{"paper_id":"3f6ee9e3-de89-42e5-a7a6-284e6c646869","body_text":"KLF14 inhibits tumor progression via FOSL1 in glioma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article KLF14 inhibits tumor progression via FOSL1 in glioma Xiaohua Wang, Xinjuan Qu, Xuelai Liu, Kaiyue Wang, Yongfang Yang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2783574/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Glioma is the most common malignancy of the central nervous system. Fos-like antigen 1 (FOSL1) is overexpressed and acts as a tumor-promoting factor in glioma. However, the regulation of FOSL1 remains unknown. KLF14, a member of Kruppel-like factors that are involved gene transcription, plays an important role in the regulation of cell proliferation, differentiation and apoptosis. Loss of KLF14 triggers spontaneous tumorigenesis of lung, spleen and lymph node, suggesting its potential as biomarker for cancer. However, its role in glioma still needs to be deciphered. Therefore, we explore the interactions between FOSL1 and KLF14, as well as their role in glioma. Methods We first determined that FOSL1 can be transcriptional inhibited by KLF14 using dual-luciferase reporter gene assays and qPCR assays. Then, through immunohistochemistry (IHC)assay and western blotting (WB) assay in glioma tissues, we demonstrated a negative correlation between FOSL1 and KLF14. Next, KLF14 knockdown cells and double knockdown of KLF14 and FOSL1 cells were generated, and cell growth were detected by different experimental methods (MTT assay, crystal violet staining, cell migration assay). We then used qPCR and WB assay to search for and validate how KLF14 affects tumor cell migration through FOSL1. Finally, we confirmed the inhibition of tumor growth by KLF14 using xenograft tumor model. Results In this study, we showed that KLF14 inhibited the transcription of FOSL1.There is a negative correlation between KLF14 and FOSL1 in glioma tissues. Overexpression of KLF14 reversed the effect of FOSL1 in cell invasion, migration and epithelial-mesenchymal transition in glioma cells, and this was accompanied by the down-regulation of Snail2 and CD44. Moreover, KLF14 overexpression inhibits tumor progression in vivo . Conclusions The present results suggest that KLF14 is a new tumor molecular marker and a potential target for the treatment of glioma, providing a new target for anti-tumor drug research. Glioma tumor progression KLF14 FOSL1 transcriptional inhibition Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Glioma is the most common primary tumor of the central nervous system, accounting for more than 50% of intracranial tumors [ 1 ]. Traditionally, the classical clinical treatment of glioma consists of surgery combined with radiotherapy and chemotherapy. However, glioma is characterized by a high degree of malignancy and the development of drug resistance. Therapeutic targets have not been identified, and the treatment of glioma is a worldwide scientific challenge [ 2 ]. Therefore, identifying new drug targets for glioma and exploring effective treatment methods is important. Fos-like antigen 1 FOSL1, a component of the transcription factor AP-1 complex, is involved in regulating cellular immune response, tumor proliferation, migration and invasion [ 3 ]. FOSL1, as a transcription factor of AP-1, activates bone matrix generation [ 4 ]. Overexpression of FOSL1 promotes the formation of osteosarcoma in mice [ 5 ]. FOSL1 is involved in the proliferation and migration of osteosarcoma cells by regulating the ERK/AP-1 signaling pathway [ 6 ]. FOSL1 acts as a potential downstream response factor of the PI3K/AKT signaling pathway, thereby promoting cell invasion [ 7 ]. FOSL1 functions as a proto-oncogene, regulating cell proliferation in KRAS-dependent lung and pancreatic cancers. [ 8 ]. A large-scale mass spectrometry study indicated that FOSL1 may serve as a potential marker and therapeutic target for the treatment of central nervous system tumors [ 9 ]. However, the regulation of FOSL1 in central nervous system tumors remains unexplored, and in-depth studies of the role of FOSL1 in central nervous system tumors, especially gliomas, are necessary. To determine whether FOSL1 could be used as a target for the treatment of glioma, the regulation of FOSL1 in relation to glioma proliferation and the upstream regulatory mechanism of FOSL1 need to be investigated. KLF transcription factors (Kruppel-like factors) are a group of zinc finger proteins that are involved gene transcription, and play an important role in the regulation of cell proliferation, differentiation and apoptosis. Aberrant function of KLFs is closely related to the occurrence and development of tumors, cardiovascular and cerebrovascular diseases, metabolic disorders and other diseases [ 10 ]. In mammals, there are 17 members of the KLF family (KLF1-KLF17), and the physiological and pathological functions of several KLFs have been extensively studied [ 11 – 13 ]. KLF14 was identified as a gene associated with fat metabolism and type II diabetes mellitus by genome-wide association analysis (GWAS) [ 14 – 16 ]. In 2011, subcutaneous adipose tissue was extracted from 776 female twins and used for whole genome analysis. The single nucleotide polymorphism rs473170 upstream of KLF14 is associated with the expression of a large number of adipose genes; hence, KLF14 was named \"master switch of adipose metabolism\" [ 17 ]. The KLF14 gene has more variants in humans than in other primates [ 18 ]. In 2015, KLF14 was shown, for the first time, to be significantly associated with the occurrence and development of tumors, and thus considered a new tumor suppressor [ 19 ]. KLF14 knockout mice develop spontaneous tumors (spleen, thymus, lungs, etc.) and KLF14 knockdown significantly increases the grade of AOM/ DSS-induced colon cancer progression. KLF14 deletion leads to excessive replication of centrosomes and thus induces genomic instability, which is an important cause of tumor occurrence and development [ 20 , 21 ]. Analysis of the oncomine database showed significantly reduced transcription levels of KLF14 in various human cancer tissues. These studies demonstrate that KLF14 is a key factor in maintaining normal centrosome replication and genomic homeostasis, and is significantly associated with tumorigenesis, tumor progression, and drug resistance. KLF14 is a tumor suppressor gene whose overexpression or increased activity facilitates tumor killing. However, there are no studies on the role of KLF14 in central nervous system tumors. In this study, we showed that KLF14 inhibited the transcription of FOSL1.There is a negative correlation between KLF14 and FOSL1 in glioma tissues. Overexpression of KLF14 reversed the effect of FOSL1 in cell invasion, migration and epithelial-mesenchymal transition in glioma cells, and this was accompanied by the down-regulation of Snail2 and CD44. Moreover, KLF14 overexpression inhibits tumor progression in vivo . In summary, the present results provide strong evidence that FOSL1 inhibition is a prognostic and therapeutic option in GBM. And we suggest that KLF14 is a new tumor molecular marker and a potential target for the treatment of glioma, providing a new target for anti-tumor drug research. Methods Cell culture and materials. U87 and U251 cells were obtained from the American Type Culture Collection. Cells were maintained in DMEM with 10% (v/v) fetal bovine serum. FOSL1-Si (ShRNA) sequence is 5’- CCGGCCTCAGCTCATCGCAAGAGTACTCGAGTACTCTTGCGATGAGCTGAGGTTTTT-3’. Lenti-Flag-FOSL1 expression plasmid was constructed by inserting the coding regions into Lenti vector. Antibodies were purchased from sigma (FOSL1, GAPDH and KLF14), Proteintech (Snail2 and CD44). Western blotting . Western blotting was performed as previously reported [ 22 ]. In brief, cells were lysed in lysis buffer (50mM Tris-HCl pH 8.0, 5mM EDTA, 150mM NaCl, 0.5% NP-40, 1mM PMSF), centrifuged for 10min at 12,000 g, and the insoluble debris was discarded. Cell lysates were further analysed with SDS-PAGE and western blotting using specific antibodies. Tissue microarray and IHC staining. Human tissue microarrays of glioma cancer (Shanghai Superbiotek Pharmaceutical Technology Co., Ltd.) were purchased. The clinical characteristics of all samples were downloaded from the Web sites of companies. Antibody against FOSL1 and KLF14 were used for immunohistochemistry staining. The intensity of FOSL1 and KLF14 staining was quantified, scored and graded (low, 0–4 point; medium, 5–8 point; and high, 9–12 point). To ensure an unbiased result, data was collected in a double-blinded manner. Cell growth analyses . Cell survival was determined by MTT assay. Clonal formation assay. 1×10 3 FOSL1 overexpression or knockdown cells and control cells were respectively seeded in 12 well plates and cultured in complete medium for 10 days. Later, cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Then clones per well were observed. Wound healing experiment. The cells were evenly spread in the six-well plate and, after the bottom was overgrown, a straight line was drawn along the ruler with a 10-µL pipette tip. The cells were then rinsed with PBS and serum-free medium was added. The cells were placed in a 37°C, 5% CO 2 incubator to cultivate, and pictures were taken and saved at 0, 12, and 24 h. Luciferase reporter assay . Luciferase reporter assay was performed as previously reported [ 22 ]. To generate FOSL1 promoter-activated luciferase reporter, -200 to 1000 bp of FOSL1 promoter was subcloned into PGL4.17. Luciferase reporter assay was performed. Briefly, cells in 24-well plates were cotransfected with indicated plasmids and the FOSL1-promoter luciferase reporter plasmid for 24 h. Luciferase was measured using the Dual-Luciferase assay kit (Promega). pRL-TK was co-transfected to normalize transfection efficiency. Tumor growth analysis in mice . Tumor growth analysis was performed as previously reported [ 22 ]. Cells were subcutaneously injected into both flanks of male BALB/c nude mice (~ 5 weeks of age). 14 days after injection, mice were treated with PBS or TMZ (10µg/kg) every day by intraperitoneal injection. At day 30, Animals were treated according to high ethical and scientific standards with oversight by the animal center at Guangzhou University of Chinese Medicine. Statistical analyses . The results are expressed as mean ± standard deviation, as indicated in the figure legends. Statistical significance was assessed by two-tailed Student t tests. Values of P < 0.05 were considered significant. Results FOSL1 transcription is inhibited by KLF14 It has been reported that high expression of FOLS1 is crucial for glioma progression, we explored the factors which regulate FOSL1. In our study, we identified KLF14 as a transcription inhibitor to negatively regulate FOSL1 mRNA expression (Fig. 1 A). Furthermore, overexpression of KLF14 decreased FOSL1 protein level (Fig. 1 B). Next, we established KLF14-overexpressed stable cell and found that either mRNA level or protein level of FOSL1 was decreased in KLF14-overexpressed cells (Fig. 1 C-D). Conversely, FOSL1 mRNA level and protein level were upregulated in KLF14-knockdown stable cells (Fig. 1 E-F). These results showed that FOSL1 transcription was inhibited by KLF14. Negative correlation between KLF14 and FOSL1 in glioma cancer Previous reports discovered FOLS1 overexpression in glioma cancer, and we next performed immunohistochemistry staining of FOSL1 and KLF14 protein on tissue chips of human glioma cancers. Results showed that there was significantly high protein level of FOSL1, but low protein level of KLF14 in glioma cancers (Fig. 2 A). Correlational analysis revealed a significant negative correlation between the protein expression levels of FOSL1 and KLF14 in glioma tumour tissues (Spearman’s r=-0.4 and − 0.6, respectively) (Fig. 2 B). In addition, western blotting assay of FOSL1 and KLF14 in human glioma tissue showed that FOSL1 is upregulated whereas KLF14 is downregulated in tumor than peri-tumor (Fig. 2 C). Results suggest that there is a negative correlation between FOSL1 and KLF14 in human glioma cancer. KLF14 inhibits tumor proliferation and migration through FOSL1 To verify the effect of KLF14 on GBM cell proliferation, cell growth was compared between KLF14 knockdown cells and control cells using the CCK-8 assay. The results showed that cell growth was higher in cells with KLF14 knockdown than in control cells. However, knockdown of FOSL1 reversed the effect (Fig. 3 A-B). Consistently, the crystal violet staining assay showed that cell proliferation was higher in KLF14 knockdown cells than in control cells, whereas FOSL1 knockdown reversed the effect (Fig. 3 C). Next, the results of wound healing assay suggested that KLF14 knockdown cells migrated quicker than control cells. And FOSL1 knockdown blocked the tendency (Fig. 3 D). Taken together, these results indicate that KLF14 depletion promotes the proliferation and migration of GBM cells, which are caused by upregulation of FOSL1. KLF14 inhibits tumor proliferation by inducing FOSL1-dependent EMT When cancer cells undergo EMT, the Twist, Snail, Slug and CD44 proteins are altered, thus causing cell migration and invasion. It has been reported that FOSL1 upregulates Snail2 and CD44. Therefore, we assessed the expression of these factors to evaluate the phenotypic modulation of KLF14. Knockdown of KLF14 in U87G cells promoted the mRNA expression of Snail2 and CD44, which is reversed by FOSL1 knockdown (Fig. 4 A). Consistently, the similar results were observed in U251 cells (Fig. 4 B). Furthermore, the protein levels of Snail2 and CD44 is upregulated in U87G cells and U251 cells with KLF14 knockdown. Whereas, the effect is reversed by FOSL1 knockdown (Fig. 4 C-D). The data suggest that KLF14 inhibits the metastasis of GBM cells by downregulation of FOSL1. Overexpression of KLF14 inhibits tumor proliferation in vivo To verify the role of KLF14 in the development of GBM in vivo, we established a xenograft tumor model for tumorigenesis experiments. U87G cells stably overexpressing KLF14 and vector were subcutaneously injected into nude mice. The results showed that KLF14-overexpression markedly decreased the tumorigenesis of GBM cells compared with the vector group (Fig. 5 A). In addition, tumor weight was significantly lower in the KLF14-overexpression group than in the control group (Fig. 5 B). Similar results were obtained in tumors from U251 cells stably overexpressing KLF14(Fig. 5 C-D). These results confirmed the role of KLF14 in inhibiting GBM in vivo . Discussion FOSL1 plays a carcinogenic role in GBM, and FOSL1 inhibition is a prognostic and therapeutic option in GBM. However, there is a lack of research on the regulation of FOSL1. In this study, we confirmed that FOSL1 is transcription inhibited by KLF14. There is a negative correlation between KLF14 and FOSL1 in glioma tissues. Overexpression of KLF14 reversed the effect of FOSL1 in cell invasion, migration and epithelial-mesenchymal transition in glioma cells. Whether KLF14 targets FOSL1 directly need to be further elucidated. Sliencing of FOSL1 inhibited tumor proliferation by decreasing levels of EMT markers, such as Twist, Snail, Slug and CD44. However, whether FOSL1 targets these factors directly or indirectly remains unknown. FOSL1 is a component of transcription factor AP-1 complex, and thus may bind to the promoters of these markers to induce their expression. Exploring the mechanism by which FOSL1 regulates EMT is necessary to elucidate the role of FOSL1 as a target for the treatment of central nervous system. A previous report showed that KLF14 depletion leads to spontaneous tumorigenesis in mice due to PLK4-dependent centrosome amplification in multiple human cancers[ 1 ]. However, there is no cell division in nerve cells. Thus, whether KLF14 depletion leads to tumorigenesis in the central nervous system remains unknown. In this study, we showed that knockdown of KLF14 promots cell invasion, migration and epithelial-mesenchymal transition through upregulating FOSL1 in glioma cells, and this was accompanied by the down-regulation of Snail2 and CD44. Moreover, KLF14 overexpression inhibits tumor progression in vivo . These results suggest that KLF14 depletion may leads to spontaneous tumorigenesis in the nervous system. Declarations Ethics approval and consent to participate All animal experimental protocols were approved by the guidelines of the Institutional Animal Care and Use Committee of Guangzhou University of Chinese Medicine.All methods were carried out in accordance with relevant guidelines and regulations. This study was carried out in compliance with the ARRIVE guidelines. Consent for publication Not applicable. Availability of data and materials The data that support the findings of this study are available from the corresponding author upon reasonable request. Competing interests The authors declare no competing interests. Funding This work was supported by the Health Science and Technology Development Program of Shandong Province (202102040561) Authors' contributions X.W and X.Q. performed most of the experiments. H.C and Y.L interpreted data and wrote the manuscript. X.L, K.W, Y.Y, Y.Z and Z.W supervised the study and reviewed the manuscript. Acknowledgements Not applicable. References Ostrom, Q.T., et al., CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2012–2016. Neuro-Oncology, 2019. 21(Supplement_5): p. v1-v100. Weller, M., et al., European Association for Neuro-Oncology (EANO) guideline on the diagnosis and treatment of adult astrocytic and oligodendroglial gliomas. The Lancet Oncology, 2017. 18(6): p. e315-e329. Caputto, B.L., A.M. Cardozo Gizzi, and G.A. Gil, c-Fos: an AP-1 transcription factor with an additional cytoplasmic, non-genomic lipid synthesis activation capacity. Biochim Biophys Acta, 2014. 1841(9): p. 1241-6. Galvagni, F., M. Orlandini, and S. Oliviero, Role of the AP-1 transcription factor FOSL1 in endothelial cells adhesion and migration. Cell Adh Migr, 2013. 7(5): p. 408-11. Jochum, W., et al., Increased bone formation and osteosclerosis in mice overexpressing the transcription factor Fra-1. Nature Medicine, 2000. 6(9): p. 980-984. Han, Y., et al., Effects of FOSL1 silencing on osteosarcoma cell proliferation, invasion and migration through the ERK/AP-1 signaling pathway. J Cell Physiol, 2019. 234(4): p. 3598-3612. Kent, L.N., et al., FOSL1 is integral to establishing the maternal-fetal interface. Mol Cell Biol, 2011. 31(23): p. 4801-13. Vallejo, A., et al., An integrative approach unveils FOSL1 as an oncogene vulnerability in KRAS-driven lung and pancreatic cancer. Nature Communications, 2017. 8(1). Behan, F.M., et al., Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature, 2019. 568(7753): p. 511-516. McConnell, B.B. and V.W. Yang, Mammalian Kruppel-Like Factors in Health and Diseases. Physiological Reviews, 2010. 90(4): p. 1337-1381. black, Sp1 and Kru¨ppel-Like Factor Family of Transcription Factors in Cell Growth Regulation and Cancer. JOURNAL OF CELLULAR PHYSIOLOGY, 2001: p. 143-160. Bieker, J.J., Kruppel-like Factors: Three Fingers in Many Pies. Journal of Biological Chemistry, 2001. 276(37): p. 34355-34358. Suske, G., E. Bruford, and S. Philipsen, Mammalian SP/KLF transcription factors: Bring in the family. Genomics, 2005. 85(5): p. 551-556. Rees, S.D., et al., Replication of 13 genome-wide association (GWA)-validated risk variants for type 2 diabetes in Pakistani populations. Diabetologia, 2011. 54(6): p. 1368-1374. Stacey, S.N., et al., New common variants affecting susceptibility to basal cell carcinoma. Nature Genetics, 2009. 41(8): p. 909-914. .Chasman, Forty-Three Loci Associated with Plasma Lipoprotein Size, Concentration, and Cholesterol Content in Genome-Wide Analysis. PLoS Genetics, 2009. 5(11). Small, K.S., et al., Identification of an imprinted master trans regulator at the KLF14 locus related to multiple metabolic phenotypes. Nature Genetics, 2011. 43(6): p. 561-564. Parker-Katiraee, L., et al., Identification of the Imprinted KLF14 Transcription Factor Undergoing Human-Specific Accelerated Evolution. PLoS Genetics, 2007. preprint(2007): p. e65. Fan, G.J., et al., Loss of KLF14 triggers centrosome amplification and tumorigenesis. nature communications, 2015. 6. Vitre, B.D. and D.W. Cleveland, Centrosomes, chromosome instability (CIN) and aneuploidy. Curr Opin Cell Biol, 2012. 24(6): p. 809-15. Krämer, A., B. Maier, and J. Bartek, Centrosome clustering and chromosomal (in)stability: A matter of life and death. Molecular Oncology, 2011. 5(4): p. 324-335. Xq, A , et al. Depletion of Kruppel-like factor 15 sensitized gliomas to temozolomide cytotoxicity through O (6)-methylguanine-DNA methyl-transferase. Biochem Biophys Rep, 2021. 27 : p. 101058. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2783574\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":200951004,\"identity\":\"716d1279-3e9e-41d5-a49b-cd60485bfc8e\",\"order_by\":0,\"name\":\"Xiaohua Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Guangzhou University of Chinese Medicine\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaohua\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":200951005,\"identity\":\"bdd39194-762f-411b-ac23-2f8ca865e56a\",\"order_by\":1,\"name\":\"Xinjuan Qu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Linyi Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xinjuan\",\"middleName\":\"\",\"lastName\":\"Qu\",\"suffix\":\"\"},{\"id\":200951006,\"identity\":\"9817e59a-2b85-4e2b-839c-b80ea1cdd20c\",\"order_by\":2,\"name\":\"Xuelai Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Linyi Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuelai\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":200951008,\"identity\":\"9aebfbe0-d018-4217-9d80-63ea9c20cc8d\",\"order_by\":3,\"name\":\"Kaiyue Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Linyi People’s Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kaiyue\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":200951010,\"identity\":\"e21f6f4c-e579-46f2-9455-d05360c8011f\",\"order_by\":4,\"name\":\"Yongfang Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Linyi People’s Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yongfang\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":200951011,\"identity\":\"8d930ed6-364f-4c51-a4e9-1687efb3f5f1\",\"order_by\":5,\"name\":\"Yujuan Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Linyi People’s Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yujuan\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":200951014,\"identity\":\"ccf916ff-ec2b-4e75-8c8b-27a483e2a559\",\"order_by\":6,\"name\":\"Zhenguo Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Linyi Hospital of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhenguo\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":200951015,\"identity\":\"5c80b64a-0aa3-4deb-9b09-5cc9033c725d\",\"order_by\":7,\"name\":\"Yuming Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuming\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":200951016,\"identity\":\"a8e28087-f865-44ac-ad3f-6775c8ebf1d8\",\"order_by\":8,\"name\":\"Hongwei Chen\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIie3QMWrDMBTGcRmBtIhqtUhxT1B4rcBkMDmLhEFTho4eHQLykgMEegkfIapoJ0NXDx1sCp09Zii03lusdOug//x+w/cQisX+Yxi7QVVFxm9cM01QbMKEkhKGzkhxxDY5PpgyTDjLxWi9bntqMZuekjokbvfEpKrDUjzu7HsBJ4yof26XSO6xX6uKZPzaNXILb1eIGdMvE6J71TEpal2vtvCBUcryAGGQapvq9jSTNfikvoDczwTm+dqu0GVkfrLqlBQHt787gClJcMurd+O5+so4bcbh/FlsOPUvi+Rn5G/nsVgsFvutbxOVUkuGYo/VAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Songjiang Hospital, Shanghai Jiao Tong University School of Medicine (Preparatory Stage)\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hongwei\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-04-06 04:14:23\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2783574/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2783574/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":37197607,\"identity\":\"73156547-ede4-4a7e-81ef-e9120b01eeec\",\"added_by\":\"auto\",\"created_at\":\"2023-05-18 13:52:25\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":175869,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFOSL1 transcription is inhibited by KLF14. (A) FOSL1 and KLF family (KLF1-17) were cotransfected into U87G cells and relative expression levels of FOSL1 mRNA were assessed by qRT-PCR. (B) Dosed KLF14 plasmids (2μg, 4μg) were transfected into U87G cells and FOSL1 protein level was detected by western blot. (C) qRT-PCR analysis of the mRNA expression level of FOSL1 in KLF14 overexpression U87G cell lines constructed using lentivirus. (D) Western blot analysis of the expression level of FOSL1 in KLF14 overexpression U87G cell lines constructed using lentivirus. (E) qRT-PCR analysis of the mRNA expression level of FOSL1 in KLF14 knockdown U87G cell lines constructed using lentivirus. (F) Western blot analysis of the expression level of FOSL1 in KLF14 knockdown U87G cell lines constructed using lentivirus. Data represent mean ± s.d., *P\\u0026lt;0.05, **P\\u0026lt;0.01, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2783574/v1/fa3c59850271244fd5ceacca.png\"},{\"id\":37196585,\"identity\":\"b0cc8b2c-2431-4dfc-8803-9029af14f7bb\",\"added_by\":\"auto\",\"created_at\":\"2023-05-18 13:44:26\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":541060,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNegative correlation between KLF14 and FOSL1 in glioma cancer. (A) Comparison of FOSL1 and KLF14 protein expression revealed by tissue array. Examples of immunohistochemical images of tumour tissue in glioma cancer stained with anti-FOSL1 and anti-KLF14 antibodies, respectively (scale bar, 100μm). (B) Spearman’s r-coefficient test for evaluation of correlations between FOSL1 and KLF14 immunohistochemical expression status in glioma cancer tissues. ρ indicates negative correlation. The level of signification is expressed by the P-value. (C) Western blot analysis of the expression level of FOSL1 and KLF14 in glioma cancer tissues. Data represent mean ± s.d., *P\\u0026lt;0.05, **P\\u0026lt;0.01, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2783574/v1/de39918acf1dc52750ac3dbb.png\"},{\"id\":37196583,\"identity\":\"2aa96e39-ed30-4719-ab00-1abaa58d379a\",\"added_by\":\"auto\",\"created_at\":\"2023-05-18 13:44:25\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":360206,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eKLF14 inhibits tumor proliferation and migration through FOSL1. (A-B) MTT assay demonstrated the proliferation ability of KLF14 knockdown or KLF14 and FOSL1 double knockdown U87G (A) and U251 (B) cell lines. (C-D) Colony formation assay demonstrated the proliferation ability of KLF14 knockdown or KLF14 and FOSL1 double knockdown U87G cell lines. (D) Wound healing assay show the migration ability of KLF14 knockdown or KLF14 and FOSL1 double knockdown U87G cell lines. Data represent mean ± s.d., *P\\u0026lt;0.05, **P\\u0026lt;0.01, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2783574/v1/bd0b757e0610ec767b2dc20f.png\"},{\"id\":37197608,\"identity\":\"50406db8-1444-4391-9114-2170b7a5cba8\",\"added_by\":\"auto\",\"created_at\":\"2023-05-18 13:52:26\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":235531,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eKLF14 inhibits tumor proliferation by inducing FOSL1-dependent EMT. (A-B) mRNA expression of Snail2 and CD44 in KLF14 knockdown or KLF14 and FOSL1 double knockdown U87G (A) and U251 (B) cells determined by RT-qPCR. (C-D) Protein expression of Twist, Snail, Slug and CD44 in KLF14 knockdown or KLF14 and FOSL1 double knockdown U87G (A) and U251 (B) cells determined by western blot.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2783574/v1/33bfea76532c434547b9c741.png\"},{\"id\":37196594,\"identity\":\"d49c5090-b3b0-4404-8a5d-b83406c98c73\",\"added_by\":\"auto\",\"created_at\":\"2023-05-18 13:44:26\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":210723,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOverexpression of KLF14 inhibits tumor proliferation \\u003cem\\u003ein vivo\\u003c/em\\u003e. (A) After injecting KLF14 overexpression U87G cells in nude mice, the tumors were collected in tumor-bearing nude mice within four weeks. (B) The tumor volume was measured four weeks later. (C) After injecting KLF14 overexpression U251 cells in nude mice, the tumors were collected in tumor-bearing nude mice within four weeks. (D) The tumor volume was measured four weeks later. Data represent mean ± s.d., *P\\u0026lt;0.05, **P\\u0026lt;0.01, Student’s t test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2783574/v1/3a9cb25196eddaaffd122fbd.png\"},{\"id\":46831463,\"identity\":\"504e6303-e377-4e89-9043-c1e85cf2f66c\",\"added_by\":\"auto\",\"created_at\":\"2023-11-21 07:59:43\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1742134,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2783574/v1/d332861f-fba8-4ee7-b2df-9afd1e78ffe8.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"KLF14 inhibits tumor progression via FOSL1 in glioma\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eGlioma is the most common primary tumor of the central nervous system, accounting for more than 50% of intracranial tumors [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Traditionally, the classical clinical treatment of glioma consists of surgery combined with radiotherapy and chemotherapy. However, glioma is characterized by a high degree of malignancy and the development of drug resistance. Therapeutic targets have not been identified, and the treatment of glioma is a worldwide scientific challenge [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Therefore, identifying new drug targets for glioma and exploring effective treatment methods is important.\\u003c/p\\u003e \\u003cp\\u003eFos-like antigen 1 FOSL1, a component of the transcription factor AP-1 complex, is involved in regulating cellular immune response, tumor proliferation, migration and invasion [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. FOSL1, as a transcription factor of AP-1, activates bone matrix generation [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Overexpression of FOSL1 promotes the formation of osteosarcoma in mice [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. FOSL1 is involved in the proliferation and migration of osteosarcoma cells by regulating the ERK/AP-1 signaling pathway [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. FOSL1 acts as a potential downstream response factor of the PI3K/AKT signaling pathway, thereby promoting cell invasion [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. FOSL1 functions as a proto-oncogene, regulating cell proliferation in KRAS-dependent lung and pancreatic cancers. [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. A large-scale mass spectrometry study indicated that FOSL1 may serve as a potential marker and therapeutic target for the treatment of central nervous system tumors [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. However, the regulation of FOSL1 in central nervous system tumors remains unexplored, and in-depth studies of the role of FOSL1 in central nervous system tumors, especially gliomas, are necessary. To determine whether FOSL1 could be used as a target for the treatment of glioma, the regulation of FOSL1 in relation to glioma proliferation and the upstream regulatory mechanism of FOSL1 need to be investigated.\\u003c/p\\u003e \\u003cp\\u003eKLF transcription factors (Kruppel-like factors) are a group of zinc finger proteins that are involved gene transcription, and play an important role in the regulation of cell proliferation, differentiation and apoptosis. Aberrant function of KLFs is closely related to the occurrence and development of tumors, cardiovascular and cerebrovascular diseases, metabolic disorders and other diseases [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. In mammals, there are 17 members of the KLF family (KLF1-KLF17), and the physiological and pathological functions of several KLFs have been extensively studied [\\u003cspan additionalcitationids=\\\"CR12\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. KLF14 was identified as a gene associated with fat metabolism and type II diabetes mellitus by genome-wide association analysis (GWAS) [\\u003cspan additionalcitationids=\\\"CR15\\\" citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. In 2011, subcutaneous adipose tissue was extracted from 776 female twins and used for whole genome analysis. The single nucleotide polymorphism rs473170 upstream of KLF14 is associated with the expression of a large number of adipose genes; hence, KLF14 was named \\\"master switch of adipose metabolism\\\" [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. The KLF14 gene has more variants in humans than in other primates [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. In 2015, KLF14 was shown, for the first time, to be significantly associated with the occurrence and development of tumors, and thus considered a new tumor suppressor [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. KLF14 knockout mice develop spontaneous tumors (spleen, thymus, lungs, etc.) and KLF14 knockdown significantly increases the grade of AOM/ DSS-induced colon cancer progression. KLF14 deletion leads to excessive replication of centrosomes and thus induces genomic instability, which is an important cause of tumor occurrence and development [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Analysis of the oncomine database showed significantly reduced transcription levels of KLF14 in various human cancer tissues. These studies demonstrate that KLF14 is a key factor in maintaining normal centrosome replication and genomic homeostasis, and is significantly associated with tumorigenesis, tumor progression, and drug resistance. KLF14 is a tumor suppressor gene whose overexpression or increased activity facilitates tumor killing. However, there are no studies on the role of KLF14 in central nervous system tumors.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we showed that KLF14 inhibited the transcription of FOSL1.There is a negative correlation between KLF14 and FOSL1 in glioma tissues. Overexpression of KLF14 reversed the effect of FOSL1 in cell invasion, migration and epithelial-mesenchymal transition in glioma cells, and this was accompanied by the down-regulation of Snail2 and CD44. Moreover, KLF14 overexpression inhibits tumor progression \\u003cem\\u003ein vivo\\u003c/em\\u003e. In summary, the present results provide strong evidence that FOSL1 inhibition is a prognostic and therapeutic option in GBM. And we suggest that KLF14 is a new tumor molecular marker and a potential target for the treatment of glioma, providing a new target for anti-tumor drug research.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eCell culture and materials.\\u003c/b\\u003e U87 and U251 cells were obtained from the American Type Culture Collection. Cells were maintained in DMEM with 10% (v/v) fetal bovine serum. FOSL1-Si (ShRNA) sequence is 5\\u0026rsquo;- CCGGCCTCAGCTCATCGCAAGAGTACTCGAGTACTCTTGCGATGAGCTGAGGTTTTT-3\\u0026rsquo;. Lenti-Flag-FOSL1 expression plasmid was constructed by inserting the coding regions into Lenti vector. Antibodies were purchased from sigma (FOSL1, GAPDH and KLF14), Proteintech (Snail2 and CD44).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eWestern blotting\\u003c/b\\u003e. Western blotting was performed as previously reported [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. In brief, cells were lysed in lysis buffer (50mM Tris-HCl pH 8.0, 5mM EDTA, 150mM NaCl, 0.5% NP-40, 1mM PMSF), centrifuged for 10min at 12,000 g, and the insoluble debris was discarded. Cell lysates were further analysed with SDS-PAGE and western blotting using specific antibodies.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTissue microarray and IHC staining.\\u003c/b\\u003e Human tissue microarrays of glioma cancer (Shanghai Superbiotek Pharmaceutical Technology Co., Ltd.) were purchased. The clinical characteristics of all samples were downloaded from the Web sites of companies. Antibody against FOSL1 and KLF14 were used for immunohistochemistry staining. The intensity of FOSL1 and KLF14 staining was quantified, scored and graded (low, 0\\u0026ndash;4 point; medium, 5\\u0026ndash;8 point; and high, 9\\u0026ndash;12 point). To ensure an unbiased result, data was collected in a double-blinded manner.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eCell growth analyses\\u003c/b\\u003e. Cell survival was determined by MTT assay.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eClonal formation assay.\\u003c/b\\u003e 1\\u0026times;10\\u003csup\\u003e3\\u003c/sup\\u003e FOSL1 overexpression or knockdown cells and control cells were respectively seeded in 12 well plates and cultured in complete medium for 10 days. Later, cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Then clones per well were observed.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eWound healing experiment.\\u003c/b\\u003e The cells were evenly spread in the six-well plate and, after the bottom was overgrown, a straight line was drawn along the ruler with a 10-\\u0026micro;L pipette tip. The cells were then rinsed with PBS and serum-free medium was added. The cells were placed in a 37\\u0026deg;C, 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e incubator to cultivate, and pictures were taken and saved at 0, 12, and 24 h.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eLuciferase reporter assay\\u003c/b\\u003e. Luciferase reporter assay was performed as previously reported [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. To generate FOSL1 promoter-activated luciferase reporter, -200 to 1000 bp of FOSL1 promoter was subcloned into PGL4.17. Luciferase reporter assay was performed. Briefly, cells in 24-well plates were cotransfected with indicated plasmids and the FOSL1-promoter luciferase reporter plasmid for 24 h. Luciferase was measured using the Dual-Luciferase assay kit (Promega). pRL-TK was co-transfected to normalize transfection efficiency.\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003eTumor growth analysis in mice\\u003c/b\\u003e. Tumor growth analysis was performed as previously reported [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Cells were subcutaneously injected into both flanks of male BALB/c nude mice (~\\u0026thinsp;5 weeks of age). 14 days after injection, mice were treated with PBS or TMZ (10\\u0026micro;g/kg) every day by intraperitoneal injection. At day 30, Animals were treated according to high ethical and scientific standards with oversight by the animal center at Guangzhou University of Chinese Medicine.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eStatistical analyses\\u003c/b\\u003e. The results are expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation, as indicated in the figure legends. Statistical significance was assessed by two-tailed Student t tests. Values of P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 were considered significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFOSL1 transcription is inhibited by KLF14\\u003c/h2\\u003e \\u003cp\\u003eIt has been reported that high expression of FOLS1 is crucial for glioma progression, we explored the factors which regulate FOSL1. In our study, we identified KLF14 as a transcription inhibitor to negatively regulate FOSL1 mRNA expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). Furthermore, overexpression of KLF14 decreased FOSL1 protein level (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). Next, we established KLF14-overexpressed stable cell and found that either mRNA level or protein level of FOSL1 was decreased in KLF14-overexpressed cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC-D). Conversely, FOSL1 mRNA level and protein level were upregulated in KLF14-knockdown stable cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE-F). These results showed that FOSL1 transcription was inhibited by KLF14.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eNegative correlation between KLF14 and FOSL1 in glioma cancer\\u003c/h3\\u003e\\n\\u003cp\\u003ePrevious reports discovered FOLS1 overexpression in glioma cancer, and we next performed immunohistochemistry staining of FOSL1 and KLF14 protein on tissue chips of human glioma cancers. Results showed that there was significantly high protein level of FOSL1, but low protein level of KLF14 in glioma cancers (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). Correlational analysis revealed a significant negative correlation between the protein expression levels of FOSL1 and KLF14 in glioma tumour tissues (Spearman\\u0026rsquo;s r=-0.4 and \\u0026minus;\\u0026thinsp;0.6, respectively) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). In addition, western blotting assay of FOSL1 and KLF14 in human glioma tissue showed that FOSL1 is upregulated whereas KLF14 is downregulated in tumor than peri-tumor (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). Results suggest that there is a negative correlation between FOSL1 and KLF14 in human glioma cancer.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eKLF14 inhibits tumor proliferation and migration through FOSL1\\u003c/h3\\u003e\\n\\u003cp\\u003eTo verify the effect of KLF14 on GBM cell proliferation, cell growth was compared between KLF14 knockdown cells and control cells using the CCK-8 assay. The results showed that cell growth was higher in cells with KLF14 knockdown than in control cells. However, knockdown of FOSL1 reversed the effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA-B). Consistently, the crystal violet staining assay showed that cell proliferation was higher in KLF14 knockdown cells than in control cells, whereas FOSL1 knockdown reversed the effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Next, the results of wound healing assay suggested that KLF14 knockdown cells migrated quicker than control cells. And FOSL1 knockdown blocked the tendency (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Taken together, these results indicate that KLF14 depletion promotes the proliferation and migration of GBM cells, which are caused by upregulation of FOSL1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eKLF14 inhibits tumor proliferation by inducing FOSL1-dependent EMT\\u003c/h3\\u003e\\n\\u003cp\\u003eWhen cancer cells undergo EMT, the Twist, Snail, Slug and CD44 proteins are altered, thus causing cell migration and invasion. It has been reported that FOSL1 upregulates Snail2 and CD44. Therefore, we assessed the expression of these factors to evaluate the phenotypic modulation of KLF14. Knockdown of KLF14 in U87G cells promoted the mRNA expression of Snail2 and CD44, which is reversed by FOSL1 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Consistently, the similar results were observed in U251 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). Furthermore, the protein levels of Snail2 and CD44 is upregulated in U87G cells and U251 cells with KLF14 knockdown. Whereas, the effect is reversed by FOSL1 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC-D). The data suggest that KLF14 inhibits the metastasis of GBM cells by downregulation of FOSL1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eOverexpression of KLF14 inhibits tumor proliferation\\u003c/b\\u003e \\u003cspan type=\\\"BoldItalic\\\" class=\\\"BoldItalic\\\" name=\\\"Emphasis\\\"\\u003ein vivo\\u003c/span\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo verify the role of KLF14 in the development of GBM in vivo, we established a xenograft tumor model for tumorigenesis experiments. U87G cells stably overexpressing KLF14 and vector were subcutaneously injected into nude mice. The results showed that KLF14-overexpression markedly decreased the tumorigenesis of GBM cells compared with the vector group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). In addition, tumor weight was significantly lower in the KLF14-overexpression group than in the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). Similar results were obtained in tumors from U251 cells stably overexpressing KLF14(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC-D). These results confirmed the role of KLF14 in inhibiting GBM \\u003cem\\u003ein vivo\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eFOSL1 plays a carcinogenic role in GBM, and FOSL1 inhibition is a prognostic and therapeutic option in GBM. However, there is a lack of research on the regulation of FOSL1. In this study, we confirmed that FOSL1 is transcription inhibited by KLF14. There is a negative correlation between KLF14 and FOSL1 in glioma tissues. Overexpression of KLF14 reversed the effect of FOSL1 in cell invasion, migration and epithelial-mesenchymal transition in glioma cells. Whether KLF14 targets FOSL1 directly need to be further elucidated.\\u003c/p\\u003e \\u003cp\\u003eSliencing of FOSL1 inhibited tumor proliferation by decreasing levels of EMT markers, such as Twist, Snail, Slug and CD44. However, whether FOSL1 targets these factors directly or indirectly remains unknown. FOSL1 is a component of transcription factor AP-1 complex, and thus may bind to the promoters of these markers to induce their expression. Exploring the mechanism by which FOSL1 regulates EMT is necessary to elucidate the role of FOSL1 as a target for the treatment of central nervous system.\\u003c/p\\u003e \\u003cp\\u003eA previous report showed that KLF14 depletion leads to spontaneous tumorigenesis in mice due to PLK4-dependent centrosome amplification in multiple human cancers[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. However, there is no cell division in nerve cells. Thus, whether KLF14 depletion leads to tumorigenesis in the central nervous system remains unknown. In this study, we showed that knockdown of KLF14 promots cell invasion, migration and epithelial-mesenchymal transition through upregulating FOSL1 in glioma cells, and this was accompanied by the down-regulation of Snail2 and CD44. Moreover, KLF14 overexpression inhibits tumor progression \\u003cem\\u003ein vivo\\u003c/em\\u003e. These results suggest that KLF14 depletion may leads to spontaneous tumorigenesis in the nervous system.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll animal experimental protocols were approved by the guidelines of the Institutional Animal Care and Use Committee of Guangzhou University of Chinese Medicine.All methods were carried out in accordance with relevant guidelines and regulations. This study was carried out in compliance with the ARRIVE guidelines.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Health Science and Technology Development Program of Shandong Province (202102040561)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eX.W and X.Q. performed most of the experiments. H.C and Y.L interpreted data and wrote the manuscript. X.L, K.W, Y.Y, Y.Z and Z.W supervised the study and reviewed the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eOstrom, Q.T., et al., CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2012\\u0026ndash;2016. Neuro-Oncology, 2019. 21(Supplement_5): p. v1-v100.\\u003c/li\\u003e\\n\\u003cli\\u003eWeller, M., et al., European Association for Neuro-Oncology (EANO) guideline on the diagnosis and treatment of adult astrocytic and oligodendroglial gliomas. The Lancet Oncology, 2017. 18(6): p. e315-e329.\\u003c/li\\u003e\\n\\u003cli\\u003eCaputto, B.L., A.M. Cardozo Gizzi, and G.A. Gil, c-Fos: an AP-1 transcription factor with an additional cytoplasmic, non-genomic lipid synthesis activation capacity. Biochim Biophys Acta, 2014. 1841(9): p. 1241-6.\\u003c/li\\u003e\\n\\u003cli\\u003eGalvagni, F., M. Orlandini, and S. Oliviero, Role of the AP-1 transcription factor FOSL1 in endothelial cells adhesion and migration. Cell Adh Migr, 2013. 7(5): p. 408-11.\\u003c/li\\u003e\\n\\u003cli\\u003eJochum, W., et al., Increased bone formation and osteosclerosis in mice overexpressing the transcription factor Fra-1. Nature Medicine, 2000. 6(9): p. 980-984.\\u003c/li\\u003e\\n\\u003cli\\u003eHan, Y., et al., Effects of FOSL1 silencing on osteosarcoma cell proliferation, invasion and migration through the ERK/AP-1 signaling pathway. J Cell Physiol, 2019. 234(4): p. 3598-3612.\\u003c/li\\u003e\\n\\u003cli\\u003eKent, L.N., et al., FOSL1 is integral to establishing the maternal-fetal interface. Mol Cell Biol, 2011. 31(23): p. 4801-13.\\u003c/li\\u003e\\n\\u003cli\\u003eVallejo, A., et al., An integrative approach unveils FOSL1 as an oncogene vulnerability in KRAS-driven lung and pancreatic cancer. Nature Communications, 2017. 8(1).\\u003c/li\\u003e\\n\\u003cli\\u003eBehan, F.M., et al., Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens. Nature, 2019. 568(7753): p. 511-516.\\u003c/li\\u003e\\n\\u003cli\\u003eMcConnell, B.B. and V.W. Yang, Mammalian Kruppel-Like Factors in Health and Diseases. Physiological Reviews, 2010. 90(4): p. 1337-1381.\\u003c/li\\u003e\\n\\u003cli\\u003eblack, Sp1 and Kru\\u0026uml;ppel-Like Factor Family of Transcription Factors in Cell Growth Regulation and Cancer. JOURNAL OF CELLULAR PHYSIOLOGY, 2001: p. 143-160.\\u003c/li\\u003e\\n\\u003cli\\u003eBieker, J.J., Kruppel-like Factors: Three Fingers in Many Pies. Journal of Biological Chemistry, 2001. 276(37): p. 34355-34358.\\u003c/li\\u003e\\n\\u003cli\\u003eSuske, G., E. Bruford, and S. Philipsen, Mammalian SP/KLF transcription factors: Bring in the family. Genomics, 2005. 85(5): p. 551-556.\\u003c/li\\u003e\\n\\u003cli\\u003eRees, S.D., et al., Replication of 13 genome-wide association (GWA)-validated risk variants for type 2 diabetes in Pakistani populations. Diabetologia, 2011. 54(6): p. 1368-1374.\\u003c/li\\u003e\\n\\u003cli\\u003eStacey, S.N., et al., New common variants affecting susceptibility to basal cell carcinoma. Nature Genetics, 2009. 41(8): p. 909-914.\\u003c/li\\u003e\\n\\u003cli\\u003e.Chasman, Forty-Three Loci Associated with Plasma Lipoprotein Size, Concentration, and Cholesterol Content in Genome-Wide Analysis. PLoS Genetics, 2009. 5(11).\\u003c/li\\u003e\\n\\u003cli\\u003eSmall, K.S., et al., Identification of an imprinted master trans regulator at the KLF14 locus related to multiple metabolic phenotypes. Nature Genetics, 2011. 43(6): p. 561-564.\\u003c/li\\u003e\\n\\u003cli\\u003eParker-Katiraee, L., et al., Identification of the Imprinted KLF14 Transcription Factor Undergoing Human-Specific Accelerated Evolution. PLoS Genetics, 2007. preprint(2007): p. e65.\\u003c/li\\u003e\\n\\u003cli\\u003eFan, G.J., et al., Loss of KLF14 triggers centrosome amplification and tumorigenesis. nature communications, 2015. 6.\\u003c/li\\u003e\\n\\u003cli\\u003eVitre, B.D. and D.W. Cleveland, Centrosomes, chromosome instability (CIN) and aneuploidy. Curr Opin Cell Biol, 2012. 24(6): p. 809-15.\\u003c/li\\u003e\\n\\u003cli\\u003eKr\\u0026auml;mer, A., B. Maier, and J. Bartek, Centrosome clustering and chromosomal (in)stability: A matter of life and death. Molecular Oncology, 2011. 5(4): p. 324-335.\\u003c/li\\u003e\\n\\u003cli\\u003eXq, A , et al. Depletion of Kruppel-like factor 15 sensitized gliomas to temozolomide cytotoxicity through O (6)-methylguanine-DNA methyl-transferase. Biochem Biophys Rep, 2021. \\u003cstrong\\u003e27\\u003c/strong\\u003e: p. 101058.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Glioma, tumor progression, KLF14, FOSL1, transcriptional inhibition\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2783574/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2783574/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eGlioma is the most common malignancy of the central nervous system. Fos-like antigen 1 (FOSL1) is overexpressed and acts as a tumor-promoting factor in glioma. However, the regulation of FOSL1 remains unknown. KLF14, a member of Kruppel-like factors that are involved gene transcription, plays an important role in the regulation of cell proliferation, differentiation and apoptosis. Loss of KLF14 triggers spontaneous tumorigenesis of lung, spleen and lymph node, suggesting its potential as biomarker for cancer. However, its role in glioma still needs to be deciphered. Therefore, we explore the interactions between FOSL1 and KLF14, as well as their role in glioma.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eWe first determined that FOSL1 can be transcriptional inhibited by KLF14 using dual-luciferase reporter gene assays and qPCR assays. Then, through immunohistochemistry (IHC)assay and western blotting (WB) assay in glioma tissues, we demonstrated a negative correlation between FOSL1 and KLF14. Next, KLF14 knockdown cells and double knockdown of KLF14 and FOSL1 cells were generated, and cell growth were detected by different experimental methods (MTT assay, crystal violet staining, cell migration assay). We then used qPCR and WB assay to search for and validate how KLF14 affects tumor cell migration through FOSL1. Finally, we confirmed the inhibition of tumor growth by KLF14 using xenograft tumor model.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eIn this study, we showed that KLF14 inhibited the transcription of FOSL1.There is a negative correlation between KLF14 and FOSL1 in glioma tissues. Overexpression of KLF14 reversed the effect of FOSL1 in cell invasion, migration and epithelial-mesenchymal transition in glioma cells, and this was accompanied by the down-regulation of Snail2 and CD44. Moreover, KLF14 overexpression inhibits tumor progression \\u003cem\\u003ein vivo\\u003c/em\\u003e.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e \\u003cp\\u003eThe present results suggest that KLF14 is a new tumor molecular marker and a potential target for the treatment of glioma, providing a new target for anti-tumor drug research.\\u003c/p\\u003e\",\"manuscriptTitle\":\"KLF14 inhibits tumor progression via FOSL1 in glioma\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-05-18 13:44:21\",\"doi\":\"10.21203/rs.3.rs-2783574/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"4146161c-7362-4e85-abcb-1f737bbcbaac\",\"owner\":[],\"postedDate\":\"May 18th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-12-10T11:59:21+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-05-18 13:44:21\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2783574\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2783574\",\"identity\":\"rs-2783574\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}