{"paper_id":"40ad7a94-8b18-401d-98b3-4806c92c2370","body_text":"Investigation into the role of MITA-TRIM38 interaction in regulating pyroptosis and maintaining immune tolerance at the maternal-fetal interface | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Article Investigation into the role of MITA-TRIM38 interaction in regulating pyroptosis and maintaining immune tolerance at the maternal-fetal interface jing Yang, Jun Liu, Yan Deng, An Wang, Bowen Liu, Xi Zhou, Tailang Yin, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3131504/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Nov, 2023 Read the published version in Cell Death & Disease → Version 1 posted You are reading this latest preprint version Abstract Maternal-fetal interface shares similarities with tumor tissues in terms of immune microenvironment. Normal pregnancy is maintained due to the immunosuppressed state, but pyroptosis induced by MITA can trigger the body's immune response and disrupt the immunosuppressed state of the maternal-fetal interface, leading to abortion. In this study, we explored the role of MITA and TRIM38 in regulating pyroptosis and maintaining the immune tolerance of the maternal-fetal interface during pregnancy. Our findings show that the interaction between MITA and TRIM38 plays a crucial role in maintaining the immunosuppressed state of the maternal-fetal interface. Specifically, we observed that TRIM38-mediated K48 ubiquitination of MITA was higher in M2 macrophages, leading to low expression levels of MITA and thus, inhibiting pyroptosis. Conversely, in M1 macrophages, the ubiquitination of K48 was lower, resulting in higher expression levels of MITA and promoting pyroptosis. Our results also indicated that pyroptosis played a significant role in hindering the transformation of M1 to M2 and maintaining the immunosuppressed state of the maternal-fetal interface. The discoveries presented offer significant understanding into the mechanisms that support the preservation of the immune tolerance microenvironment at the maternal-fetal interface, playing a vital role in ensuring successful pregnancy results. Health sciences/Diseases/Reproductive disorders Biological sciences/Immunology/Cell death and immune response maternal-fetal interface MITA ubiquitination pyroptosis URSA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 INTRODUCTION Recurrent spontaneous abortion (RSA) is defined as two or more consecutive instances of spontaneous abortion in the same individual. Studies show that the incidence of RSA ranges from 1–4% in childbearing age women in Europe and the US [ 1 ], with 50% of cases occurring during the first trimester[ 2 ]. The causes of RSA are complex and diverse, including known factors such as chromosomal abnormalities, reproductive structure issues, endocrine disorders, infectious diseases, prethrombotic status, and autoimmune factors. Additionally, a significant number of cases are referred to as unexplained RSA or URSA[ 3 ], where the cause remains unclear. Pregnancy can be considered as a semi-allogenic transplantation process where the fetus survives, matures and develops without immune rejection, relying on the mother's immune tolerance[ 4 ]. The maternal-fetal interface, composed of the placenta and decidua, is key in establishing immune tolerance and is the site of disturbance in many cases of poor pregnancy outcomes [ 5 , 6 , 7 ]. Macrophages, a crucial component in the course of pregnancy, play a significant role in immune regulation, particularly the subsets M1 and M2, whose dysregulation often results in adverse outcomes such as URSA and eclampsia [ 8 , 9 ]. Macrophages are also known as major antigen-presenting cells and their activation can stimulate the innate immune response [ 10 ], making them a popular subject of research. The MITA (also called stimulator of interferon genes, STING) is an adaptor protein that plays a crucial role in natural immunity [ 11 ]. It recognizes both viral and bacterial infections, as well as its own DNA, triggering host defense and immune responses[ 11 ]. MITA is highly expressed in the heart, spleen, peripheral leukocytes, placenta, and lung, and moderately expressed in the thymus, small intestine, liver, and kidney[ 12 , 13 ]. However, it has no expression in the brain, skeletal muscle, and colon[ 12 , 13 ]. The ubiquitin-proteasome degradation pathway is important for intracellular selective protein degradation and MITA can undergo ubiquitination through this pathway[ 14 ]. The TRIM family, mostly defined as E3 ubiquitin ligases, play crucial roles in the ubiquitination of MITA[ 15 , 16 ]. In tumor tissues, MITA is highly expressed in tumor-associated macrophages, and its activation can repolarize M2 TAMs into M1 TAMs [ 17 ]. In cancer cells, MITA expression is suppressed to help cancer cells evade the body's immune surveillance [ 18 ]. The role of MITA and ubiquitination in the polarization of macrophages at the maternal-fetal interface, which forms an immunity tolerance state similar to tumor tissue [ 19 ], is not well understood. Pyroptosis is a type of programmed cell death that is mediated by gasdermin D (GSDMD). During pyroptosis, cells experience increased swelling and develop vesicular protrusions [ 20 ]. The proteins of the cysteine aspartate specific proteinase (Caspase) family, which are mainly activated by inflammasomes, cleave and activate GSDMD proteins[ 21 ]. pro-caspase-1(p20) is a key protein in pyroptosis and is a cleavage product of mature caspase-1(p45) [ 22 ]. It cleaves GSDMD into GSDMD-N, which forms pores in the cell membrane and causes cell death from the inside[ 23 ]. However, the released GSDMD-N does not damage neighboring mammalian cells during pyroptosis due to its preference for lipid binding[ 23 ]. The activation of MITA can initiate pyroptosis and induce an immune response in macrophages [ 24 , 25 ]. Previous research has shown that there is a higher rate of cell pyroptosis in the decidual tissue of patients with recurrent abortion compared to normal pregnant patients [ 26 ]. However, there is no information available on the relationship between the ubiquitination process and cell pyroptosis in the macrophages at the maternal-fetal interface. In this study, we demonstrate that MITA can be degraded by type K48 ubiquitination, which is mediated by TRIM38 in M2 macrophages. The decreased expression of MITA leads to a decrease in pyroptosis, revealing a potential association between ubiquitination and pyroptosis. This may be why the low expression of MITA results in maternal-fetal immune tolerance and helps to sustain pregnancy. RESULTS Differential expression of pyroptosis-associated markers and macrophage subpopulations in decidual tissues between URSA and Control patients Decidual tissues were obtained from four patients with unexplained recurrent spontaneous abortion (URSA) and four control patients who had a normal pregnancy but underwent induced abortion. Western blot analysis results demonstrated significantly higher expression of gasdermin-D (GSDMD), gasdermin-D-N (GSDMD-N), pro-caspase-1, and mature caspase-1 in the URSA group compared to the control group (as depicted in Fig. 1 A). Flow cytometry was then employed to assess various parameters in decidual tissues from both groups, including the overall proportion of macrophages (Fig. 1 B-a), the proportion of surviving and dead macrophages (Fig. 1 B-b), the proportion of surviving M1 and M2 macrophages (Fig. 1 B-c and 1 B-d), and the proportion of dead M1 and M2 macrophages (Fig. 1 B-e and 1 B-f). Further analysis revealed a significantly higher total number of macrophages in the URSA group compared to the control group (Fig. 1 C). However, the ratio of surviving to dead macrophages did not exhibit a significant difference between the two groups (Fig. 1 D). Interestingly, the ratio of M1 to M2 macrophages was significantly higher in the URSA group compared to the control group, observed in both surviving and dead macrophages (Fig. 1 E). These findings suggest that the differential expression of pyroptosis-associated markers between URSA patients and control patients might be associated with alterations in the populations of M1 and M2 macrophages. Differential expression of TRIM38 and MITA in the decidual tissue of patients in the URSA group and Control group The expression of TRIM38 and MITA proteins in decidual tissues was evaluated using IHC. No difference in TRIM38 expression between the URSA and control groups was oberved (as seen in Fig. 2 A and 2 B). However, MITA expression in decidual tissues was higher in URSA group compared to control group (as shown in Fig. 2 A and 2 B). Triple IF analysis revealed that TRIM38 and MITA were specifically expressed in M1 macrophages (labeled with CD86, shown as red fluorescence) in the URSA group (Fig. 2 C- 2 F). In the control group, TRIM38 and MITA were mainly expressed in M2 macrophages (labeled with CD209, shown as green fluorescence) and MITA expression was significantly lower in M2 compared to M1 in the URSA group (Fig. 2 C- 2 F). Expression of MITA protein in decidual tissues was higher in the URSA group compared to the control group (Fig. 3 A). In contrast, there was no significant difference in TRIM38 protein expression between the two groups (Fig. 3 A). However, qRT-PCR results revealed that both TRIM38 and MITA mRNA expression in decidual tissues were decreased in the URSA group compared to the control group (Fig. 3 B). These results were also supported by the macrophages obtained from decidual tissues (Fig. 3 C and 3 D). Differential ubiquitination of TRIM38 and MITA in decidual tissues and macrophages Additionally, we compared the levels of ubiquitination in decidual tissues and macrophages between the URSA and control groups. UB and K48 levels in decidual tissues and macrophages from the URSA group were significantly lower than those in the control group, while there was no significant difference in the level of K63 between the two groups (Fig. 4 A and 4 B). Furthermore, the level of K48 of MTIA was significantly lower in the URSA group compared to the control group (Fig. 4 C). Co-IP results indicated that there were endogenous interactions between TRIM38 and MITA in decidual tissues from both groups (Fig. 4 D). Differential expression of pyroptosis-related proteins in the supernatants of M1 and M2 macrophages To validate our hypothesis, we created in vitro cell models using polarized M1 and M2 macrophages from THP-1. Western blot was used to analyze protein expression of GSDMD, GSDMD-N, pro-caspase-1, and mature caspase-1 in the macrophage supernatants. GSDMD expression was lower, while expression of GSDMD-N, pro-caspase-1, and mature caspase-1 was higher in the M1 supernatant compared to M2 (Fig. 5 A). TRIM38 expression was also higher in the M1 supernatant while MITA expression was not significantly different between the two (Fig. 2 A). MITA expression was upregulated in M1 macrophages compared to M2, but TRIM38 expression was not different (Fig. 5 B). However, qRT-PCR revealed lower TRIM38 and MITA mRNA expression in M1 macrophages compared to M2 (Fig. 5 C). The above results indicated that post-translational modifications might exist between TRIM38 and MITA. Differential expression and ubiquitination of TRIM38 and MITA in M1/M2 macrophages The Co-IP results showed that there were endogenous interactions between TRIM38 and MITA in both M1 and M2 macrophages (Fig. 5 F). Furthermore, we found that the higher expression of type UB and K48, not K63 was detected in M2 macrophages when compared to M1 macrophages (Fig. 5 D); the higher expression of ubiquitination of types UB and K48, but not K63 also occurred in MITA in M1 macrophages when compared to M2 macrophages (Fig. 5 E). Thus, based on the above results, we hypothesize that ubiquitination modification of MITA may be related to pyroptosis in macrophages. TRIM38 containing the complete domains of Ring-Finger, B-BOX, and SPRY can interact not only with MITA but also with K48-type ubiquitinated particles As a member of the TRIM protein family, TRIM38 contains three functional domains: Ring-Finger, B-BOX, and SPRY. To investigate the interplay among these three functional domains, MITA, and K48 ubiquitination, Flag-TRIM38, Flag-TRIM38 (d-RF), Flag-TRIM38 (d-BB), and Flag-TRIM38 (d-SP) were co-transfected with HA-MITA and His-K48 in 293T. It was observed that knocking down any of the three domains showed no interaction with HA-MITA (Fig. 6 A-D). However, only TRIM38 with the complete domains of Ring-Finger, B-BOX, and SPRY was able to interact with His-K48 (Fig. 6 A). If any of the three domains were knocked out, Flag-TRIM38 was unable to interact with HA-MITA and His-K48 (Fig. 6 B-D). Furthermore, there was no direct interaction between HA-MITA and His-K48 (Fig. 6 A-D). Inhibition of pyroptosis reduced MITA expression through enhanced K48 ubiquitination and promoted the conversion of M1 to M2 To investigate the relationship between ubiquitination and pyroptosis, Belnacasan (VX765), a caspase-1 inhibitor, was added during polarization. The number of pyroptotic cells in the M1 + VX765 group was lower compared to the M1 + DMSO group, yet still higher than in the M2 group (Fig. 7 A). This suggests that pyroptosis in M1 macrophages is dependent on caspase-1. Expression of GSDMD-N and mature caspase-1 in the M1 + VX765 group was lower than in the M1 group, while the expression of pro-caspase-1 was not significantly different (Fig. 7 B). This indicates that VX765 reduces the conversion of pro-caspase-1 to mature caspase-1. We analyzed the protein expression levels of cGAS and MITA in macrophages and found that cGAS and MITA were significantly lower in M2 macrophages compared to M1 macrophages (Fig. 7 C). The expression of cGAS in the M1 + VX765 group was not significantly different from that in the M1 group, but the expression of MITA in the M1 + VX765 group was significantly lower (Fig. 7 C). This suggests that VX765 can directly inhibit MITA expression without affecting cGAS, the upstream target of MITA. Furthermore, the level of K48 of MITA was significantly higher in the M1 + VX765 group than in the M1 group (Fig. 7 D). Flow cytometry analysis showed that the number of CD86 + macrophages in the M1 + VX765 group decreased, while the number of CD209 + macrophages increased compared to the M1 group (Fig. 7 E-F). These findings indicate that inhibiting pyroptosis reduces MITA expression through enhanced K48 ubiquitination and promotes the conversion of M1 to M2. Effects of TRIM38 and MITA knockdown on the pyroptosis and polarization efficiency of macrophages To investigate the impact of the K48 relationship between TRIM38, MITA, and pyroptosis, we created TRIM38- and MITA-knockdown THP-1 cells (Supplemental Fig. S1). When TRIM38 was knocked down, the level of K48 was significantly higher in shTRIM38-M1 compared to M1, but significantly lower in shTRIM38-M2 compared to M2 (Fig. 8 A). Conversely, the levels of K48 in shMITA-M1 and shMITA-M2 showed no significant difference when compared to M1 and M2, respectively (Fig. 8 A). Additionally, when TRIM38 and MITA were both knocked down, the level of K48 in shTRIM38 + shMITA-M1 was higher than in M1, but significantly lower in shTRIM38 + shMITA-M2 compared to M2 (Fig. 8 A). This suggests that TRIM38 suppresses K48 expression in M1, but enhances it in M2. Our findings also showed that the levels of K48 of MITA in shTRIM38-M1 were not significantly different from those in M1 (Fig. 8 B), which could explain the increased expression of MITA in shTRIM38-M1 (Fig. 8 C). Conversely, the levels of K48 of MITA in shTRIM38-M2 were significantly reduced compared to those in M2 (Fig. 8 B), resulting in the increased expression of MITA in shTRIM38-M2 (Fig. 8 C). These results indicated that TRIM38 directly regulated the K48 of MITA in M2, but not in M1. Additionally, the levels of GSDMD-N in the shTRIM38-M1 supernatant were significantly higher compared to those in M1 (Fig. 8 D). This is in close correlation with the increased expression of MITA in shTRIM38-M1. However, the levels of GSDMD-N in the shMITA-M1 supernatant were significantly lower compared to those in M1 (Fig. 8 D). On the other hand, the levels of GSDMD-N in the shTRIM38 + shMITA-M1 supernatant were also significantly lower compared to those in M1, but higher than those in shMITA-M1 (Fig. 8 D). Since GSDMD-N in M2 supernatant was rarely expressed, almost no GSDMD-N could be detected in the supernatants of shTRIM38-M2, shMITA-M2, and shTRIM38 + shMITA-M2 (Fig. 8 D). These results indicated that MITA could activate pyroptosis, while inhibition of MITA expression could reduce the pyroptosis of M1. When TRIM38 or MITA were individually knocked down, the polarization efficiency of shTRIM38-M1 was significantly higher than that of M1, whereas the polarization efficiency of shMITA-M1 was significantly lower than that of M1 (Fig. 9 A-B). Conversely, the polarization efficiency of shTRIM38-M2 was significantly lower than that of M2, while the polarization efficiency of shMITA-M2 was significantly higher than that of M2 (Fig. 9 C-D). DISCUSSION In this study, we found that the expression of MITA and pyroptosis-related proteins was significantly higher in the URSA group than in the Control group, both in decidual tissues and macrophages. The Control group also had a significantly higher K48-type ubiquitination, mediated by TRIM38, which may contribute to the lower expression of MITA. Using in vitro cell models, we investigated the relationship between K48 of MITA and pyroptosis-related proteins and revealed that K48 may play a role in maintaining normal pregnancy by reducing MITA expression. The current focus of URSA research is on immune cells at the maternal-fetal interface, including natural killer (NK) cells, macrophages, and T-lymphocytes. Macrophages are the predominant endometrial leukocytes and can be polarized into two types: classically activated (M1) and selectively activated (M2)[ 6 , 27 , 28 ]. Single-cell sequencing studies have shown that macrophages are the immune cell population that changes the most with pregnancy status[ 8 ]. Imbalance in the M1/M2 ratio in decidual tissue has been identified as a factor in URSA. In URSA patients, M1 play a dominant role in inflammation, while M2 help regulate immune response in normal pregnancy [ 29 , 30 ]. The immune environment at the maternal-fetal interface is dynamic and regulatory, and decidual macrophages help maintain this environment by removing dead trophoblasts [ 31 , 32 ]. However, the specific mechanisms and factors affecting macrophage polarization remain unclear. MITA is a crucial adaptor protein in the innate immune system and plays a role in various diseases [ 33 ]. Low expression of MITA in tumor tissues has been linked to an immunosuppressed state that helps avoid the body's immune response [ 18 ]. The maternal decidua, with similarities to the formation of cancer cell metastases, has also been studied[ 19 ]. TRIM38, a small molecule protein in the TRIM protein family, has three functional domains (Ring-Finger, B-Box, and SPRY) and is classified as an E3 ubiquitin ligase due to its Ring-Finger structure. It mediates various types of ubiquitination [ 34 ]. In this study, we found that the expression of MITA was significantly lower in normal pregnancy and M2 macrophages compared to URSA and M1 macrophages. We also discovered the direct interaction between TRIM38 and MITA, and the possibility of post-translational modification, such as K48-type ubiquitination, based on the different expression trends at the mRNA and protein levels. Ubiquitination, as an important post-translational modification[ 35 ], can manifest either as K48 that degrades the target protein or K63 that causes structural changes in the target protein[ 36 ]. We found that K48 was higher in M2 than M1, and that MITA ubiquitination by K48 was also higher in M2 compared to M1. Our in vitro experiments showed that knocking down TRIM38 suppressed the intracellular ubiquitination level of M1 macrophages and promoted it in M2 macrophages. Furthermore, our findings indicate that downregulation of TRIM38 expression can enhance the polarization efficiency of M1 macrophages but suppress the polarization efficiency of M2 macrophages. Conversely, reduction in MITA expression inhibits M1 polarization while promoting the polarization efficiency of M2 macrophages. This might explain why MITA has a low expression in M2 and suggests that MITA and TRIM38 do not significantly interact through ubiquitination in M1.Not only that, given the different functional status exhibited by TRIM38-MITA in M1 and M2, we speculated that TRIM38 may be structural differences between M1 and M2. However, by the validation in 293T cells, we found that on matter which one of the above three domains was absent, TRIM38 could not mediate K48. The molecular weight of TRIM38 we detected either in vivo or in vitro were not consistent with the above defective TRIM38, from which we inferred that the different effects of TRIM38-MITA in M1 and M2 were not caused by the defective TRIM38. In this study, we investigated whether pyroptosis mediated by MITA was involved in the ubiquitination process described above. This was prompted by the different interaction functions displayed by MITA and TRIM38 in M1 and M2, as well as the fact that several members of the TRIM protein family can positively or negatively regulate cell pyroptosis [ 37 ]. Our findings showed that M1 underwent classical, caspase1-dependent cell pyroptosis. Although previous studies have suggested that cell self-death can activate the cGAS-MITA pathway, leading to increased MITA production and a strong immune response [ 38 ], and the activation of GSDMD-N could inhibit the cGAS-MITA pathway by promoting K + efflux and reducing cGAS expression, ultimately leading to decreased MITA expression [ 39 ]. In this study, we found that the knockdown of MITA inhibited the production of GSDMD-N in M1, while the knockdown of TRIM38 increased the expression of GSDMD-N. This suggests that MITA promotes while TRIM38 suppresses pyroptosis in M1, confirming that TRIM38 and MITA play different roles in M1 and M2, and that this difference is closely related to their different cellular pyroptosis states. Interestingly, when we introduced the VX765, an inhibitor of caspase1, we found that both the levels of GSDMD-N in the supernatant and MITA expression in the cells were significantly decreased, regardless of cGAS expression. This suggests that blocking pyroptosis could directly downregulate MITA expression and cause the transformation of M1 to M2, leading to an increase in the ubiquitinated degradation of MITA's K48. This also implies that MITA positively regulates pyroptosis in M1, the different pyroptosis states in M1 and M2 are likely the main reasons for the different interaction functions of MITA and TRIM38. The validation of the tissue samples further confirmed the differential expression of MITA in decidual tissues in URSA and normal pregnancy, which was closely correlated with the proportion of M1 and M2. While it has been reported that dead cells can release intracellular mitochondria and activate MITA-related pathways, leading to increased expression of MITA[ 40 ], our study found no clear differences in the proportion of surviving and dead macrophages between the two groups via FCM. IHC and Triple IF also indicated that higher MITA expression in decidual tissues in the URSA group compared to the control group was strongly associated with viable M1 and M2, not dead macrophages. Additionally, we observed much higher K48-type ubiquitination in normal pregnancy decidual tissue and macrophages than in URSA in vivo, which was highly consistent with our cell models in vitro and with the M1/M2 ratio demonstrated by FCM, IHC, and Triple IF. CONCLUSIONS In this study, we found that low expression of MITA in M2 macrophages helps to avoid triggering an excessive immune response and maintain stability in the immune tolerance microenvironment at the maternal-fetal interface, enabling the pregnancy to continue. In contrast, no effect of K48 on MITA was observed in M1 macrophages. Clear cell pyroptosis was observed in M1 macrophages, and when cell pyroptosis was inhibited, M1 macrophages not only exhibited K48 of MITA but also showed a clear trend towards transforming into M2 macrophages. This suggests that cell pyroptosis may have an inhibitory effect on K48 of MITA and impact the transformation between M1 and M2 macrophages. MATERIALS AND METHODS Ethical statement The studies involving human participants were reviewed and approved by the Medical Ethics Committee of the Wuhan Children’s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science &Technology. The patients/participants provided their written informed consent to participate in this study (No. 2020E042-E02). Collection of clinical samples Patients aged 20-35, menopause for 40-60 days, HCG (+) and early uterine ultrasound found the original pericardial beats of the pregnant sac, but the disappearance of the later stage, were diagnosed as missed abortion, who had a history of one or more unexplained abortion in the past. Four cases of uterine decidual tissue without gene chromosomal abnormalities were taken as the URSA group, and four patients of uterine decidual tissue from early normal pregnancy (indicating the gestational sac and original cardidial beats) requiring artificial abortion to terminate pregnancy were collected as the Control group. The clinical characteristics of the included participants were shown in Table 1. Isolation of macrophages from tissues samples Macrophages were isolated from decidual tissue using the conventional adherent method. Tissue samples (weighing about 5-8 g) from each patient were washed twice with sterile phosphate-buffered saline (PBS, Gibco) to remove visible blood clots. The tissue was sheared beforehand and added to a 10 cm sterile cell culture dish along with 2 ml of pancreatic enzyme analog (ATV, TrypLE™Express) at 37°C for 15 mins in a thermostatic cell incubator. Then, 50ml sterile centrifuge tubes were prepared, each corresponding to a patient's tissue sample and marked separately. A 70 μm cell filter (Biosharp, Labgic, Beijing, China) was placed at the mouth of each tube. The ATV-digested decidual tissue was removed from the cell incubator, placed on the corresponding filter screen, and ground with 5 ml of sterile syringe and PBS. The cell suspension was collected in the centrifuge tube under the filter screen. After collection, a volume of 40 ml of PBS was added, thoroughly mixed, and then centrifuged at room temperature for 5 minutes at a speed of 1500 rpm. The resulting supernatant was discarded, and another 40 ml of PBS was added, mixed thoroughly, and centrifuged again at 1500 rpm for 5 minutes at room temperature. Once again, the supernatant was discarded, and this time 15 ml of PBS was added. Human red blood cell lysates, previously diluted to 1× with sterilized dd H2O, were added to the prepared cell suspension at a 1:1 ratio, thoroughly mixed at room temperature, and then placed in a black light protection box for 15 minutes. Following this, the cell suspension was removed, centrifuged at 1500 rpm for 5 minutes at room temperature, and the supernatant was discarded. Subsequently, 40 ml of PBS was added, thoroughly mixed, and centrifuged at 1500 rpm for 5 minutes at room temperature. Once again, the supernatant was discarded. Based on the amount of cell precipitation in the lower layer, the cells were resuspended in 8-10 ml of complete medium prepared with Gibco RPMI1640 medium + 10% Gibco fetal calf serum (FBS) + 1% double-antibody (penicillin + streptomycin, PS) + 1% 4-2-hydroxyethyl-1-ethylonic acid (HEPES). The cell count was measured, and 2 ml of the cell suspension was spread into a six-well plate for each patient sample. After a period of 6 hours, the RPMI 1640 complete medium was replaced, and the condition of cell adhesion was observed using a microscope. The cells were replaced every 1-2 days thereafter and collected after 5-7 days. The entire process of sample collection was completed in the biosafety cabinet. After discarding the upper cell medium, 2 ml of PBS was added to each well, and the attached macrophages were rinsed by gently shaking the plate. Next, 300 µl ATV was added, and the surface was sprayed with 75% alcohol sterilized and digested in a 37°C constant static cell incubator for 15 min. After the adherent cells became suspended under the 40x light microscope, digestion was terminated by adding sterile PBS (1 ml) to each well, and the cell suspension was transferred to a new sterile EP tube. Because there were fewer cells in each patient under the light microscope, cell samples from 4 patients in the URSA group and 4 patients in the Control group were combined. Cell culture and polarization, VX765 treatment The THP-1 cell line was a gift from Professor Xi Zhou (LRV-Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China). The THP-1 cells were cultured in RPMI 1640 medium (Gibco, Thermo Fisher, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher, USA), 1% penicillin, 1% streptomycin and 1% 4- (2-hydroxyethyl) -1-piperazine ethylene sulfonic acid (Gibco, Thermo Fisher Scientific, USA) in an incubator containing 5% CO 2 at 37 o C. The cell polarization was induced by incubating THP-1 cells (10 6 /ml) with phorbol 12-myristate 13-acetate (PMA) at a final concentration of 100 ng/ml (#P1585, Sigma, USA) for a 24-h period. This caused the THP-1 cells to differentiate into M0 macrophages. To further polarize the M0 macrophages, interferon-γ (IFN-γ) at a concentration of 20 ng/ml (#285-IF, R&D Systems, USA) and lipopolysaccharide (LPS) at 10 pg/ml (#L2630, Sigma, USA), Interleukin4 (IL-4) at 20 ng/ml (#204-IL, R&D Systems, USA) and interleukin13 (IL-13) at 20 ng/ml (#213-ILB, R&D Systems, USA), were added to the complete medium for 48 hours, resulting in the polarization of M0 into M1 and M2 macrophages respectively. In addition, during the polarization of M1 macrophages, the caspase1 inhibitor VX765(#HY13205, MCE, working concentration: 25 µM) and equal amounts of dimethyl sulfoxide (DMSO, the solvent of VX765, 2.5 µl/10ml) were added, together with IFN-γ and LPS. Knockdown of TRIM38 and MITA in THP-1 cells Lentiviral particles were used to knock down the TRIM38 and MITA genes in THP-1 cells. The particles targeting TRIM38 were obtained from Santa (#sc-95352-V, USA) and had a pool-sequence of GATCCGTACAGATTCAGAGACAAATTCAAGAGATTTGTCTCTGAATCTGTACTTTTT+GATCCGTAGACTGAGGGACTATGATTCAAGAGATC ATAGTCCCTCAGTCTACTTTT+GATCCCTGTCTCCTTGGAACTTCATTCAAGAGATGAAGTTCCAAGGAGACAGTTTTT, with a titer of 106 TU/ml. The particles targeting MITA were obtained from GenePharma (#D01001, China) and had a sequence of GCTGTCCATCTATTTCTACTA, with a titer of 108 TU/ml. The vector used for the MITA particles contained GFP green fluorescence. Blank lentiviral particles were obtained from GenePharma (#D03JZ, China). Transduction was carried out with a multiplicity of infection (MOI) of 1:100, as per the manufacturer's instructions. Knockdown efficiency was confirmed through qRT-PCR and western blot analysis. THP-1 cells were polarized into M1 and M2 macrophages after knockdown of TRIM38 or MITA, and labeled as shTRIM38-M1, shTRIM38-M2, shMITA-M1, and shMITA-M2, respectively. When both TRIM38 and MITA were knocked down, THP-1 cells were polarized into M1 and M2 macrophages and labeled as shTRIM38+shMITA-M1 and shTRIM38+shMITA-M2, respectively. Transfection of 293T cell The 293T cell line was provided as a gift from Professor Xi Zhou of LRV-Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China. The 293T cells were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, USA) and maintained in an incubator at 37°C with 5% CO2. The following plasmids were established by Miaolingbio, China: Flag-tagged TRIM38 plasmid (Flag-TRIM38), Flag-tagged TRIM38 plasmid without the Ring-Finger domain (Flag-TRIM38 (d-RF)), Flag-tagged TRIM38 plasmid without the B-BOX domain (Flag-TRIM38 (d-BB)), Flag-tagged TRIM38 plasmid without the SPRY domain (Flag-TRIM38 (d-SP)), HA-tagged MITA plasmid (HA-MITA), and His-tagged K48 ubiquitination plasmid (His-K48). Flag-TRIM38, Flag-TRIM38 (d-RF), Flag-TRIM38 (d-BB), and Flag-TRIM38 (d-SP) were co-transfected with 8 μg of HA-MITA and His-K48 plasmids using Opti-MEM (Gibco, Thermo Fisher Scientific, USA) and PEI MAX (SenGene, Shanghai, China), following the manufacturer’s instructions. After 6-8 hours of transfection, the medium was replaced with fresh DMEM medium, and the cells were harvested after incubating for 24 hours. Flow cytometry and cell sorting 1 mL of each tissue sample suspension was treated with red cell lysate and resuspended in 40 mL of PBS. Subsequently, the samples underwent centrifugation at a speed of 1500 rpm for a duration of 5 minutes. Following the removal of the supernatant, each tube was supplemented with 0.3-0.5% BSA (#V900933, Merck, USA) in PBS, which had been pre-cooled to 4°C, in order to resuspend the cells. The cell suspension was then subjected to centrifugation at 500 g and 4°C for 5 minutes, and this process was repeated once more after discarding the supernatant. The cells were resuspended in PBS to 200 µL, and the cell density was adjusted to 10^6/mL by cell counting. The cell suspension was then passed through a 40 µm cell filter (Biosharp, Labgic, Beijing, China) into a new 1.5 mL EP tube. The filtered cell suspensions were divided into negative control (20 µL), CD14 (20 µL), FVS780 (20 µL), CD86 (20 µL), CD209 (20 µL), and sample tubes (100 µL). The negative control tube directly had PBS added to the resuspension to 300 µL, and the other tubes were filled with the recommended staining ratio (5 µL/100 µL cell suspension). FVS780 (20 µL) with 0.1 µL (1 µL/1000 µL cell suspension), 5 µL of flow antibodies CD14 (#12-0149-42; PE channel, BD Biosciences, USA)/CD86 (#305412; APC channel, Biolegend, USA)/CD209 (#330104; FITC channel, Biolegend, USA) and 0.1 µL of FVS780 (#565388; APC-CY7 channel, BD Biosciences, USA) were added to the sample tubes (100 µL) respectively. The cell suspension in the above EP tubes was fully mixed and then placed in a fully sealed black light avoidance box for staining at room temperature for 30 minutes. After staining, 0.3-0.5% BSA in PBS, pre-cooled at 4°C, was added to each tube to resuspend the cells. The cell suspension was centrifuged at 500 g and 4°C for 5 minutes, and the operation was repeated once after discarding the supernatant. The cell suspension of the above EP tubes was resuspended with PBS to 300 µL, placed on ice together with the negative control to protect from light, and then analyzed by flow cytometry with a FACSAriaTM III (BD Biosciences). Data analysis was performed using FlowJoV10.8.0 software. THP-1 cells and THP-1 cells with TRIM38 and MITA knockdown were seeded in T75 flasks at a density of 2.5 × 106 cells per flask and differentiated with PMA. After incubation with either IFN-γ and LPS or IL-4 and IL-13, respectively, the cells were washed with cold PBS. The macrophages derived from M1 polarization were stained with flow antibodies of FVS780 and CD86, while M2 was stained with FVS780 and CD209, following the same flow steps as for the tissue. Since the lentiviral particles vector for knocking down the MITA gene contained GFP green fluorescence, CD209 (#330108; APC channel, Biolegend) was used in M2 with MITA knockdown. In other M2 macrophages, CD209 (#330104; FITC channel, Biolegend, USA) was still used. The cells were analyzed by flow cytometry with a FACSAriaTM III (BD Biosciences), and data analysis was performed using FlowJoV10.8.0 software. M1 with FVS780(-) and CD86(+), and M2 with FVS780(-) and CD209(+) were collected in sterile 15ml centrifuge tubes containing RPMI 1640 medium for subsequent experiments. Real-time Quantitative PCR (qPCR) the isolation of total RNA from tissues was carried out using Trizol reagent (Takara, Japan), while cells were isolated using a kit from Sangon Biotech (Shanghai, China). The RNA was then reverse-transcribed using the high-capacity cDNA reverse transcriptase kit (TaKaRa, Japan) according to the manufacturer's instructions. qPCR assays were conducted using SYBR Green PCR Master Mix (TaKaRa, Japan) and the Fast qPCR System (QuantStudio5, Thermo Fisher, USA). Gene-specific primers were designed and obtained from Ruibo Biology Co., Ltd (Shanghai, China). The primer sequences can be found in Table 2. To normalize gene expression levels, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as the internal control. Three biological replicates were utilized for each sample. The 2 −ΔΔ Ct method was employed to calculate and normalize the gene expression levels relative to the internal controls. Extraction of supernatants and cell components The cell supernatants were collected in sterile EP tubes. Trichloroacetic acid (TCA, Sinopharm Chemical Reagent Co., Ltd) was added at a ratio of 1:10 and mixed well. The mixture was placed in a 4 o C refrigerator overnight and then transferred to a 4 o C low-temperature centrifuge at 12000 g for 10 mins. The upper liquid was discarded and the protein precipitate at the bottom of the tube was gently washed with 1 ml of sterilized PBS. The PBS was then taken away, and 60-100 µl of western & IP lysate was added to dissolve the precipitation, depending on the amount of precipitation. Next, 5X loading buffer was added and the sample was cooked in a 95 o C water bath for 10 mins. Western blotting Cell lysis was performed using Western & IP lysates (Beyotime, Shanghai, China) for cells and RIPA lysate (GBCBIO Technologies, Guangzhou, China) for tissues. The protease inhibitor cocktail (Solarbio, Beijing, China) was added at a ratio of 1:100. Following lysis, the cells or tissues were transferred into tubes designed for cell or tissue crushing. Subsequently, they were centrifuged at 12,000 g for 15 minutes at a temperature of 4°C. The resulting supernatants were extracted separately and mixed with 5X loading buffer. To facilitate protein denaturation, the samples were boiled at 95°C for 10 minutes. Afterward, the collected samples were subjected to electrophoresis on a 10% SDS-PAGE gel at a voltage of 80 V for 2 hours. Following electrophoresis, the proteins were transferred to a membrane using a current of 350 mA for 2 hours. To prevent non-specific binding, the membrane was blocked with 5% skim milk for 1 hour and subsequently incubated overnight at 4°C with the appropriate primary antibodies. The western blot bands derived from cells or tissues were visualized using an enhanced chemiluminescence (ECL, MILLIPORE, USA) developer and a chemiluminescence imaging system (Shanghai Qinxiang Scientific Instrument Co., Ltd.). The primary antibodies used in this study are listed below: rabbit monoclonal [EPR13130-55] to MITA (#239074, Abcam, USA), mouse monoclonal anti-human TRIM38 (#MA5-26235, Invitrogen), rabbit monoclonal [EPR19672] to Caspase-1 (#207802, Abcam, USA), rabbit monoclonal [EPR20829-408] to cleaved N-terminal GSDMD (#215203, Abcam, USA), rabbit monoclonal [EPR19829] to GSDMD (#210070, Abcam, USA), and rabbit monoclonal [EPR26492-84] to cGAS (#302617, Abcam, USA). Rabbit anti-GAPDH (#181602, Abcam, USA) was used as the internal control. IgG (HRP) goat anti-rabbit antibody (#6721, Abcam, USA) and IgG (HRP) goat anti-mouse antibody (#6789, Abcam, USA) were used as the secondary antibodies. Co-Immunoprecipitation (Co-IP) Endogenous Co-IP was performed on decidual tissues, M1 and M2 macrophages using Western & IP lysates (Beyotime, Shanghai, China). To perform immunoprecipitation, monoclonal antibodies against MITA (#239074, Abcam, USA) were utilized to immunoprecipitate tissue and cell lysates. In the case of exogenous co-immunoprecipitation (Co-IP), 293T cells were collected 24 hours after transfection and subsequently lysed using a buffer containing 25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA, and a proteinase inhibitor cocktail (Solarbio, Beijing, China). Whole cell lysates were subjected to immunoprecipitation using monoclonal antibodies against Flag (#2368, CST, USA), HA (#236632, Abcam, USA), or His (#12698, CST, USA) in the presence of magnetic beads (MCE, USA). For both endogenous and exogenous Co-IP, Normal Rabbit IgG (#2729, CST, USA) was employed as a negative control. To minimize non-specific interference, all lysates were incubated with 10 µl magnetic beads (MCE, USA) on a rotating shaker at 4°C for 2 hours. Generally, 1-2 μg of commercial antibody was added to 500 μl of tissue or cell lysates, and the mixture was incubated overnight at 4°C. The immunocomplexes captured on the affinity gel or magnetic beads were thoroughly washed with lysis buffer and subsequently eluted with SDS loading buffer through boiling for 5 minutes. Subsequently, the samples were subjected to SDS-PAGE and analyzed by Western blotting. Immunohistochemistry staining of TRIM38 and MITA in decidual tissues The collected decidual tissues underwent fixation in 4% paraformaldehyde and subsequent embedding in paraffin. Microtome (HM355; Microm) was used to cut sections (4 μm), which were then deparaffinized through a series of incubations: 10 minutes in Xylene, followed by 100%, 96%, and 70% ethanol, and deionized water. Antigen retrieval was performed using citrate buffer (pH 6.0), and to remove endogenous peroxidase, the sections were incubated with 3% hydrogen peroxide for 30 minutes. For staining, the sections were blocked with 3% bovine serum albumin at room temperature for 30 minutes and then incubated overnight at 4°C with the following primary antihuman antibodies: rabbit monoclonal [EPR13130-55] to MITA (#239074, Abcam, Dilution 1:4000) and mouse monoclonal anti-human TRIM38 (#MA5-26235, Invitrogen, Dilution 1:150). After washing with phosphate-buffered saline three times for 5 minutes each, the sections were incubated with corresponding secondary antibodies (goat anti-rabbit antibody, 1:400, #5220-0336, SeraCare; goat anti-mouse antibody, 1:400, #5220-0341, SeraCare) for 1 hour at room temperature. To visualize the expression of MITA and TRIM38 in the decidua, diaminobenzidine chromogen was utilized. Finally, the sections were counter-stained with hematoxylin. Triple immunofluorescence staining of decidual tissues The obtained decidual tissues were fixed using 4% paraformaldehyde and subsequently embedded in paraffin. Using a microtome (HM355; Microm), sections with a thickness of 4 μm were obtained. These sections were then deparaffinized by treatment with Xylene for 10 minutes, followed by sequential washing with 100%, 96%, and 70% ethanol, as well as deionized water. Antigen retrieval was performed using citrate buffer (pH 6.0), and endogenous peroxidase was removed by incubating the sections with 3% hydrogen peroxide for 30 minutes. For the triple staining of CD86 + CD206 and TRIM38, the sections were treated with 3% bovine serum albumin at room temperature for 30 minutes, followed by overnight incubation at 4°C with the primary anti-human antibody CD206 (#60143-1-Ig, Proteintech, Dilution 1:400). After washing the sections with PBST three times, each for 5 minutes, a secondary antibody (1:400, #5220-0341, SeraCare) was applied and incubated at room temperature for 1 hour. Subsequently, the sections were washed with PBST three times, each for 5 minutes, and incubated with Alexa Fluor™ 488 tyramide for 30 minutes at room temperature. Then, the sections were treated again for antigen retrieval and endogenous peroxidase quenching, followed by blocking. After that, the staining of CD80 was performed by incubating the sections with the corresponding primary antibody against CD80 (#bs-1035R, 1:200, Bioss), secondary antibody (#5220-0341, 1:400, SeraCare) and Cy3 tyramide. Similarly, staining of TRIM38 was detected by incubating with the corresponding primary antibody against TRIM38 (#334BAA80, 1:100, Invitrogen), secondary antibody (#5220-0341, 1:400, SeraCare), and Cy5 tyramide. The nucleus was stained with DAPI. A similar protocol was used for the triple staining of CD86 + CD206 and MITA, where after staining CD86 and CD206, the staining of MITA was detected by incubating with the corresponding primary antibody against MITA (#ab239073, 1:100, Abcam), secondary antibody (#5220-0336, 1:400, SeraCare), and Cy5 tyramide. The nucleus was stained with DAPI. Signal analysis was carried out using fluorescence microscopy (Olympus BX50) and digitally photographed. Statistical analysis ” All the statistical analysis was performed using GraphPad Prism 9 (GraphPad Software, La Jolla, USA)”. “All the data were presented as mean ± standard deviation. Significant differences between/among different groups were assessed using unpaired t-test or one-way ANOVA followed by Bonferroni’s multiple comparison tests”. “P < 0.05 was considered statistically significant”. Declarations ACKNOWLEDGEMENTS We thank all the patients whose participation made this study possible. We thank Prof. Daji Luo (Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan Hubei, China), Dr. Yujie Ren, Chong Wang, Yang Han, Yuan Fang, Jia Quan, Ruyi Yang, Xiaobei Xiong, Muhan Huang (State Key Laboratory of Virology, Wuhan Institute of Virology, Center for Biosafety Mega-Science, Chinese Academy of Sciences (CAS), Wuhan, China) for their provisions of corresponding experimental site and the use guidance of relevant experimental instruments. We thank Dr. Jie Zeng, Ping Tian (Wuhan Children’s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science &Technology, Wuhan, China) for their collection of decidual tissue samples. This study was funded by grants from the Fund of the National Key Research and Development Program of China (2018YFC1002804 and 2016YFC1000600 ), the National Natural Science Foundation of China (81771618, 81971356 and 82001642), Fund of Clinical Medical Education teaching Reform of Hubei Provincial Health Commission (HBJG-220074). AUTHORS ’ CONTRIBUTIONS Jing Yang, Jiao Chen, Yang Qiu & Tao Tang had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analyses. Jun Liu , Yan Deng, An Wang & Bowen Liu had equal contributions to this article. Jing Yang, Jun Liu, Yang Qiu, Xi Zhou & Jiao Chen designed the study. Jun Liu, Yan Deng, Bowen Liu & Tailang Yin cleaned and analysed the clinical data. Yan Wang analysed the FCM data. Jun Liu performed all the experiments. Jun Liu, An Wang analyzed the data and drew the Pattern Diagram. Jun Liu, Tao Tang & Jiao Chen discussed the data and wrote the manuscript. CONFLICT OF INTEREST The authors declare no competing interests. References Dimitriadis E, Menkhorst E, Saito S, Kutteh WH, Brosens JJ. Recurrent pregnancy loss. Nat Rev Dis Primers. 2020;6(1):98. Sahoo T, Dzidic N, Strecker MN, Commander S, Travis MK, Doherty C, et al. Comprehensive genetic analysis of pregnancy loss by chromosomal microarrays: outcomes, benefits, and challenges. Genet Med. 2017;19(1):83–89. Wang XH, Xu S, Zhou XY, Zhao R, Lin Y, Cao J, et al. Low chorionic villous succinate accumulation associates with recurrent spontaneous abortion risk. Nat Commun. 2021;12(1):3428. Li Y, Zhang D, Xu L, Dong L, Zheng J, Lin Y, et al. Cell-cell contact with proinflammatory macrophages enhances the immunotherapeutic effect of mesenchymal stem cells in two abortion models. Cell Mol Immunol. 2019;16(12):908–920. Reese HR, Shanahan CC, Proulx C, Menegatti S. Peptide science: A \"rule model\" for new generations of peptidomimetics. Acta Biomater. 2020;102:35-74.2019;16(12):908–920. Yang F, Zheng Q, Jin L. Dynamic Function and Composition Changes of Immune Cells During Normal and Pathological Pregnancy at the Maternal-Fetal Interface. Front Immunol. 2019;10:2317. Schjenken JE, Moldenhauer LM, Zhang B, Care AS, Groome HM, Chan HY, et al. MicroRNA miR-155 is required for expansion of regulatory T cells to mediate robust pregnancy tolerance in mice. Mucosal Immunol. 2020;13(4):609–625. Pique-Regi R, Romero R, Tarca AL, Sendler ED, Xu Y, Garcia-Flores V, et al. Single cell transcriptional signatures of the human placenta in term and preterm parturition. Elife. 2019;8:e52004. Jiang X, Du MR, Li M, Wang H. Three macrophage subsets are identified in the uterus during early human pregnancy. Cell Mol Immunol. 2018;15(12):1027–1037. Guerriero JL. Macrophages: Their Untold Story in T Cell Activation and Function. Int Rev Cell Mol Biol. 2019;342:73–93. Hu MM, Shu HB. Innate Immune Response to Cytoplasmic DNA: Mechanisms and Diseases. Annu Rev Immunol. 2020;38:79–98. Zhong B, Yang Y, Li S, Wang YY, Li Y, Diao F, et al. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity. 2008;29(4):538–550. Sun W, Li Y, Chen L, Chen H, You F, Zhou X, et al. ERIS, an endoplasmic reticulum IFN stimulator, activates innate immune signaling through dimerization. Proc Natl Acad Sci U S A. 2009;106(21):8653–8658. Chen X, Dou QP, Liu J, Tang D. Targeting Ubiquitin-Proteasome System With Copper Complexes for Cancer Therapy. Front Mol Biosci. 2021;8:649151. Hatakeyama S. TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem Sci. 2017;42(4):297–311. Ebner P, Versteeg GA, Ikeda F. Ubiquitin enzymes in the regulation of immune responses. Crit Rev Biochem Mol Biol. 2017;52(4):425–460. Zhang Y, Sun Z, Pei J, Luo Q, Zeng X, Li Q, et al. Identification of α-Mangostin as an Agonist of Human STING. ChemMedChem. 2018;13(19):2057–2064. Konno H, Yamauchi S, Berglund A, Putney RM, Mulé JJ, Barber GN. Suppression of STING signaling through epigenetic silencing and missense mutation impedes DNA damage mediated cytokine production. Oncogene. 2018;37(15):2037–2051. Beaman KD, Jaiswal MK, Katara GK, Kulshreshta A, Pamarthy S, Ibrahim S, et al. Pregnancy is a model for tumors, not transplantation. Am J Reprod Immunol. 2016;76(1):3–7. Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature. 2015;526(7575):660–665. Yockey LJ, Jurado KA, Arora N, Millet A, Rakib T, Milano KM, et al. Type I interferons instigate fetal demise after Zika virus infection. Sci Immunol. 2018;3(19):eaao1680. Huang LS, Hong Z, Wu W, Xiong S, Zhong M, Gao X, et al. mtDNA Activates cGAS Signaling and Suppresses the YAP-Mediated Endothelial Cell Proliferation Program to Promote Inflammatory Injury. Immunity. 2020;52(3):475–486.e5. Liu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, et al. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature. 2016;535(7610):153–158. Liu Z, Wang M, Wang X, Bu Q, Wang Q, Su W, et al. XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury. Redox Biol. 2022;52:102305. Okondo MC, Johnson DC, Sridharan R, Go EB, Chui AJ, Wang MS, et al. DPP8 and DPP9 inhibition induces pro-caspase-1-dependent monocyte and macrophage pyroptosis. Nat Chem Biol. 2017;13(1):46-53.26. Zhu D, Zou H, Liu J, Wang J, Ma C, Yin J, et al. Inhibition of HMGB1 Ameliorates the Maternal-Fetal Interface Destruction in Unexplained Recurrent Spontaneous Abortion by Suppressing Pyroptosis Activation. Front Immunol. 2021;12:782792. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation [published correction appears in Nat Rev Immunol.2010 Jun;10(6):460]. Nat Rev Immunol. 2008;8(12):958–969. Zhou X, Li W, Wang S, Zhang P, Wang Q, Xiao J, et al. YAP Aggravates Inflammatory Bowel Disease by Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis. Cell Rep. 2019;27(4):1176–1189.e5. Timmer AM, Nizet V. IKKbeta/NF-kappaB and the miscreant macrophage. J Exp Med. 2008;205(6):1255–1259. Abumaree MH, Al Harthy S, Al Subayyil AM, Alshabibi MA, Abomaray FM, Khatlani T, et al. Decidua Basalis Mesenchymal Stem Cells Favor Inflammatory M1 Macrophage Differentiation In Vitro. Cells. 2019;8(2):173. Mor G, Aldo P, Alvero AB. The unique immunological and microbial aspects of pregnancy. Nat Rev Immunol. 2017;17(8):469–482. Abrahams VM, Kim YM, Straszewski SL, Romero R, Mor G. Macrophages and apoptotic cell clearance during pregnancy. Am J Reprod Immunol. 2004;51(4):275–282. Motwani M, Pesiridis S, Fitzgerald KA. DNA sensing by the cGAS-STING pathway in health and disease. Nat Rev Genet. 2019;20(11):657–674. Hu MM, Liao CY, Yang Q, Xie XQ, Shu HB. Innate immunity to RNA virus is regulated by temporal and reversible sumoylation of RIG-I and MDA5. J Exp Med. 2017;214(4):973–989. van Wijk SJ, Fulda S, Dikic I, Heilemann M. Visualizing ubiquitination in mammalian cells. EMBO Rep. 2019;20(2):e46520. Bard JAM, Goodall EA, Greene ER, Jonsson E, Dong KC, Martin A. Structure and Function of the 26S Proteasome. Annu Rev Biochem. 2018;87:697–724. Wan T, Li X, Li Y. The role of TRIM family proteins in autophagy, pyroptosis, and diabetes mellitus. Cell Biol Int. 2021;45(5):913–926. West AP, Khoury-Hanold W, Staron M, Tal MC, Pineda CM, Lang SM, et al. Mitochondrial DNA stress primes the antiviral innate immune response. Nature. 2015;520(7548):553–557. Banerjee I, Behl B, Mendonca M, Shrivastava G, Russo AJ, Menoret A, et al. Gasdermin D Restrains Type I Interferon Response to Cytosolic DNA by Disrupting Ionic Homeostasis. Immunity. 2018;49(3):413–426.e5. Murthy AMV, Robinson N, Kumar S. Crosstalk between cGAS-STING signaling and cell death. Cell Death Differ. 2020;27(11):2989–3003. Tables Table 1. Clinical characteristics of the included participants. URSA Control Patient 1 Patient 2 Patient 3 Patient 4 Patient 1 Patient 2 Patient 3 Patient 4 Age (years) 25 32 29 30 22 33 26 23 Race Han Han Han Han Han Han Han Han Gestation G2P0 G2P0 G2P0 G2P0 G2P0 G2P0 G2P0 G2P0 Menopause (days) 52 55 58 54 45 55 48 59 Past RSA 1 1 1 1 0 0 0 0 Disease history No No No No No No No No Primary heartbeat No No No No Yes Yes Yes Yes Villus CMV (-) (-) (-) (-) (-) (-) (-) (-) COVID-19 (-) (-) (-) (-) (-) (-) (-) (-) Table 2. The sequence of primers. Sequence TRIM38 Forward: 5ʹ-CTCAAGAGCCACATCCTGGAAC-3ʹ Reverse: 5ʹ-GTTCCAAGGAGACAGCCTCTGA-3ʹ MITA Forward: 5ʹ- GGTGCCTGATAACCTGAGTATG-3ʹ Reverse: 5ʹ-GTTGCTGTAAACCCGATCCTTG-3ʹ GAPDH Forward: 5ʹ-GTCTCCTCTGACTTCAACAGCG-3ʹ Reverse: 5ʹ-ACCACCCTGTTGCTGTAGCCAA-3ʹ Additional Declarations (Not answered) Supplementary Files FS1.jpg PatternDiagram.jpg Cite Share Download PDF Status: Published Journal Publication published 28 Nov, 2023 Read the published version in Cell Death & Disease → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3131504\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":217374849,\"identity\":\"6c46353c-2691-434a-ad01-2d2d9e541a52\",\"order_by\":0,\"name\":\"jing Yang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA80lEQVRIiWNgGAWjYDCCA2CSjYeBgfkAM5IIUVrYEkjSAgI8BsRp4bt9xvBzwS8+GXP+Nd+kC9sY5PhuJDB+LsCjRfJcjrH0zD42HssZb7dJz2xjMJa8kcAsPQOPFoMzPAbSvD1sPAY3zm67zdvGkLjhRgIbMw9+Lca/IVrOPANpqSdGi5k0zw+glvM9bCAtCQaEtEieYSuz5m0A2cJm/pvnnIThzDMPm6XxaeE7w7z5Ns+fY/YG5w8/NuYps5HnO5588DM+LQwMHAYMjG3HGBgkEkA8CSBmbMCrgYGB/QEDw58aBgb+AwQUjoJRMApGwYgFAPazS6BTPuOmAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Renmin Hospital of Wuhan University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"jing\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":217374850,\"identity\":\"b160de47-e43e-48bb-917d-17db6605f39b\",\"order_by\":1,\"name\":\"Jun Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Renmin Hospital, Wuhan University, Wuhan, China\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jun\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":217374851,\"identity\":\"0d5193ad-6616-4983-9457-a2ce9b8df4dc\",\"order_by\":2,\"name\":\"Yan Deng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Deng\",\"suffix\":\"\"},{\"id\":217374852,\"identity\":\"21e471ee-4fd4-48f7-9cea-429b0bf5a8ab\",\"order_by\":3,\"name\":\"An Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wuhan Institute of Virology, Center for Biosafety Mega-Science, Chinese Academy of Sciences\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"An\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":217374853,\"identity\":\"d8a5d7a5-caa9-4432-959b-032612d695c3\",\"order_by\":4,\"name\":\"Bowen Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Renmin Hospital, Wuhan University, Wuhan, China\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bowen\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":217374854,\"identity\":\"5f4a4a08-8908-4834-adda-800b589a7d22\",\"order_by\":5,\"name\":\"Xi Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Wuhan Institute of Virology, Chinese Academy of Sciences\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xi\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":217374855,\"identity\":\"8caf497b-cb9f-4bcd-9d48-0b591a00e51e\",\"order_by\":6,\"name\":\"Tailang Yin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Renmin Hospital of Wuhan University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tailang\",\"middleName\":\"\",\"lastName\":\"Yin\",\"suffix\":\"\"},{\"id\":217374856,\"identity\":\"61bce4ff-2ec9-4768-a9ab-cd4e29b534d8\",\"order_by\":7,\"name\":\"Yan Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chinese Academy of Sciences\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":217374857,\"identity\":\"03cf99e3-8976-4c98-9c89-a768f128c0f3\",\"order_by\":8,\"name\":\"Tao Tang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Obstetrics \\u0026 Gynaecology, The Chinese University of Hong Kong\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tao\",\"middleName\":\"\",\"lastName\":\"Tang\",\"suffix\":\"\"},{\"id\":217374858,\"identity\":\"305786d7-4d96-461e-aaaf-0807be53aeaa\",\"order_by\":9,\"name\":\"Yang Qiu\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-5152-1242\",\"institution\":\"Wuhan Institute Of Virology\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yang\",\"middleName\":\"\",\"lastName\":\"Qiu\",\"suffix\":\"\"},{\"id\":217374859,\"identity\":\"7d0aef11-c953-49d3-aa97-ef733d67b295\",\"order_by\":10,\"name\":\"Jiao Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Renmin Hospital, Wuhan University, Wuhan, China\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiao\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-07-01 17:25:41\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3131504/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3131504/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41419-023-06314-w\",\"type\":\"published\",\"date\":\"2023-11-28T05:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":41525052,\"identity\":\"d346ea50-a0eb-46c3-9da3-94c549592476\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:44:11\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":458270,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDifferential expression of pyroptosis-associated markers and macrophage subpopulations in decidual tissues between URSA and Control patients.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e Differences in protein level expression of GSDMD, GSDMD-N, Pro-caspase1 and Mature-caspase1 in decidua tissues between patients with URSA group and Control group. \\u003cstrong\\u003e(B) \\u003c/strong\\u003eFCM analysis shows the content of CD14-labeled macrophages, FVS-labeled live/dead cells, and the content of M1 macrophages labeled by CD86, M2 macrophages labeled in CD209 in viable and dead cells in the decidual tissues in one patient with URSA and one patient with Control respectively: panel \\u003cstrong\\u003ea\\u003c/strong\\u003eshows the percentage of all the macrophages with CD14 (+) in the URSA and Control groups are 5.02% and 1.32%, respectively; panel \\u003cstrong\\u003eb\\u003c/strong\\u003e shows the percentage of CD14 (+) of FVS (-) and FVS (+) in the URSA and Control groups are 53.6% and 42.1%, 28.4% and 38.2%, respectively; panel \\u003cstrong\\u003ec\\u003c/strong\\u003e shows the percentage of macrophages showing the survival status of FVS (-) represented by M1 macrophages of CD86 (+) in the URSA group and Control group are 38.5% and 33.3%, respectively; panel \\u003cstrong\\u003ed\\u003c/strong\\u003e shows the percentage of macrophages showing the survival status of FVS (-) represented by M2 macrophages of CD209 (+) in the URSA and Control groups are 31.2% and 71.5%, respectively; panel \\u003cstrong\\u003ee\\u003c/strong\\u003eshows the percentage of macrophages showing the dead status of FVS (+) represented by M1 macrophages of CD86 (+) in the URSA group and Control group are 45.4% and 30.4%; panel \\u003cstrong\\u003ef\\u003c/strong\\u003e shows the percentage of macrophages showing the dead status of FVS (+) represented by M2 macrophages of CD209 (+) in the URSA group and Control group are 22.5% and 55.2%. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e FCM analysis of differences in total macrophage content in decidua tissues between patients with URSA group and Control group. \\u003cstrong\\u003e(D)\\u003c/strong\\u003e FCM analysis of the proportion of macrophage survival and death in the uterine decidual tissues of patients with URSA group and Control group. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e FCM analysis of the difference in the proportion of M1 and M2 macrophages in the macrophage survival and dead parts of URSA group and Control group. *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ns = non-significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/34c13ba1c58847a0216046ad.jpg\"},{\"id\":41525049,\"identity\":\"493aa280-6693-4d9a-84bc-136c8e89420b\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:44:11\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":408115,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDiffer expression of TRIM38 and MITA in the decidual tissues between patients with URSA group and Control group as determined by immunohistochemistry and immunofluorescence staining. (A)\\u003c/strong\\u003e Immunohistochemistry shows the differences in MITA and TRIM38 expression in the uterine decidual tissue of patients with URSA and Control (brown part). \\u003cstrong\\u003e(B)\\u003c/strong\\u003e Triple immunofluorescence staining shows the distribution and expression differences of M1 macrophages (CD86 marker, red), M2 macrophages (CD206 marker, green) and TRIM38 (pink) in the uterine decidual tissue of patients with URSA and Control. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e Immunofluorescence staining shows the differences in the distribution and expression differences of M1 macrophages (CD86 marker, red), M2 macrophages (CD206 marker, green) and MITA (pink) in the uterine decidual tissue of patients with URSA and Control. \\u003cstrong\\u003e(D)\\u003c/strong\\u003eLocal magnification plot corresponding to panel B. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e Local magnification plot corresponding to panel C.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/5e8b2aec5a10f3c4e16d5fd7.jpg\"},{\"id\":41525906,\"identity\":\"323bcb59-8b5f-4935-94d6-4cf1de77a695\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:52:12\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":256849,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDifferential expression of TRIM38 and MITA in the decidual tissue of patients in the URSA group and Control group\\u003c/strong\\u003e \\u003cstrong\\u003eas determined by western blot and qPCR.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003eDifferences in protein level expression of TRIM38 and MITA in the decidual tissues of URSA group and Control group. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e Differences in mRNA level expression of TRIM38 and MITA in the decidual tissues of URSA group and Control group.\\u003cstrong\\u003e (C) \\u003c/strong\\u003eDifferences in protein level expression of TRIM38 and MITA in macrophages of decidual tissues in patients with URSA group and Control group. \\u003cstrong\\u003e(D)\\u003c/strong\\u003eDifferences in mRNA level expression of TRIM38 and MITA in macrophages of decidual tissues in patients with URSA group and Control group. *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001, ns = non-significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/2613b52fdc9f65134bb3cd73.jpg\"},{\"id\":41525056,\"identity\":\"eb3b2327-5229-48b5-8442-111312eb5e37\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:44:11\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":346943,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDifferent ubiquitination expression of type UB, K48, and K63 occurred in the decidual tissues and macrophages of URSA group and Control group.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e The higher expression of type UB and K48, not K63, occurred in the decidual tissues of Control group compared to URSA group. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e The higher expression of type UB and K48, not K63, occurred in macrophages of decidual tissues in Control group compared to URSA group. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e The higher expression of MITA by ubiquitination of type K48 in decidual tissues in Control group compared to URSA group. \\u003cstrong\\u003e(D)\\u003c/strong\\u003eVerification of the endogenous interaction relationship between TRIM38 and MITA in the decidual tissues of URSA group and Control group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/ff963b4b4ed7fdc903c50f7f.jpg\"},{\"id\":41526359,\"identity\":\"9b3707dc-4c63-4ec8-9efc-a734a2100bd1\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 12:00:11\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":302722,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eDifferential expression of pyroptosis-related proteins in the supernatants and low cells of M1/M2 \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e Differences in protein level expression of TRIM38, MITA, GSDMD, GSDMD-N, Pro-caspase1 and Mature-caspase1 in the supernatants of M1 and M2 macrophages. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e Differences in protein level expression of TRIM38 and MITA in M1 and M2 macrophages. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e Differences in mRNA level expression of TRIM38 and MITA in M1 and M2 macrophages. \\u003cstrong\\u003e(D)\\u003c/strong\\u003eThe higher expression of type UB and K48, not K63, occurred in M1 compared to M2 macrophages. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e The higher expression of MITA by ubiquitination of types UB, K48, not K63, occurred in M1 compared to M2 macrophages. \\u003cstrong\\u003e(F)\\u003c/strong\\u003eThe endogenous interaction relationship between TRIM38 and MITA in M1 and M2 macrophages. *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/af09348dd857c8a84736bc02.jpg\"},{\"id\":41525904,\"identity\":\"1c7faa5e-3aec-4f9a-99e0-6c0826ea407f\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:52:11\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":274422,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExogenous interaction relationship among TRIM38 (Flag tag) and MITA (HA tag) and K48 plasmid (His tag) in 293T cells before and after knockdown of three domains, respectively. (A) \\u003c/strong\\u003eExogenous interaction relationship among TRIM38 (Flag tag) and MITA (HA tag) and K48 plasmid (His tag). \\u003cstrong\\u003e(B) \\u003c/strong\\u003eExogenous interaction relationship among Knockdown of the Ring-Finger structure of TRIM38 (Flag-TRIM38(d-RF))、MITA(HA-MITA)and K48 plasmid（His-K48). \\u003cstrong\\u003e(C) \\u003c/strong\\u003eExogenous interaction relationship among Knockdown of the B-BOX structure of TRIM38 (Flag-TRIM38(d-BB))、MITA(HA-MITA)and K48 plasmid（His-K48). \\u003cstrong\\u003e(D) \\u003c/strong\\u003eExogenous interaction relationship among Knockdown of the SPRY structure of TRIM38 TRIM38(Flag-TRIM38(d-SP))、MITA(HA-MITA)and K48 plasmid（His-K48). \\u003cstrong\\u003e(E)\\u003c/strong\\u003e Expression validation of the type K48 ubiquitinated plasmid (His-K48) in 293T cells（input）.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/4e5e3b4d33fb2a5fd8c18068.jpg\"},{\"id\":41526360,\"identity\":\"9d48aa8d-0803-46d3-9708-a13748c64bce\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 12:00:11\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":541697,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe relationship between pyroptosis and K48.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e Morphology and number of pyroptotic cells in the supernatants of wild M1, M1with DMSO (M1-Vehicle), M1 with VX765(M1-VX765) and wild M2 macrophages Under a 40X microscope. \\u003cstrong\\u003e(B)\\u003c/strong\\u003eDifferences in protein level expression of GSDMD-N, Caspase1 and Caspase1-cleaved in the supernatants of M1, M1with DMSO (M1-Vehicle) , M1 with VX765(M1-VX765) and M2 macrophages. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e Differences in protein level expression of MITA and cGAS in M1, M1 with DMSO (M1-Vehicle) , M1 with VX765(M1-VX765) and M2 macrophages. \\u003cstrong\\u003e(D)\\u003c/strong\\u003e Differential expression of MITA by ubiquitination of type K48 in M1, M1 with DMSO (M1-Vehicle) and M1 with VX765(M1-VX765) macrophages. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e FCM analysis shows the wild M1, M1 with DMSO (M1-Vehicle), M1 with VX765(M1-VX765) of FVS-labeled live cells, and the content of macrophages labeled by CD86 or CD209 in viable cells in the above three kinds of cells respectively: panel \\u003cstrong\\u003ea-c\\u003c/strong\\u003e shows the percentage of FVS (-) in M1, M1-Vehicle and M1-VX765 are 59.5%, 58.9% and 58.2%, respectively; panel \\u003cstrong\\u003ed-f\\u003c/strong\\u003e shows the percentage of macrophages showing the survival status of FVS (-) represented by macrophages of CD86 (+) in M1, M1-Vehicle and M1-VX765 are 49.1%, 48.2% and 42.5%, respectively; panel \\u003cstrong\\u003eg-i\\u003c/strong\\u003e shows the percentage of macrophages showing the survival status of FVS (-) represented by macrophages of CD209 (+) in M1, M1-Vehicle and M1-VX765 are 0.09%, 0.10% and 0.86%, respectively. \\u003cstrong\\u003e(F) \\u003c/strong\\u003eThe phenotypes of CD86 and CD209 in wild M1, M1-Vehicle, M1-VX765 were analyzed by FCM. *\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, ****\\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt; 0.0001, ns = non-significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/dbba89c4dff42fff41ac1df2.jpg\"},{\"id\":41525907,\"identity\":\"383a2926-fcef-46d2-8423-d8146fda41b4\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:52:12\",\"extension\":\"jpg\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":350573,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLentiviral knockdown related genes to verify the association between TRIM38, MITA, ubiquitination and pyroptosis.\\u003c/strong\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e Different ubiquitination expression of type UB, K48, and K63 occurred in M1, shTRIM38-M1, shMITA-M1, shTRIM38+shMITA-M1 and M2, shTRIM38-M2, shMITA-M2, shTRIM38+shMITA-M2. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e Differential expression of MITA by ubiquitination of types UB, K48, and K63 in M1, M2, shTRIM38-M1 and shTRIM38-M2. \\u003cstrong\\u003e(C) \\u003c/strong\\u003eDifferences in protein level expression of TRIM38 and MITA in M1, shTRIM38-M1, shMITA-M1, shTRIM38+shMITA-M1 and M2, shTRIM38-M2, shMITA-M2, shTRIM38+shMITA-M2. \\u003cstrong\\u003e(D)\\u003c/strong\\u003e Differences in protein level expression of GSDMD-N in the supernatants of M1, shTRIM38-M1, shMITA-M1, shTRIM38+shMITA-M1 and M2, shTRIM38-M2, shMITA-M2, shTRIM38+shMITA-M2.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure8.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/ba398903640758c9ac83c555.jpg\"},{\"id\":41525055,\"identity\":\"71b02b16-f776-4d87-b363-e768197051f7\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:44:11\",\"extension\":\"jpg\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":569861,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEffect of Lentiviral knockdown of TRIM38 or MITA on the polarization efficiency of macrophages. (A)\\u003c/strong\\u003eFCM analysis shows the wild M1, shTRIM38-M1, shMITA-M1 of FVS-labeled live cells, and the content of macrophages labeled by CD86 in viable cells in the above three kinds of cells respectively: panel \\u003cstrong\\u003ea-c\\u003c/strong\\u003e shows the percentage of FVS (-) in M1, shTRIM38-M1, shMITA-M1 are 75.0%, 75.7% and 74.7%, respectively; panel \\u003cstrong\\u003ed-f\\u003c/strong\\u003e shows the percentage of macrophages showing the survival status of FVS (-) represented by macrophages of CD86 (+) in M1, shTRIM38-M1, shMITA-M1 are 76.5%, 86.4% and 65.3%, respectively. \\u003cstrong\\u003e(B)\\u003c/strong\\u003e The phenotypes of FVS(-) and survival macrophages with CD86(+) in wild M1, shTRIM38-M1, shMITA-M1 were analyzed by FCM. **\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01, ns = non-significant. \\u003cstrong\\u003e(C) \\u003c/strong\\u003eFCM analysis shows the wild M2, shTRIM38-M2, shMITA-M2 of FVS-labeled live cells, and the content of macrophages labeled by CD209 in viable cells in the above three kinds of cells respectively: panel \\u003cstrong\\u003ea-c\\u003c/strong\\u003eshows the percentage of FVS (-) in M2, shTRIM38-M2, shMITA-M2 are 74.9%, 72.4% and 72.9%, respectively; panel \\u003cstrong\\u003ed-f\\u003c/strong\\u003e shows the percentage of macrophages showing the survival status of FVS (-) represented by macrophages of CD209 (+) in M2, shTRIM38-M2, shMITA-M2 are 50.9%, 32.7% and 76.6%, respectively. \\u003cstrong\\u003e(D)\\u003c/strong\\u003eThe phenotypes of FVS(-) and survival macrophages with CD209(+) in wild M2, shTRIM38-M2, shMITA-M2 were analyzed by FCM. ***\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001, ns = non-significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure9.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/95c18249427e7964e678e5d1.jpg\"},{\"id\":47864288,\"identity\":\"7f791288-615e-4d76-8932-efd4af98778a\",\"added_by\":\"auto\",\"created_at\":\"2023-12-08 15:58:19\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1616378,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/e3b5303c-1879-41c8-92e9-76fdd9a6a2bd.pdf\"},{\"id\":41525073,\"identity\":\"ae4b7444-3e5f-4174-aae6-b9ba48418eb6\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:44:13\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":309828,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FS1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/cd55e299cdca901b60e180c6.jpg\"},{\"id\":41525902,\"identity\":\"a400d778-3a92-4b82-bf5e-c9d87bc4a994\",\"added_by\":\"auto\",\"created_at\":\"2023-08-14 11:52:11\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":398239,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"PatternDiagram.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3131504/v1/04d8eb7f3526cbdd071be7b6.jpg\"}],\"financialInterests\":\"(Not answered)\",\"formattedTitle\":\"Investigation into the role of MITA-TRIM38 interaction in regulating pyroptosis and maintaining immune tolerance at the maternal-fetal interface\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eRecurrent spontaneous abortion (RSA) is defined as two or more consecutive instances of spontaneous abortion in the same individual. Studies show that the incidence of RSA ranges from 1\\u0026ndash;4% in childbearing age women in Europe and the US [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e], with 50% of cases occurring during the first trimester[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The causes of RSA are complex and diverse, including known factors such as chromosomal abnormalities, reproductive structure issues, endocrine disorders, infectious diseases, prethrombotic status, and autoimmune factors. Additionally, a significant number of cases are referred to as unexplained RSA or URSA[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e], where the cause remains unclear.\\u003c/p\\u003e \\u003cp\\u003ePregnancy can be considered as a semi-allogenic transplantation process where the fetus survives, matures and develops without immune rejection, relying on the mother's immune tolerance[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. The maternal-fetal interface, composed of the placenta and decidua, is key in establishing immune tolerance and is the site of disturbance in many cases of poor pregnancy outcomes [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Macrophages, a crucial component in the course of pregnancy, play a significant role in immune regulation, particularly the subsets M1 and M2, whose dysregulation often results in adverse outcomes such as URSA and eclampsia [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Macrophages are also known as major antigen-presenting cells and their activation can stimulate the innate immune response [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e], making them a popular subject of research.\\u003c/p\\u003e \\u003cp\\u003eThe MITA (also called stimulator of interferon genes, STING) is an adaptor protein that plays a crucial role in natural immunity [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. It recognizes both viral and bacterial infections, as well as its own DNA, triggering host defense and immune responses[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. MITA is highly expressed in the heart, spleen, peripheral leukocytes, placenta, and lung, and moderately expressed in the thymus, small intestine, liver, and kidney[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. However, it has no expression in the brain, skeletal muscle, and colon[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. The ubiquitin-proteasome degradation pathway is important for intracellular selective protein degradation and MITA can undergo ubiquitination through this pathway[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. The TRIM family, mostly defined as E3 ubiquitin ligases, play crucial roles in the ubiquitination of MITA[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. In tumor tissues, MITA is highly expressed in tumor-associated macrophages, and its activation can repolarize M2 TAMs into M1 TAMs [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. In cancer cells, MITA expression is suppressed to help cancer cells evade the body's immune surveillance [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. The role of MITA and ubiquitination in the polarization of macrophages at the maternal-fetal interface, which forms an immunity tolerance state similar to tumor tissue [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e], is not well understood.\\u003c/p\\u003e \\u003cp\\u003ePyroptosis is a type of programmed cell death that is mediated by gasdermin D (GSDMD). During pyroptosis, cells experience increased swelling and develop vesicular protrusions [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. The proteins of the cysteine aspartate specific proteinase (Caspase) family, which are mainly activated by inflammasomes, cleave and activate GSDMD proteins[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. pro-caspase-1(p20) is a key protein in pyroptosis and is a cleavage product of mature caspase-1(p45) [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. It cleaves GSDMD into GSDMD-N, which forms pores in the cell membrane and causes cell death from the inside[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. However, the released GSDMD-N does not damage neighboring mammalian cells during pyroptosis due to its preference for lipid binding[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eThe activation of MITA can initiate pyroptosis and induce an immune response in macrophages [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Previous research has shown that there is a higher rate of cell pyroptosis in the decidual tissue of patients with recurrent abortion compared to normal pregnant patients [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. However, there is no information available on the relationship between the ubiquitination process and cell pyroptosis in the macrophages at the maternal-fetal interface. In this study, we demonstrate that MITA can be degraded by type K48 ubiquitination, which is mediated by TRIM38 in M2 macrophages. The decreased expression of MITA leads to a decrease in pyroptosis, revealing a potential association between ubiquitination and pyroptosis. This may be why the low expression of MITA results in maternal-fetal immune tolerance and helps to sustain pregnancy.\\u003c/p\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eDifferential expression of pyroptosis-associated markers and macrophage subpopulations in decidual tissues between URSA and Control patients\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eDecidual tissues were obtained from four patients with unexplained recurrent spontaneous abortion (URSA) and four control patients who had a normal pregnancy but underwent induced abortion. Western blot analysis results demonstrated significantly higher expression of gasdermin-D (GSDMD), gasdermin-D-N (GSDMD-N), pro-caspase-1, and mature caspase-1 in the URSA group compared to the control group (as depicted in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). Flow cytometry was then employed to assess various parameters in decidual tissues from both groups, including the overall proportion of macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-a), the proportion of surviving and dead macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-b), the proportion of surviving M1 and M2 macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-c and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-d), and the proportion of dead M1 and M2 macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-e and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-f). Further analysis revealed a significantly higher total number of macrophages in the URSA group compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). However, the ratio of surviving to dead macrophages did not exhibit a significant difference between the two groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). Interestingly, the ratio of M1 to M2 macrophages was significantly higher in the URSA group compared to the control group, observed in both surviving and dead macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). These findings suggest that the differential expression of pyroptosis-associated markers between URSA patients and control patients might be associated with alterations in the populations of M1 and M2 macrophages.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eDifferential expression of TRIM38 and MITA in the decidual tissue of patients in the URSA group and Control group\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe expression of TRIM38 and MITA proteins in decidual tissues was evaluated using IHC. No difference in TRIM38 expression between the URSA and control groups was oberved (as seen in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). However, MITA expression in decidual tissues was higher in URSA group compared to control group (as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Triple IF analysis revealed that TRIM38 and MITA were specifically expressed in M1 macrophages (labeled with CD86, shown as red fluorescence) in the URSA group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF). In the control group, TRIM38 and MITA were mainly expressed in M2 macrophages (labeled with CD209, shown as green fluorescence) and MITA expression was significantly lower in M2 compared to M1 in the URSA group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eExpression of MITA protein in decidual tissues was higher in the URSA group compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). In contrast, there was no significant difference in TRIM38 protein expression between the two groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). However, qRT-PCR results revealed that both TRIM38 and MITA mRNA expression in decidual tissues were decreased in the URSA group compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). These results were also supported by the macrophages obtained from decidual tissues (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eDifferential ubiquitination of TRIM38 and MITA in decidual tissues and macrophages\\u003c/p\\u003e \\u003cp\\u003eAdditionally, we compared the levels of ubiquitination in decidual tissues and macrophages between the URSA and control groups. UB and K48 levels in decidual tissues and macrophages from the URSA group were significantly lower than those in the control group, while there was no significant difference in the level of K63 between the two groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). Furthermore, the level of K48 of MTIA was significantly lower in the URSA group compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Co-IP results indicated that there were endogenous interactions between TRIM38 and MITA in decidual tissues from both groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDifferential expression of pyroptosis-related proteins in the supernatants of M1 and M2 macrophages\\u003c/h2\\u003e \\u003cp\\u003eTo validate our hypothesis, we created in vitro cell models using polarized M1 and M2 macrophages from THP-1. Western blot was used to analyze protein expression of GSDMD, GSDMD-N, pro-caspase-1, and mature caspase-1 in the macrophage supernatants. GSDMD expression was lower, while expression of GSDMD-N, pro-caspase-1, and mature caspase-1 was higher in the M1 supernatant compared to M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). TRIM38 expression was also higher in the M1 supernatant while MITA expression was not significantly different between the two (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). MITA expression was upregulated in M1 macrophages compared to M2, but TRIM38 expression was not different (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). However, qRT-PCR revealed lower TRIM38 and MITA mRNA expression in M1 macrophages compared to M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). The above results indicated that post-translational modifications might exist between TRIM38 and MITA.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDifferential expression and ubiquitination of TRIM38 and MITA in M1/M2 macrophages\\u003c/h2\\u003e \\u003cp\\u003eThe Co-IP results showed that there were endogenous interactions between TRIM38 and MITA in both M1 and M2 macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF). Furthermore, we found that the higher expression of type UB and K48, not K63 was detected in M2 macrophages when compared to M1 macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD); the higher expression of ubiquitination of types UB and K48, but not K63 also occurred in MITA in M1 macrophages when compared to M2 macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE). Thus, based on the above results, we hypothesize that ubiquitination modification of MITA may be related to pyroptosis in macrophages.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTRIM38 containing the complete domains of Ring-Finger, B-BOX, and SPRY can interact not only with MITA but also with K48-type ubiquitinated particles\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eAs a member of the TRIM protein family, TRIM38 contains three functional domains: Ring-Finger, B-BOX, and SPRY. To investigate the interplay among these three functional domains, MITA, and K48 ubiquitination, Flag-TRIM38, Flag-TRIM38 (d-RF), Flag-TRIM38 (d-BB), and Flag-TRIM38 (d-SP) were co-transfected with HA-MITA and His-K48 in 293T. It was observed that knocking down any of the three domains showed no interaction with HA-MITA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA-D). However, only TRIM38 with the complete domains of Ring-Finger, B-BOX, and SPRY was able to interact with His-K48 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). If any of the three domains were knocked out, Flag-TRIM38 was unable to interact with HA-MITA and His-K48 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB-D). Furthermore, there was no direct interaction between HA-MITA and His-K48 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA-D).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eInhibition of pyroptosis reduced MITA expression through enhanced K48 ubiquitination and promoted the conversion of M1 to M2\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo investigate the relationship between ubiquitination and pyroptosis, Belnacasan (VX765), a caspase-1 inhibitor, was added during polarization. The number of pyroptotic cells in the M1\\u0026thinsp;+\\u0026thinsp;VX765 group was lower compared to the M1\\u0026thinsp;+\\u0026thinsp;DMSO group, yet still higher than in the M2 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA). This suggests that pyroptosis in M1 macrophages is dependent on caspase-1. Expression of GSDMD-N and mature caspase-1 in the M1\\u0026thinsp;+\\u0026thinsp;VX765 group was lower than in the M1 group, while the expression of pro-caspase-1 was not significantly different (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eB). This indicates that VX765 reduces the conversion of pro-caspase-1 to mature caspase-1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eWe analyzed the protein expression levels of cGAS and MITA in macrophages and found that cGAS and MITA were significantly lower in M2 macrophages compared to M1 macrophages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC). The expression of cGAS in the M1\\u0026thinsp;+\\u0026thinsp;VX765 group was not significantly different from that in the M1 group, but the expression of MITA in the M1\\u0026thinsp;+\\u0026thinsp;VX765 group was significantly lower (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC). This suggests that VX765 can directly inhibit MITA expression without affecting cGAS, the upstream target of MITA. Furthermore, the level of K48 of MITA was significantly higher in the M1\\u0026thinsp;+\\u0026thinsp;VX765 group than in the M1 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eD). Flow cytometry analysis showed that the number of CD86\\u003csup\\u003e+\\u003c/sup\\u003e macrophages in the M1\\u0026thinsp;+\\u0026thinsp;VX765 group decreased, while the number of CD209\\u003csup\\u003e+\\u003c/sup\\u003e macrophages increased compared to the M1 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eE-F). These findings indicate that inhibiting pyroptosis reduces MITA expression through enhanced K48 ubiquitination and promotes the conversion of M1 to M2.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEffects of TRIM38 and MITA knockdown on the pyroptosis and polarization efficiency of macrophages\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the impact of the K48 relationship between TRIM38, MITA, and pyroptosis, we created TRIM38- and MITA-knockdown THP-1 cells (Supplemental Fig. S1). When TRIM38 was knocked down, the level of K48 was significantly higher in shTRIM38-M1 compared to M1, but significantly lower in shTRIM38-M2 compared to M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). Conversely, the levels of K48 in shMITA-M1 and shMITA-M2 showed no significant difference when compared to M1 and M2, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). Additionally, when TRIM38 and MITA were both knocked down, the level of K48 in shTRIM38\\u0026thinsp;+\\u0026thinsp;shMITA-M1 was higher than in M1, but significantly lower in shTRIM38\\u0026thinsp;+\\u0026thinsp;shMITA-M2 compared to M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). This suggests that TRIM38 suppresses K48 expression in M1, but enhances it in M2. Our findings also showed that the levels of K48 of MITA in shTRIM38-M1 were not significantly different from those in M1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eB), which could explain the increased expression of MITA in shTRIM38-M1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eC). Conversely, the levels of K48 of MITA in shTRIM38-M2 were significantly reduced compared to those in M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eB), resulting in the increased expression of MITA in shTRIM38-M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eC). These results indicated that TRIM38 directly regulated the K48 of MITA in M2, but not in M1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eAdditionally, the levels of GSDMD-N in the shTRIM38-M1 supernatant were significantly higher compared to those in M1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eD). This is in close correlation with the increased expression of MITA in shTRIM38-M1. However, the levels of GSDMD-N in the shMITA-M1 supernatant were significantly lower compared to those in M1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eD). On the other hand, the levels of GSDMD-N in the shTRIM38\\u0026thinsp;+\\u0026thinsp;shMITA-M1 supernatant were also significantly lower compared to those in M1, but higher than those in shMITA-M1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eD). Since GSDMD-N in M2 supernatant was rarely expressed, almost no GSDMD-N could be detected in the supernatants of shTRIM38-M2, shMITA-M2, and shTRIM38\\u0026thinsp;+\\u0026thinsp;shMITA-M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eD). These results indicated that MITA could activate pyroptosis, while inhibition of MITA expression could reduce the pyroptosis of M1.\\u003c/p\\u003e \\u003cp\\u003eWhen TRIM38 or MITA were individually knocked down, the polarization efficiency of shTRIM38-M1 was significantly higher than that of M1, whereas the polarization efficiency of shMITA-M1 was significantly lower than that of M1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA-B). Conversely, the polarization efficiency of shTRIM38-M2 was significantly lower than that of M2, while the polarization efficiency of shMITA-M2 was significantly higher than that of M2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eC-D).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eIn this study, we found that the expression of MITA and pyroptosis-related proteins was significantly higher in the URSA group than in the Control group, both in decidual tissues and macrophages. The Control group also had a significantly higher K48-type ubiquitination, mediated by TRIM38, which may contribute to the lower expression of MITA. Using in vitro cell models, we investigated the relationship between K48 of MITA and pyroptosis-related proteins and revealed that K48 may play a role in maintaining normal pregnancy by reducing MITA expression.\\u003c/p\\u003e \\u003cp\\u003eThe current focus of URSA research is on immune cells at the maternal-fetal interface, including natural killer (NK) cells, macrophages, and T-lymphocytes. Macrophages are the predominant endometrial leukocytes and can be polarized into two types: classically activated (M1) and selectively activated (M2)[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Single-cell sequencing studies have shown that macrophages are the immune cell population that changes the most with pregnancy status[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Imbalance in the M1/M2 ratio in decidual tissue has been identified as a factor in URSA. In URSA patients, M1 play a dominant role in inflammation, while M2 help regulate immune response in normal pregnancy [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. The immune environment at the maternal-fetal interface is dynamic and regulatory, and decidual macrophages help maintain this environment by removing dead trophoblasts [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. However, the specific mechanisms and factors affecting macrophage polarization remain unclear.\\u003c/p\\u003e \\u003cp\\u003eMITA is a crucial adaptor protein in the innate immune system and plays a role in various diseases [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Low expression of MITA in tumor tissues has been linked to an immunosuppressed state that helps avoid the body's immune response [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. The maternal decidua, with similarities to the formation of cancer cell metastases, has also been studied[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. TRIM38, a small molecule protein in the TRIM protein family, has three functional domains (Ring-Finger, B-Box, and SPRY) and is classified as an E3 ubiquitin ligase due to its Ring-Finger structure. It mediates various types of ubiquitination [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. In this study, we found that the expression of MITA was significantly lower in normal pregnancy and M2 macrophages compared to URSA and M1 macrophages. We also discovered the direct interaction between TRIM38 and MITA, and the possibility of post-translational modification, such as K48-type ubiquitination, based on the different expression trends at the mRNA and protein levels. Ubiquitination, as an important post-translational modification[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e], can manifest either as K48 that degrades the target protein or K63 that causes structural changes in the target protein[\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. We found that K48 was higher in M2 than M1, and that MITA ubiquitination by K48 was also higher in M2 compared to M1. Our \\u003cem\\u003ein vitro\\u003c/em\\u003e experiments showed that knocking down TRIM38 suppressed the intracellular ubiquitination level of M1 macrophages and promoted it in M2 macrophages. Furthermore, our findings indicate that downregulation of TRIM38 expression can enhance the polarization efficiency of M1 macrophages but suppress the polarization efficiency of M2 macrophages. Conversely, reduction in MITA expression inhibits M1 polarization while promoting the polarization efficiency of M2 macrophages. This might explain why MITA has a low expression in M2 and suggests that MITA and TRIM38 do not significantly interact through ubiquitination in M1.Not only that, given the different functional status exhibited by TRIM38-MITA in M1 and M2, we speculated that TRIM38 may be structural differences between M1 and M2. However, by the validation in 293T cells, we found that on matter which one of the above three domains was absent, TRIM38 could not mediate K48. The molecular weight of TRIM38 we detected either in vivo or in vitro were not consistent with the above defective TRIM38, from which we inferred that the different effects of TRIM38-MITA in M1 and M2 were not caused by the defective TRIM38.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we investigated whether pyroptosis mediated by MITA was involved in the ubiquitination process described above. This was prompted by the different interaction functions displayed by MITA and TRIM38 in M1 and M2, as well as the fact that several members of the TRIM protein family can positively or negatively regulate cell pyroptosis [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Our findings showed that M1 underwent classical, caspase1-dependent cell pyroptosis. Although previous studies have suggested that cell self-death can activate the cGAS-MITA pathway, leading to increased MITA production and a strong immune response [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e], and the activation of GSDMD-N could inhibit the cGAS-MITA pathway by promoting K\\u0026thinsp;+\\u0026thinsp;efflux and reducing cGAS expression, ultimately leading to decreased MITA expression [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. In this study, we found that the knockdown of MITA inhibited the production of GSDMD-N in M1, while the knockdown of TRIM38 increased the expression of GSDMD-N. This suggests that MITA promotes while TRIM38 suppresses pyroptosis in M1, confirming that TRIM38 and MITA play different roles in M1 and M2, and that this difference is closely related to their different cellular pyroptosis states. Interestingly, when we introduced the VX765, an inhibitor of caspase1, we found that both the levels of GSDMD-N in the supernatant and MITA expression in the cells were significantly decreased, regardless of cGAS expression. This suggests that blocking pyroptosis could directly downregulate MITA expression and cause the transformation of M1 to M2, leading to an increase in the ubiquitinated degradation of MITA's K48. This also implies that MITA positively regulates pyroptosis in M1, the different pyroptosis states in M1 and M2 are likely the main reasons for the different interaction functions of MITA and TRIM38.\\u003c/p\\u003e \\u003cp\\u003eThe validation of the tissue samples further confirmed the differential expression of MITA in decidual tissues in URSA and normal pregnancy, which was closely correlated with the proportion of M1 and M2. While it has been reported that dead cells can release intracellular mitochondria and activate MITA-related pathways, leading to increased expression of MITA[\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e], our study found no clear differences in the proportion of surviving and dead macrophages between the two groups via FCM. IHC and Triple IF also indicated that higher MITA expression in decidual tissues in the URSA group compared to the control group was strongly associated with viable M1 and M2, not dead macrophages. Additionally, we observed much higher K48-type ubiquitination in normal pregnancy decidual tissue and macrophages than in URSA in vivo, which was highly consistent with our cell models in vitro and with the M1/M2 ratio demonstrated by FCM, IHC, and Triple IF.\\u003c/p\\u003e\"},{\"header\":\"CONCLUSIONS\",\"content\":\"\\u003cp\\u003eIn this study, we found that low expression of MITA in M2 macrophages helps to avoid triggering an excessive immune response and maintain stability in the immune tolerance microenvironment at the maternal-fetal interface, enabling the pregnancy to continue. In contrast, no effect of K48 on MITA was observed in M1 macrophages. Clear cell pyroptosis was observed in M1 macrophages, and when cell pyroptosis was inhibited, M1 macrophages not only exhibited K48 of MITA but also showed a clear trend towards transforming into M2 macrophages. This suggests that cell pyroptosis may have an inhibitory effect on K48 of MITA and impact the transformation between M1 and M2 macrophages.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthical statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe studies involving human participants were reviewed and approved by the Medical Ethics Committee of the Wuhan Children\\u0026rsquo;s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science \\u0026amp;Technology. The patients/participants provided their written informed consent to participate in this study (No. 2020E042-E02).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCollection of clinical samples\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePatients aged 20-35, menopause for 40-60 days, HCG (+) and early uterine ultrasound found the original pericardial beats of the pregnant sac, but the disappearance of the later stage, were diagnosed as missed abortion, who had a history of one or more unexplained abortion in the past. Four cases of uterine decidual tissue without gene chromosomal abnormalities were taken as the URSA group, and four patients of uterine decidual tissue from early normal pregnancy (indicating the gestational sac and original cardidial beats) requiring artificial abortion to terminate pregnancy were collected as the Control group. The clinical characteristics of the included participants were shown in Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIsolation of macrophages from tissues samples\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMacrophages were isolated from decidual tissue using the conventional adherent method. Tissue samples (weighing about 5-8 g) from each patient were washed twice with sterile phosphate-buffered saline (PBS, Gibco) to remove visible blood clots. The tissue was sheared beforehand and added to a 10 cm sterile cell culture dish along with 2 ml of pancreatic enzyme analog (ATV, TrypLE\\u0026trade;Express) at 37\\u0026deg;C for 15 mins in a thermostatic cell incubator. Then, 50ml sterile centrifuge tubes were prepared, each corresponding to a patient\\u0026apos;s tissue sample and marked separately. A 70\\u0026nbsp;\\u0026mu;m cell filter (Biosharp, Labgic, Beijing, China) was placed at the mouth of each tube. The ATV-digested decidual tissue was removed from the cell incubator, placed on the corresponding filter screen, and ground with 5 ml of sterile syringe and PBS. The cell suspension was collected in the centrifuge tube under the filter screen. After collection, a volume of 40 ml of PBS was added, thoroughly mixed, and then centrifuged at room temperature for 5 minutes at a speed of 1500 rpm. The resulting supernatant was discarded, and another 40 ml of PBS was added, mixed thoroughly, and centrifuged again at 1500 rpm for 5 minutes at room temperature. Once again, the supernatant was discarded, and this time 15 ml of PBS was added. Human red blood cell lysates, previously diluted to 1\\u0026times;\\u0026nbsp;with sterilized dd H2O, were added to the prepared cell suspension at a 1:1 ratio, thoroughly mixed at room temperature, and then placed in a black light protection box for 15 minutes. Following this, the cell suspension was removed, centrifuged at 1500 rpm for 5 minutes at room temperature, and the supernatant was discarded. Subsequently, 40 ml of PBS was added, thoroughly mixed, and centrifuged at 1500 rpm for 5 minutes at room temperature. Once again, the supernatant was discarded. Based on the amount of cell precipitation in the lower layer, the cells were resuspended in 8-10 ml of complete medium prepared with Gibco RPMI1640 medium + 10% Gibco fetal calf serum (FBS) + 1% double-antibody (penicillin + streptomycin, PS) + 1% 4-2-hydroxyethyl-1-ethylonic acid (HEPES). The cell count was measured, and 2 ml of the cell suspension was spread into a six-well plate for each patient sample. After a period of 6 hours, the RPMI 1640 complete medium was replaced, and the condition of cell adhesion was observed using a microscope. The cells were replaced every 1-2 days thereafter and collected after 5-7 days. The entire process of sample collection was completed in the biosafety cabinet. After discarding the upper cell medium, 2 ml of PBS was added to each well, and the attached macrophages were rinsed by gently shaking the plate. Next, 300 \\u0026micro;l ATV was added, and the surface was sprayed with 75% alcohol sterilized and digested in a 37\\u0026deg;C constant static cell incubator for 15 min. After the adherent cells became suspended under the 40x light microscope, digestion was terminated by adding sterile PBS (1 ml) to each well, and the cell suspension was transferred to a new sterile EP tube. Because there were fewer cells in each patient under the light microscope, cell samples from 4 patients in the URSA group and 4 patients in the Control group were combined.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCell culture and polarization, VX765 treatment\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe THP-1 cell line was a gift from Professor Xi Zhou (LRV-Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China). The THP-1 cells were cultured in RPMI 1640 medium (Gibco, Thermo Fisher, USA) supplemented with 10% fetal bovine serum (Gibco, Thermo Fisher, USA), 1% penicillin, 1% streptomycin and 1% 4- (2-hydroxyethyl) -1-piperazine ethylene sulfonic acid (Gibco, Thermo Fisher Scientific, USA) in an incubator containing 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e at 37 \\u003csup\\u003eo\\u003c/sup\\u003eC. The cell polarization was induced by incubating THP-1 cells (10\\u003csup\\u003e6\\u003c/sup\\u003e/ml) with phorbol 12-myristate 13-acetate (PMA) at a final concentration of 100 ng/ml (#P1585, Sigma, USA) for a 24-h period. This caused the THP-1 cells to differentiate into M0 macrophages. To further polarize the M0 macrophages, interferon-\\u0026gamma;\\u0026nbsp;(IFN-\\u0026gamma;) at a concentration of 20 ng/ml (#285-IF, R\\u0026amp;D Systems, USA) and lipopolysaccharide (LPS) at 10 pg/ml (#L2630, Sigma, USA), Interleukin4 (IL-4) at 20 ng/ml (#204-IL, R\\u0026amp;D Systems, USA) and interleukin13 (IL-13) at 20 ng/ml (#213-ILB, R\\u0026amp;D Systems, USA), were added to the complete medium for 48 hours, resulting in the polarization of M0 into M1 and M2 macrophages respectively.\\u003c/p\\u003e\\n\\u003cp\\u003eIn addition, during the polarization of M1 macrophages, the caspase1 inhibitor VX765(#HY13205, MCE, working concentration: 25 \\u0026micro;M) and equal amounts of dimethyl sulfoxide (DMSO, the solvent of VX765, 2.5 \\u0026micro;l/10ml) were added, together with IFN-\\u0026gamma;\\u0026nbsp;and LPS.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eKnockdown of TRIM38 and MITA in THP-1 cells\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eLentiviral particles were used to knock down the TRIM38 and MITA genes in THP-1 cells. The particles targeting TRIM38 were obtained from Santa (#sc-95352-V, USA) and had a pool-sequence of GATCCGTACAGATTCAGAGACAAATTCAAGAGATTTGTCTCTGAATCTGTACTTTTT+GATCCGTAGACTGAGGGACTATGATTCAAGAGATC ATAGTCCCTCAGTCTACTTTT+GATCCCTGTCTCCTTGGAACTTCATTCAAGAGATGAAGTTCCAAGGAGACAGTTTTT, with a titer of 106 TU/ml. The particles targeting MITA were obtained from GenePharma (#D01001, China) and had a sequence of GCTGTCCATCTATTTCTACTA, with a titer of 108 TU/ml. The vector used for the MITA particles contained GFP green fluorescence. Blank lentiviral particles were obtained from GenePharma (#D03JZ, China). Transduction was carried out with a multiplicity of infection (MOI) of 1:100, as per the manufacturer\\u0026apos;s instructions. Knockdown efficiency was confirmed through qRT-PCR and western blot analysis. THP-1 cells were polarized into M1 and M2 macrophages after knockdown of TRIM38 or MITA, and labeled as shTRIM38-M1, shTRIM38-M2, shMITA-M1, and shMITA-M2, respectively. When both TRIM38 and MITA were knocked down, THP-1 cells were polarized into M1 and M2 macrophages and labeled as shTRIM38+shMITA-M1 and shTRIM38+shMITA-M2, respectively.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTransfection of 293T cell\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe 293T cell line was provided as a gift from Professor Xi Zhou of LRV-Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China. The 293T cells were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, USA) and maintained in an incubator at 37\\u0026deg;C with 5% CO2. The following plasmids were established by Miaolingbio, China: Flag-tagged TRIM38 plasmid (Flag-TRIM38), Flag-tagged TRIM38 plasmid without the Ring-Finger domain (Flag-TRIM38 (d-RF)), Flag-tagged TRIM38 plasmid without the B-BOX domain (Flag-TRIM38 (d-BB)), Flag-tagged TRIM38 plasmid without the SPRY domain (Flag-TRIM38 (d-SP)), HA-tagged MITA plasmid (HA-MITA), and His-tagged K48 ubiquitination plasmid (His-K48). Flag-TRIM38, Flag-TRIM38 (d-RF), Flag-TRIM38 (d-BB), and Flag-TRIM38 (d-SP) were co-transfected with 8\\u0026nbsp;\\u0026mu;g of HA-MITA and His-K48 plasmids using Opti-MEM (Gibco, Thermo Fisher Scientific, USA) and PEI MAX (SenGene, Shanghai, China), following the manufacturer\\u0026rsquo;s instructions. After 6-8 hours of transfection, the medium was replaced with fresh DMEM medium, and the cells were harvested after incubating for 24 hours.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFlow cytometry and cell sorting\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e1 mL of each tissue sample suspension was treated with red cell lysate and resuspended in 40 mL of PBS. Subsequently, the samples underwent centrifugation at a speed of 1500 rpm for a duration of 5 minutes. Following the removal of the supernatant, each tube was supplemented with 0.3-0.5% BSA (#V900933, Merck, USA) in PBS, which had been pre-cooled to 4\\u0026deg;C, in order to resuspend the cells. The cell suspension was then subjected to centrifugation at 500 g and 4\\u0026deg;C for 5 minutes, and this process was repeated once more after discarding the supernatant. The cells were resuspended in PBS to 200 \\u0026micro;L, and the cell density was adjusted to 10^6/mL by cell counting. The cell suspension was then passed through a 40 \\u0026micro;m cell filter (Biosharp, Labgic, Beijing, China) into a new 1.5 mL EP tube. The filtered cell suspensions were divided into negative control (20 \\u0026micro;L), CD14 (20 \\u0026micro;L), FVS780 (20 \\u0026micro;L), CD86 (20 \\u0026micro;L), CD209 (20 \\u0026micro;L), and sample tubes (100 \\u0026micro;L). The negative control tube directly had PBS added to the resuspension to 300 \\u0026micro;L, and the other tubes were filled with the recommended staining ratio (5 \\u0026micro;L/100 \\u0026micro;L cell suspension). FVS780 (20 \\u0026micro;L) with 0.1 \\u0026micro;L (1 \\u0026micro;L/1000 \\u0026micro;L cell suspension), 5 \\u0026micro;L of flow antibodies CD14 (#12-0149-42; PE channel, BD Biosciences, USA)/CD86 (#305412; APC channel, Biolegend, USA)/CD209 (#330104; FITC channel, Biolegend, USA) and 0.1 \\u0026micro;L of FVS780 (#565388; APC-CY7 channel, BD Biosciences, USA) were added to the sample tubes (100 \\u0026micro;L) respectively. The cell suspension in the above EP tubes was fully mixed and then placed in a fully sealed black light avoidance box for staining at room temperature for 30 minutes. After staining, 0.3-0.5% BSA in PBS, pre-cooled at 4\\u0026deg;C, was added to each tube to resuspend the cells. The cell suspension was centrifuged at 500 g and 4\\u0026deg;C for 5 minutes, and the operation was repeated once after discarding the supernatant. The cell suspension of the above EP tubes was resuspended with PBS to 300 \\u0026micro;L, placed on ice together with the negative control to protect from light, and then analyzed by flow cytometry with a FACSAriaTM III (BD Biosciences). Data analysis was performed using FlowJoV10.8.0 software.\\u003c/p\\u003e\\n\\u003cp\\u003eTHP-1 cells and THP-1 cells with TRIM38 and MITA knockdown were seeded in T75 flasks at a density of 2.5\\u0026nbsp;\\u0026times;\\u0026nbsp;106 cells per flask and differentiated with PMA. After incubation with either IFN-\\u0026gamma;\\u0026nbsp;and LPS or IL-4 and IL-13, respectively, the cells were washed with cold PBS. The macrophages derived from M1 polarization were stained with flow antibodies of FVS780 and CD86, while M2 was stained with FVS780 and CD209, following the same flow steps as for the tissue. Since the lentiviral particles vector for knocking down the MITA gene contained GFP green fluorescence, CD209 (#330108; APC channel, Biolegend) was used in M2 with MITA knockdown. In other M2 macrophages, CD209 (#330104; FITC channel, Biolegend, USA) was still used. The cells were analyzed by flow cytometry with a FACSAriaTM III (BD Biosciences), and data analysis was performed using FlowJoV10.8.0 software. M1 with FVS780(-) and CD86(+), and M2 with FVS780(-) and CD209(+) were collected in sterile 15ml centrifuge tubes containing RPMI 1640 medium for subsequent experiments.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eReal-time Quantitative PCR (qPCR)\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ethe isolation of total RNA from tissues was carried out using Trizol reagent (Takara, Japan), while cells were isolated using a kit from Sangon Biotech (Shanghai, China). The RNA was then reverse-transcribed using the high-capacity cDNA reverse transcriptase kit (TaKaRa, Japan) according to the manufacturer\\u0026apos;s instructions. qPCR assays were conducted using SYBR Green PCR Master Mix (TaKaRa, Japan) and the Fast qPCR System (QuantStudio5, Thermo Fisher, USA). Gene-specific primers were designed and obtained from Ruibo Biology Co., Ltd (Shanghai, China). The primer sequences can be found in Table 2. To normalize gene expression levels, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as the internal control. Three biological replicates were utilized for each sample. The 2\\u003csup\\u003e\\u0026minus;\\u0026Delta;\\u0026Delta;\\u003c/sup\\u003e\\u003csup\\u003eCt\\u003c/sup\\u003e method was employed to calculate and normalize the gene expression levels relative to the internal controls.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExtraction of supernatants and cell components\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe cell supernatants were collected in sterile EP tubes. Trichloroacetic acid (TCA, Sinopharm Chemical Reagent Co., Ltd) was added at a ratio of 1:10 and mixed well. The mixture was placed in a 4 \\u003csup\\u003eo\\u003c/sup\\u003eC refrigerator overnight and then transferred to a 4 \\u003csup\\u003eo\\u003c/sup\\u003eC low-temperature centrifuge at 12000 g for 10 mins. The upper liquid was discarded and the protein precipitate at the bottom of the tube was gently washed with 1 ml of sterilized PBS. The PBS was then taken away, and 60-100 \\u0026micro;l of western \\u0026amp; IP lysate was added to dissolve the precipitation, depending on the amount of precipitation. Next, 5X loading buffer was added and the sample was cooked in a 95 \\u003csup\\u003eo\\u003c/sup\\u003eC water bath for 10 mins.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eWestern blotting\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCell lysis was performed using Western \\u0026amp; IP lysates (Beyotime, Shanghai, China) for cells and RIPA lysate (GBCBIO Technologies, Guangzhou, China) for tissues. The protease inhibitor cocktail (Solarbio, Beijing, China) was added at a ratio of 1:100. Following lysis, the cells or tissues were transferred into tubes designed for cell or tissue crushing. Subsequently, they were centrifuged at 12,000 g for 15 minutes at a temperature of 4\\u0026deg;C. The resulting supernatants were extracted separately and mixed with 5X loading buffer. To facilitate protein denaturation, the samples were boiled at 95\\u0026deg;C for 10 minutes. Afterward, the collected samples were subjected to electrophoresis on a 10% SDS-PAGE gel at a voltage of 80 V for 2 hours. Following electrophoresis, the proteins were transferred to a membrane using a current of 350 mA for 2 hours. To prevent non-specific binding, the membrane was blocked with 5% skim milk for 1 hour and subsequently incubated overnight at 4\\u0026deg;C with the appropriate primary antibodies. The western blot bands derived from cells or tissues were visualized using an enhanced chemiluminescence (ECL, MILLIPORE, USA) developer and a chemiluminescence imaging system (Shanghai Qinxiang Scientific Instrument Co., Ltd.).\\u003c/p\\u003e\\n\\u003cp\\u003eThe primary antibodies used in this study are listed below: rabbit monoclonal [EPR13130-55] to MITA (#239074, Abcam, USA), mouse monoclonal anti-human TRIM38 (#MA5-26235, Invitrogen), rabbit monoclonal [EPR19672] to Caspase-1 (#207802, Abcam, USA), rabbit monoclonal [EPR20829-408] to cleaved N-terminal GSDMD (#215203, Abcam, USA), rabbit monoclonal [EPR19829] to GSDMD (#210070, Abcam, USA), and rabbit monoclonal [EPR26492-84] to cGAS (#302617, Abcam, USA). Rabbit anti-GAPDH (#181602, Abcam, USA) was used as the internal control. IgG (HRP) goat anti-rabbit antibody (#6721, Abcam, USA) and IgG (HRP) goat anti-mouse antibody (#6789, Abcam, USA) were used as the secondary antibodies.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCo-Immunoprecipitation (Co-IP)\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eEndogenous Co-IP was performed on decidual tissues, M1 and M2 macrophages using Western \\u0026amp; IP lysates (Beyotime, Shanghai, China).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo perform immunoprecipitation, monoclonal antibodies against MITA (#239074, Abcam, USA) were utilized to immunoprecipitate tissue and cell lysates. In the case of exogenous co-immunoprecipitation (Co-IP), 293T cells were collected 24 hours after transfection and subsequently lysed using a buffer containing 25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA, and a proteinase inhibitor cocktail (Solarbio, Beijing, China). Whole cell lysates were subjected to immunoprecipitation using monoclonal antibodies against Flag (#2368, CST, USA), HA (#236632, Abcam, USA), or His (#12698, CST, USA) in the presence of magnetic beads (MCE, USA). For both endogenous and exogenous Co-IP, Normal Rabbit IgG (#2729, CST, USA) was employed as a negative control. To minimize non-specific interference, all lysates were incubated with 10 \\u0026micro;l magnetic beads (MCE, USA) on a rotating shaker at 4\\u0026deg;C for 2 hours. Generally, 1-2\\u0026nbsp;\\u0026mu;g of commercial antibody was added to 500\\u0026nbsp;\\u0026mu;l of tissue or cell lysates, and the mixture was incubated overnight at 4\\u0026deg;C. The immunocomplexes captured on the affinity gel or magnetic beads were thoroughly washed with lysis buffer and subsequently eluted with SDS loading buffer through boiling for 5 minutes. Subsequently, the samples were subjected to SDS-PAGE and analyzed by Western blotting.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eImmunohistochemistry staining of TRIM38 and MITA in decidual tissues\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe collected decidual tissues underwent fixation in 4% paraformaldehyde and subsequent embedding in paraffin. Microtome (HM355; Microm) was used to cut sections (4\\u0026nbsp;\\u0026mu;m), which were then deparaffinized through a series of incubations: 10 minutes in Xylene, followed by 100%, 96%, and 70% ethanol, and deionized water. Antigen retrieval was performed using citrate buffer (pH 6.0), and to remove endogenous peroxidase, the sections were incubated with 3% hydrogen peroxide for 30 minutes. For staining, the sections were blocked with 3% bovine serum albumin at room temperature for 30 minutes and then incubated overnight at 4\\u0026deg;C with the following primary antihuman antibodies: rabbit monoclonal [EPR13130-55] to MITA (#239074, Abcam, Dilution 1:4000) and mouse monoclonal anti-human TRIM38 (#MA5-26235, Invitrogen, Dilution 1:150). After washing with phosphate-buffered saline three times for 5 minutes each, the sections were incubated with corresponding secondary antibodies (goat anti-rabbit antibody, 1:400, #5220-0336, SeraCare; goat anti-mouse antibody, 1:400, #5220-0341, SeraCare) for 1 hour at room temperature. To visualize the expression of MITA and TRIM38 in the decidua, diaminobenzidine chromogen was utilized. Finally, the sections were counter-stained with hematoxylin.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTriple immunofluorescence staining of decidual tissues\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe obtained decidual tissues were fixed using 4% paraformaldehyde and subsequently embedded in paraffin. Using a microtome (HM355; Microm), sections with a thickness of 4\\u0026nbsp;\\u0026mu;m were obtained. These sections were then deparaffinized by treatment with Xylene for 10 minutes, followed by sequential washing with 100%, 96%, and 70% ethanol, as well as deionized water. Antigen retrieval was performed using citrate buffer (pH 6.0), and endogenous peroxidase was removed by incubating the sections with 3% hydrogen peroxide for 30 minutes. For the triple staining of CD86 + CD206 and TRIM38, the sections were treated with 3% bovine serum albumin at room temperature for 30 minutes, followed by overnight incubation at 4\\u0026deg;C with the primary anti-human antibody CD206 (#60143-1-Ig, Proteintech, Dilution 1:400). After washing the sections with PBST three times, each for 5 minutes, a secondary antibody (1:400, #5220-0341, SeraCare) was applied and incubated at room temperature for 1 hour. Subsequently, the sections were washed with PBST three times, each for 5 minutes, and incubated with Alexa Fluor\\u0026trade;\\u0026nbsp;488 tyramide for 30 minutes at room temperature. Then, the sections were treated again for antigen retrieval and endogenous peroxidase quenching, followed by blocking. After that, the staining of CD80 was performed by incubating the sections with the corresponding primary antibody against CD80 (#bs-1035R, 1:200, Bioss), secondary antibody (#5220-0341, 1:400, SeraCare) and Cy3 tyramide. Similarly, staining of TRIM38 was detected by incubating with the corresponding primary antibody against TRIM38 (#334BAA80, 1:100, Invitrogen), secondary antibody (#5220-0341, 1:400, SeraCare), and Cy5 tyramide. The nucleus was stained with DAPI.\\u003c/p\\u003e\\n\\u003cp\\u003eA similar protocol was used for the triple staining of CD86 + CD206 and MITA, where after staining CD86 and CD206, the staining of MITA was detected by incubating with the corresponding primary antibody against MITA (#ab239073, 1:100, Abcam), secondary antibody (#5220-0336, 1:400, SeraCare), and Cy5 tyramide. The nucleus was stained with DAPI. Signal analysis was carried out using fluorescence microscopy (Olympus BX50) and digitally photographed.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistical analysis\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026rdquo;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll the statistical analysis was performed using GraphPad Prism 9 (GraphPad Software, La Jolla, USA)\\u0026rdquo;. \\u0026ldquo;All the data were presented as mean \\u0026plusmn; standard deviation. Significant differences between/among different groups were assessed using unpaired t-test or one-way ANOVA followed by Bonferroni\\u0026rsquo;s multiple comparison tests\\u0026rdquo;. \\u0026ldquo;P \\u0026lt; 0.05 was considered statistically significant\\u0026rdquo;.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eACKNOWLEDGEMENTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank all the patients whose participation made this study possible. We thank Prof. Daji Luo (Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan Hubei, China), Dr. Yujie Ren, Chong Wang, Yang Han, Yuan Fang, Jia Quan, Ruyi Yang, Xiaobei Xiong, Muhan Huang (State Key Laboratory of Virology, Wuhan Institute of Virology, Center for Biosafety Mega-Science, Chinese Academy of Sciences (CAS), Wuhan, China) for their provisions of corresponding experimental site and the use guidance of relevant experimental instruments. We thank Dr. Jie Zeng, Ping Tian (Wuhan Children\\u0026rsquo;s Hospital (Wuhan Maternal and Child Healthcare Hospital), Tongji Medical College, Huazhong University of Science \\u0026amp;Technology, Wuhan, China) for their collection of decidual tissue samples. This study was funded by grants from the Fund of the National Key Research and Development Program of China (2018YFC1002804 and 2016YFC1000600 ), the National Natural Science Foundation of China (81771618, 81971356 and 82001642), Fund of Clinical Medical Education teaching Reform of Hubei Provincial Health Commission (HBJG-220074).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAUTHORS\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026rsquo;\\u003c/strong\\u003e\\u003cstrong\\u003eCONTRIBUTIONS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eJing Yang, Jiao Chen, Yang Qiu \\u0026amp; Tao Tang had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analyses. Jun Liu , Yan Deng, An Wang \\u0026amp; Bowen Liu had equal contributions to this article. Jing Yang, Jun Liu, Yang Qiu, Xi Zhou \\u0026amp; Jiao Chen designed the study. Jun Liu, Yan Deng, Bowen Liu \\u0026amp; Tailang Yin cleaned and analysed the clinical data. Yan Wang analysed the FCM data. Jun Liu performed all the experiments. Jun Liu, An Wang analyzed the data and drew the Pattern Diagram. Jun Liu, Tao Tang \\u0026amp; Jiao Chen discussed the data and wrote the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCONFLICT OF INTEREST\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eDimitriadis E, Menkhorst E, Saito S, Kutteh WH, Brosens JJ. Recurrent pregnancy loss. Nat Rev Dis Primers. 2020;6(1):98.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSahoo T, Dzidic N, Strecker MN, Commander S, Travis MK, Doherty C, et al. Comprehensive genetic analysis of pregnancy loss by chromosomal microarrays: outcomes, benefits, and challenges. Genet Med. 2017;19(1):83\\u0026ndash;89.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang XH, Xu S, Zhou XY, Zhao R, Lin Y, Cao J, et al. Low chorionic villous succinate accumulation associates with recurrent spontaneous abortion risk. Nat Commun. 2021;12(1):3428.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi Y, Zhang D, Xu L, Dong L, Zheng J, Lin Y, et al. Cell-cell contact with proinflammatory macrophages enhances the immunotherapeutic effect of mesenchymal stem cells in two abortion models. Cell Mol Immunol. 2019;16(12):908\\u0026ndash;920.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eReese HR, Shanahan CC, Proulx C, Menegatti S. Peptide science: A \\\"rule model\\\" for new generations of peptidomimetics. Acta Biomater. 2020;102:35-74.2019;16(12):908\\u0026ndash;920.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang F, Zheng Q, Jin L. Dynamic Function and Composition Changes of Immune Cells During Normal and Pathological Pregnancy at the Maternal-Fetal Interface. Front Immunol. 2019;10:2317.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchjenken JE, Moldenhauer LM, Zhang B, Care AS, Groome HM, Chan HY, et al. MicroRNA miR-155 is required for expansion of regulatory T cells to mediate robust pregnancy tolerance in mice. Mucosal Immunol. 2020;13(4):609\\u0026ndash;625.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePique-Regi R, Romero R, Tarca AL, Sendler ED, Xu Y, Garcia-Flores V, et al. Single cell transcriptional signatures of the human placenta in term and preterm parturition. Elife. 2019;8:e52004.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang X, Du MR, Li M, Wang H. Three macrophage subsets are identified in the uterus during early human pregnancy. Cell Mol Immunol. 2018;15(12):1027\\u0026ndash;1037.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuerriero JL. Macrophages: Their Untold Story in T Cell Activation and Function. Int Rev Cell Mol Biol. 2019;342:73\\u0026ndash;93.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu MM, Shu HB. Innate Immune Response to Cytoplasmic DNA: Mechanisms and Diseases. Annu Rev Immunol. 2020;38:79\\u0026ndash;98.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhong B, Yang Y, Li S, Wang YY, Li Y, Diao F, et al. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity. 2008;29(4):538\\u0026ndash;550.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun W, Li Y, Chen L, Chen H, You F, Zhou X, et al. ERIS, an endoplasmic reticulum IFN stimulator, activates innate immune signaling through dimerization. Proc Natl Acad Sci U S A. 2009;106(21):8653\\u0026ndash;8658.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen X, Dou QP, Liu J, Tang D. Targeting Ubiquitin-Proteasome System With Copper Complexes for Cancer Therapy. Front Mol Biosci. 2021;8:649151.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHatakeyama S. TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem Sci. 2017;42(4):297\\u0026ndash;311.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEbner P, Versteeg GA, Ikeda F. Ubiquitin enzymes in the regulation of immune responses. Crit Rev Biochem Mol Biol. 2017;52(4):425\\u0026ndash;460.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang Y, Sun Z, Pei J, Luo Q, Zeng X, Li Q, et al. Identification of α-Mangostin as an Agonist of Human STING. ChemMedChem. 2018;13(19):2057\\u0026ndash;2064.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKonno H, Yamauchi S, Berglund A, Putney RM, Mul\\u0026eacute; JJ, Barber GN. Suppression of STING signaling through epigenetic silencing and missense mutation impedes DNA damage mediated cytokine production. Oncogene. 2018;37(15):2037\\u0026ndash;2051.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBeaman KD, Jaiswal MK, Katara GK, Kulshreshta A, Pamarthy S, Ibrahim S, et al. Pregnancy is a model for tumors, not transplantation. Am J Reprod Immunol. 2016;76(1):3\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature. 2015;526(7575):660\\u0026ndash;665.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYockey LJ, Jurado KA, Arora N, Millet A, Rakib T, Milano KM, et al. Type I interferons instigate fetal demise after Zika virus infection. Sci Immunol. 2018;3(19):eaao1680.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuang LS, Hong Z, Wu W, Xiong S, Zhong M, Gao X, et al. mtDNA Activates cGAS Signaling and Suppresses the YAP-Mediated Endothelial Cell Proliferation Program to Promote Inflammatory Injury. Immunity. 2020;52(3):475\\u0026ndash;486.e5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, et al. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature. 2016;535(7610):153\\u0026ndash;158.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu Z, Wang M, Wang X, Bu Q, Wang Q, Su W, et al. XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury. Redox Biol. 2022;52:102305.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOkondo MC, Johnson DC, Sridharan R, Go EB, Chui AJ, Wang MS, et al. DPP8 and DPP9 inhibition induces pro-caspase-1-dependent monocyte and macrophage pyroptosis. Nat Chem Biol. 2017;13(1):46-53.26.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhu D, Zou H, Liu J, Wang J, Ma C, Yin J, et al. Inhibition of HMGB1 Ameliorates the Maternal-Fetal Interface Destruction in Unexplained Recurrent Spontaneous Abortion by Suppressing Pyroptosis Activation. Front Immunol. 2021;12:782792.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMosser DM, Edwards JP. Exploring the full spectrum of macrophage activation [published correction appears in Nat Rev Immunol.2010 Jun;10(6):460]. Nat Rev Immunol. 2008;8(12):958\\u0026ndash;969.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhou X, Li W, Wang S, Zhang P, Wang Q, Xiao J, et al. YAP Aggravates Inflammatory Bowel Disease by Regulating M1/M2 Macrophage Polarization and Gut Microbial Homeostasis. Cell Rep. 2019;27(4):1176\\u0026ndash;1189.e5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTimmer AM, Nizet V. IKKbeta/NF-kappaB and the miscreant macrophage. J Exp Med. 2008;205(6):1255\\u0026ndash;1259.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAbumaree MH, Al Harthy S, Al Subayyil AM, Alshabibi MA, Abomaray FM, Khatlani T, et al. Decidua Basalis Mesenchymal Stem Cells Favor Inflammatory M1 Macrophage Differentiation In Vitro. Cells. 2019;8(2):173.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMor G, Aldo P, Alvero AB. The unique immunological and microbial aspects of pregnancy. Nat Rev Immunol. 2017;17(8):469\\u0026ndash;482.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAbrahams VM, Kim YM, Straszewski SL, Romero R, Mor G. Macrophages and apoptotic cell clearance during pregnancy. Am J Reprod Immunol. 2004;51(4):275\\u0026ndash;282.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMotwani M, Pesiridis S, Fitzgerald KA. DNA sensing by the cGAS-STING pathway in health and disease. Nat Rev Genet. 2019;20(11):657\\u0026ndash;674.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu MM, Liao CY, Yang Q, Xie XQ, Shu HB. Innate immunity to RNA virus is regulated by temporal and reversible sumoylation of RIG-I and MDA5. J Exp Med. 2017;214(4):973\\u0026ndash;989.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003evan Wijk SJ, Fulda S, Dikic I, Heilemann M. Visualizing ubiquitination in mammalian cells. EMBO Rep. 2019;20(2):e46520.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBard JAM, Goodall EA, Greene ER, Jonsson E, Dong KC, Martin A. Structure and Function of the 26S Proteasome. Annu Rev Biochem. 2018;87:697\\u0026ndash;724.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWan T, Li X, Li Y. The role of TRIM family proteins in autophagy, pyroptosis, and diabetes mellitus. Cell Biol Int. 2021;45(5):913\\u0026ndash;926.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWest AP, Khoury-Hanold W, Staron M, Tal MC, Pineda CM, Lang SM, et al. Mitochondrial DNA stress primes the antiviral innate immune response. Nature. 2015;520(7548):553\\u0026ndash;557.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBanerjee I, Behl B, Mendonca M, Shrivastava G, Russo AJ, Menoret A, et al. Gasdermin D Restrains Type I Interferon Response to Cytosolic DNA by Disrupting Ionic Homeostasis. Immunity. 2018;49(3):413\\u0026ndash;426.e5.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMurthy AMV, Robinson N, Kumar S. Crosstalk between cGAS-STING signaling and cell death. Cell Death Differ. 2020;27(11):2989\\u0026ndash;3003.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eTable 1. Clinical characteristics of the included participants.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cdiv\\u003e\\n \\u003ctable border=\\\"0\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"99%\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"43.03350970017637%\\\" colspan=\\\"4\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eURSA\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"43.03350970017637%\\\" colspan=\\\"4\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eControl\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e1\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e2\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e3\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e4\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e1\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e2\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e3\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePatient\\u003cstrong\\u003e4\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAge (years)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e30\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e22\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eRace\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHan\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGestation\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eG2P0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMenopause (days)\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e54\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e45\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e48\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePast RSA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eDisease history\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePrimary heartbeat\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNo\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eYes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eYes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eYes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eYes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eVillus CMV\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"13.932980599647266%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCOVID-19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.758377425044092%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e(-)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 2. The sequence of primers.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"21.47887323943662%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"78.52112676056338%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003cstrong\\u003eSequence\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"21.47887323943662%\\\" rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;TRIM38\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"78.52112676056338%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Forward: 5ʹ-CTCAAGAGCCACATCCTGGAAC-3ʹ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"100%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Reverse: 5ʹ-GTTCCAAGGAGACAGCCTCTGA-3ʹ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"21.47887323943662%\\\" rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;MITA\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"78.52112676056338%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Forward: 5ʹ- GGTGCCTGATAACCTGAGTATG-3ʹ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"100%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Reverse: 5ʹ-GTTGCTGTAAACCCGATCCTTG-3ʹ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"21.47887323943662%\\\" rowspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;GAPDH\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"78.52112676056338%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Forward: 5ʹ-GTCTCCTCTGACTTCAACAGCG-3ʹ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"100%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Reverse: 5ʹ-ACCACCCTGTTGCTGTAGCCAA-3ʹ\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"maternal-fetal interface, MITA, ubiquitination, pyroptosis, URSA\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3131504/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3131504/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMaternal-fetal interface shares similarities with tumor tissues in terms of immune microenvironment. Normal pregnancy is maintained due to the immunosuppressed state, but pyroptosis induced by MITA can trigger the body's immune response and disrupt the immunosuppressed state of the maternal-fetal interface, leading to abortion. In this study, we explored the role of MITA and TRIM38 in regulating pyroptosis and maintaining the immune tolerance of the maternal-fetal interface during pregnancy. Our findings show that the interaction between MITA and TRIM38 plays a crucial role in maintaining the immunosuppressed state of the maternal-fetal interface. Specifically, we observed that TRIM38-mediated K48 ubiquitination of MITA was higher in M2 macrophages, leading to low expression levels of MITA and thus, inhibiting pyroptosis. Conversely, in M1 macrophages, the ubiquitination of K48 was lower, resulting in higher expression levels of MITA and promoting pyroptosis. Our results also indicated that pyroptosis played a significant role in hindering the transformation of M1 to M2 and maintaining the immunosuppressed state of the maternal-fetal interface. The discoveries presented offer significant understanding into the mechanisms that support the preservation of the immune tolerance microenvironment at the maternal-fetal interface, playing a vital role in ensuring successful pregnancy results.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Investigation into the role of MITA-TRIM38 interaction in regulating pyroptosis and maintaining immune tolerance at the maternal-fetal interface\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-08-14 11:44:07\",\"doi\":\"10.21203/rs.3.rs-3131504/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"efe64c5d-17cc-4373-89fa-ffea3c4bbc13\",\"owner\":[],\"postedDate\":\"August 14th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":23135144,\"name\":\"Health sciences/Diseases/Reproductive disorders\"},{\"id\":23135145,\"name\":\"Biological sciences/Immunology/Cell death and immune response\"}],\"tags\":[],\"updatedAt\":\"2023-12-08T15:56:39+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-3131504\",\"link\":\"https://doi.org/10.1038/s41419-023-06314-w\",\"journal\":{\"identity\":\"cell-death-and-disease\",\"isVorOnly\":false,\"title\":\"Cell Death \\u0026 Disease\"},\"publishedOn\":\"2023-11-28 05:00:00\",\"publishedOnDateReadable\":\"November 28th, 2023\"},\"versionCreatedAt\":\"2023-08-14 11:44:07\",\"video\":\"\",\"vorDoi\":\"10.1038/s41419-023-06314-w\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41419-023-06314-w\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3131504\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3131504\",\"identity\":\"rs-3131504\",\"version\":[\"v1\"]},\"buildId\":\"wLkW0s4AflPzk-lpfg-fK\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}