD2. Among these proteins, CTPS1 was the most enriched protein (Supplemental Fig. S1G). Using Co-IP experiments, we confirmed that RASD2 interacted with CTPS1 (Fig. 5A). Therefore, we chose CTPS1 as a downstream target of RASD2. Interestingly, IP-MS results revealed that RASD2 also interacted with PSMC1, PSMC2, PSMC3, PSMC5, PSMC5, and PSMD2 proteins, which are involved in the assembly of the 26S proteasome (Supplemental Fig. S1G). This finding suggested that RASD2 might regulate protein stability through the proteasome pathway. Thus, we then investigated the regulatory relationship among histone lactylation, RASD2, and CTPS1. The results demonstrated that sodium lactate promoted CTPS1 expression, whereas 2-DG and sodium oxamate inhibited CTPS1 expression (Fig. 5B; Supplemental Fig. S1H). RASD2 knockdown inhibited the expression of CTPS1 (Fig. 5C; Supplemental Fig. S1I), and RASD2 overexpression promoted the expression of CTPS1 (Fig. 5D; Supplemental Fig. S1J).\nWe next investigated how RASD2 regulated CTPS1 expression. RASD2 knockdown iESCs were treated with cycloheximide to block the synthesis of CTPS1 protein and to observe the degradation of CTPS1 protein. The results showed that the stability of CTPS1 protein decreased after RASD2 knockdown (Fig. 5E). Notably, the addition of MG132, a proteasome inhibitor, reversed the effect of RASD2 knockdown, suggesting that RASD2 increases CTPS1 stability by inhibiting proteasomal degradation of CTPS1 (Fig. 5F). Finally, we predicted the SUMOylation sites of CTPS1 using GPS-SUMO (https://sumo.biocuckoo.cn/), JASSA (http://www.jassa.fr/), and SUMOplot (https://www.abcepta.com/sumoplot). The results indicated that K38, K171, and K584 might be the SUMOylation sites (Fig. 5G), and then we mutated lysine to arginine to investigate the types of SUMOylation and the specific sites of SUMOylation. The results showed that the mutations at the K38, K171, and K584 sites of CTPS1 attenuated the SUMO2/3 modification of CTPS1, but not the SUMO1 modification, suggesting that RASD2 mainly promoted the SUMO2/3 modification of CTPS1 at the K38, K171, and K584 sites (Fig. 5H). Since the ubiquitination and the SUMOylation occur at the same amino acid residues, the cross-talk between ubiquitination and SUMOylation is unclear. The aforementioned findings suggest that RASD2 might influence the cross-talk between SUMOylation and ubiquitination. Therefore, we investigated the effects of RASD2 on the SUMOylation and the ubiquitination of CTPS1 by Co-IP experiments to gain a detailed understanding of the reasons why RASD2 promoted the stability of CTPS1. The results indicated that the SUMOylation of CTPS1 was elevated and the ubiquitination of CTPS1 was decreased after RASD2 overexpression (Fig. 5I), and that the SUMOylation of CTPS1 was decreased and the ubiquitination of CTPS1 was increased after RASD2 knockdown (Fig. 5J). Based on the experimental results, we concluded that RASD2 could enhance the stability of CTPS1 by promoting the SUMOylation of CTPS1 and inhibiting the ubiquitination of CTPS1.\nHistone Lactylation/RASD2/CTPS1 Axis Promotes the Progression of Endometriosis\nThe function of CTPS1 suggests that CTPS1 might also promote the progression of endometriosis (42). However, direct evidence linking CTPS1 to endometriosis progression requires further investigation. Therefore, we performed rescue experiments to investigate whether RASD2 promoted endometriosis progression via CTPS1. We verified the knockdown efficiency of CTPS1 by qRT-PCR and Western blot and selected shCTPS1-3 to perform the subsequent experiments (Fig. 6A). The Western blot results indicated that CTPS1 knockdown reversed the effect of RASD2, which promoted the expression of CTPS1 (Fig. 6B). The results of the CCK8 assay and Transwell assay showed that CTPS1 knockdown inhibited the proliferation, migration, and invasion abilities and could reverse the biological effects of RASD2 that promoted the proliferation, migration, and invasion abilities (Fig. 6, C and D). Therefore, we concluded that RASD2 promoted the progression of endometriosis through CTPS1.\nNext, we performed rescue experiments to investigate whether histone lactylation promoted the progression of endometriosis via CTPS1. By Western blot experiments, we found that CTPS1 overexpression reversed the effects of 2-DG and sodium oxamate, which inhibited the expression of CTPS1 (Supplemental Fig. S2A). The results of CCK8 assay and Transwell assay indicated that overexpression of CTPS1 partially reversed the effects of 2-DG and sodium oxamate that inhibited proliferation, migration, and invasion abilities (Supplemental Fig. S2, B–E). Taken together, we concluded histone lactylation/RASD2/CTPS1 axis promotes the progression of endometriosis.\nInhibition of Histone Lactylation by Glycolysis Inhibitors Suppresses Endometriosis Progression In Vivo\nTo further investigate the function of histone lactylation in endometriosis, we constructed endometriosis mouse models and treated them with glycolysis inhibitors. The results demonstrated that there was no significant difference in body weight between the control, 2-DG, and sodium oxamate groups, indicating that the concentrations of 2-DG and sodium oxamate were safe (Fig. 7A). The results showed that 2-DG and sodium oxamate at safe doses reduced the size of endometriosis lesions (Fig. 7, B and C). To further confirm the above results, we examined the proliferation ability of endometriosis lesions by immunohistochemistry, and consistently, the expression of PCNA was attenuated in the 2-DG and sodium oxamate groups (Fig. 7D). To investigate whether the effect of glycolysis inhibitors was a consequence of histone lactylation inhibition, we examined the levels of PanKla, H3K18la, and H3K9la in endometriosis lesions by immunohistochemistry, and the results showed that 2-DG and sodium oxamate decreased the levels of PanKla and H3K18la in endometriosis lesions, and there was no significant difference in the level of H3K9la between the control, 2-DG, and sodium oxamate groups (Fig. 7D). Finally, we examined the expression of RASD2 and CTPS1 by immunohistochemistry, and the results showed that 2-DG and sodium oxamate could inhibit the expression of RASD2 and CTPS1 (Fig. 7D). In conclusion, these results indicated that inhibition of histone lactylation/RASD2/CTPS1 axis could suppress the progression of endometriosis in vivo.\nDISCUSSION\nEndometriosis is a chronic gynecological disease in which endometrial tissue grows outside the uterus, causing pain, inflammation, and infertility and significantly reducing women’s quality of life (43). Thus, it is imperative to understand the pathogenesis of endometriosis and to explore diagnostic and therapeutic targets for endometriosis. In this research, we analyzed the expression profile of histone lactylation in endometriosis by immunohistochemistry and elucidated the role of histone lactylation in endometriosis by in vivo and in vitro experiments. In addition, we also discovered a novel mechanism that promotes the progression of endometriosis, that is, the histone lactylation/RASD2/CTPS1 axis.\nA previous study reported that histone lactylation could promote the progression of endometriosis in vitro (44). Consistently, we also found that histone lactylation promotes endometriosis progression in vitro. Unlike previous studies, our study examined the differential expression of common histone lactylation types in endometriosis tissues, investigated the in vivo effects of histone lactylation, and uncovered a completely new mechanism. Among the three most common histone lactylation sites, we found that H3K18la was significantly increased in eutopic and ectopic endometrium and exhibited the same expression trend in the proliferation and secretory phases, indicating that H3K18la might play a crucial role in the progression of endometriosis and might be a diagnostic and therapeutic target for endometriosis.\nIn in vivo experiments, considering the long duration of administration and the tolerability of the mice, we chose lower dosages of 2-DG and sodium oxamate (45–50). Consistently, the results of our experiments showed that there was no significant difference among the body weights of the control, 2-DG, and sodium oxamate groups, indicating that the concentrations of 2-DG and sodium oxamate were safe. More significantly, at the safe dosages, 2-DG and sodium oxamate could inhibit the development of ectopic lesions, which provided a theoretical basis and new insights for the prevention and treatment of endometriosis in the future. Numerous studies have shown that glycolysis inhibitors, 2-DG and sodium oxamate, could effectively inhibit the progression of tumors (51, 52). Endometriosis, which is considered an immortal cancer, has similar biological behaviors and biological background with tumors. Our study found that glycolysis inhibitors, 2-DG and sodium oxamate, could also inhibit endometriosis progression both in vivo and in vitro, which was consistent with previous studies.\nHowever, some questions still remain. A previous study suggested that estrogen could promote the production of lactate, the substrate for histone lactylation modification, in human endometrial stromal cells (13, 53). As we all know, endometriosis is an estrogen-dependent disease (6, 54, 55). These findings indicated that estrogen might regulate histone lactylation levels by promoting lactate production and also inspired us to consider the possibility that in endometriosis, lowering circulating lactate levels might have the same effect as lowering circulating estrogen levels. However, further work is needed to confirm whether estrogen promotes histone lactylation levels by promoting the production of lactate. Currently, the most direct and effective way to study posttranslational modifications of proteins is to mutate the modification sites, but for histone modifications, such as histone lactylation, this approach is extremely difficult. Based on the above theories, in this study, we mainly investigated the biological role of histone lactylation by regulating the histone lactylation level using sodium lactate and glycolysis inhibitors, which indirectly illustrates the role of the histone lactylation/RASD2/CTPS1 axis in endometriosis, although this approach is also the main way to investigate the function of histone lactylation (12, 14). Therefore, more experimental data, such as regulating histone lactylation writers and erasers, are needed to further illustrate the role of the histone lactylation/RASD2/CTPS1 axis in endometriosis.\nThrough transcriptomic and ChIP-qPCR experiments, we confirmed the target gene of H3K18la, which is RASD2. RASD2, a SUMO E3 ligase, exerts its biological effects by regulating the posttranslational modification of proteins and is also associated with the progression of several diseases (28, 56). For example, in uveal melanoma, RASD2 could promote cancer cell proliferation, migration, and invasion (41). Consistent with previous studies, in this research, we also found that RASD2 could promote iESCs proliferation, migration, and invasion by regulating the SUMOylation of CTPS1. Our results indicated that RASD2 might be a diagnostic and therapeutic target for endometriosis. It is generally accepted that SUMOylation and ubiquitination of proteins are antagonistic because the modified amino acid residues are shared (57). However, a study reported that SUMOylation and ubiquitination could synergistically regulate protein stability (25). To find out the answer, we also examined the ubiquitination level of CTPS1. The results showed that RASD2 could promote the SUMOylation of CTPS1 and inhibit the ubiquitination of CTPS1, suggesting that the SUMOylation and the ubiquitination of CTPS1 are antagonistic. Thus, we postulated that RASD2 promotes the binding of SUMO molecules to lysine residues of CTPS1, occupying the binding sites and in turn interfering with the binding of ubiquitin molecules to lysine residues of CTPS1. A previous study suggested that RASD2 could promote glycolysis to facilitate lactate production (41). This finding suggested that RASD2 might amplify the biological effects of histone lactylation by promoting glycolysis. Unfortunately, we did not perform further experiments to test this hypothesis.\nThrough IP-MS and Co-IP experiments, we found that RASD2 bound to CTPS1 and promoted the SUMOylation of CTPS1, thus improving the stability of CTPS1. CTPS1, the rate-limiting enzyme for de novo pyrimidine synthesis, plays a critical role in a variety of physiopathological processes (58–60). Several studies have shown that CTPS1 promotes tumor cell proliferation, migration, and invasion and have been identified as a potential therapeutic target for a variety of tumors (29, 58). Similarly, in this research, we found that CTPS1 could promote endometrial stromal cell proliferation, migration, and invasion. This result inspired us that CTPS1 might be a therapeutic target for endometriosis. In our research, RASD2 mainly promoted the SUMOylation of CTPS1 at the 38th, 171st, and 584th lysine residues. Therefore, we postulated that designing drugs that target the SUMOylation sites of CTPS1 to reduce the stability of CTPS1 might inhibit the progression of endometriosis. Unfortunately, further work is needed to test this hypothesis.\nConclusions\nIn summary, our study identified a novel mechanism by which histone lactylation promoted the progression of endometriosis, that is, the abnormally upregulated histone lactylation in eutopic and ectopic endometrium promoted the expression of RASD2, thus increasing the stability of CTPS1 by promoting the SUMOylation of CTPS1 and inhibiting the ubiquitination of CTPS1, which in turn promoted the progression of endometriosis. The novel mechanism of endometriosis, the histone lactylation/RASD2/CTPS1 axis, provides a potential target for the diagnosis and treatment of endometriosis.\nDATA AVAILABILITY\nAll data from this study is available from the corresponding authors upon reasonable request.\nSUPPLEMENTAL MATERIAL\nSupplemental Figs. S1 and S2: https://doi.org/10.6084/m9.figshare.27896859.v6.\nGRANTS\nThe research was supported by National Key R&D Program of China Grant No. 2020YFA0803903 and National Nature Science Foundation of China Grant Nos. 82201819 and 81771543.\nDISCLOSURES\nNo conflicts of interest, financial or otherwise, are declared by the authors.\nAUTHOR CONTRIBUTIONS\nZiwei Wang, Y.X., and Y.Z. conceived and designed research; Ziwei Wang performed experiments; Ziwei Wang, Zihan Wang, S.L., and Y.Z. analyzed data; Y.M. interpreted results of experiments; R.Z. prepared figures; Z.H., S.X., and Y.X. edited and revised manuscript; Y.X. and Y.Z. approved final version of manuscript.\nSUPPLEMENTAL MATERIAL\nSupplemental Figs. S1 and S2: https://doi.org/10.6084/m9.figshare.27896859.v6.\nACKNOWLEDGMENTS\nGraphical abstract was created by figdraw.com (ID: SISWW3b7e7).\nREFERENCES\n1.\nShafrir AL, Farland LV, Shah DK, Harris HR, Kvaskoff M, Zondervan K, Missmer SA. Risk for and consequences of endometriosis: a critical epidemiologic review. Best Pract Res Clin Obstet Gynaecol 51: 1–15, 2018.\n2.\nZondervan KT, Becker CM, Missmer SA. Endometriosis. N Engl J Med 382: 1244–1256, 2020.\n3.\nGiudice LC, Kao LC. Endometriosis. Lancet 364: 1789–1799, 2004.\n4.\nACOG Committee Opinion. Dysmenorrhea and endometriosis in the adolescent. Obstet Gynecol 132: e249–e258, 2018.\n5.\nde Ziegler D, Borghese B, Chapron C. Endometriosis and infertility: pathophysiology and management. Lancet 376: 730–738, 2010.\n6.\nVercellini P, Viganò P, Somigliana E, Fedele L. Endometriosis: pathogenesis and treatment. Nat Rev Endocrinol 10: 261–275, 2014.\n7.\nTaylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic disease: clinical challenges and novel innovations. Lancet 397: 839–852, 2021.\n8.\nHorne AW, Missmer SA. Pathophysiology, diagnosis, and management of endometriosis. BMJ 379: e070750, 2022.\n9.\nFalcone T, Flyckt R. Clinical management of endometriosis. Obstet Gynecol 131: 557–571, 2018.\n10.\nMcCrory C, Verma J, Tucey TM, Turner R, Weerasinghe H, Beilharz TH, Traven A. The short-chain fatty acid crotonate reduces invasive growth and immune escape of Candida albicans by regulating hyphal gene expression. mBio 14: e0260523, 2023.\n11.\nHu Q, Xu J, Wang L, Yuan Y, Luo R, Gan M, Wang K, Zhao T, Wang Y, Han T, Wang JB. SUCLG2 regulates mitochondrial dysfunction through succinylation in lung adenocarcinoma. Adv Sci (Weinh) 10: e2303535, 2023.\n12.\nZhang D, Tang Z, Huang H, Zhou G, Cui C, Weng Y, Liu W, Kim S, Lee S, Perez-Neut M, Ding J, Czyz D, Hu R, Ye Z, He M, Zheng YG, Shuman HA, Dai L, Ren B, Roeder RG, Becker L, Zhao Y. Metabolic regulation of gene expression by histone lactylation. Nature 574: 575–580, 2019.\n13.\nIzzo LT, Wellen KE. Histone lactylation links metabolism and gene regulation. Nature 574: 492–493, 2019.\n14.\nYu J, Chai P, Xie M, Ge S, Ruan J, Fan X, Jia R. Histone lactylation drives oncogenesis by facilitating m(6)A reader protein YTHDF2 expression in ocular melanoma. Genome Biol 22: 85, 2021.\n15.\nPan L, Feng F, Wu J, Fan S, Han J, Wang S, Yang L, Liu W, Wang C, Xu K. Demethylzeylasteral targets lactate by inhibiting histone lactylation to suppress the tumorigenicity of liver cancer stem cells. Pharmacol Res 181: 106270, 2022.\n16.\nWang J, Liu Z, Xu Y, Wang Y, Wang F, Zhang Q, Ni C, Zhen Y, Xu R, Liu Q, Fang W, Huang P, Liu X. Enterobacterial LPS-inducible LINC00152 is regulated by histone lactylation and promotes cancer cells invasion and migration. Front Cell Infect Microbiol 12: 913815, 2022.\n17.\nDutta M, Joshi M, Srivastava S, Lodh I, Chakravarty B, Chaudhury K. A metabonomics approach as a means for identification of potential biomarkers for early diagnosis of endometriosis. Mol Biosyst 8: 3281–3287, 2012.\n18.\nQi X, Zhang Y, Ji H, Wu X, Wang F, Xie M, Shu L, Jiang S, Mao Y, Cui Y, Liu J. Knockdown of prohibitin expression promotes glucose metabolism in eutopic endometrial stromal cells from women with endometriosis. Reprod Biomed Online 29: 761–770, 2014.\n19.\nGill G. SUMO and ubiquitin in the nucleus: different functions, similar mechanisms? Genes Dev 18: 2046–2059, 2004.\n20.\nMüller S, Hoege C, Pyrowolakis G, Jentsch S. SUMO, ubiquitin’s mysterious cousin. Nat Rev Mol Cell Biol 2: 202–210, 2001.\n21.\nQin Y, Li Q, Liang W, Yan R, Tong L, Jia M, Zhao C, Zhao W. TRIM28 SUMOylates and stabilizes NLRP3 to facilitate inflammasome activation. Nat Commun 12: 4794, 2021.\n22.\nLi X, Xia Q, Mao M, Zhou H, Zheng L, Wang Y, Zeng Z, Yan L, Zhao Y, Shi J. Annexin-A1 SUMOylation regulates microglial polarization after cerebral ischemia by modulating IKKα stability via selective autophagy. Sci Adv 7: eabc5539, 2021.\n23.\nZhang A, Tao W, Zhai K, Fang X, Huang Z, Yu JS, Sloan AE, Rich JN, Zhou W, Bao S. Protein sumoylation with SUMO1 promoted by Pin1 in glioma stem cells augments glioblastoma malignancy. Neuro Oncol 22: 1809–1821, 2020.\n24.\nSedek M, Strous GJ. SUMOylation is a regulator of the translocation of Jak2 between nucleus and cytosol. Biochem J 453: 231–239, 2013.\n25.\nMo Y, Wang Y, Zhang S, Xiong F, Yan Q, Jiang X, Deng X, Wang Y, Fan C, Tang L, Zhang S, Gong Z, Wang F, Liao Q, Guo C, Li Y, Li X, Li G, Zeng Z, Xiong W. Circular RNA circRNF13 inhibits proliferation and metastasis of nasopharyngeal carcinoma via SUMO2. Mol Cancer 20: 112, 2021.\n26.\nSubramaniam S, Napolitano F, Mealer RG, Kim S, Errico F, Barrow R, Shahani N, Tyagi R, Snyder SH, Usiello A. Rhes, a striatal-enriched small G protein, mediates mTOR signaling and L-DOPA-induced dyskinesia. Nat Neurosci 15: 191–193, 2011.\n27.\nRamírez-Jarquín UN, Sharma M, Shahani N, Li Y, Boregowda S, Subramaniam S. Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brain. Sci Adv 8: eabm3877, 2022.\n28.\nSubramaniam S, Sixt KM, Barrow R, Snyder SH. Rhes, a striatal specific protein, mediates mutant-Huntingtin cytotoxicity. Science 324: 1327–1330, 2009.\n29.\nLiang JH, Ren YM, Du KX, Gao R, Duan ZW, Guo JR, Xing TY, Wang WT, Wang L, Wang Y, Wang R, Li JY, Xu W. MYC-induced cytidine metabolism regulates survival and drug resistance via cGas-STING pathway in mantle cell lymphoma. Br J Haematol 202: 550–565, 2023.\n30.\nChoi MG, Carman GM. Phosphorylation of human CTP synthetase 1 by protein kinase A: identification of Thr455 as a major site of phosphorylation. J Biol Chem 282: 5367–5377, 2007.\n31.\nLin Y, Zhang J, Li Y, Guo W, Chen L, Chen M, Chen X, Zhang W, Jin X, Jiang M, Xiao H, Wang C, Song C, Fu F. CTPS1 promotes malignant progression of triple-negative breast cancer with transcriptional activation by YBX1. J Transl Med 20: 17, 2022.\n32.\nSun Z, Zhang Z, Wang QQ, Liu JL. Combined inactivation of CTPS1 and ATR is synthetically lethal to MYC-overexpressing cancer cells. Cancer Res 82: 1013–1024, 2022.\n33.\nVouk K, Hevir N, Ribić-Pucelj M, Haarpaintner G, Scherb H, Osredkar J, Möller G, Prehn C, Rižner TL, Adamski J. Discovery of phosphatidylcholines and sphingomyelins as biomarkers for ovarian endometriosis. Hum Reprod 27: 2955–2965, 2012.\n34.\nAdamyan LV, Starodubtseva N, Borisova A, Stepanian AA, Chagovets V, Salimova D, Wang Z, Kononikhin A, Popov I, Bugrova A, Chingin K, Kozachenko A, Chen H, Frankevich V. Direct mass spectrometry differentiation of ectopic and eutopic endometrium in patients with endometriosis. J Minim Invasive Gynecol 25: 426–433, 2018.\n35.\nAhn SH, Singh V, Tayade C. Biomarkers in endometriosis: challenges and opportunities. Fertil Steril 107: 523–532, 2017.\n36.\nLi L, Chen K, Wang T, Wu Y, Xing G, Chen M, Hao Z, Zhang C, Zhang J, Ma B, Liu Z, Yuan H, Liu Z, Long Q, Zhou Y, Qi J, Zhao D, Gao M, Pei D, Nie J, Ye D, Pan G, Liu X. Glis1 facilitates induction of pluripotency via an epigenome-metabolome-epigenome signalling cascade. Nat Metab 2: 882–892, 2020 [Erratum in Nat Metab 2: 1179, 2020].\n37.\nIrizarry-Caro RA, McDaniel MM, Overcast GR, Jain VG, Troutman TD, Pasare C. TLR signaling adapter BCAP regulates inflammatory to reparatory macrophage transition by promoting histone lactylation. Proc Natl Acad Sci USA 117: 30628–30638, 2020.\n38.\nLin Y, Kojima S, Ishikawa A, Matsushita H, Takeuchi Y, Mori Y, Ma J, Takeuchi K, Umezawa K, Wakatsuki A. Inhibition of MLCK-mediated migration and invasion in human endometriosis stromal cells by NF-κB inhibitor DHMEQ. Mol Med Rep 28: 141, 2023.\n39.\nLi X, Xiong W, Long X, Dai X, Peng Y, Xu Y, Zhang Z, Zhang L, Liu Y. Inhibition of METTL3/m6A/miR126 promotes the migration and invasion of endometrial stromal cells in endometriosis†. Biol Reprod 105: 1221–1233, 2021.\n40.\nXue W, Yao X, Ting G, Ling J, Huimin L, Yuan Q, Chun Z, Ming Z, Yuanzhen Z. BPA modulates the WDR5/TET2 complex to regulate ERβ expression in eutopic endometrium and drives the development of endometriosis. Environ Pollut 268: 115748, 2021.\n41.\nXie M, Xin C. RASD2 promotes the development and metastasis of uveal melanoma via enhancing glycolysis. Biochem Biophys Res Commun 610: 92–98, 2022.\n42.\nMinet N, Boschat AC, Lane R, Laughton D, Beer P, Asnagli H, Soudais C, Bourne T, Fischer A, Martin E, Latour S. Differential roles of CTP synthetases CTPS1 and CTPS2 in cell proliferation. Life Sci Alliance 6: e202302066, 2023.\n43.\nChild TJ, Tan SL. Endometriosis: aetiology, pathogenesis and treatment. Drugs 61: 1735–1750, 2001.\n44.\nChen J, Qin P, Sun Y, Han S. Histone lactylation promotes cell proliferation, migration and invasion through targeting HMGB1 in endometriosis. J Biomed Res 37: 470–478, 2023.\n45.\nTagg SLC, Foster PA, Leese MP, Potter BVL, Reed MJ, Purohit A, Newman SP. 2-Methoxyoestradiol-3,17-O,O-bis-sulphamate and 2-deoxy-D-glucose in combination: a potential treatment for breast and prostate cancer. Br J Cancer 99: 1842–1848, 2008.\n46.\nAn J, Zhang Y, He J, Zang Z, Zhou Z, Pei X, Zheng X, Zhang W, Yang H, Li S. Lactate dehydrogenase A promotes the invasion and proliferation of pituitary adenoma. Sci Rep 7: 4734, 2017.\n47.\nLi X, Lu W, Hu Y, Wen S, Qian C, Wu W, Huang P. Effective inhibition of nasopharyngeal carcinoma in vitro and in vivo by targeting glycolysis with oxamate. Int J Oncol 43: 1710–1718, 2013.\n48.\nZhai X, Yang Y, Wan J, Zhu R, Wu Y. Inhibition of LDH-A by oxamate induces G2/M arrest, apoptosis and increases radiosensitivity in nasopharyngeal carcinoma cells. Oncol Rep 30: 2983–2991, 2013.\n49.\nZhang XT, Hu XB, Wang HL, Kan WJ, Xu L, Wang ZJ, Xiang YQ, Wu WB, Feng B, Li JN, Gao AH, Dong TC, Xia CM, Zhou YB, Li J. Activation of unfolded protein response overcomes Ibrutinib resistance in diffuse large B-cell lymphoma. Acta Pharmacol Sin 42: 814–823, 2021.\n50.\nQiao T, Xiong Y, Feng Y, Guo W, Zhou Y, Zhao J, Jiang T, Shi C, Han Y. Inhibition of LDH-A by oxamate enhances the efficacy of anti-PD-1 treatment in an NSCLC humanized mouse model. Front Oncol 11: 632364, 2021.\n51.\nZhao Z, Han F, Yang S, Wu J, Zhan W. Oxamate-mediated inhibition of lactate dehydrogenase induces protective autophagy in gastric cancer cells: involvement of the Akt-mTOR signaling pathway. Cancer Lett 358: 17–26, 2015.\n52.\nGoldberg L, Israeli R, Kloog Y. FTS and 2-DG induce pancreatic cancer cell death and tumor shrinkage in mice. Cell Death Dis 3: e284, 2012.\n53.\nSalama SA, Mohammad MA, Diaz-Arrastia CR, Kamel MW, Kilic GS, Ndofor BT, Abdel-Baki MS, Theiler SK. Estradiol-17β upregulates pyruvate kinase M2 expression to coactivate estrogen receptor-α and to integrate metabolic reprogramming with the mitogenic response in endometrial cells. J Clin Endocrinol Metab 99: 3790–3799, 2014.\n54.\nBulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, Kohlmeier A, Yin P, Milad M, Wei JJun. Endometriosis. Endocr Rev 40: 1048–1079, 2019.\n55.\nMcKinnon BD, Kocbek V, Nirgianakis K, Bersinger NA, Mueller MD. Kinase signalling pathways in endometriosis: potential targets for non-hormonal therapeutics. Hum Reprod Update 22: 382–403, 2016.\n56.\nVargiu P, De Abajo R, Garcia-Ranea JA, Valencia A, Santisteban P, Crespo P, Bernal J. The small GTP-binding protein, Rhes, regulates signal transduction from G protein-coupled receptors. Oncogene 23: 559–568, 2004.\n57.\nChen X, Qin Y, Zhang Y, Yang X, Xing Z, Shen Y, Cheng J, Yeh ETH, Wu H, Qi Y. SENP2-PLCβ4 signaling regulates neurogenesis through the maintenance of calcium homeostasis. Cell Death Differ 29: 337–350, 2022.\n58.\nPfeiffer C, Grandits AM, Asnagli H, Schneller A, Huber J, Zojer N, Schreder M, Parker AE, Bolomsky A, Beer PA, Ludwig H. CTPS1 is a novel therapeutic target in multiple myeloma which synergizes with inhibition of CHEK1, ATR or WEE1. Leukemia 38: 181–192, 2024.\n59.\nAsnagli H, Minet N, Pfeiffer C, Hoeben E, Lane R, Laughton D, Birch L, Jones G, Novak A, Parker AE, Ludwig H, Fischer A, Latour S, Beer PA. CTP Synthase 1 is a novel therapeutic target in lymphoma. Hemasphere 7: e864, 2023.\n60.\nTang R, Cui XB, Wang JN, Chen SY. CTP synthase 1, a smooth muscle-sensitive therapeutic target for effective vascular repair. Arterioscler Thromb Vasc Biol 33: 2336–2344, 2013.\nInformation & Authors\nInformation\nPublished In\nAmerican Journal of Physiology-Cell Physiology\nVolume 328 • Issue 2 • February 2025\nPages: C500 - C513\nPubMed: 39672102\nCopyright\nCopyright © 2025 The Authors. Licensed under Creative Commons Attribution CC-BY 4.0. Published by the American Physiological Society.\nHistory\nReceived: 15 July 2024\nRevision received: 26 November 2024\nAccepted: 26 November 2024\nPublished ahead of print: 13 December 2024\nPublished online: 22 January 2025\nPublished in print: February 2025\nKeywords\nAuthors\nMetrics & Citations\nMetrics\nArticle Usage\n- For recently published articles, the total views count will show as 0 until a new month begins.\n- There is a 3–4 day delay in usage data reporting after article publication.\n- Citation counts are from the Crossref Cited-by service.\nAltmetrics\nDimensions\nScite\nCitations\nIf you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click on download.\nDownload article citation data for:\nAmerican Journal of Physiology-Cell Physiology 2025 328:2, C500-C513 10.1152/ajpcell.00493.2024\nAmerican Journal of Physiology-Cell Physiology 2025 328:2, C500-C513 10.1152/ajpcell.00493.2024\nView Options\nView options\nAccess content\nTo read the fulltext, please use one of the options below to sign in or purchase access.\nThis functionality works only for purchases made as a guest","source_license":"CC-BY-4.0","license_restricted":false}