{"paper_id":"41609ebe-7f36-4641-9341-4f7ef57ca73e","body_text":"Marker-assisted pyramiding of bacterial leaf blight resistance genes (Xa21, xa13 and xa5) in a short-duration rice cultivar Luit | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Marker-assisted pyramiding of bacterial leaf blight resistance genes (Xa21, xa13 and xa5) in a short-duration rice cultivar Luit Sushil Kumar Singh, Dhananjay Kumar, Sanjay Kumar Chetia, Mahendra Kumar Modi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8706341/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Bacterial leaf blight (BLB), caused by Xanthomonas oryzae pv. oryzae, remains a major constraint to rice production in the humid and flood-prone rice-growing regions of northeastern India. In this study, BLB resistance was improved in the elite short-duration rice cultivar Luit through marker-assisted backcross breeding by pyramiding three widely used resistance genes, Xa21, xa13 and xa5, with IRBB60 serving as the donor parent. Gene-specific functional markers were used for foreground selection, while genome-wide SSR markers supported background selection and accelerated recovery of the recurrent parent genome. Screening of the BC₂F₂ population identified 57 lines homozygous for all three resistance genes. These pyramided lines showed high recurrent parent genome recovery (81.25–93.84%) and largely retained the agronomic characteristics of Luit, including grain yield, spikelet fertility and flowering duration. When evaluated under artificial inoculation with three virulent X. oryzae pv. oryzae isolates prevalent in Assam, the three-gene pyramided lines consistently exhibited significantly shorter lesion lengths than lines carrying one or two resistance genes, indicating enhanced and stable resistance. The results demonstrate that pyramiding Xa21, xa13 and xa5 through marker-assisted backcrossing is an effective approach for developing agronomically competitive rice breeding lines with durable BLB resistance. The identified lines constitute valuable genetic resources for further multi-location evaluation and for use in rice improvement programmes targeting BLB-prone environments. bacterial leaf blight rice breeding marker-assisted backcrossing gene pyramiding Xa21 xa13 xa5 Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Rice (Oryza sativa L.) is the primary source of dietary calories for more than half of the world’s population and plays a vital role in ensuring food security, particularly in South and Southeast Asia. Despite substantial gains in rice productivity over past decades, crop yields remain highly vulnerable to biotic stresses, among which bacterial leaf blight (BLB), caused by Xanthomonas oryzae pv. oryzae (Xoo), is one of the most destructive diseases of rice. BLB epidemics are especially severe in warm, humid environments and can result in yield losses ranging from 20% to over 50%, depending on the susceptibility of the cultivar, crop growth stage, and virulence of the pathogen population (Mew et al. 1992; Noh et al. 2007; Pradhan et al. 2020). In India, BLB is endemic in most rice-growing regions and poses a persistent threat to productivity, particularly in eastern and northeastern states where climatic conditions favour rapid pathogen multiplication (Joshi et al. 2020; Banerjee et al. 2018). Assam, characterized by frequent flooding and high humidity, represents a hotspot for BLB incidence. Farmers in flood-prone areas predominantly cultivate short-duration rice varieties to escape flood damage; however, many such varieties, including the widely grown cultivar Luit, remain highly susceptible to BLB. This susceptibility significantly undermines yield stability and limits the long-term sustainability of rice cultivation in the region. The deployment of host plant resistance is widely regarded as the most effective, economical, and environmentally sustainable strategy for BLB management. Chemical control measures are often ineffective under field conditions and raise concerns related to cost, environmental safety, and pathogen resistance. Although conventional breeding has successfully introduced individual BLB resistance genes into elite cultivars, resistance conferred by single genes is frequently race-specific and prone to breakdown due to the rapid evolution and diversification of Xoo populations (Mew et al. 1992; Verdier et al. 2012; Pradhan et al. 2020). Consequently, there is a growing consensus that durable BLB resistance can be achieved more effectively through pyramiding multiple resistance genes with complementary mechanisms of action. To date, more than 40 BLB resistance genes (Xa/xa) have been identified in rice, originating from cultivated and wild Oryza species (Kim 2018; Pradhan et al. 2020; Lu et al. 2021). Among these, Xa21, xa13, and xa5 are the most extensively deployed genes in rice breeding programs. Xa21, a dominant gene encoding a receptor-like kinase, confers broad-spectrum resistance, while xa13 and xa5 are recessive genes that operate through distinct molecular mechanisms involving host susceptibility and transcriptional regulation, respectively (Song et al. 1995; Chu et al. 2006; Iyer and McCouch 2004). Several studies have demonstrated that pyramiding Xa21 with xa13 and xa5 significantly enhances resistance levels and improves resistance durability across diverse Xoo strains compared with single- or two-gene combinations (Sundaram et al. 2008; Pradhan et al. 2015; Hsu et al. 2020). The advent of marker-assisted selection (MAS) has revolutionized resistance breeding by enabling precise introgression of target genes while minimizing linkage drag. In particular, marker-assisted backcross breeding (MABB) integrates foreground selection using gene-specific functional markers with background selection using genome-wide markers to accelerate the recovery of the recurrent parent genome (Collard and Mackill 2008; Varshney et al. 2005). This approach has been successfully employed to improve BLB resistance in several elite rice cultivars without compromising agronomic performance or grain quality (Sundaram et al. 2009; Dash et al. 2016; Sabar et al. 2019). Despite the proven effectiveness of MABB for BLB resistance, limited efforts have been made to pyramid multiple BLB resistance genes into short-duration, flood-avoidance rice varieties adapted to the agro-climatic conditions of northeastern India. The rice cultivar Luit, developed for flood-prone ecosystems of Assam, is highly popular among farmers due to its early maturity and adaptability but remains vulnerable to BLB, including strains prevalent in the region. Improving BLB resistance in Luit while retaining its desirable agronomic traits would therefore have substantial practical and socio-economic significance. In this context, the present study aimed to introgress and pyramid three major BLB resistance genes, Xa21, xa13 and xa5, into the genetic background of Luit through marker-assisted backcross breeding. The resulting pyramided lines were evaluated for foreground and background selection efficiency, recurrent parent genome recovery, agronomic performance, and resistance against multiple virulent Xoo isolates collected from different agro-climatic zones of Assam. By combining molecular tools with conventional selection, this study seeks to develop rice lines with durable, broad-spectrum BLB resistance and stable agronomic performance, providing valuable genetic resources for rice improvement in BLB-prone environments. MATERIALS AND METHODS Plant materials The bacterial leaf blight (BLB)–resistant donor parent IRBB60, a near-isogenic line (NIL) of IR24 carrying four BLB resistance genes (Xa21, xa13, xa5 and Xa4), was used as the source of resistance genes. IRBB60 was originally developed at the International Rice Research Institute (IRRI), Philippines, and is widely used in BLB resistance breeding programs. The recurrent parent Luit is a short-duration, medium-grain rice variety released by the Regional Agricultural Research Station (RARS), Titabar, Assam Agricultural University, India. Luit is highly preferred by farmers in flood-prone regions of Assam due to its early maturity and adaptability to rainfed and irrigated ecosystems; however, it is susceptible to bacterial leaf blight. The rice variety Taichung Native 1 (TN-1) was included as a highly susceptible check for BLB during disease screening experiments. Breeding strategy and population development A marker-assisted backcross breeding (MABB) approach was adopted to introgress bacterial leaf blight (BLB) resistance genes into the genetic background of the elite rice cultivar Luit. An initial cross was made between the recurrent parent Luit and the BLB-resistant donor parent IRBB60. The hybridity of F₁ plants was confirmed using polymorphic SSR markers, and only true F₁ plants were advanced further. Confirmed F₁ plants were backcrossed with the recurrent parent Luit to generate the BC₁F₁ population. Marker-assisted foreground selection was carried out in the BC₁F₁ generation to identify plants heterozygous for the target resistance genes. Plants carrying the desired gene combinations and showing close morphological resemblance to Luit were selected and backcrossed again with the recurrent parent to produce the BC₂F₁ population. Foreground selection was repeated in the BC₂F₁ generation to identify plants carrying all three target resistance genes. These selected plants were subjected to background selection using polymorphic SSR markers to estimate recurrent parent genome recovery and to minimize linkage drag. BC₂F₁ plants exhibiting high recovery of the Luit genome along with desirable agronomic traits were selfed to develop the BC₂F₂ population. In the BC₂F₂ generation, a large population was screened using gene-specific functional markers to identify plants homozygous for the target resistance genes. Plants carrying homozygous alleles for Xa21, xa13 and xa5 were selected for further evaluation. Throughout the breeding program, phenotypic selection was integrated with marker-assisted selection at each generation to eliminate plants with undesirable agronomic traits and to retain the characteristic features of the recurrent parent Luit. The short-duration nature of Luit (approximately 90–100 days) allowed rapid advancement of generations by utilizing multiple rice-growing seasons (Ahu, Sali and Boro) prevalent in Assam, thereby accelerating the development of advanced backcross lines. DNA extraction and PCR amplification Genomic DNA was extracted from young leaf tissues collected from rice seedlings at the three-leaf stage using a modified cetyltrimethylammonium bromide (CTAB) method as described by Dellaporta et al. (1983). The quality and concentration of extracted DNA were assessed by agarose gel electrophoresis and spectrophotometric analysis, and DNA samples were diluted to a working concentration of approximately 50 ng μL⁻¹ for polymerase chain reaction (PCR) analysis. PCR amplification was performed in a reaction volume of 10 μL containing approximately 50 ng of template DNA, 5 pmol each of forward and reverse primers, and EmeraldAmp® MAX PCR Master Mix (Takara Bio Inc., Japan). Amplifications were carried out in a thermal cycler using standard cycling conditions optimized for individual markers. PCR products amplified using functional molecular markers were resolved on 2.5–3.0% agarose gels, while SSR marker–based PCR products used for background selection were separated on 3.0–3.5% agarose gels. Gels were stained with ethidium bromide or an equivalent nucleic acid stain and visualized under ultraviolet light using a gel documentation system. Clear and reproducible banding patterns were recorded for subsequent data analysis. Marker-assisted foreground selection Marker-assisted foreground selection was carried out at each generation to identify plants carrying the target bacterial leaf blight (BLB) resistance genes. Three gene-specific functional molecular markers, pTA248, xa13pro, and xa5FM, tightly linked to the resistance genes Xa21, xa13, and xa5, respectively, were used for this purpose ( Supplementary Figure S1 .). At the early stages of the breeding program, parental polymorphism was confirmed using these functional markers to distinguish resistant and susceptible alleles for each target gene. Foreground selection was subsequently applied in the F₁, BC₁F₁, BC₂F₁, and BC₂F₂ generations to track the presence and inheritance of the resistance genes. Plants showing diagnostic banding patterns corresponding to resistance alleles were selected and advanced to the next generation. In the BC₂F₂ population, a large number of plants were screened to identify individuals homozygous for all three target resistance genes. Genotypic classification was based on comparison of banding patterns with those of the donor parent IRBB60 and the recurrent parent Luit. Plants exhibiting homozygous resistance alleles at all three loci were selected for further evaluation and disease screening, while plants carrying single resistance genes or undesirable gene combinations were discarded. The effectiveness of foreground selection and the inheritance of resistance genes in the segregating populations were confirmed through clear and reproducible amplification patterns obtained using the functional markers. This systematic foreground selection ensured accurate pyramiding of Xa21, xa13, and xa5 into the genetic background of the recurrent parent. Background selection and recurrent parent genome recovery Background selection was performed to accelerate the recovery of the recurrent parent genome and to minimize linkage drag associated with the introgression of bacterial leaf blight (BLB) resistance genes. Foreground-positive plants identified in the BC₂F₂ generation and exhibiting agronomic traits similar to the recurrent parent Luit were subjected to background genome analysis. A total of 352 SSR markers distributed across all 12 rice chromosomes were initially screened for parental polymorphism between IRBB60 and Luit. Among these, 88 polymorphic co-dominant SSR markers were selected and used for background analysis of the pyramided lines. PCR amplification and gel electrophoresis were carried out as described previously, and marker data were scored based on the presence of donor, recurrent, or heterozygous alleles. Binary data generated from the SSR analysis were used to estimate genetic similarity between pyramided lines and their parents using Dice similarity coefficients (Nei 1973). A dendrogram illustrating genetic relationships among the pyramided lines, donor parent, and recurrent parent was constructed using the unweighted pair group method with arithmetic mean (UPGMA) implemented in the NTSYS-PC software package. This analysis facilitated the identification of pyramided lines showing closer genetic affinity to the recurrent parent Luit. To visualize the genomic composition of individual pyramided lines and to assess the extent of donor introgression across chromosomes, graphical genotype analysis was performed using GGT version 2.0. Chromosomal segments were classified as donor, recurrent, or heterozygous based on SSR marker profiles, enabling the identification of residual donor segments and regions of linkage drag on carrier chromosomes. The percentage of recurrent parent genome recovery (RPG%) in each pyramided line was calculated using the formula described by Sundaram et al. (2008): where A represents the number of markers homozygous for the recurrent parent allele, B represents the number of heterozygous markers, and N denotes the total number of polymorphic markers used for background analysis. Based on RPG% values, genetic similarity, and agronomic performance, selected pyramided lines exhibiting high recovery of the Luit genome were advanced for disease resistance screening and further field evaluation.( Supplementary Figure S2). Screening for bacterial leaf blight resistance Screening for bacterial leaf blight (BLB) resistance was conducted under controlled field conditions using virulent isolates of Xanthomonas oryzae pv. oryzae (Xoo) collected from different agro-climatic zones of Assam. Based on preliminary virulence assays, three highly aggressive Xoo isolates, ASXOO-LBVZ, ASXOO-CBVZ, and ASXOO-UBVZ, representing the Lower, Central, and Upper Brahmaputra Valley Zones, respectively, were selected for resistance evaluation. The bacterial isolates were cultured on peptone sucrose agar (PSA) medium and incubated at 28 ± 2 °C for 48 h. Bacterial suspensions were prepared in sterile distilled water and adjusted to a concentration of approximately 10⁹ cells mL⁻¹, following the standard protocol described by Kauffman et al. (1973). Artificial inoculation was performed at the maximum tillering stage using the leaf-clip method. For each plant, two to three fully expanded leaves were clipped with sterile scissors dipped in the bacterial suspension. Inoculations were carried out during early morning hours to ensure favourable environmental conditions for disease development, including high relative humidity (≈90%) and moderate temperature (28 ± 2 °C). Disease symptoms were assessed 14 days post-inoculation (dpi), once the susceptible check Taichung Native 1 (TN-1) exhibited fully developed lesions. Lesion length (LL) was measured in centimetres from the cut leaf margin to the visible end of the lesion. Disease reactions were classified based on lesion length according to the standard scoring scale described by Lore et al. (2011). BLB reactions of pyramided lines carrying two or three resistance genes were compared with those of the recurrent parent Luit, the donor parent IRBB60, and the susceptible check TN-1. Mean lesion length values were used to determine the resistance spectrum of the pyramided lines against the different Xoo isolates.(Table 2) Evaluation of agro-morphological traits Selected bacterial leaf blight (BLB) resistance gene–pyramided lines, along with the recurrent parent Luit and donor parent IRBB60, were evaluated for agro-morphological performance under field conditions during the main rice-growing season. Standard agronomic practices recommended for the region were followed throughout the crop growth period to ensure uniform crop management. Data were recorded on key agronomic traits, including plant height (cm), number of tillers per plant, number of effective tillers, panicle length (cm), number of grains per panicle, spikelet fertility (%), 100-grain weight (g), grain yield per plant (g), days to 50% flowering, and days to maturity. Observations were recorded from representative plants in each line at appropriate growth stages following the standard rice evaluation system. Grain yield per plant was determined by harvesting plants at physiological maturity, followed by threshing and cleaning of grains, and recording grain weight after proper drying. Spikelet fertility was calculated as the percentage of filled grains relative to the total number of spikelets per panicle. The agronomic performance of the pyramided lines was compared with that of the recurrent parent Luit to assess the extent to which desirable traits were retained following introgression of BLB resistance genes. The percentage of recurrent parent genome recovery (RPG%) for each pyramided line, estimated through background marker analysis, was also considered in conjunction with agronomic traits to identify superior lines combining high genome recovery, desirable yield attributes, and BLB resistance. Summary statistics for agronomic traits of the pyramided lines are presented. Statistical analysis Data recorded for agro-morphological traits and bacterial leaf blight (BLB) resistance were subjected to appropriate statistical analysis to summarize variation among the pyramided lines. Descriptive statistics, including minimum, maximum, mean, standard error (SE), standard deviation (SD), and coefficient of variation (CV), were calculated for agronomic traits using standard statistical procedures. Mean lesion length values obtained from BLB screening experiments were used to compare the resistance response of different gene combinations against multiple Xanthomonas oryzae pv. oryzae isolates. Analysis of variance (ANOVA) was performed to assess differences among pyramided lines, parents, and checks wherever applicable. Mean comparisons were conducted at the 5% probability level (P ≤ 0.05), and statistically significant differences are indicated in the corresponding figures and tables. All statistical analyses were carried out using standard statistical software packages. Graphical representation of data was prepared using suitable software to clearly illustrate trends in disease response and agronomic performance. Clustering and similarity analyses for background selection were conducted as described in the respective sections. Results Foreground selection and confirmation of bacterial leaf blight resistance genes Marker-assisted foreground selection was carried out using gene-specific functional molecular markers to confirm the presence of bacterial leaf blight (BLB) resistance genes in the segregating populations. The functional markers pTA248, xa13pro, and xa5FM, tightly linked to the resistance genes Xa21, xa13, and xa5, respectively, clearly differentiated resistant and susceptible alleles between the donor parent IRBB60 and the recurrent parent Luit. PCR amplification using the marker pTA248 produced a resistance-specific band of approximately 1000 bp in the donor parent IRBB60, whereas the susceptible allele was observed in the recurrent parent Luit. Similar clear polymorphism was observed for xa13pro and xa5FM markers, enabling reliable identification of resistant and susceptible alleles for xa13 and xa5 genes, respectively (Fig. 1), Supplementary Figure S3). Foreground screening across successive generations facilitated the accurate tracking of target resistance genes during backcrossing and selfing. In the BC₂F₂ population, plants carrying all three resistance genes were identified based on diagnostic banding patterns corresponding to homozygous resistant alleles at all three loci. The effectiveness and reproducibility of the functional markers ensured precise selection of true pyramided lines, confirming the successful introgression of Xa21, xa13, and xa5 into the genetic background of Luit (Table 2). Segregation of bacterial leaf blight resistance genes in the BC₂F₂ population Segregation of bacterial leaf blight (BLB) resistance genes was analysed in the BC₂F₂ population following marker-assisted foreground screening. Functional molecular markers specific to Xa21, xa13, and xa5 were used to classify plants based on the presence and combination of resistance genes. Among the BC₂F₂ plants screened, 57 individuals were identified as homozygous for all three resistance genes, confirming the successful pyramiding of Xa21, xa13, and xa5. In addition to the triple-gene homozygous plants, a substantial number of plants carried different two-gene combinations. Specifically, 135 plants carried the Xa21 + xa13 combination, while 95 plants each carried the Xa21 + xa5 and xa13 + xa5 combinations. A total of 197 plants were found to carry only a single resistance gene and were therefore excluded from further advancement. The observed segregation pattern demonstrated efficient recovery of the desired gene combinations in the BC₂F₂ generation, with a clear enrichment of multiple-gene genotypes resulting from marker-assisted selection. Based on genotypic constitution and breeding objectives, plants homozygous for all three resistance genes were selected for subsequent background genome analysis, agronomic evaluation, and disease resistance screening (Table 3). Background selection and recurrent parent genome recovery Background selection was carried out to assess the extent of recurrent parent genome recovery in the selected bacterial leaf blight resistance gene–pyramided lines. Polymorphic SSR markers distributed across all 12 rice chromosomes were used to estimate genetic similarity between the pyramided lines, the donor parent IRBB60, and the recurrent parent Luit. Cluster analysis based on Dice similarity coefficients revealed clear differentiation between the donor parent and the recurrent parent, with the pyramided lines clustering closer to Luit (Fig. 2). Most of the selected BC₂F₂ lines grouped in the same major cluster as the recurrent parent, indicating substantial recovery of the Luit genome following two backcrosses combined with marker-assisted selection. In contrast, the donor parent IRBB60 formed a distinct cluster, confirming its genetic divergence from Luit. Graphical genotype analysis using GGT 2.0 provided a chromosome-wise visualization of donor, recurrent, and heterozygous genome segments in the pyramided lines (Fig. 3). The majority of chromosomal regions in the selected lines were occupied by recurrent parent segments, with limited donor introgressions confined mainly to regions surrounding the target resistance loci. Only small heterozygous segments were observed on non-carrier chromosomes, suggesting effective elimination of undesirable donor regions through background selection. The percentage of recurrent parent genome recovery (RPG%) among the pyramided lines ranged from 81.25% to 93.84%. Several lines exhibited RPG values exceeding 90%, demonstrating efficient recovery of the Luit genetic background within the BC₂F₂ generation. These results confirm the effectiveness of marker-assisted backcross breeding in accelerating genome recovery while retaining the introgressed resistance genes.(Figures 2 & 3, Table 4 – RPG%) Evaluation of agro-morphological performance of pyramided lines The selected bacterial leaf blight resistance gene–pyramided lines were evaluated for key agro-morphological traits to assess the extent to which desirable characteristics of the recurrent parent Luit were retained following introgression of resistance genes. Considerable variation was observed among the pyramided lines for most of the traits studied, reflecting segregation within the BC₂F₂ population (Table 4). Plant height among the pyramided lines ranged from 84 to 105 cm, with a mean value of 96.38 cm, which was comparable to that of the recurrent parent Luit (90 cm). Most lines exhibited plant height suitable for lodging tolerance and field adaptability. The number of tillers per plant varied from 6 to 18, while the number of effective tillers ranged from 4 to 18, indicating adequate tillering capacity in several pyramided lines. Panicle length ranged from 20.67 to 27.33 cm, with a mean of 24.60 cm, and the number of grains per panicle varied widely (72.16–179.44), suggesting substantial diversity for yield-contributing traits. Spikelet fertility among the pyramided lines ranged from 53.78% to 89.86%, with many lines exhibiting fertility levels comparable to or exceeding those of the recurrent parent. Grain yield per plant among the pyramided lines ranged from 32.0 to 38.0 g, with a mean yield of 35.15 g, which was comparable to the recurrent parent Luit (34.58 g) and, in some cases, approached the donor parent IRBB60. The 100-grain weight varied from 1.73 to 2.23 g, indicating that grain weight was largely maintained following gene introgression. Days to 50% flowering among the pyramided lines ranged from 75 to 86 days, while days to maturity varied from 93 to 121 days, suggesting that most lines retained the short-duration nature of Luit. When considered together with recurrent parent genome recovery values, several pyramided lines combined high RPG% (above 90%) with favourable agronomic performance, indicating successful recovery of the Luit genetic background without yield penalty (Table 4). Reaction of pyramided lines to bacterial leaf blight The bacterial leaf blight (BLB) reaction of the pyramided lines was evaluated based on lesion length following artificial inoculation with three virulent Xanthomonas oryzae pv. oryzae (Xoo) isolates representing different agro-climatic zones of Assam. Clear differences in disease response were observed among lines carrying different combinations of resistance genes (Fig. 4). Across all three Xoo isolates, the three-gene pyramided lines (NC lines) consistently exhibited significantly shorter lesion lengths compared to lines carrying only two resistance genes (NL lines) and the recurrent parent Luit. The enhanced resistance of NC lines was evident against isolates ASXOO-LBVZ, ASXOO-CBVZ, and ASXOO-UBVZ, indicating a broad and stable resistance response across diverse pathogen populations. Two-gene pyramided lines displayed moderate levels of resistance, with lesion lengths generally lower than those of the recurrent parent but higher than those observed in three-gene pyramided lines. As expected, the recurrent parent Luit showed a susceptible reaction, while the donor parent IRBB60 exhibited strong resistance against all tested isolates. The susceptible check Taichung Native 1 (TN-1) developed long lesions, confirming the effectiveness of the inoculation and the virulence of the Xoo isolates. Statistical analysis revealed that differences in lesion length between three-gene pyramided lines and two-gene lines were significant at P ≤ 0.05 and P ≤ 0.01, depending on the isolate (Fig. 4). These results demonstrate that pyramiding Xa21, xa13 and xa5 conferred enhanced and more stable resistance to BLB compared with partial gene combinations, validating the effectiveness of the marker-assisted gene pyramiding strategy. Identification of superior pyramided lines combining resistance and agronomic performance To identify breeding-ready candidates, pyramided lines were further evaluated by integrating bacterial leaf blight resistance response, recurrent parent genome recovery, and key agronomic traits. Lines homozygous for all three resistance genes that exhibited consistently low lesion lengths across all Xanthomonas oryzae pv. oryzae isolates were considered superior in terms of disease resistance. Among the three-gene pyramided lines, several lines combined high recurrent parent genome recovery (>90%) with agronomic performance comparable to or exceeding that of the recurrent parent Luit, particularly for grain yield, spikelet fertility, and flowering duration (Table 4). These lines also maintained the short-duration growth habit characteristic of Luit, indicating successful recovery of the recurrent parent phenotype. The convergence of durable BLB resistance, high genome recovery, and desirable agronomic performance in these selected lines highlights their potential suitability for further multi-location evaluation and possible varietal deployment. This integrative assessment demonstrates that marker-assisted pyramiding of Xa21, xa13 and xa5 can generate elite rice lines with both enhanced disease resistance and agronomic stability. Discussion The present study demonstrates that marker-assisted pyramiding of Xa21, xa13 and xa5 into the popular short-duration rice cultivar Luit successfully generated advanced backcross lines that combine broad-spectrum bacterial leaf blight (BLB) resistance with agronomic performance comparable to the recurrent parent. The high recovery of the recurrent parent genome (RPG values of 81.25% to 93.84%) indicates that the marker-assisted backcross breeding strategy was effective in minimizing linkage drag while retaining the characteristic phenotypic identity of Luit, even after the introgression of multiple resistance genes (Sundaram et al. 2008; Collard and Mackill 2008). This confirms the efficiency of integrating molecular selection with conventional breeding for improving disease resistance without compromising cultivar integrity. Effectiveness of gene pyramiding for durable BLB resistance The strong resistance displayed by the three-gene pyramided lines against multiple Xanthomonas oryzae pv. oryzae (Xoo) isolates clearly highlights the advantage of combining resistance genes with complementary modes of action. The dominant gene Xa21, which encodes a receptor-like kinase, provides broad-spectrum recognition of the pathogen, while the recessive genes xa13 and xa5 interfere with pathogen virulence and host transcriptional regulation, respectively (Song et al. 1995; Chu et al. 2006; Iyer and McCouch 2004). The consistently shorter lesion lengths observed across isolates collected from different agro-climatic zones of Assam indicate that pyramiding these genes creates a multilayered defense system, thereby reducing the risk of resistance breakdown. Similar improvements in resistance level and durability through multi-gene pyramiding have been reported in other elite rice backgrounds, further supporting the effectiveness of this strategy for long-term BLB management (Sundaram et al. 2008; Pradhan et al. 2016; Hsu et al. 2020). Background genome recovery and linkage drag Background selection using genome-wide SSR markers revealed that donor genome introgressions in the pyramided lines were largely restricted to regions flanking the target resistance loci, as visualized through graphical genotype analysis. Lines showing higher RPG values clustered closely with the recurrent parent in dendrogram analysis, confirming efficient genome recovery within the BC₂F₂ generation. These results clearly demonstrate the value of integrating background selection into resistance breeding programmes, particularly when multiple genes are introgressed simultaneously, as it enables rapid recovery of the elite genetic background while limiting undesirable donor segments (Varshney et al. 2005; Van Berloo 2008). Agronomic performance and breeding relevance Retention of key agronomic traits is essential for the practical adoption of improved cultivars by farmers. In the present study, several three-gene pyramided lines exhibited grain yield, spikelet fertility and phenological traits comparable to, and in some cases better than, those of the recurrent parent Luit. This indicates that introgression of BLB resistance genes did not impose a yield penalty or negatively affect important agronomic characteristics. Similar outcomes have been reported in marker-assisted improvement of rice cultivars for BLB resistance, where careful molecular and phenotypic selection preserved yield potential while enhancing disease resistance (Dash et al. 2016; Sabar et al. 2019). Management and deployment implications From a practical breeding and crop management perspective, the pyramided lines developed in this study represent promising genetic resources for BLB-prone regions of northeastern India. The short-duration nature of Luit makes it particularly suitable for flood-escape ecosystems, and the addition of durable BLB resistance further strengthens its suitability under changing climatic conditions. Deployment of such resistant lines has the potential to reduce farmers’ dependence on chemical control measures, thereby lowering production costs and minimizing environmental impacts. For effective deployment, the selected elite pyramided lines should be evaluated through multi-location and multi-season yield trials across diverse agro-ecologies of Assam to validate their performance under natural disease pressure. Continuous monitoring of Xoo populations will also be important to detect shifts in pathogen virulence that may threaten resistance durability (Verdier et al. 2012; Pradhan et al. 2020). Integrating these resistant lines into existing integrated disease management strategies, including balanced fertilization and optimal planting schedules, will further enhance their field performance. In addition to their direct deployment potential, the pyramided lines can serve as valuable donor parents for future breeding programmes targeting BLB resistance in other locally adapted varieties. The availability of lines combining high RPG, stable resistance and desirable agronomic traits provides breeders with flexible options for addressing region-specific production constraints. Overall, this study demonstrates that marker-assisted pyramiding of Xa21, xa13 and xa5 into an elite short-duration rice variety is an effective strategy for developing BLB-resistant lines without compromising agronomic performance. The integration of molecular tools with conventional breeding and phenotypic selection enabled the identification of breeding-ready lines with strong potential for deployment in BLB-endemic regions, contributing to ongoing efforts to achieve durable disease resistance and sustainable rice production under diverse and challenging agro-climatic conditions. Conclusion This study demonstrates the effectiveness of marker-assisted backcross breeding for pyramiding three major bacterial leaf blight resistance genes, Xa21, xa13 and xa5, into the short-duration rice cultivar Luit. The combined use of gene-specific functional markers for foreground selection and genome-wide SSR markers for background selection enabled rapid recovery of the recurrent parent genome while minimizing linkage drag. Several BC₂F₂ pyramided lines were identified that exhibited stable resistance to multiple virulent Xanthomonas oryzae pv. oryzae isolates, high recurrent parent genome recovery (up to 93.84%), and agronomic performance comparable to, or better than, the recurrent parent. The retention of key traits such as early maturity, grain yield and spikelet fertility indicates that introgression of multiple resistance genes did not result in a yield penalty. By integrating resistance evaluation, genome recovery analysis and agronomic assessment, the study identified advanced breeding lines with strong potential for further multi-location testing and potential varietal deployment following additional evaluation in bacterial leaf blight–prone regions of northeastern India. In addition to their direct breeding value, these pyramided lines constitute useful genetic resources for future rice improvement programmes targeting durable disease resistance. Overall, the findings highlight the practical utility of marker-assisted gene pyramiding as an effective strategy for developing agronomically competitive rice lines with enhanced resistance to bacterial leaf blight, thereby supporting sustainable rice production under diverse and challenging agro-climatic conditions. Declarations Acknowledgements The first author would like to acknowledge the ICAR and DBT-AAU Centre, Assam Agricultural University, for assisting the entire investigation at Assam Agricultural University, Jorhat, as part of the PhD research work. We are also thankful to Dr T. Ahmed, Chief Scientist, RARS, Titabor, for providing the facility for all the fieldwork. Author contributions The authors confirm their contributions to the paper, as follows: study conception and design, MKM and SKS; data collection and analysis, SKS; interpretation of results, SKS, DK and SKC; and draft manuscript preparation, SKS, DK. All authors reviewed the results and approved the final manuscript version. Funding: This research was funded by the Department of Agricultural Biotechnology, Assam Agricultural University, Jorhat, Assam, a PhD research Fund Data availability: The data supporting this article are included in the Supplementary Information. Conflict of interest: The authors declare that they have no conflicts of interest in the publication. Ethical approval: No human participants and/or animals were involved in this research. Competing interests: We declare that there are no financial and research competing interests. References Banerjee A, Roy S, Bag MK, Bhagat S, Kar MK, Mandal NP, Maiti D (2018) A survey of bacterial blight (Xanthomonas oryzae pv. oryzae) resistance in rice germplasm from eastern and northeastern India using molecular markers. Crop Protection 112:168–176. https://doi.org/10.1016/j.cropro.2018.05.017 Chu Z, Fu B, Yang H, Xu C, Li Z, Sanchez A, Park YJ, Bennetzen JL, Zhang Q, Wang S (2006) Targeting xa13, a recessive gene for bacterial blight resistance in rice. Theoretical and Applied Genetics 112:455–461. https://doi.org/10.1007/s00122-005-0145-6 Collard BCY, Mackill DJ (2008) Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B: Biological Sciences 363:557–572. https://doi.org/10.1098/rstb.2007.2170 Dash AK, Rao RN, Rao GJN, Verma RL, Katara JL, Mukherjee AK, Bagchi TB (2016) Phenotypic and marker-assisted genetic enhancement of parental lines of Rajalaxmi, an elite rice hybrid. Frontiers in Plant Science 7:1005. https://doi.org/10.3389/fpls.2016.01005 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1:19–21. https://doi.org/10.1007/BF02712670 Hsu YC, Chiu CH, Yap R, Tseng YC, Wu YP (2020) Pyramiding bacterial blight resistance genes in rice for broad-spectrum resistance using marker-assisted selection. International Journal of Molecular Sciences 21:1281. https://doi.org/10.3390/ijms21041281 Iyer AS, McCouch SR (2004) The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Molecular Plant–Microbe Interactions 17:1348–1354. https://doi.org/10.1094/MPMI.2004.17.12.1348 Joshi JB, Arul L, Ramalingam J, Uthandi S (2020) Advances in the Xoo–rice pathosystem interaction and its exploitation in disease management. Journal of Biosciences 45:1–17. https://doi.org/10.1007/s12038-020-00051-6 Kauffman HE, Reddy APK, Hsieh SPY, Merca SD (1973) An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Disease Reporter 57:537–541 Kim SM (2018) Identification of novel recessive gene xa44(t) conferring resistance to bacterial blight in rice. Theoretical and Applied Genetics 131:2733–2743. https://doi.org/10.1007/s00122-018-3173-8 Lore JS, Vikal Y, Hunjan MS, Goel RK, Bharaj TS, Raina GL (2011) Resistance reaction of rice genotypes against bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae. Oryza 48:114–118 Lu J, Wang C, Zeng D, Li J, Shi X, Shi Y, Zhou Y (2021) Genome-wide association study dissects resistance loci against bacterial blight in rice. Rice 14:1–13. https://doi.org/10.1186/s12284-021-00470-5 Mew TW, Vera Cruz CM, Medalla ES (1992) Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted. Plant Disease 76:1029–1032. https://doi.org/10.1094/PD-76-1029 Nei M, Li WH (1979) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences USA 76:5269–5273. https://doi.org/10.1073/pnas.76.10.5269 Noh TH, Lee DK, Park JC, Shim HK, Choi MY, Kang MH et al. (2007) Effect of bacterial leaf blight on rice yield and grain quality. Research in Plant Disease 13:20–23 Pradhan SK, Nayak DK, Pandit E, Behera L, Anandan A, Mukherjee AK, Lenka S, Barik DP (2016) Incorporation of bacterial blight resistance genes into lowland rice through marker-assisted backcross breeding. Phytopathology 106:710–718. https://doi.org/10.1094/PHYTO-09-15-0226-R Pradhan SK, Barik SR, Nayak DK, Pradhan A, Pandit E, Nayak P, Lenka S (2020) Genetics, molecular mechanisms and deployment of bacterial blight resistance genes in rice. Critical Reviews in Plant Sciences 39:360–385. https://doi.org/10.1080/07352689.2020.1801361 Sabar M, Shabir G, Shah SM, Aslam K, Naveed SA, Arif M (2019) Marker-assisted pyramiding of bacterial blight resistance genes in rice. Journal of Plant Pathology 101:871–881. https://doi.org/10.1007/s42161-019-00323-4 Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald PC (1995) A receptor kinase-like protein encoded by the rice disease resistance gene Xa21. Science 270:1804–1806. https://doi.org/10.1126/science.270.5243.1804 Sundaram RM, Vishnupriya MR, Biradar SK, Laha GS, Reddy GA, Rani NS, Sarma NP, Sonti RV (2008) Marker-assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica 160:411–422. https://doi.org/10.1007/s10681-007-9564-6 Sundaram RM, Vishnupriya MR, Laha GS, Rani NS, Rao PS, Balachandran SM et al. (2009) Introduction of bacterial blight resistance into Triguna rice variety. Biotechnology Journal 4:400–407. https://doi.org/10.1002/biot.200800311 Van Berloo R (2008) GGT 2.0: versatile software for visualization and analysis of genetic data. Journal of Heredity 99:232–236. https://doi.org/10.1093/jhered/esm109 Varshney RK, Graner A, Sorrells ME (2005) Genomics-assisted breeding for crop improvement. Trends in Plant Science 10:621–630. https://doi.org/10.1016/j.tplants.2005.10.004 Verdier V, Cruz CV, Leach JE (2012) Controlling rice bacterial blight in Africa: needs and prospects. Journal of Biotechnology 159:320–328. https://doi.org/10.1016/j.jbiotec.2011.09.020 Tables Table 1. Functional molecular markers used for foreground selection of bacterial leaf blight resistance genes Resistance gene Chromosome Functional marker Genetic distance (cM) Primer sequences (5′–3′) Reference xa5 5 xa5FM 0 F: GTCTGGAATTTGCTCGCGTTCG R: TGGTAAAGTAGATACCTTATCAAACTGGA Sundaram et al. (2011) xa13 8 xa13pro 0 F: GGCCATGGCTCAGTGTTTAT R: GAGCTCCAGCTCTCCAAATG Sundaram et al. (2011) Xa21 11 pTA248 0 F: AGACGCGGAAGGGTGGTTCCCGGA R: AGACGCGGTAATCGAAGATGAAA Ronald et al. (19 Table 2. Disease reaction scale for bacterial leaf blight based on lesion length Lesion length (cm)* Disease reaction Score < 5.0 Resistant (R) 1 5.1 – 10.0 Moderately resistant (MR) 3 10.1 – 15.0 Moderately susceptible (MS) 5 15.1 – 20.0 Susceptible (S) 7 > 20.0 Highly susceptible (HS) 9 Footnote: Lesion length was measured at 14 days post-inoculation (dpi) following the standard clip inoculation method described by Lore et al. (2011) . Table 3. Segregation of bacterial leaf blight resistance genes in the BC₂F₂ population derived from Luit × IRBB60 A. Distribution of resistance gene combinations in BC₂F₂ population Resistance gene combination Genotypic class* Number of plants Xa21 + xa13 + xa5 Homozygous for all three genes 57 Xa21 + xa13 Heterozygous / homozygous 135 Xa21 + xa5 Heterozygous / homozygous 95 xa13 + xa5 Heterozygous / homozygous 95 Single resistance gene Heterozygous / homozygous 197 Total BC₂F₂ plants screened 579 B. Summary of selection outcome for advancement Category Number of plants Total BC₂F₂ plants screened 579 Triple-gene homozygous lines selected 57 Double-gene pyramided lines 325 Single-gene lines (discarded) 197 Footnote Genotypic classification was based on functional marker-assisted foreground selection using pTA248 (Xa21), xa13pro (xa13), and xa5FM (xa5). Segregation ratios were not subjected to chi-square analysis as the population was advanced through marker-assisted selection rather than Mendelian segregation analysis . Table 4. Agronomic performance of selected bacterial leaf blight resistance gene-pyramided lines in comparison with recurrent and donor parents Plant material PH (cm) NOT ENT NOG SF (%) PL (cm) 100-GW (g) GYP (g) DTM DTF Disease reaction RPG (%) IRBB60 (Donor parent) 110 15 14 145 88.60 26.0 2.20 38.00 117 88 LS – Luit (Recurrent parent) 90 10 9 134 79.25 25.0 1.85 34.58 95 75 LS – NC1.5 88 9 7 111.17 54.43 20.67 1.95 37.00 121 86 LS 86.42 NC6.3 105 14 9 176.33 81.29 25.33 1.95 35.00 95 76 MS 85.92 NC6.5 100 18 18 142.23 84.06 22.33 2.23 36.00 95 76 MS 93.84 NC6.11 90 16 16 170.83 85.76 23.00 1.95 37.00 95 76 MS 93.84 NC7.3 99 6 4 162.26 83.98 24.33 1.97 34.00 98 78 MS 92.25 NC7.4 90 11 9 104.29 72.19 25.33 2.15 32.00 93 75 LS 88.19 NC7.5 84 11 10 94.68 70.07 25.00 2.10 36.00 96 75 MS 82.19 NC8.1 105 12 12 179.44 79.01 24.33 1.73 37.00 110 80 LS 92.36 NC8.4 97 10 9 115.17 65.56 25.33 1.85 38.00 111 81 LS 89.73 NC8.5 100 16 16 102.27 68.89 26.33 1.81 33.00 118 85 LS 91.22 NC8.6 99 12 11 72.16 78.36 25.50 1.85 32.00 105 79 MS 88.51 NC8.7 97 14 14 141.40 89.86 25.00 2.17 36.00 108 80 MS 83.33 NC8.9 99 15 15 119.00 53.78 27.33 2.20 34.00 106 79 MS 81.25 Summary statistics (BC₂F₂ pyramided lines) Statistic PH NOT ENT NOG SF (%) PL 100-GW GYP DTM DTF RPG (%) Minimum 84 6 4 72.16 53.78 20.67 1.73 32.0 93 75 81.25 Maximum 105 18 18 179.44 89.86 27.33 2.23 38.0 121 86 93.84 Mean 96.38 12.62 11.50 131.34 75.67 24.60 1.99 35.15 104.2 79.26 88.39 SE (±) 1.79 0.92 1.13 8.31 2.92 0.48 0.04 0.52 2.40 1.01 – SD 7.18 3.20 3.88 32.19 11.32 1.65 0.16 1.99 9.65 4.20 – CV (%) 7.42 25.41 33.71 24.51 14.96 6.69 8.23 5.65 9.26 5.29 – Footnotes PH: plant height; NOT: number of tillers; ENT: effective number of tillers; NOG: number of grains per panicle; SF: spikelet fertility; PL: panicle length; 100-GW: 100-grain weight; GYP: grain yield per plant; DTM: days to maturity; DTF: days to 50% flowering; RPG: recurrent parent genome recovery. Disease reaction categories are based on lesion length scoring (Table 2). Additional Declarations No competing interests reported. Supplementary Files supplementaryS1.docx supplementaryS2.docx supplementaryS3.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8706341\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":594067109,\"identity\":\"4982382c-7eb6-42b0-a9a4-1bf7f572a1fd\",\"order_by\":0,\"name\":\"Sushil Kumar Singh\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYBACfhDB2CAhAyKByAbEbTyAT4tkA0QLD1RLGpiLV4vBAbAaBh4GiHWHwTReLQwH2J9J/txhwcPAf7jt4dcd5+3Wth8G2lJjE41LB2MDj5k07xmgwyQS241lz9xO3nYmEajlWFpuAw4tzAw8bNKMbSAtjG3Skm23k80OALUAXYhTCxsDyGEgLfwHQVrOJZudf4hfC9DbZhK8IC0MiW2SH9sO2JndIGCLBDOPsTVIC5tEYhvQhckJZjeAtiTg8Yv98faHN3+21cnx8x8HudDO3ux8+sMHH2pscGoB+h/mKSAb5DywygRcytEB4w+gtcQqHgWjYBSMgpEDALiZWfD2sEVjAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Assam Agricultural University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Sushil\",\"middleName\":\"Kumar\",\"lastName\":\"Singh\",\"suffix\":\"\"},{\"id\":594067110,\"identity\":\"4f796434-472b-4147-8c0e-24ab212b6fae\",\"order_by\":1,\"name\":\"Dhananjay Kumar\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Assam Down Town University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dhananjay\",\"middleName\":\"\",\"lastName\":\"Kumar\",\"suffix\":\"\"},{\"id\":594067111,\"identity\":\"ddfd1474-dd8b-4249-91b0-7e6f52fefbfb\",\"order_by\":2,\"name\":\"Sanjay Kumar Chetia\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Assam Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sanjay\",\"middleName\":\"Kumar\",\"lastName\":\"Chetia\",\"suffix\":\"\"},{\"id\":594067112,\"identity\":\"eb30128a-6079-412f-b1ea-7100193e7a8d\",\"order_by\":3,\"name\":\"Mahendra Kumar Modi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Assam Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mahendra\",\"middleName\":\"Kumar\",\"lastName\":\"Modi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-01-27 06:09:25\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8706341/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8706341/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":103111439,\"identity\":\"f298e18d-8e02-4124-b90b-8b6a0c45b4c9\",\"added_by\":\"auto\",\"created_at\":\"2026-02-21 04:04:41\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":368387,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eForeground selection of BC₂F₂ recombinant lines for bacterial leaf blight resistance genes using functional molecular markers.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) PCR amplification with marker pTA248, specific to the Xa21 gene, showing the resistance-specific allele (~1000 bp) in the donor parent IRBB60 and selected pyramided lines.\\u003c/p\\u003e\\n\\u003cp\\u003e(B) Foreground selection using xa13pro marker linked to the xa13 gene, where the resistant allele (~450 bp) is present in the donor parent and pyramided lines, while the susceptible allele (~220 bp) is observed in the recurrent parent Luit.\\u003c/p\\u003e\\n\\u003cp\\u003e(C) PCR amplification using xa5FM marker specific to the xa5 gene, differentiating resistant and susceptible alleles based on diagnostic banding patterns. M, DNA ladder; RP, recurrent parent (Luit); DP, donor parent (IRBB60); lanes 1–26 represent BC₂F₂ pyramided recombinant lines.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/1b32654b7968416ef8df666e.png\"},{\"id\":103505038,\"identity\":\"1ed1155a-7d1c-434d-927d-0b6eb51ca55a\",\"added_by\":\"auto\",\"created_at\":\"2026-02-26 13:22:34\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":107532,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDendrogram depicting the genetic relationship among selected bacterial leaf blight resistance gene–pyramided lines and their parents based on background marker analysis. The dendrogram was generated using polymorphic SSR markers to assess genome similarity between 12 BC₂F₂ pyramided lines, the donor parent IRBB60, and the recurrent parent Luit. Clustering patterns indicate the extent of recurrent parent genome recovery in the pyramided lines, with lines grouping closer to Luit showing higher genetic similarity to the recurrent parent.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/157ef5117a80d07d84b5b51a.png\"},{\"id\":103111433,\"identity\":\"5ed12423-da73-48a8-9816-e1e44e3c7479\",\"added_by\":\"auto\",\"created_at\":\"2026-02-21 04:04:40\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":412654,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGraphical genotype representation of carrier chromosomes showing donor, recurrent, and heterozygous genome segments in bacterial leaf blight resistance gene–pyramided lines. The graphical genotypes were generated using GGT 2.0 to visualise the distribution of chromosomal segments derived from the donor parent IRBB60, the recurrent parent Luit, and heterozygous regions across the carrier chromosomes of 12 selected BC₂F₂ pyramided lines. Colored blocks indicate donor (D), recurrent (R), and heterozygous (H) genomic regions, highlighting the extent of recurrent parent genome recovery achieved through marker-assisted backcross breeding.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/d676a697cfa9a8bf89cd87bd.png\"},{\"id\":103111434,\"identity\":\"f8f2186d-06a2-43c1-a67b-19ae9bf3da11\",\"added_by\":\"auto\",\"created_at\":\"2026-02-21 04:04:40\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":213115,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eReaction of bacterial leaf blight resistance gene–pyramided rice lines based on lesion length following artificial inoculation with different Xanthomonas oryzae pv. oryzae (Xoo) strains. Lesion length (cm) was recorded in three-gene pyramided lines (NC lines) and two-gene pyramided lines (NL lines) against three prevalent Xoo strains of Assam: ASXOO-LBVZ (Lower Brahmaputra Valley Zone), ASXOO-CBVZ (Central Brahmaputra Valley Zone), and ASXOO-UBVZ (Upper Brahmaputra Valley Zone). Data represent mean lesion length values, and significant differences among lines are indicated by asterisks (P ≤ 0.05; P ≤ 0.01), demonstrating enhanced and stable resistance in three-gene pyramided lines across multiple pathogen populations.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/569a9cec124ec0eec1ecf997.png\"},{\"id\":103509169,\"identity\":\"ace0808b-56bd-444d-b0fa-85ec7322d27b\",\"added_by\":\"auto\",\"created_at\":\"2026-02-26 13:57:00\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2817850,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/6f0e2c5c-c5bf-436c-9c21-8237f4c5414b.pdf\"},{\"id\":103111435,\"identity\":\"a05fe3f3-3841-4ee4-bbbf-a583a9100e3f\",\"added_by\":\"auto\",\"created_at\":\"2026-02-21 04:04:40\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":110888,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementaryS1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/70ac386586752e2f0fc9130c.docx\"},{\"id\":103504512,\"identity\":\"71743398-9c3c-4e72-9198-d39c18b4d24f\",\"added_by\":\"auto\",\"created_at\":\"2026-02-26 13:20:20\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":555058,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementaryS2.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/7db8627ce9adbb78d10691e9.docx\"},{\"id\":103111437,\"identity\":\"5340770a-7a16-4f57-92e6-c00e1abe5a88\",\"added_by\":\"auto\",\"created_at\":\"2026-02-21 04:04:40\",\"extension\":\"docx\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":99510,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementaryS3.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8706341/v1/40c91f5c3e7328bfed37adea.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Marker-assisted pyramiding of bacterial leaf blight resistance genes (Xa21, xa13 and xa5) in a short-duration rice cultivar Luit\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eRice (Oryza sativa L.) is the primary source of dietary calories for more than half of the world\\u0026rsquo;s population and plays a vital role in ensuring food security, particularly in South and Southeast Asia. Despite substantial gains in rice productivity over past decades, crop yields remain highly vulnerable to biotic stresses, among which bacterial leaf blight (BLB), caused by Xanthomonas oryzae pv. oryzae (Xoo), is one of the most destructive diseases of rice. BLB epidemics are especially severe in warm, humid environments and can result in yield losses ranging from 20% to over 50%, depending on the susceptibility of the cultivar, crop growth stage, and virulence of the pathogen population (Mew et al. 1992; Noh et al. 2007; Pradhan et al. 2020). In India, BLB is endemic in most rice-growing regions and poses a persistent threat to productivity, particularly in eastern and northeastern states where climatic conditions favour rapid pathogen multiplication (Joshi et al. 2020; Banerjee et al. 2018). Assam, characterized by frequent flooding and high humidity, represents a hotspot for BLB incidence. Farmers in flood-prone areas predominantly cultivate short-duration rice varieties to escape flood damage; however, many such varieties, including the widely grown cultivar Luit, remain highly susceptible to BLB. This susceptibility significantly undermines yield stability and limits the long-term sustainability of rice cultivation in the region. The deployment of host plant resistance is widely regarded as the most effective, economical, and environmentally sustainable strategy for BLB management. Chemical control measures are often ineffective under field conditions and raise concerns related to cost, environmental safety, and pathogen resistance. Although conventional breeding has successfully introduced individual BLB resistance genes into elite cultivars, resistance conferred by single genes is frequently race-specific and prone to breakdown due to the rapid evolution and diversification of Xoo populations (Mew et al. 1992; Verdier et al. 2012; Pradhan et al. 2020). Consequently, there is a growing consensus that durable BLB resistance can be achieved more effectively through pyramiding multiple resistance genes with complementary mechanisms of action.\\u003c/p\\u003e\\n\\u003cp\\u003eTo date, more than 40 BLB resistance genes (Xa/xa) have been identified in rice, originating from cultivated and wild Oryza species (Kim 2018; Pradhan et al. 2020; Lu et al. 2021). Among these, Xa21, xa13, and xa5 are the most extensively deployed genes in rice breeding programs. Xa21, a dominant gene encoding a receptor-like kinase, confers broad-spectrum resistance, while xa13 and xa5 are recessive genes that operate through distinct molecular mechanisms involving host susceptibility and transcriptional regulation, respectively (Song et al. 1995; Chu et al. 2006; Iyer and McCouch 2004). Several studies have demonstrated that pyramiding Xa21 with xa13 and xa5 significantly enhances resistance levels and improves resistance durability across diverse Xoo strains compared with single- or two-gene combinations (Sundaram et al. 2008; Pradhan et al. 2015; Hsu et al. 2020). The advent of marker-assisted selection (MAS) has revolutionized resistance breeding by enabling precise introgression of target genes while minimizing linkage drag. In particular, marker-assisted backcross breeding (MABB) integrates foreground selection using gene-specific functional markers with background selection using genome-wide markers to accelerate the recovery of the recurrent parent genome (Collard and Mackill 2008; Varshney et al. 2005). This approach has been successfully employed to improve BLB resistance in several elite rice cultivars without compromising agronomic performance or grain quality (Sundaram et al. 2009; Dash et al. 2016; Sabar et al. 2019). Despite the proven effectiveness of MABB for BLB resistance, limited efforts have been made to pyramid multiple BLB resistance genes into short-duration, flood-avoidance rice varieties adapted to the agro-climatic conditions of northeastern India. The rice cultivar Luit, developed for flood-prone ecosystems of Assam, is highly popular among farmers due to its early maturity and adaptability but remains vulnerable to BLB, including strains prevalent in the region. Improving BLB resistance in Luit while retaining its desirable agronomic traits would therefore have substantial practical and socio-economic significance. In this context, the present study aimed to introgress and pyramid three major BLB resistance genes, Xa21, xa13 and xa5, into the genetic background of Luit through marker-assisted backcross breeding. The resulting pyramided lines were evaluated for foreground and background selection efficiency, recurrent parent genome recovery, agronomic performance, and resistance against multiple virulent Xoo isolates collected from different agro-climatic zones of Assam. By combining molecular tools with conventional selection, this study seeks to develop rice lines with durable, broad-spectrum BLB resistance and stable agronomic performance, providing valuable genetic resources for rice improvement in BLB-prone environments.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003ePlant materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe bacterial leaf blight (BLB)\\u0026ndash;resistant donor parent IRBB60, a near-isogenic line (NIL) of IR24 carrying four BLB resistance genes (Xa21, xa13, xa5 and Xa4), was used as the source of resistance genes. IRBB60 was originally developed at the International Rice Research Institute (IRRI), Philippines, and is widely used in BLB resistance breeding programs. The recurrent parent Luit is a short-duration, medium-grain rice variety released by the Regional Agricultural Research Station (RARS), Titabar, Assam Agricultural University, India. Luit is highly preferred by farmers in flood-prone regions of Assam due to its early maturity and adaptability to rainfed and irrigated ecosystems; however, it is susceptible to bacterial leaf blight. The rice variety Taichung Native 1 (TN-1) was included as a highly susceptible check for BLB during disease screening experiments.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBreeding strategy and population development\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA marker-assisted backcross breeding (MABB) approach was adopted to introgress bacterial leaf blight (BLB) resistance genes into the genetic background of the elite rice cultivar Luit. An initial cross was made between the recurrent parent Luit and the BLB-resistant donor parent IRBB60. The hybridity of F₁ plants was confirmed using polymorphic SSR markers, and only true F₁ plants were advanced further. Confirmed F₁ plants were backcrossed with the recurrent parent Luit to generate the BC₁F₁ population. Marker-assisted foreground selection was carried out in the BC₁F₁ generation to identify plants heterozygous for the target resistance genes. Plants carrying the desired gene combinations and showing close morphological resemblance to Luit were selected and backcrossed again with the recurrent parent to produce the BC₂F₁ population. Foreground selection was repeated in the BC₂F₁ generation to identify plants carrying all three target resistance genes. These selected plants were subjected to background selection using polymorphic SSR markers to estimate recurrent parent genome recovery and to minimize linkage drag. BC₂F₁ plants exhibiting high recovery of the Luit genome along with desirable agronomic traits were selfed to develop the BC₂F₂ population. In the BC₂F₂ generation, a large population was screened using gene-specific functional markers to identify plants homozygous for the target resistance genes. Plants carrying homozygous alleles for Xa21, xa13 and xa5 were selected for further evaluation. Throughout the breeding program, phenotypic selection was integrated with marker-assisted selection at each generation to eliminate plants with undesirable agronomic traits and to retain the characteristic features of the recurrent parent Luit. The short-duration nature of Luit (approximately 90\\u0026ndash;100 days) allowed rapid advancement of generations by utilizing multiple rice-growing seasons (Ahu, Sali and Boro) prevalent in Assam, thereby accelerating the development of advanced backcross lines.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDNA extraction and PCR amplification\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGenomic DNA was extracted from young leaf tissues collected from rice seedlings at the three-leaf stage using a modified cetyltrimethylammonium bromide (CTAB) method as described by Dellaporta et al. (1983). The quality and concentration of extracted DNA were assessed by agarose gel electrophoresis and spectrophotometric analysis, and DNA samples were diluted to a working concentration of approximately 50 ng \\u0026mu;L⁻\\u0026sup1; for polymerase chain reaction (PCR) analysis. PCR amplification was performed in a reaction volume of 10 \\u0026mu;L containing approximately 50 ng of template DNA, 5 pmol each of forward and reverse primers, and EmeraldAmp\\u0026reg; MAX PCR Master Mix (Takara Bio Inc., Japan). Amplifications were carried out in a thermal cycler using standard cycling conditions optimized for individual markers. PCR products amplified using functional molecular markers were resolved on 2.5\\u0026ndash;3.0% agarose gels, while SSR marker\\u0026ndash;based PCR products used for background selection were separated on 3.0\\u0026ndash;3.5% agarose gels. Gels were stained with ethidium bromide or an equivalent nucleic acid stain and visualized under ultraviolet light using a gel documentation system. Clear and reproducible banding patterns were recorded for subsequent data analysis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMarker-assisted foreground selection\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMarker-assisted foreground selection was carried out at each generation to identify plants carrying the target bacterial leaf blight (BLB) resistance genes. Three gene-specific functional molecular markers, pTA248, xa13pro, and xa5FM, tightly linked to the resistance genes Xa21, xa13, and xa5, respectively, were used for this purpose (\\u003cstrong\\u003eSupplementary Figure S1\\u003c/strong\\u003e.). At the early stages of the breeding program, parental polymorphism was confirmed using these functional markers to distinguish resistant and susceptible alleles for each target gene. Foreground selection was subsequently applied in the F₁, BC₁F₁, BC₂F₁, and BC₂F₂ generations to track the presence and inheritance of the resistance genes. Plants showing diagnostic banding patterns corresponding to resistance alleles were selected and advanced to the next generation. In the BC₂F₂ population, a large number of plants were screened to identify individuals homozygous for all three target resistance genes. Genotypic classification was based on comparison of banding patterns with those of the donor parent IRBB60 and the recurrent parent Luit. Plants exhibiting homozygous resistance alleles at all three loci were selected for further evaluation and disease screening, while plants carrying single resistance genes or undesirable gene combinations were discarded. The effectiveness of foreground selection and the inheritance of resistance genes in the segregating populations were confirmed through clear and reproducible amplification patterns obtained using the functional markers. This systematic foreground selection ensured accurate pyramiding of Xa21, xa13, and xa5 into the genetic background of the recurrent parent.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBackground selection and recurrent parent genome recovery\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBackground selection was performed to accelerate the recovery of the recurrent parent genome and to minimize linkage drag associated with the introgression of bacterial leaf blight (BLB) resistance genes. Foreground-positive plants identified in the BC₂F₂ generation and exhibiting agronomic traits similar to the recurrent parent Luit were subjected to background genome analysis. A total of 352 SSR markers distributed across all 12 rice chromosomes were initially screened for parental polymorphism between IRBB60 and Luit. Among these, 88 polymorphic co-dominant SSR markers were selected and used for background analysis of the pyramided lines. PCR amplification and gel electrophoresis were carried out as described previously, and marker data were scored based on the presence of donor, recurrent, or heterozygous alleles. Binary data generated from the SSR analysis were used to estimate genetic similarity between pyramided lines and their parents using Dice similarity coefficients (Nei 1973). A dendrogram illustrating genetic relationships among the pyramided lines, donor parent, and recurrent parent was constructed using the unweighted pair group method with arithmetic mean (UPGMA) implemented in the NTSYS-PC software package. This analysis facilitated the identification of pyramided lines showing closer genetic affinity to the recurrent parent Luit. To visualize the genomic composition of individual pyramided lines and to assess the extent of donor introgression across chromosomes, graphical genotype analysis was performed using GGT version 2.0. Chromosomal segments were classified as donor, recurrent, or heterozygous based on SSR marker profiles, enabling the identification of residual donor segments and regions of linkage drag on carrier chromosomes.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;The percentage of recurrent parent genome recovery (RPG%) in each pyramided line was calculated using the formula described by Sundaram et al. (2008):\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cimg src=\\\"https://myfiles.space/user_files/58895_8739fc6c57c1c19a/58895_custom_files/img1771646192.png\\\" width=\\\"337\\\" height=\\\"125\\\"\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ewhere A represents the number of markers homozygous for the recurrent parent allele, B represents the number of heterozygous markers, and N denotes the total number of polymorphic markers used for background analysis. Based on RPG% values, genetic similarity, and agronomic performance, selected pyramided lines exhibiting high recovery of the Luit genome were advanced for disease resistance screening and further field evaluation.(\\u003cstrong\\u003eSupplementary Figure S2).\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eScreening for bacterial leaf blight resistance\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eScreening for bacterial leaf blight (BLB) resistance was conducted under controlled field conditions using virulent isolates of Xanthomonas oryzae pv. oryzae (Xoo) collected from different agro-climatic zones of Assam. Based on preliminary virulence assays, three highly aggressive Xoo isolates, ASXOO-LBVZ, ASXOO-CBVZ, and ASXOO-UBVZ, representing the Lower, Central, and Upper Brahmaputra Valley Zones, respectively, were selected for resistance evaluation. The bacterial isolates were cultured on peptone sucrose agar (PSA) medium and incubated at 28 \\u0026plusmn; 2 \\u0026deg;C for 48 h. Bacterial suspensions were prepared in sterile distilled water and adjusted to a concentration of approximately 10⁹ cells mL⁻\\u0026sup1;, following the standard protocol described by Kauffman et al. (1973). Artificial inoculation was performed at the maximum tillering stage using the leaf-clip method. For each plant, two to three fully expanded leaves were clipped with sterile scissors dipped in the bacterial suspension. Inoculations were carried out during early morning hours to ensure favourable environmental conditions for disease development, including high relative humidity (\\u0026asymp;90%) and moderate temperature (28 \\u0026plusmn; 2 \\u0026deg;C).\\u003c/p\\u003e\\n\\u003cp\\u003eDisease symptoms were assessed 14 days post-inoculation (dpi), once the susceptible check Taichung Native 1 (TN-1) exhibited fully developed lesions. Lesion length (LL) was measured in centimetres from the cut leaf margin to the visible end of the lesion. Disease reactions were classified based on lesion length according to the standard scoring scale described by Lore et al. (2011).\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eBLB reactions of pyramided lines carrying two or three resistance genes were compared with those of the recurrent parent Luit, the donor parent IRBB60, and the susceptible check TN-1. Mean lesion length values were used to determine the resistance spectrum of the pyramided lines against the different Xoo isolates.(Table 2)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEvaluation of agro-morphological traits\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSelected bacterial leaf blight (BLB) resistance gene\\u0026ndash;pyramided lines, along with the recurrent parent Luit and donor parent IRBB60, were evaluated for agro-morphological performance under field conditions during the main rice-growing season. Standard agronomic practices recommended for the region were followed throughout the crop growth period to ensure uniform crop management. Data were recorded on key agronomic traits, including plant height (cm), number of tillers per plant, number of effective tillers, panicle length (cm), number of grains per panicle, spikelet fertility (%), 100-grain weight (g), grain yield per plant (g), days to 50% flowering, and days to maturity. Observations were recorded from representative plants in each line at appropriate growth stages following the standard rice evaluation system. Grain yield per plant was determined by harvesting plants at physiological maturity, followed by threshing and cleaning of grains, and recording grain weight after proper drying. Spikelet fertility was calculated as the percentage of filled grains relative to the total number of spikelets per panicle. The agronomic performance of the pyramided lines was compared with that of the recurrent parent Luit to assess the extent to which desirable traits were retained following introgression of BLB resistance genes. The percentage of recurrent parent genome recovery (RPG%) for each pyramided line, estimated through background marker analysis, was also considered in conjunction with agronomic traits to identify superior lines combining high genome recovery, desirable yield attributes, and BLB resistance. Summary statistics for agronomic traits of the pyramided lines are presented.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistical analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData recorded for agro-morphological traits and bacterial leaf blight (BLB) resistance were subjected to appropriate statistical analysis to summarize variation among the pyramided lines. Descriptive statistics, including minimum, maximum, mean, standard error (SE), standard deviation (SD), and coefficient of variation (CV), were calculated for agronomic traits using standard statistical procedures. Mean lesion length values obtained from BLB screening experiments were used to compare the resistance response of different gene combinations against multiple Xanthomonas oryzae pv. oryzae isolates. Analysis of variance (ANOVA) was performed to assess differences among pyramided lines, parents, and checks wherever applicable. Mean comparisons were conducted at the 5% probability level (P \\u0026le; 0.05), and statistically significant differences are indicated in the corresponding figures and tables. All statistical analyses were carried out using standard statistical software packages. Graphical representation of data was prepared using suitable software to clearly illustrate trends in disease response and agronomic performance. Clustering and similarity analyses for background selection were conducted as described in the respective sections.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eForeground selection and confirmation of bacterial leaf blight resistance genes\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMarker-assisted foreground selection was carried out using gene-specific functional molecular markers to confirm the presence of bacterial leaf blight (BLB) resistance genes in the segregating populations. The functional markers pTA248, xa13pro, and xa5FM, tightly linked to the resistance genes Xa21, xa13, and xa5, respectively, clearly differentiated resistant and susceptible alleles between the donor parent IRBB60 and the recurrent parent Luit. PCR amplification using the marker pTA248 produced a resistance-specific band of approximately 1000 bp in the donor parent IRBB60, whereas the susceptible allele was observed in the recurrent parent Luit. Similar clear polymorphism was observed for xa13pro and xa5FM markers, enabling reliable identification of resistant and susceptible alleles for xa13 and xa5 genes, respectively \\u003cstrong\\u003e(Fig. 1), Supplementary Figure S3).\\u003c/strong\\u003e Foreground screening across successive generations facilitated the accurate tracking of target resistance genes during backcrossing and selfing. In the BC₂F₂ population, plants carrying all three resistance genes were identified based on diagnostic banding patterns corresponding to homozygous resistant alleles at all three loci. The effectiveness and reproducibility of the functional markers ensured precise selection of true pyramided lines, confirming the successful introgression of Xa21, xa13, and xa5 into the genetic background of Luit \\u003cstrong\\u003e(Table 2).\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSegregation of bacterial leaf blight resistance genes in the BC₂F₂ population\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSegregation of bacterial leaf blight (BLB) resistance genes was analysed in the BC₂F₂ population following marker-assisted foreground screening. Functional molecular markers specific to Xa21, xa13, and xa5 were used to classify plants based on the presence and combination of resistance genes. Among the BC₂F₂ plants screened, 57 individuals were identified as homozygous for all three resistance genes, confirming the successful pyramiding of Xa21, xa13, and xa5. In addition to the triple-gene homozygous plants, a substantial number of plants carried different two-gene combinations. Specifically, 135 plants carried the Xa21 + xa13 combination, while 95 plants each carried the Xa21 + xa5 and xa13 + xa5 combinations. A total of 197 plants were found to carry only a single resistance gene and were therefore excluded from further advancement. The observed segregation pattern demonstrated efficient recovery of the desired gene combinations in the BC₂F₂ generation, with a clear enrichment of multiple-gene genotypes resulting from marker-assisted selection. Based on genotypic constitution and breeding objectives, plants homozygous for all three resistance genes were selected for subsequent background genome analysis, agronomic evaluation, and disease resistance screening (Table 3).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBackground selection and recurrent parent genome recovery\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBackground selection was carried out to assess the extent of recurrent parent genome recovery in the selected bacterial leaf blight resistance gene\\u0026ndash;pyramided lines. Polymorphic SSR markers distributed across all 12 rice chromosomes were used to estimate genetic similarity between the pyramided lines, the donor parent IRBB60, and the recurrent parent Luit. Cluster analysis based on Dice similarity coefficients revealed clear differentiation between the donor parent and the recurrent parent, with the pyramided lines clustering closer to Luit (Fig. 2). Most of the selected BC₂F₂ lines grouped in the same major cluster as the recurrent parent, indicating substantial recovery of the Luit genome following two backcrosses combined with marker-assisted selection. In contrast, the donor parent IRBB60 formed a distinct cluster, confirming its genetic divergence from Luit. Graphical genotype analysis using GGT 2.0 provided a chromosome-wise visualization of donor, recurrent, and heterozygous genome segments in the pyramided lines (Fig. 3). The majority of chromosomal regions in the selected lines were occupied by recurrent parent segments, with limited donor introgressions confined mainly to regions surrounding the target resistance loci. Only small heterozygous segments were observed on non-carrier chromosomes, suggesting effective elimination of undesirable donor regions through background selection. The percentage of recurrent parent genome recovery (RPG%) among the pyramided lines ranged from 81.25% to 93.84%. Several lines exhibited RPG values exceeding 90%, demonstrating efficient recovery of the Luit genetic background within the BC₂F₂ generation. These results confirm the effectiveness of marker-assisted backcross breeding in accelerating genome recovery while retaining the introgressed resistance genes.(Figures 2 \\u0026amp; 3, Table 4 \\u0026ndash; RPG%)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEvaluation of agro-morphological performance of pyramided lines\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe selected bacterial leaf blight resistance gene\\u0026ndash;pyramided lines were evaluated for key agro-morphological traits to assess the extent to which desirable characteristics of the recurrent parent Luit were retained following introgression of resistance genes. Considerable variation was observed among the pyramided lines for most of the traits studied, reflecting segregation within the BC₂F₂ population (Table 4). Plant height among the pyramided lines ranged from 84 to 105 cm, with a mean value of 96.38 cm, which was comparable to that of the recurrent parent Luit (90 cm). Most lines exhibited plant height suitable for lodging tolerance and field adaptability. The number of tillers per plant varied from 6 to 18, while the number of effective tillers ranged from 4 to 18, indicating adequate tillering capacity in several pyramided lines. Panicle length ranged from 20.67 to 27.33 cm, with a mean of 24.60 cm, and the number of grains per panicle varied widely (72.16\\u0026ndash;179.44), suggesting substantial diversity for yield-contributing traits. Spikelet fertility among the pyramided lines ranged from 53.78% to 89.86%, with many lines exhibiting fertility levels comparable to or exceeding those of the recurrent parent.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;Grain yield per plant among the pyramided lines ranged from 32.0 to 38.0 g, with a mean yield of 35.15 g, which was comparable to the recurrent parent Luit (34.58 g) and, in some cases, approached the donor parent IRBB60. The 100-grain weight varied from 1.73 to 2.23 g, indicating that grain weight was largely maintained following gene introgression. Days to 50% flowering among the pyramided lines ranged from 75 to 86 days, while days to maturity varied from 93 to 121 days, suggesting that most lines retained the short-duration nature of Luit. When considered together with recurrent parent genome recovery values, several pyramided lines combined high RPG% (above 90%) with favourable agronomic performance, indicating successful recovery of the Luit genetic background without yield penalty (Table 4).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eReaction of pyramided lines to bacterial leaf blight\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe bacterial leaf blight (BLB) reaction of the pyramided lines was evaluated based on lesion length following artificial inoculation with three virulent Xanthomonas oryzae pv. oryzae (Xoo) isolates representing different agro-climatic zones of Assam. Clear differences in disease response were observed among lines carrying different combinations of resistance genes (Fig. 4). Across all three Xoo isolates, the three-gene pyramided lines (NC lines) consistently exhibited significantly shorter lesion lengths compared to lines carrying only two resistance genes (NL lines) and the recurrent parent Luit. The enhanced resistance of NC lines was evident against isolates ASXOO-LBVZ, ASXOO-CBVZ, and ASXOO-UBVZ, indicating a broad and stable resistance response across diverse pathogen populations. Two-gene pyramided lines displayed moderate levels of resistance, with lesion lengths generally lower than those of the recurrent parent but higher than those observed in three-gene pyramided lines. As expected, the recurrent parent Luit showed a susceptible reaction, while the donor parent IRBB60 exhibited strong resistance against all tested isolates. The susceptible check Taichung Native 1 (TN-1) developed long lesions, confirming the effectiveness of the inoculation and the virulence of the Xoo isolates. Statistical analysis revealed that differences in lesion length between three-gene pyramided lines and two-gene lines were significant at P \\u0026le; 0.05 and P \\u0026le; 0.01, depending on the isolate (Fig. 4). These results demonstrate that pyramiding Xa21, xa13 and xa5 conferred enhanced and more stable resistance to BLB compared with partial gene combinations, validating the effectiveness of the marker-assisted gene pyramiding strategy.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIdentification of superior pyramided lines combining resistance and agronomic performance\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo identify breeding-ready candidates, pyramided lines were further evaluated by integrating bacterial leaf blight resistance response, recurrent parent genome recovery, and key agronomic traits. Lines homozygous for all three resistance genes that exhibited consistently low lesion lengths across all Xanthomonas oryzae pv. oryzae isolates were considered superior in terms of disease resistance. Among the three-gene pyramided lines, several lines combined high recurrent parent genome recovery (\\u0026gt;90%) with agronomic performance comparable to or exceeding that of the recurrent parent Luit, particularly for grain yield, spikelet fertility, and flowering duration (Table 4). These lines also maintained the short-duration growth habit characteristic of Luit, indicating successful recovery of the recurrent parent phenotype. The convergence of durable BLB resistance, high genome recovery, and desirable agronomic performance in these selected lines highlights their potential suitability for further multi-location evaluation and possible varietal deployment. This integrative assessment demonstrates that marker-assisted pyramiding of Xa21, xa13 and xa5 can generate elite rice lines with both enhanced disease resistance and agronomic stability.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe present study demonstrates that marker-assisted pyramiding of Xa21, xa13 and xa5 into the popular short-duration rice cultivar Luit successfully generated advanced backcross lines that combine broad-spectrum bacterial leaf blight (BLB) resistance with agronomic performance comparable to the recurrent parent. The high recovery of the recurrent parent genome (RPG values of 81.25% to 93.84%) indicates that the marker-assisted backcross breeding strategy was effective in minimizing linkage drag while retaining the characteristic phenotypic identity of Luit, even after the introgression of multiple resistance genes (Sundaram et al. 2008; Collard and Mackill 2008). This confirms the efficiency of integrating molecular selection with conventional breeding for improving disease resistance without compromising cultivar integrity.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEffectiveness of gene pyramiding for durable BLB resistance\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe strong resistance displayed by the three-gene pyramided lines against multiple Xanthomonas oryzae pv. oryzae (Xoo) isolates clearly highlights the advantage of combining resistance genes with complementary modes of action. The dominant gene Xa21, which encodes a receptor-like kinase, provides broad-spectrum recognition of the pathogen, while the recessive genes xa13 and xa5 interfere with pathogen virulence and host transcriptional regulation, respectively (Song et al. 1995; Chu et al. 2006; Iyer and McCouch 2004). The consistently shorter lesion lengths observed across isolates collected from different agro-climatic zones of Assam indicate that pyramiding these genes creates a multilayered defense system, thereby reducing the risk of resistance breakdown. Similar improvements in resistance level and durability through multi-gene pyramiding have been reported in other elite rice backgrounds, further supporting the effectiveness of this strategy for long-term BLB management (Sundaram et al. 2008; Pradhan et al. 2016; Hsu et al. 2020).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eBackground genome recovery and linkage drag\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBackground selection using genome-wide SSR markers revealed that donor genome introgressions in the pyramided lines were largely restricted to regions flanking the target resistance loci, as visualized through graphical genotype analysis. Lines showing higher RPG values clustered closely with the recurrent parent in dendrogram analysis, confirming efficient genome recovery within the BC₂F₂ generation. These results clearly demonstrate the value of integrating background selection into resistance breeding programmes, particularly when multiple genes are introgressed simultaneously, as it enables rapid recovery of the elite genetic background while limiting undesirable donor segments (Varshney et al. 2005; Van Berloo 2008).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAgronomic performance and breeding relevance\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRetention of key agronomic traits is essential for the practical adoption of improved cultivars by farmers. In the present study, several three-gene pyramided lines exhibited grain yield, spikelet fertility and phenological traits comparable to, and in some cases better than, those of the recurrent parent Luit. This indicates that introgression of BLB resistance genes did not impose a yield penalty or negatively affect important agronomic characteristics. Similar outcomes have been reported in marker-assisted improvement of rice cultivars for BLB resistance, where careful molecular and phenotypic selection preserved yield potential while enhancing disease resistance (Dash et al. 2016; Sabar et al. 2019).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eManagement and deployment implications\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFrom a practical breeding and crop management perspective, the pyramided lines developed in this study represent promising genetic resources for BLB-prone regions of northeastern India. The short-duration nature of Luit makes it particularly suitable for flood-escape ecosystems, and the addition of durable BLB resistance further strengthens its suitability under changing climatic conditions. Deployment of such resistant lines has the potential to reduce farmers\\u0026rsquo; dependence on chemical control measures, thereby lowering production costs and minimizing environmental impacts. For effective deployment, the selected elite pyramided lines should be evaluated through multi-location and multi-season yield trials across diverse agro-ecologies of Assam to validate their performance under natural disease pressure. Continuous monitoring of Xoo populations will also be important to detect shifts in pathogen virulence that may threaten resistance durability (Verdier et al. 2012; Pradhan et al. 2020). Integrating these resistant lines into existing integrated disease management strategies, including balanced fertilization and optimal planting schedules, will further enhance their field performance. In addition to their direct deployment potential, the pyramided lines can serve as valuable donor parents for future breeding programmes targeting BLB resistance in other locally adapted varieties. The availability of lines combining high RPG, stable resistance and desirable agronomic traits provides breeders with flexible options for addressing region-specific production constraints. Overall, this study demonstrates that marker-assisted pyramiding of Xa21, xa13 and xa5 into an elite short-duration rice variety is an effective strategy for developing BLB-resistant lines without compromising agronomic performance. The integration of molecular tools with conventional breeding and phenotypic selection enabled the identification of breeding-ready lines with strong potential for deployment in BLB-endemic regions, contributing to ongoing efforts to achieve durable disease resistance and sustainable rice production under diverse and challenging agro-climatic conditions.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThis study demonstrates the effectiveness of marker-assisted backcross breeding for pyramiding three major bacterial leaf blight resistance genes, Xa21, xa13 and xa5, into the short-duration rice cultivar Luit. The combined use of gene-specific functional markers for foreground selection and genome-wide SSR markers for background selection enabled rapid recovery of the recurrent parent genome while minimizing linkage drag. Several BC₂F₂ pyramided lines were identified that exhibited stable resistance to multiple virulent Xanthomonas oryzae pv. oryzae isolates, high recurrent parent genome recovery (up to 93.84%), and agronomic performance comparable to, or better than, the recurrent parent. The retention of key traits such as early maturity, grain yield and spikelet fertility indicates that introgression of multiple resistance genes did not result in a yield penalty. By integrating resistance evaluation, genome recovery analysis and agronomic assessment, the study identified advanced breeding lines with strong potential for further multi-location testing and potential varietal deployment following additional evaluation in bacterial leaf blight\\u0026ndash;prone regions of northeastern India. In addition to their direct breeding value, these pyramided lines constitute useful genetic resources for future rice improvement programmes targeting durable disease resistance. Overall, the findings highlight the practical utility of marker-assisted gene pyramiding as an effective strategy for developing agronomically competitive rice lines with enhanced resistance to bacterial leaf blight, thereby supporting sustainable rice production under diverse and challenging agro-climatic conditions.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe first author would like to acknowledge the ICAR and DBT-AAU Centre, Assam Agricultural University, for assisting the entire investigation at Assam Agricultural University, Jorhat, as part of the PhD research work. We are also thankful to Dr T. Ahmed, Chief Scientist, RARS, Titabor, for providing the facility for all the fieldwork.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors confirm their contributions to the paper, as follows: study conception and design, MKM and SKS; data collection and analysis, SKS; interpretation of results, SKS, DK and SKC; and draft manuscript preparation, SKS, DK. \\u0026nbsp;All authors reviewed the results and approved the final manuscript version.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u003c/strong\\u003e This research was funded by the Department of \\u0026nbsp;Agricultural Biotechnology, Assam Agricultural University, Jorhat, Assam, a PhD research Fund\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability:\\u003c/strong\\u003e The data supporting this article are included in the Supplementary Information.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest:\\u003c/strong\\u003e The authors declare that they have no conflicts of interest in the publication.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical approval:\\u003c/strong\\u003e No human participants and/or animals were involved in this research.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests:\\u0026nbsp;\\u003c/strong\\u003eWe declare that there are no financial and research competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eBanerjee A, Roy S, Bag MK, Bhagat S, Kar MK, Mandal NP, Maiti D (2018) A survey of bacterial blight (Xanthomonas oryzae pv. oryzae) resistance in rice germplasm from eastern and northeastern India using molecular markers. Crop Protection 112:168\\u0026ndash;176. https://doi.org/10.1016/j.cropro.2018.05.017\\u003c/li\\u003e\\n \\u003cli\\u003eChu Z, Fu B, Yang H, Xu C, Li Z, Sanchez A, Park YJ, Bennetzen JL, Zhang Q, Wang S (2006) Targeting xa13, a recessive gene for bacterial blight resistance in rice. Theoretical and Applied Genetics 112:455\\u0026ndash;461. https://doi.org/10.1007/s00122-005-0145-6\\u003c/li\\u003e\\n \\u003cli\\u003eCollard BCY, Mackill DJ (2008) Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B: Biological Sciences 363:557\\u0026ndash;572. https://doi.org/10.1098/rstb.2007.2170\\u003c/li\\u003e\\n \\u003cli\\u003eDash AK, Rao RN, Rao GJN, Verma RL, Katara JL, Mukherjee AK, Bagchi TB (2016) Phenotypic and marker-assisted genetic enhancement of parental lines of Rajalaxmi, an elite rice hybrid. Frontiers in Plant Science 7:1005. https://doi.org/10.3389/fpls.2016.01005\\u003c/li\\u003e\\n \\u003cli\\u003eDellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1:19\\u0026ndash;21. https://doi.org/10.1007/BF02712670\\u003c/li\\u003e\\n \\u003cli\\u003eHsu YC, Chiu CH, Yap R, Tseng YC, Wu YP (2020) Pyramiding bacterial blight resistance genes in rice for broad-spectrum resistance using marker-assisted selection. International Journal of Molecular Sciences 21:1281. https://doi.org/10.3390/ijms21041281\\u003c/li\\u003e\\n \\u003cli\\u003eIyer AS, McCouch SR (2004) The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Molecular Plant\\u0026ndash;Microbe Interactions 17:1348\\u0026ndash;1354. https://doi.org/10.1094/MPMI.2004.17.12.1348\\u003c/li\\u003e\\n \\u003cli\\u003eJoshi JB, Arul L, Ramalingam J, Uthandi S (2020) Advances in the Xoo\\u0026ndash;rice pathosystem interaction and its exploitation in disease management. Journal of Biosciences 45:1\\u0026ndash;17. https://doi.org/10.1007/s12038-020-00051-6\\u003c/li\\u003e\\n \\u003cli\\u003eKauffman HE, Reddy APK, Hsieh SPY, Merca SD (1973) An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Disease Reporter 57:537\\u0026ndash;541\\u003c/li\\u003e\\n \\u003cli\\u003eKim SM (2018) Identification of novel recessive gene xa44(t) conferring resistance to bacterial blight in rice. Theoretical and Applied Genetics 131:2733\\u0026ndash;2743. https://doi.org/10.1007/s00122-018-3173-8\\u003c/li\\u003e\\n \\u003cli\\u003eLore JS, Vikal Y, Hunjan MS, Goel RK, Bharaj TS, Raina GL (2011) Resistance reaction of rice genotypes against bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae. Oryza 48:114\\u0026ndash;118\\u003c/li\\u003e\\n \\u003cli\\u003eLu J, Wang C, Zeng D, Li J, Shi X, Shi Y, Zhou Y (2021) Genome-wide association study dissects resistance loci against bacterial blight in rice. Rice 14:1\\u0026ndash;13. https://doi.org/10.1186/s12284-021-00470-5\\u003c/li\\u003e\\n \\u003cli\\u003eMew TW, Vera Cruz CM, Medalla ES (1992) Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted. Plant Disease 76:1029\\u0026ndash;1032. https://doi.org/10.1094/PD-76-1029\\u003c/li\\u003e\\n \\u003cli\\u003eNei M, Li WH (1979) Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences USA 76:5269\\u0026ndash;5273. https://doi.org/10.1073/pnas.76.10.5269\\u003c/li\\u003e\\n \\u003cli\\u003eNoh TH, Lee DK, Park JC, Shim HK, Choi MY, Kang MH et al. (2007) Effect of bacterial leaf blight on rice yield and grain quality. Research in Plant Disease 13:20\\u0026ndash;23\\u003c/li\\u003e\\n \\u003cli\\u003ePradhan SK, Nayak DK, Pandit E, Behera L, Anandan A, Mukherjee AK, Lenka S, Barik DP (2016) Incorporation of bacterial blight resistance genes into lowland rice through marker-assisted backcross breeding. Phytopathology 106:710\\u0026ndash;718. https://doi.org/10.1094/PHYTO-09-15-0226-R\\u003c/li\\u003e\\n \\u003cli\\u003ePradhan SK, Barik SR, Nayak DK, Pradhan A, Pandit E, Nayak P, Lenka S (2020) Genetics, molecular mechanisms and deployment of bacterial blight resistance genes in rice. Critical Reviews in Plant Sciences 39:360\\u0026ndash;385. https://doi.org/10.1080/07352689.2020.1801361\\u003c/li\\u003e\\n \\u003cli\\u003eSabar M, Shabir G, Shah SM, Aslam K, Naveed SA, Arif M (2019) Marker-assisted pyramiding of bacterial blight resistance genes in rice. Journal of Plant Pathology 101:871\\u0026ndash;881. https://doi.org/10.1007/s42161-019-00323-4\\u003c/li\\u003e\\n \\u003cli\\u003eSong WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald PC (1995) A receptor kinase-like protein encoded by the rice disease resistance gene Xa21. Science 270:1804\\u0026ndash;1806. https://doi.org/10.1126/science.270.5243.1804\\u003c/li\\u003e\\n \\u003cli\\u003eSundaram RM, Vishnupriya MR, Biradar SK, Laha GS, Reddy GA, Rani NS, Sarma NP, Sonti RV (2008) Marker-assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica 160:411\\u0026ndash;422. https://doi.org/10.1007/s10681-007-9564-6\\u003c/li\\u003e\\n \\u003cli\\u003eSundaram RM, Vishnupriya MR, Laha GS, Rani NS, Rao PS, Balachandran SM et al. (2009) Introduction of bacterial blight resistance into Triguna rice variety. Biotechnology Journal 4:400\\u0026ndash;407. https://doi.org/10.1002/biot.200800311\\u003c/li\\u003e\\n \\u003cli\\u003eVan Berloo R (2008) GGT 2.0: versatile software for visualization and analysis of genetic data. Journal of Heredity 99:232\\u0026ndash;236. https://doi.org/10.1093/jhered/esm109\\u003c/li\\u003e\\n \\u003cli\\u003eVarshney RK, Graner A, Sorrells ME (2005) Genomics-assisted breeding for crop improvement. Trends in Plant Science 10:621\\u0026ndash;630. https://doi.org/10.1016/j.tplants.2005.10.004\\u003c/li\\u003e\\n \\u003cli\\u003eVerdier V, Cruz CV, Leach JE (2012) Controlling rice bacterial blight in Africa: needs and prospects. Journal of Biotechnology 159:320\\u0026ndash;328. https://doi.org/10.1016/j.jbiotec.2011.09.020\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eTable 1. Functional molecular markers used for foreground selection of bacterial leaf blight resistance genes\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eResistance gene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eChromosome\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eFunctional marker\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGenetic distance (cM)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePrimer sequences (5\\u0026prime;\\u0026ndash;3\\u0026prime;)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReference\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003exa5\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003exa5FM\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eF:\\u003c/strong\\u003e GTCTGGAATTTGCTCGCGTTCG\\u0026nbsp;\\u003cbr\\u003e\\u003cstrong\\u003eR:\\u003c/strong\\u003e TGGTAAAGTAGATACCTTATCAAACTGGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSundaram \\u003cem\\u003eet al.\\u003c/em\\u003e (2011)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003exa13\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003exa13pro\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eF:\\u003c/strong\\u003e GGCCATGGCTCAGTGTTTAT\\u0026nbsp;\\u003cbr\\u003e\\u003cstrong\\u003eR:\\u003c/strong\\u003e GAGCTCCAGCTCTCCAAATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSundaram \\u003cem\\u003eet al.\\u003c/em\\u003e (2011)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eXa21\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003epTA248\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eF:\\u003c/strong\\u003e AGACGCGGAAGGGTGGTTCCCGGA\\u0026nbsp;\\u003cbr\\u003e\\u003cstrong\\u003eR:\\u003c/strong\\u003e AGACGCGGTAATCGAAGATGAAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eRonald \\u003cem\\u003eet al.\\u003c/em\\u003e (19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 2. Disease reaction scale for bacterial leaf blight based on lesion length\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eLesion length (cm)*\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDisease reaction\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eScore\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026lt; 5.0\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eResistant (R)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e5.1 \\u0026ndash; 10.0\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eModerately resistant (MR)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e10.1 \\u0026ndash; 15.0\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eModerately susceptible (MS)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e15.1 \\u0026ndash; 20.0\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSusceptible (S)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u0026gt; 20.0\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHighly susceptible (HS)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFootnote:\\u003c/strong\\u003e\\u003cbr\\u003eLesion length was measured at \\u003cstrong\\u003e14 days post-inoculation (dpi)\\u003c/strong\\u003e following the standard clip inoculation method described by \\u003cstrong\\u003eLore \\u003cem\\u003eet al.\\u003c/em\\u003e (2011)\\u003c/strong\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 3. Segregation of bacterial leaf blight resistance genes in the BC₂F₂ population derived from Luit \\u0026times; IRBB60\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eA. Distribution of resistance gene combinations in BC₂F₂ population\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eResistance gene combination\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGenotypic class*\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNumber of plants\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eXa21 + xa13 + xa5\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHomozygous for all three genes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e57\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eXa21 + xa13\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHeterozygous / homozygous\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e135\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eXa21 + xa5\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHeterozygous / homozygous\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003exa13 + xa5\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHeterozygous / homozygous\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSingle resistance gene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHeterozygous / homozygous\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e197\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTotal BC₂F₂ plants screened\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\u003cbr\\u003e\\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e579\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eB. Summary of selection outcome for advancement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCategory\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNumber of plants\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTotal BC₂F₂ plants screened\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e579\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTriple-gene homozygous lines selected\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e57\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDouble-gene pyramided lines\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e325\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSingle-gene lines (discarded)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e197\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFootnote\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGenotypic classification was based on \\u003cstrong\\u003efunctional marker-assisted foreground selection\\u003c/strong\\u003e using pTA248 (Xa21), xa13pro (xa13), and xa5FM (xa5). Segregation ratios were \\u003cstrong\\u003enot subjected to chi-square analysis\\u003c/strong\\u003e as the population was advanced through \\u003cstrong\\u003emarker-assisted selection rather than Mendelian segregation analysis\\u003c/strong\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 4. Agronomic performance of selected bacterial leaf blight resistance gene-pyramided lines in comparison with recurrent and donor parents\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellpadding=\\\"0\\\" class=\\\"fr-table-selection-hover\\\"\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePlant material\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePH (cm)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNOT\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eENT\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNOG\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSF (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePL (cm)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e100-GW (g)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGYP (g)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDTM\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDTF\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDisease reaction\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eRPG (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eIRBB60 (Donor parent)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e110\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e145\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e88.60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e26.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e38.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e117\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e88\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eLuit (Recurrent parent)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e90\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e134\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e79.25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.85\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e34.58\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC1.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e88\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e111.17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e54.43\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e37.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e121\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e86.42\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC6.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e105\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e176.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e81.29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e35.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e85.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC6.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e142.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e84.06\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e22.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e36.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e93.84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC6.11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e90\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e170.83\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e85.76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e23.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e37.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e76\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e93.84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC7.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e162.26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e83.98\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e24.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.97\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e34.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e98\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e78\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e92.25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC7.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e90\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e104.29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e72.19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e32.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e88.19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC7.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e94.68\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e70.07\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e36.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e96\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e82.19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC8.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e105\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e179.44\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e79.01\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e24.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e37.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e110\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e80\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e92.36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC8.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e97\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e115.17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e65.56\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.85\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e38.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e111\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e81\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e89.73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC8.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e102.27\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e68.89\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e26.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.81\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e33.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e118\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e85\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eLS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e91.22\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC8.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e72.16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e78.36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.85\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e32.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e105\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e88.51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC8.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e97\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e141.40\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e89.86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e36.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e108\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e80\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e83.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNC8.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e119.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e53.78\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e27.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e34.00\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e106\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eMS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e81.25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSummary statistics (BC₂F₂ pyramided lines)\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eStatistic\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePH\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNOT\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eENT\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNOG\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSF (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePL\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e100-GW\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGYP\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDTM\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDTF\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eRPG (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMinimum\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e72.16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e53.78\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e32.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e81.25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMaximum\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e105\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e179.44\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e89.86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e27.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e38.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e121\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e86\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e93.84\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMean\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e96.38\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e12.62\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e11.50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e131.34\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e75.67\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e24.60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e35.15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e104.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e79.26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e88.39\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSE (\\u0026plusmn;)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.79\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.13\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e8.31\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.48\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.04\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e2.40\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.01\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSD\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e7.18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e3.20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e3.88\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e32.19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e11.32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.65\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0.16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1.99\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9.65\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e4.20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCV (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e7.42\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e25.41\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e33.71\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e24.51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e14.96\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e6.69\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e8.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e5.65\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e9.26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e5.29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFootnotes\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePH: plant height; NOT: number of tillers; ENT: effective number of tillers; NOG: number of grains per panicle; SF: spikelet fertility; PL: panicle length; 100-GW: 100-grain weight; GYP: grain yield per plant; DTM: days to maturity; DTF: days to 50% flowering; RPG: recurrent parent genome recovery.\\u003cbr\\u003e\\u0026nbsp;Disease reaction categories are based on lesion length scoring (Table 2).\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"bacterial leaf blight, rice breeding, marker-assisted backcrossing, gene pyramiding, Xa21, xa13, xa5\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8706341/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8706341/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eBacterial leaf blight (BLB), caused by Xanthomonas oryzae pv. oryzae, remains a major constraint to rice production in the humid and flood-prone rice-growing regions of northeastern India. In this study, BLB resistance was improved in the elite short-duration rice cultivar Luit through marker-assisted backcross breeding by pyramiding three widely used resistance genes, Xa21, xa13 and xa5, with IRBB60 serving as the donor parent. Gene-specific functional markers were used for foreground selection, while genome-wide SSR markers supported background selection and accelerated recovery of the recurrent parent genome. Screening of the BC₂F₂ population identified 57 lines homozygous for all three resistance genes. These pyramided lines showed high recurrent parent genome recovery (81.25\\u0026ndash;93.84%) and largely retained the agronomic characteristics of Luit, including grain yield, spikelet fertility and flowering duration. When evaluated under artificial inoculation with three virulent X. oryzae pv. oryzae isolates prevalent in Assam, the three-gene pyramided lines consistently exhibited significantly shorter lesion lengths than lines carrying one or two resistance genes, indicating enhanced and stable resistance. The results demonstrate that pyramiding Xa21, xa13 and xa5 through marker-assisted backcrossing is an effective approach for developing agronomically competitive rice breeding lines with durable BLB resistance. The identified lines constitute valuable genetic resources for further multi-location evaluation and for use in rice improvement programmes targeting BLB-prone environments.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Marker-assisted pyramiding of bacterial leaf blight resistance genes (Xa21, xa13 and xa5) in a short-duration rice cultivar Luit\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-02-21 04:04:35\",\"doi\":\"10.21203/rs.3.rs-8706341/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"016449f1-012a-42ba-a117-0c4f374d992e\",\"owner\":[],\"postedDate\":\"February 21st, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-02-21T04:04:36+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-02-21 04:04:35\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8706341\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8706341\",\"identity\":\"rs-8706341\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}