{"paper_id":"3f579ab1-d5cb-4fe9-8de8-4db64b6bab62","body_text":"LAP2α Orchestrates Alternative Lengthening of Telomeres Suppression through Telomeric Heterochromatin Regulation with HDAC1: Unveiling a Potential Therapeutic Target | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article LAP2α Orchestrates Alternative Lengthening of Telomeres Suppression through Telomeric Heterochromatin Regulation with HDAC1: Unveiling a Potential Therapeutic Target Feng Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3917613/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Oct, 2024 Read the published version in Cell Death & Disease → Version 1 posted 9 You are reading this latest preprint version Abstract In response to the challenge of telomere attrition during DNA replication, cancer cells predominantly employ telomerase or, in 10%-15% of cases, the alternative lengthening of telomeres (ALT). The intricate details of ALT, however, remain elusive. In this study, we unveil that the knockdown of lamina-associated polypeptide 2 alpha (LAP2α) in ALT cells results in telomere dysfunction, triggering a notable increase in ALT-associated hallmarks, including high frequencies of PML bodies (APBs), C-rich extrachromosomal circles (C-circles), and telomere sister chromatid exchange (T-SCE). Furthermore, LAP2α emerges as a crucial player in the process of break-induced telomere replication for telomerase-positive cells following telomeric double-strand breaks. Mechanistically, our investigation underscores LAP2α's role in hindering the recruitment of homologous recombination factors (e.g., RAD52 and RPA2) to telomeres. This occurs through the regulation of the heterochromatic state of telomeres, thereby increasing telomeric accessibility. Consistent with our findings, LAP2α expression is markedly diminished in ALT-positive Osteosarcoma. The use of methotrexate (MTX), which restores the lost heterochromatin state induced by LAP2α depletion, effectively reverses ALT characteristics. This is highlighted by a significant inhibition of tumor proliferation, specifically in ALT-positive patient-derived xenograft (PDX) mouse models. These results underscore the critical role of LAP2α in regulating ALT activity, offering significant insights into the interplay between lamina-associated proteins and telomeres for maintaining telomere length. Of paramount significance, our findings contribute to the identification of a more appropriate target population for the osteosarcoma therapeutic drug, MTX. Biological sciences/Cell biology/Chromosomes/Telomeres Biological sciences/Cancer/Bone cancer LAP2α nuclear envelope Telomere ALT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Telomere is a nucleoprotein structure found at the end of the linear chromosome, which is composed of TTAGGG repetitive DNA and shelterin complex. Human shelterin is a six-subunit complex (TRF2, TRF1, RAP1, TPP1, TIN2, and POT1) that binds telomeres and shields the ends of chromosomes from degradation and end-to-end fusions 1 . Due to the terminal replication problem, the length of the telomere gradually shortened with continuous cellular proliferation ,and the cells will eventually undergo cell cycle arrest then cellular senescence 2 . Activation of telomere maintenance mechanism to prevent excessive telomere shortening is required for the sustained proliferation in cancer cells 3 . Most of cancers use telomerase to extend their telomeres 4 but 10–15% of cancers elongate their telomere through telomerase independent pathway, which is named alternative lengthening of telomeres (ALT) 5 , 6 . ALT was firstly found in the telomerase mutational budding yeast 7 and then it was observed in human tumors. In the past decades, researchers have done a lot of work to uncover the molecular mechanism of ALT. Even though the precise molecular mechanism of ALT is still unclear. It is widely accepted that ALT is a DNA repair process dependent homologous recombination process 8 , which is represented by the appearance of a variety of hallmarks, including extra chromosome telomere repeat (CTR, such as C-circle), ALT associated PML bodies (APBs), heterogeneity of telomere length, and telomere sister chromatid exchange (T-SCE) 5 . In addition, accumulating evidence indicates that the long noncoding RNA (lncRNA) telomeric repeat-containing RNA (TERRA) are elevated in ALT cells 9 , 10 . The current studies revealed that the presence of recombinase RAD51 and RAD52 are essential for ALT telomere maintenance 11 . Inhibition of RAD52 decreases the natural ALT telomere synthesis at APBs in G2 cells 12 , and the depletion of RAD51 leads to an increase of fragile telomeres and telomere dysfunction induced foci in ALT cells but not affects the mitotic DNA synthesis (MiDAS) at telomeres 13 . Instead of directly taking part in ALT DNA homologous recombination, RAD51 may mainly functions in lessening telomere fragility by suppressing the stalled replication forks. Moreover, RAD52-mediated telomeric MiDAS is observed in both ALT positive and telomerase positive cells when cells encounter with exogenous DNA damage or replication inhibitor, indicating that RAD52 is essential for break induce replication (BIR) at collapsed forks and fragile sites. Interestingly, a most recent study demonstrates that the c-circles levels are not altered in RAD52 knockdown cells, suggesting that there is a RAD52-independent ALT pathway, which is responsible for C-circles generation during telomere damage 14 . In addition, POLD3/POLD4 are reported to be required for the conservative DNA replication during BIR, which could be enhanced by BLM and reduced by SLX4 15 . In ALT positive human cells, telomeres undergo conservative synthesis also rely on POLD3/4, thereby linking ALT to BIR. 53BP1 nuclear bodies are formed when DNA damage occurs in S phase, however it is excluded from DNA breaks during mitosis. In contrast, the ssDNA-binding protein RPA can bind to exposed ssDNA in M-phase 16 . Recent research reported that RPA plays critical roles in protecting resected ssDNA upon chromosome breakage and promoting the successful progress of telomeric MiDAS 17 . In addition, the elevated level of TERRA suggests it plays a crucial role in ALT telomeres recombinogenic by forming R-loop or RNA–DNA hybrids with the telomeric C-rich DNA strand, which contributes to activation of the DNA damage response (DDR) and promotes recruitment of the recombinase. 18 , 19 . The aberrant accumulation of phosphorylated RPA at ALT telomeres when the RNaseH1 was deleted, which regulates the levels of RNA-DNA hybrids between telomeric, indicates that RPA itself could promote the forming of R-loop. Supporting this, it has been reported that the C-rich telomeric ssDNA accumulate in ALT cells when the RPA was depleted 20 . Moreover, in yeast, the telomeres are bound by the Rap1 protein, Rap1 interacts with Sir3 and Sir4 that, together with the histone deacetylase Sir2, which initiate heterochromatin formation in subtelomeric regions 21 . The Sir2/Sir3/Sir4 complex also restricts TERRA expression via transcriptional repression 22 . So the roles of RPA and RAP1 in TERRA R-loop regulation in human ALT cells deserve further explore. Previous studies have shown that Lamin A/C is involved in DNA damage repair and telomere maintenance 23 – 26 . As a lamina associated protein, lamina associated polypeptide 2(LAP2) belongs to the LEM domain protein family. There are six splicing isoform encoded by the TMPO , including LAP2 α, β, γ, δ, ε,and ζ 27 . All isoforms have LEM domain and LEM-like domain, by which to interact with BAF protein and bind to DNA 28 , 29 . Unlike the other isoforms, LAP2α and ζ lacks transmembrane domain, thus they could only localize at nucleoplasm with Lamin A/C 30 , 31 . In addition, it is reported that LAP2α interacted with WRN helicase and Ku86 25 , which are essential for classical non-homologous end joining repair and telomere integrity during telomeric DNA damage repair 32 – 34 . Moreover, it has been recently reported that LAP2α could promote the deposition of RPA on damaged DNA and facilitate the homologous recombination (HR) 35 . It has been demonstrated that, the distribution of LAP2α in cells changes with cell cycles 36 , and it binds to telomere or sub-telomere at the anaphase and telophase of mitosis 37 . Additionally, it has demonstrated that LAP2α could located at the end of chromosome and colocalized with telomere, during anaphase and telophase of mitosis. Thus, we speculate that LAP2α might play a critical role in break induced replication mediated alternative telomere lengthening. In this study, we demonstrated the interaction of LAP2α with the shelterin complex. The knockdown of LAP2α resulted in a significant increase in ALT-associated hallmarks, including APBs, C-circles, and T-SCE, emphasizing LAP2α's crucial role in ALT maintenance. Subsequent investigations unveiled that LAP2α depletion led to the recruitment of recombination factors, such as RPA and RAD52, to telomeres. Moreover, LAP2α was found to interact with HDAC1, potentially contributing to the de-repression of the heterochromatin state of telomeric DNA, promoting telomere recombination and ALT occurrence. This observation aligns with our findings that LAP2α expression is low in ALT-positive osteosarcoma patients. Furthermore, methotrexate (MTX), a widely used drug for treating osteosarcoma, has been reported to enhance DNA heterochromatinization. Our discovery revealed that MTX treatment increased the aggregation of H3K9 trimethylation and HP1 in the telomeric region. Notably, in our patient-derived xenograft (PDX) model, MTX exhibited specific inhibition of the proliferation of LAP2α-low-expressing ALT-positive osteosarcoma tumors. Mechanistically, our data provide initial evidence that the lamina-associated protein LAP2α intricately participates in ALT telomere synthesis by regulating telomeric heterochromatin status. This breakthrough opens new avenues for unraveling the precise molecular mechanisms underlying ALT, offering promising insights for future investigations. Importantly, our findings enhance the targeted use of MTX, providing a critical context for its improved clinical performance. Results LAP2α interacted with shelterin complex and LAP2α deficiency induced dysfunctional telomeres of ALT positive cells Previous research has suggested that LAP2α, a lamin-associated protein, may participate in nuclear membrane reconstruction during mitosis and localize to the end of chromosomes during anaphase and telophase 36 . This led us to investigate whether LAP2α was necessary for telomere maintenance. We initially validated the interaction between LAP2α and telomeres through proximity ligation assays (PLA), confirming the association between LAP2α and telomere binding proteins TRF1 and TRF2. This assessment was conducted in both ALT-positive U2OS and SAOS2 cells, as well as telomerase-positive HeLa cells (Fig. 1 A, B and Supplementary Fig. S1 A). PLA foci were present in all three cell lines, and the knockdown of LAP2α in these cell lines significantly reduced the PLA foci. These findings suggest that LAP2α interacts with the shelterin complex in vivo, regardless of whether the cells are ALT-positive or telomerase-positive. We then tested whether LAP2α plays a role in telomere maintenance by transiently transfecting cells with LAP2α siRNA (Fig. 1 C) and examining telomere defects, including fragile telomere formation and telomere loss, in metaphase cells. Our results showed that LAP2α knockdown in U2OS cells significantly increased the number of fragile sites on telomeres and the number of chromosomes ends lacking telomere FISH signals (SFE) compared to siNC controls (Fig. 1 D, E). However, we did not observe any effect of LAP2α knockdown on telomere maintenance in HeLa cells (Fig. 1 F, G). To further confirm the non-specific role of LAP2α in osteosarcoma cells, telomerase-positive osteosarcoma cells MG32 were utilized. Even in MG32 cells, we did not observe any impact of LAP2α knockdown on telomere maintenance (Supplementary Fig. S1 B, C). These findings suggest that, despite LAP2α interacting with telomeres in multiple cell types, it is crucial for telomere maintenance specifically in ALT cells, not in telomerase-positive cells. Knockdown of LAP2α elevates the telomeric homologous recombination and extends the telomere length of ALT cell Next, we aimed to further understand the role of LAP2α in ALT cells. Mechanistically, ALT is a telomere elongation mechanism that relies on homology-directed repair 38 , 39 , which leaded to telomere aggregation termed \"telomere clustering\" 40 . Therefore, we examined the effect of LAP2α disruption on telomere clustering in ALT cells. U2OS and SAOS2 cells were transfected with two different LAP2α siRNAs for 72 hours (Fig. 2 A), and the percentage of cells with clustered telomeres was determined. The results showed that the percentage of U2OS (Fig. 2 B, C) and SAOS2(Fig. 2 D, E) cells with telomere clustering significantly increased upon LAP2α depletion. To directly observe telomeric homologous recombination in ALT cells, telomere chromosome orientation fluorescence in situ hybridization (CO-FISH) was carried out, and the occurrence of telomere sister chromatid exchange (T-SCE) events was determined. Consistent with the results of telomere clustering, the frequency of chromatid exchange was significantly increased in LAP2α-knockdown U2OS cells (Fig. 2 F, G). These findings support the idea that LAP2α inhibits telomeric homologous recombination in ALT cells. Furthermore, we estimated telomere length by quantitative-FISH (Q-FISH) using two Alexa 488-labeled or Cy3-labeled PNA probes. The average fluorescence unit (AFU) was used to reflect relative telomere length. Our results showed that the telomere length was slightly extended when LAP2α was knocked down with both probes (Fig. 2 H, I and Supplementary Fig. S2 A, B). LAP2α depletion stimulates the formation of hallmarks of ALT Although the precise molecular mechanism of ALT remains unclear, there are several hallmarks of ALT, including the formation of APBs and C-circles. To better understand the function of LAP2α in the ALT pathway, we examined the formation of APBs by determining the colocalization of PML and telomeric DNA in LAP2α knockdown U2OS and SAOS2 cells. The results showed that the average number of APBs per cell was significantly increased upon LAP2α removal (Fig. 3 A, B, C). Consequently, a rescue experiment was conducted by re-expressing the doxycycline (DOX)-inducible RNAi-resistant LAP2α in the knockdown cell lines, and we observed that the recovery of LAP2α restrained the formation of APBs in both cell lines (Fig. 3 A, B, C). In addition, upon LAP2α depletion, the formation of C-circles was significantly increased in two ALT cell lines, and subsequent rescue experiments further confirmed that LAP2α depletion stimulates the ALT process (Fig. 3 D, E). Meanwhile, LAP2α was knocked down in telomerase-positive HeLa cells and telomerase-positive osteosarcoma cells MG32, and the formation of C-circles was examined. We found that LAP2α deficiency alone could not enough to initiate the formation of C-circles (Supplementary Fig. S3 A). These findings confirm that LAP2α inhibits the occurrence of ALT, but the knockdown of LAP2α alone is not sufficient to initiate ALT in telomerase-positive cells. Previous reports have shown that sustained double-strand breaks (DSBs) at telomeric DNA can lead to the formation of ALT-like characteristics and result in the initiation of recombination and elongation of telomeres in telomerase-positive cell lines 15 , 41 , 42 . Thus, we attempted to deliberate the role of LAP2α in telomerase-positive cells upon telomeric DNA breaks. Firstly, double-strand telomeric DNA breaks were induced in HeLa cell lines using CRISPR-CAS9-sgTel system, which consists of sgRNA targeting telomeric DNA as previously reported 43 . Immunofluorescence (IF) and fluorescence in situ hybridization (FISH) were performed to visualize the localization of 53BP1, an indicator of DNA damage response, with telomeres to verify the formation of telomeric-specific breaks. As expected, 53BP1 was recruited to telomeres to form telomere dysfunction foci (TIF) in HeLa cells after infection with CAS9-sgTel lentivirus (Fig. 3 F). And the hallmarks of ALT, such as the formation of APBs and C-circles, were observed be induced in HeLa cells upon treatment with CAS9-sgTel lentivirus (Supplementary Fig. S3 B, C, D). Moreover, when we knocked down LAP2α after telomeric DNA breaks were induced, the formation of C-circles caused by CAS9-sgTel was significantly exacerbated (Fig. 3 G). This finding again proves that LAP2α is crucial for telomeric break-induced repair and the initiation of telomere recombination in telomerase-positive cells upon breaks. LAP2α repressing the recruitment of recombination factors to telomeres RPA (replication protein A), the sensor of single-stranded DNA (ssDNA) that plays an essential role in DNA damage repair and homologous recombination, has been shown to colocalize with telomeric DNA in human ALT cells 44 , 45 . Therefore, we examined the recruitment of RPA to telomeres by IF-FISH when LAP2α was knocked down. We observed a significant increase in the colocalization of RPA (RPA2) with telomeres upon LAP2α depletion (Fig. 4 A, B). Furthermore, RPA is crucial for the assembly of RAD52 recombinase during DNA double-strand break repair 46 , 47 , and RAD52 plays an important role in homologous telomere elongation in ALT cells 12 , 14 , 48 . Therefore, we also examined the recruitment of RAD52 to telomeres upon LAP2α depletion. Similarly, the recruitment of RAD52 to telomeres in U2OS cells increased after LAP2α knockdown (Fig. 4 C, D). We were unable to detect any foci of Rad51; therefore, we could not determine the colocalization of Rad51 and telomeres (Supplementary Fig. S4 A). Taken together, these findings indicate that the absence of LAP2α promotes the recruitment of recombination factors, including RPA and Rad52, to telomeres, thereby facilitating the ALT process. Lack of LAP2α decreased the heterchromatin status of telomere The integrity of telomeric heterochromatin is thought to be a suppressor of ALT, given that the highly condensed chromatin structure inhibits recombination processes 49 , 50 . Loss of nuclear lamina proteins, such as Lamin A/C 51,52 and SUN 53 , can alter the degree of DNA heterochromatinization. Additionally, LAP2α has been documented to interact with histone deacetylases (HDAC1), reinforcing the role of heterochromatin in chromatin condensation 54 , 55 . Therefore, our subsequent investigation delved into the interaction between LAP2α and HDAC1, alongside the assessment of histone epigenetic modifications at the telomere region following LAP2α depletion. Proximity ligation assay (PLA) results demonstrated the in vivo interaction between endogenous LAP2α and HDAC1 (Fig. 5 A). Moreover, LAP2α disruption led to a ~ 30–40% reduction in H3K9 trimethylation and altered HP1 localization at telomeric repeats (Fig. 5 B, C, D), suggesting that LAP2α depletion may impede the recruitment of HDAC1 to telomeres, consequently inducing telomeric chromatin decondensation. It has been reported that mutations in the demethylase KDM4B can reduce DNA heterochromatinization and enhance telomeric accessibility. This alteration correlates with increased levels of heterochromatin-associated proteins, including H3K9me3, ATRX, and HP1, observed in KDM4B knockout cells. To further validate the role of LAP2α in driving the formation of Alternative Lengthening of Telomeres (ALT) through the regulation of telomeric DNA heterochromatin status, KDM4B was depleted in siLAP2α U2OS cells to attenuate heterochromatinization in the telomeric region. Subsequently, its impact on ALT formation was elucidated by assessing C-circle formation. The current results indicate that the levels of H3K9me3 and HP1 at telomeres increased upon KDM4B knockdown in both siNC and siLAP2α U2OS cell lines (Fig. 5 B, C, D). Furthermore, the heightened C-circle formation induced by LAP2α knockdown was rescued by depleting KDM4B (Fig. 5 E, F). These findings underscore the pivotal role of LAP2α in driving the formation of Alternative Lengthening of Telomeres (ALT) through the regulation of telomeric DNA heterochromatin status. To further investigate the impact of LAP2α on chromatin accessibility, we performed ATAC-seq analysis targeting the telomere region. Strikingly, our results demonstrated a significant increase in the number of accessible telomeres upon LAP2α depletion, providing further evidence for the stimulation of telomere accessibility by LAP2α disruption (Fig. 5 G). Moreover, we explored the effect of LAP2α depletion on the accessibility of other genomic regions, including the 5’-UTR, 3’-UTR, gene body, and TSS. Remarkably, we observed a significant suppression of accessibility following LAP2α depletion, suggesting that LAP2α may exert a distinct regulatory function in modulating accessibility at various genomic loci (Fig. 5 H). TERRA, transcribed from telomeric repeat-containing RNA, was reported to be down-regulated by the heterochromatic status of telomeric DNA (Nanavaty, Sandhu, Jehi, Pandya, & Li, 2017). To further confirm the role of LAP2α in regulating the heterochromatin state, we detected TERRA transcripts from individual chromosomes (including 9p, 17p, and 5q) and found that the TERRA transcribed from these chromosomes was significantly elevated in LAP2α knockdown U2OS cells(Fig. 5 I) and SAOS2 cells (Supplementary Fig. S5 A) Taken together, our data indicate that LAP2α knockdown results in the loss of telomeric heterochromatin, ultimately promoting the telomeric accessibility and the occurrence of ALT, potentially through the recruitment of deacetylase HDAC1 to chromosome ends. LAP2α expression is lower in ALT-positive osteosarcomas(OS) and associated with poorer survival To further explore the LAP2α expression and its impact on ALT positive tumor outcomes, we collected data from 39 OS cases, including 21 ALT-positive and 12 ALT-negative cases (Table.1). Through immunohistochemistry, we analyzed LAP2α expression in 33 osteosarcoma tissues and 4 normal tissues (Fig. 6 A). Expression levels were grouped as high or low based on a predetermined cut-off, and the C-circle signal distinguished ALT-negative and ALT-positive cases. Our analysis revealed significantly lower LAP2α expression in ALT-positive OS compared to ALT-negative OS and normal tissue (Fig. 6 B). Kaplan-Meier analysis demonstrated poorer overall survival in ALT-positive cases (Fig. 6 C) and better outcomes with increased LAP2α expression (Fig. 6 D). Taken together, our findings suggest that the downregulation of LAP2α could serve as a potential marker or therapeutic target in managing the more aggressive ALT-positive osteosarcoma. Methotrexate Reverses LAP2α-Induced Telomeric Chromatin decondensation, Offering Therapeutic Precision in Osteosarcoma As previously mentioned, the knockdown of LAP2α has been associated with the promotion of ALT by decondensing telomeric chromatin. Given that methotrexate, a commonly used chemotherapy drug for osteosarcoma, has recently been identified as a heterochromatin-promoting agent by increasing the level of H3K9me3 56 , we aimed to investigate whether methotrexate could restore telomeric chromatin decondensation caused by LAP2α knockdown. Chromatin immunoprecipitation (ChIP) was performed, and telomeric heterochromatin markers H3K9me3 and HP1 were detected using dot blot analysis. The results demonstrated that the decrease in H3K9me3 and HP1 induced by LAP2α depletion was restored by methotrexate treatment (Fig. 7 A, B), indicating the capacity of methotrexate treatment to counteract the decreased heterochromatinization induced by the knockdown of LAP2α. Subsequently, the C-Circle generation was determined. And we observed that the C-Circle signal was also reduced by ~ 34.5% after methotrexate treatment compared to the LAP2α depleted cells (Fig. 7 C, D). This additional observation lends further support to the notion that LAP2α plays a crucial role in influencing the occurrence of ALT, and that methotrexate can modulate this mechanism. Given the subdivision of osteosarcoma into ALT + and ALT- categories, where ALT + exhibits a more open chromatin level in the telomere region compared to ALT-, we sought to determine if methotrexate exhibits differential sensitivity in these subtypes, aiming to offer improved guidance for clinical medication. To explore this, we established an osteosarcoma tumor patient-derived xenograft (PDX) mouse model, successfully generating one ALT-positive PDX and one ALT-negative PDX mouse. Subsequently, tumor tissues were extracted, dissociated into cells, and then re-implanted into NSG mice to establish a second generation of PDX mice. The mice were divided into four groups (n = 12 mice per group) and subjected to treatment with either vehicle or 0.5 mg/kg/day methotrexate. Tumor volume and weight were closely monitored throughout the course of methotrexate treatment. These results revealed a significant reduction in ALT + tumor growth following methotrexate treatment compared to the vehicle-treated group (Fig. 7 E). Intriguingly, methotrexate exhibited no observable impact on ALT- PDX tumor growth relative to the vehicle-treated group (Fig. 7 F, G). These findings strongly suggest that for patients with the more aggressive ALT + phenotype, characterized by lower LAP2α expression, they may benefit from MTX treatment. Once again, this reaffirms that categorizing osteosarcoma based on the telomere extension pathway has the potential to enhance guidance for clinical medication decisions. Discussion Telomeres and telomerase are targets for anticancer drug development and specific inhibitors are currently under clinical investigation. However, only a few telomerase inhibition approach have been used in clinical settings, possibly due to the activation of the ALT pathway in response to persistent telomere DNA damage caused by these inhibitors, leading to increased tumor aggressiveness 57 , 58 . Therefore, understanding the telomere maintenance mechanism underlying the transition between the telomerase-dependent and ALT pathway is critical. This study reveals that LAP2α interacts with telomeres (TRF1/TRF2), suppressing ALT by inhibiting recombination factor recruitment. The occurrence is likely associated with its interaction with HDAC1, which contributed to a reduction in heterochromatinization and stimulated accessibility of telomere. In addition, the observation that LAP2α expression is increased in ALT-negative osteosarcoma patients further supports its significance in suppressing homologous recombination-mediated telomere lengthening. Patients with lower LAP2α expression in ALT-positive osteosarcoma exhibit a poorer prognosis and lower survival rates, prompting the consideration of whether enhancing heterochromatinization caused by LAP2α depletion can impede the growth of ALT tumors. Coincidentally, methotrexate (MTX), a common drug for osteosarcoma, is known to enhance DNA heterochromatinization. The administration of MTX was observed to inhibit ALT occurrence and suppress the proliferation of LAP2α lower-expressed ALT-positive patient-derived xenograft (PDX) tumors. In contrast, its impact on ALT-negative OS tumors was not pronounced. These findings offer valuable insights into the regulation of telomere maintenance and may have implications for the development of novel therapeutic strategies targeting telomere maintenance in ALT-positive cancers. Until now, the detailed molecular mechanism of the ALT pathway has not been fully understood. It has been suggested that ALT maintains telomeres through a homology-directed repair (HDR) process, involving various recombination factors, such as RPA, RAD51/RAD52, BLM, and SLX4 59 . Upon DNA damage, cells initiate a DNA damage response process, resulting in a temporary opening of the chromatin structure around the damaged sites. This facilitates the access for DNA repair complexes to the affected regions. ALT is considered a telomere break-induced replication process, requiring the decondensation of telomeric DNA 60 , 61 . Typically, compacted heterochromatin is situated at the nuclear periphery, closely associated with the nuclear envelope (NE). Nuclear envelope proteins play roles in facilitating the attachment of telomere to the nuclear lamina (NL) 62 . Although LAP2α's effect on telomeres is not well-explored, studies have elucidated the significant role of lamins in telomere homeostasis 23 , 63 , 64 . Lamin A, for instance, interacts with TRF2, contributing to the stabilization of chromosome-end structures 65 . Diminished of lamin A/C or LMNA mutations stimulate telomere-telomere recombination 66 and reduced interstitial telomere-loop formation 67 . Furthermore, the interaction between SUN1, a protein interacting with Lamin A, and RAP1 establishes a link between the nuclear envelope (NE) and the shelterin complex 37 , 68 . SUN1/2 interactions with the DNA-dependent protein kinase (DNAPK) complex contribute to telomere nonhomologous end-joining repair 69 . These collective insights shed light on the intricate interplay of nuclear envelope associated molecular components in the regulation of telomeres integrity. Notably, LAP2α expression has been observed to mitigate the LMNA mutations-induced loss of H3K27me3, an epigenetics modification typically associated with gene silencing and chromatin compaction, especially in the telomere region 70 . In addition, the co-localization of LAP2α with telomeres and H3K27me3 undergoes attenuation in Hutchinson-Gilford Progeria Syndrome (HGPS), a condition caused by mutations in the LMNA gene 71 . These observations offer insights into the pivotal role of LAP2α in the regulation of chromatin organization. Mechanistically, our study demonstrates that LAP2α can interact with histone deacetylases to maintain a heterochromatic state at telomeres. These findings provide new insights into the role of nuclear architecture in regulating chromatin organization by LAP2α, particularly in its role of suppressing homology-directed repair in ALT cells or telomerase-positive cells in response to telomeric damage. Interestingly, the depletion of LAP2α is not sufficient to induce the formation of ALT features, indicating that it does not play a role in the initiation of ALT. Instead, it appears to balance homologous recombination to maintain telomere length after ALT activation. While a recent study reported that LAP2α could associate with Replication Protein A (RPA) and facilitate its deposition to damaged chromatin during homologous recombination 35 . However, our findings reveal a distinctive occurrence at telomere, that the disruption of LAP2α increases the recruitment of RPA to telomeric DNA. Previous research in mammalian cells has established that ALT is a break-induced replication (BIR)-related process, representing a late DNA synthesis persisting through G2-M phase into mitosis, referred to as mitotic DNA synthesis (MiDAS) 72 – 74 However, classical homologous recombination (HR), primarily activated during the S and G2 phases, repairs genomic DNA double-strand breaks (DSBs) 75 . Our current data suggest that LAP2α's involvement in telomere homology-directed replication may differ from its role in ordinary genomic homologous recombination. Methotrexate (MTX), a widely used drug in osteosarcoma treatment, has been identified as a potential molecule with the ability to increase heterochromatinization 56 . In our cell-based research, MTX induced enhanced heterochromatinization in the telomeric region, counteracting the chromatin decondensation caused by LAP2α depletion and subsequently suppressing ALT production. Furthermore, in the subsequent patient-derived xenograft (PDX) model, MTX effectively inhibited the growth of ALT-positive osteosarcoma tumors. However, the clinical subtyping of tumors based on ALT and the implementation of targeted therapies have not been actively pursued. Therefore, the use of MTX in the clinical treatment of ALT-positive osteosarcoma may potentially expand the benefits for relevant patients. In conclusion, the findings from this study illuminate LAP2α's pivotal role in suppressing telomere-telomere recombination and Alternative Lengthening of Telomeres (ALT) activity. The study underscores LAP2α's significance in ALT formation, emphasizing the intricate interplay between telomere-nuclear envelope association and ALT activity, closely linked with heterochromatin structure. Notably, in a patient-derived xenograft (PDX) model, methotrexate (MTX) exhibited a specific inhibitory effect on LAP2α-low-expressing ALT-positive osteosarcoma tumors. This discovery opens up a promising avenue for targeted clinical applications, suggesting MTX as a potential therapeutic agent for the specific treatment of ALT-positive osteosarcomas. The comprehensive nature of these findings not only emphasizes LAP2α's critical role in ALT but also positions MTX as a potential therapeutic option, potentially extending its applicability to other ALT-positive tumors. Further research and clinical investigations are warranted to explore the full scope of LAP2α and MTX as key players in the targeted therapy landscape for ALT-positive cancers. Materials and methods Cell culture and treatment U2OS, HeLa, 293T, and SAOS2 cells were obtained from American Type Culture Collection (Manassas, VA). Cells were cultured at 37°C and 5% CO2. U2OS and 293T cells were grown in DMEM (Corning) supplemented with 10% fetal bovine serum (FBS, gibco) and 1% penicillin/streptomycin (Hyclone). HeLa cells were grown in 1640 (Corning) with 10% FBS. SAOS2 cells were grown in McCoy's 5A (Hyclone) with 15% FBS and 1% penicillin/streptomycin (Hyclone). All cell lines were identified by standardized short tandem repeat analysis. Mycoplasma was regularly examined during cell culturing, and no contamination occurred during this study. Sequences of the various siRNAs used in the study are: NC(negative control): 5′-UUCUCCGAACGUGUCACGUdTdT-3′; siLAP2α-1:5′-GCAACACAGAUAUUAU CAGdTdT-3′; siLAP2α-2:5′-GUCUAGAAGUGGCUAAGCAdTdT-3′; siLAP2β-1: 5′-GGGAUAUUCUUAAGGAAAUdTdT-3′;siLAP2β-2:5′-GGUGGAAACUUCAG- AACAUdTdT-3′. RT-qPCR Total RNA was extracted with Eastep® Super Total RNA Extraction kit (Promrga) and cDNA was prepared with HiScript II Q Select RT SuperMix for qPCR (Vazyme) following the manufacturer’s instruction. qPCR reactions were performed with ChamQ SYBR qPCR Master Mix (Vazyme, China). GAPDH was used for normalization. qPCR primers are listed in the Supplementary Table. Antibodies and western blot analysis. The antibodies used for western blot analysis were as follows: anti-GAPDH (affinity, AF0911, dilution1:5000), anti-LAP2α (Abcam, catalogue no. ab5162, dilution 1:1000). For immunoblotting, Whole cell lysates were isolated using RIPA buffer, quantified using the Pierce TM BCA protein assay kit (Thermo Scientific, Waltham, MA), separated by SDS-PAGE and transferred onto nitrocellulose membranes. The lysate was resolved on SDS–PAGE gel. The separated proteins were then blotted on a nitrocellulose plus membrane Membranes were blocked for 1hr in 5% non-fat dry milk in TBS/0.1% Tween-20 and incubated with appropriate primary antibody in blocking solution overnight at 4°C. The membranes were washed 3×15 min with TBS/0.1% Tween-20 and incubated with appropriate secondary antibody in blocking solution for 1 h at room temperature. Chemiluminescence detection was performed using an ECL (MILLIPORE). Plasmid Construction and Lentivirus Production The pLenti-TRE-LAP2α-CBH-Tet-On@3G vector was gifts from Dr. Lei Shi (Tianjin medical University, China) and the lenti-CRISPRv2 consisting of Flag-Cas9 enzyme and sgRNA were gifts from Yong Zhao (Sun Yat-sen University, Guangzhou ). Briefly, the guiding sequence GTTAGGGTTAGGGTTAGGGTTA (referred to as sgTel in the text) was used to induce DSBs in telomeres. The scrambled sequence TGCTCCGTGCATCTGGCATC (referred to as sgScr in the text) was used as a control. For the production of the lentivirus, briefly, before transfection, plate 293T lentiviral packaging cells in a 10-cm dish in 10 ml of DMEM supplemented with 10% fetal bovine serum so that the cells are 70–80% confluent at the moment of transfection. In a sterile polypropylene tube, dilute 10 µg of lentiviral expression plasmid into 500 µl of Opti-MEM® I (Invitrogen). In a separate tube, dilute 50 µl of Polyetherimide (PEI) into 500 µl of Opti-MEM I. Add diluted PEI reagent drop-wise to the plasmid solution while gently vortex the DNA-containing tube. Incubate the mixture for 20 minutes at room temperature to allow the plasmid-PEI complex to form. Add the complex directly to each dish. Replace the overnight culture medium with fresh DMEM medium. Collect the supernatant 48 hours post transfection and centrifuge the tubes at 500 g for 10 minutes to get rid of cell debris and stored at − 80°C until use. Immunofluorescence -fluorescence in situ hybridization (IF-FISH) Cells were grown on a coverslip, washed with PBS and fixed in 4% paraformaldehyde for 5 minutes at room temperature, and then permeabilized in 0.5% Triton X-100 at room temperature for 30 minutes. The cells were washed thrice with PBS and blocked with 5% goat serum for 1 hour at room temperature. The cells were first incubated with primary antibody (anti-PML, Santa Cruz; anti-RPA2, Abcam; anti-RAD52, Santa Cruz; anti-53BP1, Abcam) overnight at 4°C and then with secondary antibody conjugated with Alex488 or Alex555 for 1 hour at room temperature. The coverslip was washed with PBST and fixed in 4% paraformaldehyde for 10 minutes. Dehydrated in 70%, 95%, and 100%, denatured at 85°C for 5 minutes, hybridized with Cy3-labeled or Alex488-labeled CCCTAA PNA probe (Panagene) for 2 hours at 37°C, washed and mounted with the 4′,6-diamidino-2-phenyl-indole (DAPI, D3571, Life Technologies, Carlsbad, CA). Fluorescence was detected and imaged using fluorescence microscope (Nikon, Tokyo, Japan). Chromosome orientation fluorescence in suit hybridization (CO-FISH) After 54 hours of last transfection with siRNA, U2OS cells were incubated with BrdU for 18 hours; Colchicine (1µg/ml) was added 5 hours before harvest. Cells were trypsinized and resuspended in a hypotonic solution of 0.075 M KCl incubated at 37°C for 30 minutes. The cells were fixed thrice with methanol:acetic acid (3:1) for 10 minutes each time. The cells were then spread onto slides, digested with pepsin (1 mg/ml) for 40 seconds, and exposed to UV (365 nm, UVP-CL1000) in the presence of Hoechst for 35 minutes. The cells were treated with Exo III (200 U for 30 minutes at 37°C), hybridized with G-rich probe (red, Cy3-labeled) and C-rich (green, Alex488-labeled) in sequence, mounted with DAPI, and observed using fluorescence microscope (Nikon, Tokyo, Japan). Telomere Quantitative-FISH (Q-FISH) Cells were treated with 1 µg/ml colchicine for 3 hours to enrich cells at metaphase. Cells were harvested and q-FISH was performed as previously described 76 . Cy3-labeled or Alex488 labeled (CCCTAA) 3 PNA probe was used. Images were taken using a fluorescence microscope (Nikon, Tokyo, Japan). The fluorescence intensity of the telomeres was analyzed by Image J and the TFL-TELO program. C-circle assay The C-circle assay was performed as described previously with minor modification 77 . Briefly, genomic DNA was was extracted with Tissue gDNA isolation kit (Biomiga) and a total of 30 ng genomic DNA was used for amplification with Φ29 DNA polymerase (NEB) at 30°C for 8 hours followed by 65°C for 20 minutes. The products were blotted onto nitrocellulose filter membrane, UV cross linked, and hybridized with a DIG-labeled probe (CCCTAA)4 to detect C-circle amplification products. Blots were washed, exposed to Tanon 5200 (Tanon Science and Technology Co., Ltd, Shanghai, China), and quantified using ImageJ. Chromatin immunoprecipitation (ChIP) and Dot Blot ChIP assays were carried out following the protocol from the truChIP Chromatin shearing Kit (Covaris). Briefly, cells were treated with 1% formaldehyde for 5 min at room temperature to crosslink proteins to DNA. The cell was harvested and lysised. After lysis, the nuclei pellet was collected and resuspended in CHIP buffer, and the chromatin was then sheared by AFA Focused-ultrasonicator (Covaris, Woburn, USA). A total of 25 µl of sheared chromatin was taken to analysis the shearing efficiency, and the remaining chromatin was subjected to chromatin immunoprecipitation. An aliquot of each sample was set aside as input control, while the remaining portion was subjected to immunoprecipitation with anti-H3K9me3 (Abcam) overnight at 4°C, with IgG (5 µl/IP) as negative control. The complex of co-precipitation was captured by ChIP-Grade Protein G Dynabeads, and chromatin was eluted from antibody/Protein G Beads and reversed crosslinks. Subsequently, DNA was purified and eluted with PCR purification kits (QIAGEN, Hilden, Germany) for Dot-Blot. For dot blot the purified DNA was denatured in 0.2 M NaOH at 65°C for 10 min, neutralized with 2× SSC, the samples were added to the membrane (Bio-Rad) using a dot-blotting apparatus loaded onto slot-blot Hybond N+ (GE healthcare) membrane, UV crosslinked to membrane, and pre-hybridized with DIG Easy Hyb solution (Roche) for 40 min and hybridized with DIG-labeled telomeric G-probe (TTAGGG)4 overnight at 42°C. The membrane was washed twice in 2X SSC/0.1% SDS solution for 10 min then twice in 0.1X SSC/0.1% SDS for 10 min at 42°C. The hybridization signal was detected using the DIG detection system (Roche) and quantitated using the ImageJ software. Calculate the amount of telomeric DNA immunoprecipitated relative to the signal of the corresponding inputs. The ChIP values are represented as a percentage of the total input telomeric DNA, Proximity ligation assay (PLA) The protein interaction studies were performed with PLA. A Duolink® In Situ Detection Reagents (DUO92002, Sigma, MO, USA) was used according to the manufacturer's instructions. Briefly, cells were cultured on sterile coverslips in 24-well plates and treated with siRNA. After being fixed with 4% PFA and permeabilized using 0.5% triton X-100, cells were blocked in Duolink II solution for 1 h. The slides were incubated with anti-TRF1 antibody (1:200) or anti-TRF2 antibody (1:200) and anti-LAP2α antibody (1:500) at 4°C overnight, followed by incubation with Duolink PLA anti-Mouse PLUS and PLA anti-Rabbit PLUS proximity probes. After washing the slides three times, the ligation reaction was done for 30 min and the amplification was run for 100 min at 37°C. Then the slides were visualized using a fluorescence microscope (Nikon, Tokyo, Japan). ATAT-Seq ATAC-seq was performed essentially as previously described 78 . Briefly, U2OS cells were treated with siNC or 50 µM siLAP2α RNA for 72 h. Then cells were harvested and sent to Beijing Novogene Co., Ltd. For ATAC-seq assay. ATAC-Seq were mapped to human genome (hg19 from UCSC genome browser) using Bowtie2 software package (version 2.3.0) 79 , followed by standard quality control and adapter removal. For telomere read analysis, the maximum number of times of consecutive appearance of telomere sequence (TTAGGG or the reverse complement CCCTAA) with exact match was counted. Immunohistochemistry staining Tissue sections were deparaffinized in xylene and microwaved in 10 mM sodium citrate buffer (pH 6.0) to unmask the epitopes. Endogenous peroxidase activity was blocked by incubating for 10 min with 3% hydrogen peroxide in methanol. Immunohistochemical staining for LAP2α (1:200) was performed by using the indirect avidin biotin-enhanced horseradish peroxidase method according to the manufacturer’s instructions (Vector Laboratories, Burlingame, CA). After developing with 3,3’-diaminobenzidine, all sections were counterstained with hematoxylin and observed by microscope (200× magnification). Quantitative analysis of immunohistochemical staining was performed using the Image-Pro Plus software (version 6.2) program (Media Cybernetics, Inc., Rockville, MD). Patient-derived xenograft (PDX) mouse model PDX animal studies were preformed following guidelines approved by the Tianjin Medical University Institutional Animal Care and Use Committee (Tianjin, China). HumanALT + and ALT- osteosarcoma tumor fragments were obtained from The Tianjin Medical University Cancer Institute and Hospital and cut in smaller fragments (2–3 mm) and then implanted into severe combined immune deficient (SCID) mice. Mice were divided into 4 groups (12 mice per group). MTX (0.5 mg/kg) was dissolved in PBS with 2.5% dimethyl sulfoxide (DMSO), 5% polyethylene glycol 400 (PGE 400) and 5% tween 80. MTX was administered to mice by oral gavage. Tumor volume measurements were obtained every 2 days and tumor volume was calculated from measurements of 3 diameters of the individual tumor base using the ellipsoid formula: tumor volume (mm3) = (length × width × height × 0.52). Mice were monitored until tumor volume reached 1 cm3, at which time mice were euthanized and tumors were extracted. Statistical analysis The results are shown as means ± SEM and the Student’s two-tailed unpaired t-test was used to determine the statistical significance (*P < 0.05; **P < 0.01; ***P < 0.001; ***P < 0.001). For every figure, statistical tests are justified as appropriate. Declarations Acknowledgements We thank Basic Research Center of Tianjin Medical University for support. We thank Dr Yong Zhao (Sun Yat-sen University) for providing CRISPRv2 -sgScr and CRISPRv2-sgTel (plasmid). We thank Dr Ji-long Yang ( Tianjin Medical University Cancer Institute and Hospital) for providing osteosarcoma tissues and 4 normal bone tissues. Conflict of Interest Statement The authors declare no competing interests. Author Contribution Statement FW, LS, YL and YL conceived and designed the study. BW performed the analysis and prepared the manuscript drafts. HK assisted with analysis and helped supervise the project. QZ provided the siRNA and DOX-induced LAP2α over expression plasmid. YW assisted with PLA assay. DJ assisted with drawing. ZZ established PDX models and collected the data. YZ helped with ATAC-Seq data analysis. MZ and LS edited original draft. MZ edited and revised the manuscript. All the authors read and approved the final manuscript. Ethics Approval and Consent to Participate see supplementary file1 Funding This work was supported by the grant from the National Natural Science Foundation of China (No. 32170762, 3217050514, 31771520, 31471293, 91649102, 92149302, 81772243, 81771135, 81970958, 82303619), Tianjin Health Research Project (No. 19YFZCSY00600), Science and Technology Project of Tianjin Municipal Health Committee (No. TJWJ2022XK018, TJWJ2022QN030) and the Natural Science Foundation of Tianjin City (No. 19JCJQJC63500) Data Availability Statement All data generated or analysed during this study are included in this published article [and itssupplementary information files] References Schmutz, I., and de Lange, T. (2016). Shelterin. Curr Biol 26 , R397-399. 10.1016/j.cub.2016.01.056. Shay, J.W., and Wright, W.E. (2000). Hayflick, his limit, and cellular ageing. Nat Rev Mol Cell Biol 1 , 72-76. 10.1038/35036093. Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next generation. Cell 144 , 646-674. 10.1016/j.cell.2011.02.013. Shay, J.W., and Bacchetti, S. (1997). A survey of telomerase activity in human cancer. Eur J Cancer 33 , 787-791. 10.1016/S0959-8049(97)00062-2. Henson, J.D., and Reddel, R.R. (2010). Assaying and investigating Alternative Lengthening of Telomeres activity in human cells and cancers. FEBS Lett 584 , 3800-3811. 10.1016/j.febslet.2010.06.009. Amorim, J.P., Santos, G., Vinagre, J., and Soares, P. (2016). The Role of ATRX in the Alternative Lengthening of Telomeres (ALT) Phenotype. Genes (Basel) 7 . 10.3390/genes7090066. McEachern, M.J., and Haber, J.E. (2006). Break-induced replication and recombinational telomere elongation in yeast. Annu Rev Biochem 75 , 111-135. 10.1146/annurev.biochem.74.082803.133234. Dunham, M.A., Neumann, A.A., Fasching, C.L., and Reddel, R.R. (2000). Telomere maintenance by recombination in human cells. Nat Genet 26 , 447-450. 10.1038/82586. Episkopou, H., Draskovic, I., Van Beneden, A., Tilman, G., Mattiussi, M., Gobin, M., Arnoult, N., Londono-Vallejo, A., and Decottignies, A. (2014). Alternative Lengthening of Telomeres is characterized by reduced compaction of telomeric chromatin. Nucleic Acids Res 42 , 4391-4405. 10.1093/nar/gku114. Azzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007). Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 318 , 798-801. 10.1126/science.1147182. Mladenov, E., Staudt, C., Soni, A., Murmann-Konda, T., Siemann-Loekes, M., and Iliakis, G. (2020). Strong suppression of gene conversion with increasing DNA double-strand break load delimited by 53BP1 and RAD52. Nucleic Acids Res 48 , 1905-1924. 10.1093/nar/gkz1167. Verma, P., Dilley, R.L., Zhang, T., Gyparaki, M.T., Li, Y., and Greenberg, R.A. (2019). RAD52 and SLX4 act nonepistatically to ensure telomere stability during alternative telomere lengthening. Genes & development 33 , 221-235. 10.1101/gad.319723.118. Cho, N.W., Dilley, R.L., Lampson, M.A., and Greenberg, R.A. (2014). Interchromosomal homology searches drive directional ALT telomere movement and synapsis. Cell 159 , 108-121. 10.1016/j.cell.2014.08.030. Zhang, J.M., Yadav, T., Ouyang, J., Lan, L., and Zou, L. (2019). Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways. Cell reports 26 , 955-968 e953. 10.1016/j.celrep.2018.12.102. Dilley, R.L., Verma, P., Cho, N.W., Winters, H.D., Wondisford, A.R., and Greenberg, R.A. (2016). Break-induced telomere synthesis underlies alternative telomere maintenance. Nature 539 , 54-58. 10.1038/nature20099. Kabeche, L., Nguyen, H.D., Buisson, R., and Zou, L. (2018). A mitosis-specific and R loop-driven ATR pathway promotes faithful chromosome segregation. Science 359 , 108-114. 10.1126/science.aan6490. Lezaja, A., Panagopoulos, A., Wen, Y., Carvalho, E., Imhof, R., and Altmeyer, M. (2021). RPA shields inherited DNA lesions for post-mitotic DNA synthesis. Nat Commun 12 , 3827. 10.1038/s41467-021-23806-5. Arora, R., Lee, Y., Wischnewski, H., Brun, C.M., Schwarz, T., and Azzalin, C.M. (2014). RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat Commun 5 , 5220. 10.1038/ncomms6220. Graf, M., Bonetti, D., Lockhart, A., Serhal, K., Kellner, V., Maicher, A., Jolivet, P., Teixeira, M.T., and Luke, B. (2017). Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell 170 , 72-85 e14. 10.1016/j.cell.2017.06.006. Grudic, A., Jul-Larsen, A., Haring, S.J., Wold, M.S., Lonning, P.E., Bjerkvig, R., and Boe, S.O. (2007). Replication protein A prevents accumulation of single-stranded telomeric DNA in cells that use alternative lengthening of telomeres. Nucleic Acids Res 35 , 7267-7278. 10.1093/nar/gkm738. Moretti, P., Freeman, K., Coodly, L., and Shore, D. (1994). Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev 8 , 2257-2269. 10.1101/gad.8.19.2257. Iglesias, N., Redon, S., Pfeiffer, V., Dees, M., Lingner, J., and Luke, B. (2011). Subtelomeric repetitive elements determine TERRA regulation by Rap1/Rif and Rap1/Sir complexes in yeast. EMBO Rep 12 , 587-593. 10.1038/embor.2011.73. Gonzalez-Suarez, I., Redwood, A.B., Perkins, S.M., Vermolen, B., Lichtensztejin, D., Grotsky, D.A., Morgado-Palacin, L., Gapud, E.J., Sleckman, B.P., Sullivan, T., et al. (2009). Novel roles for A-type lamins in telomere biology and the DNA damage response pathway. EMBO J 28 , 2414-2427. 10.1038/emboj.2009.196. Huang, S., Risques, R.A., Martin, G.M., Rabinovitch, P.S., and Oshima, J. (2008). Accelerated telomere shortening and replicative senescence in human fibroblasts overexpressing mutant and wild-type lamin A. Exp Cell Res 314 , 82-91. 10.1016/j.yexcr.2007.08.004. Lachapelle, S., Gagne, J.P., Garand, C., Desbiens, M., Coulombe, Y., Bohr, V.A., Hendzel, M.J., Masson, J.Y., Poirier, G.G., and Lebel, M. (2011). Proteome-wide identification of WRN-interacting proteins in untreated and nuclease-treated samples. J Proteome Res 10 , 1216-1227. 10.1021/pr100990s. Redwood, A.B., Perkins, S.M., Vanderwaal, R.P., Feng, Z., Biehl, K.J., Gonzalez-Suarez, I., Morgado-Palacin, L., Shi, W., Sage, J., Roti-Roti, J.L., et al. (2011). A dual role for A-type lamins in DNA double-strand break repair. Cell Cycle 10 , 2549-2560. 10.4161/cc.10.15.16531. Cai, M., Huang, Y., Ghirlando, R., Wilson, K.L., Craigie, R., and Clore, G.M. (2001). Solution structure of the constant region of nuclear envelope protein LAP2 reveals two LEM-domain structures: one binds BAF and the other binds DNA. The EMBO journal 20 , 4399-4407. 10.1093/emboj/20.16.4399. Brachner, A., and Foisner, R. (2011). Evolvement of LEM proteins as chromatin tethers at the nuclear periphery. Biochem Soc Trans 39 , 1735-1741. 10.1042/BST20110724. Lee, B., Lee, T.H., and Shim, J. (2017). Emerin suppresses Notch signaling by restricting the Notch intracellular domain to the nuclear membrane. Biochim Biophys Acta Mol Cell Res 1864 , 303-313. 10.1016/j.bbamcr.2016.11.013. Harris, C.A., Andryuk, P.J., Cline, S.W., Mathew, S., Siekierka, J.J., and Goldstein, G. (1995). Structure and mapping of the human thymopoietin (TMPO) gene and relationship of human TMPO beta to rat lamin-associated polypeptide 2. Genomics 28 , 198-205. 10.1006/geno.1995.1131. Brachner, A., and Foisner, R. (2014). Lamina-associated polypeptide (LAP)2alpha and other LEM proteins in cancer biology. Adv Exp Med Biol 773 , 143-163. 10.1007/978-1-4899-8032-8_7. Jaco, I., Munoz, P., and Blasco, M.A. (2004). Role of human Ku86 in telomere length maintenance and telomere capping. Cancer Res 64 , 7271-7278. 10.1158/0008-5472.CAN-04-1381. Myung, K., Ghosh, G., Fattah, F.J., Li, G., Kim, H., Dutia, A., Pak, E., Smith, S., and Hendrickson, E.A. (2004). Regulation of telomere length and suppression of genomic instability in human somatic cells by Ku86. Mol Cell Biol 24 , 5050-5059. 10.1128/MCB.24.11.5050-5059.2004. Wang, Y., Ghosh, G., and Hendrickson, E.A. (2009). Ku86 represses lethal telomere deletion events in human somatic cells. Proc Natl Acad Sci U S A 106 , 12430-12435. 10.1073/pnas.0903362106. Bao, K., Zhang, Q., Liu, S., Song, N., Guo, Q., Liu, L., Tian, S., Hao, J., Zhu, Y., Zhang, K., et al. (2022). LAP2alpha preserves genome integrity through assisting RPA deposition on damaged chromatin. Genome Biol 23 , 64. 10.1186/s13059-022-02638-6. Dechat, T., Gajewski, A., Korbei, B., Gerlich, D., Daigle, N., Haraguchi, T., Furukawa, K., Ellenberg, J., and Foisner, R. (2004). LAP2alpha and BAF transiently localize to telomeres and specific regions on chromatin during nuclear assembly. J Cell Sci 117 , 6117-6128. 10.1242/jcs.01529. Crabbe, L., Cesare, A.J., Kasuboski, J.M., Fitzpatrick, J.A., and Karlseder, J. (2012). Human telomeres are tethered to the nuclear envelope during postmitotic nuclear assembly. Cell Rep 2 , 1521-1529. 10.1016/j.celrep.2012.11.019. Dilley, R.L., and Greenberg, R.A. (2015). ALTernative Telomere Maintenance and Cancer. Trends in cancer 1 , 145-156. 10.1016/j.trecan.2015.07.007. Heaphy, C.M., Subhawong, A.P., Hong, S.M., Goggins, M.G., Montgomery, E.A., Gabrielson, E., Netto, G.J., Epstein, J.I., Lotan, T.L., Westra, W.H., et al. (2011). Prevalence of the alternative lengthening of telomeres telomere maintenance mechanism in human cancer subtypes. The American journal of pathology 179 , 1608-1615. 10.1016/j.ajpath.2011.06.018. Scherthan, H. (2007). Telomere attachment and clustering during meiosis. Cell Mol Life Sci 64 , 117-124. 10.1007/s00018-006-6463-2. Lovejoy, C.A., Li, W., Reisenweber, S., Thongthip, S., Bruno, J., de Lange, T., De, S., Petrini, J.H., Sung, P.A., Jasin, M., et al. (2012). Loss of ATRX, genome instability, and an altered DNA damage response are hallmarks of the alternative lengthening of telomeres pathway. PLoS Genet 8 , e1002772. 10.1371/journal.pgen.1002772. Mao, P., Liu, J., Zhang, Z., Zhang, H., Liu, H., Gao, S., Rong, Y.S., and Zhao, Y. (2016). Homologous recombination-dependent repair of telomeric DSBs in proliferating human cells. Nat Commun 7 , 12154. 10.1038/ncomms12154. Liu, H., Xie, Y., Zhang, Z., Mao, P., Liu, J., Ma, W., and Zhao, Y. (2018). Telomeric Recombination Induced by DNA Damage Results in Telomere Extension and Length Heterogeneity. Neoplasia 20 , 905-916. 10.1016/j.neo.2018.07.004. O'Sullivan, R.J., Arnoult, N., Lackner, D.H., Oganesian, L., Haggblom, C., Corpet, A., Almouzni, G., and Karlseder, J. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nat Struct Mol Biol 21 , 167-174. 10.1038/nsmb.2754. Marechal, A., and Zou, L. (2015). RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response. Cell Res 25 , 9-23. 10.1038/cr.2014.147. Ceccaldi, R., Rondinelli, B., and D'Andrea, A.D. (2016). Repair Pathway Choices and Consequences at the Double-Strand Break. Trends Cell Biol 26 , 52-64. 10.1016/j.tcb.2015.07.009. Mehta, A., and Haber, J.E. (2014). Sources of DNA double-strand breaks and models of recombinational DNA repair. Cold Spring Harb Perspect Biol 6 , a016428. 10.1101/cshperspect.a016428. Min, J., Wright, W.E., and Shay, J.W. (2019). Clustered telomeres in phase-separated nuclear condensates engage mitotic DNA synthesis through BLM and RAD52. Genes & development 33 , 814-827. 10.1101/gad.324905.119. Price, B.D., and D'Andrea, A.D. (2013). Chromatin remodeling at DNA double-strand breaks. Cell 152 , 1344-1354. 10.1016/j.cell.2013.02.011. Chen, Z., and Tyler, J.K. (2022). The Chromatin Landscape Channels DNA Double-Strand Breaks to Distinct Repair Pathways. Front Cell Dev Biol 10 , 909696. 10.3389/fcell.2022.909696. van Steensel, B., and Belmont, A.S. (2017). Lamina-Associated Domains: Links with Chromosome Architecture, Heterochromatin, and Gene Repression. Cell 169 , 780-791. 10.1016/j.cell.2017.04.022. van Schaik, T., Manzo, S.G., Vouzas, A.E., Liu, N.Q., Teunissen, H., de Wit, E., Gilbert, D.M., and van Steensel, B. (2022). Dynamic chromosomal interactions and control of heterochromatin positioning by Ki-67. EMBO Rep 23 , e55782. 10.15252/embr.202255782. Sosa, B.A., Kutay, U., and Schwartz, T.U. (2013). Structural insights into LINC complexes. Curr Opin Struct Biol 23 , 285-291. 10.1016/j.sbi.2013.03.005. Vidak, S., Kubben, N., Dechat, T., and Foisner, R. (2015). Proliferation of progeria cells is enhanced by lamina-associated polypeptide 2alpha (LAP2alpha) through expression of extracellular matrix proteins. Genes Dev 29 , 2022-2036. 10.1101/gad.263939.115. Gesson, K., Rescheneder, P., Skoruppa, M.P., von Haeseler, A., Dechat, T., and Foisner, R. (2016). A-type lamins bind both hetero- and euchromatin, the latter being regulated by lamina-associated polypeptide 2 alpha. Genome Res 26 , 462-473. 10.1101/gr.196220.115. Loyola, A.C., Zhang, L., Shang, R., Dutta, P., Li, J., and Li, W.X. (2019). Identification of methotrexate as a heterochromatin-promoting drug. Sci Rep 9 , 11673. 10.1038/s41598-019-48137-w. Bechter, O.E., Zou, Y., Walker, W., Wright, W.E., and Shay, J.W. (2004). Telomeric recombination in mismatch repair deficient human colon cancer cells after telomerase inhibition. Cancer Res 64 , 3444-3451. 10.1158/0008-5472.CAN-04-0323. Cimino-Reale, G., Gandellini, P., Santambrogio, F., Recagni, M., Zaffaroni, N., and Folini, M. (2017). miR-380-5p-mediated repression of TEP1 and TSPYL5 interferes with telomerase activity and favours the emergence of an \"ALT-like\" phenotype in diffuse malignant peritoneal mesothelioma cells. J Hematol Oncol 10 , 140. 10.1186/s13045-017-0510-3. Gao, J., and Pickett, H.A. (2022). Targeting telomeres: advances in telomere maintenance mechanism-specific cancer therapies. Nat Rev Cancer 22 , 515-532. 10.1038/s41568-022-00490-1. Bhattacharjee, P., Das, A., Giri, A.K., and Bhattacharjee, P. (2020). Epigenetic regulations in alternative telomere lengthening: Understanding the mechanistic insight in arsenic-induced skin cancer patients. Sci Total Environ 704 , 135388. 10.1016/j.scitotenv.2019.135388. Shi, G., Hu, Y., Zhu, X., Jiang, Y., Pang, J., Wang, C., Huang, W., Zhao, Y., Ma, W., Liu, D., et al. (2020). A critical role of telomere chromatin compaction in ALT tumor cell growth. Nucleic Acids Res 48 , 6019-6031. 10.1093/nar/gkaa224. Shevelyov, Y.Y., and Ulianov, S.V. (2019). The Nuclear Lamina as an Organizer of Chromosome Architecture. Cells 8 . 10.3390/cells8020136. Taimen, P., Pfleghaar, K., Shimi, T., Moller, D., Ben-Harush, K., Erdos, M.R., Adam, S.A., Herrmann, H., Medalia, O., Collins, F.S., et al. (2009). A progeria mutation reveals functions for lamin A in nuclear assembly, architecture, and chromosome organization. Proc Natl Acad Sci U S A 106 , 20788-20793. 10.1073/pnas.0911895106. Makhija, E., Jokhun, D.S., and Shivashankar, G.V. (2016). Nuclear deformability and telomere dynamics are regulated by cell geometric constraints. Proc Natl Acad Sci U S A 113 , E32-40. 10.1073/pnas.1513189113. Wood, A.M., Rendtlew Danielsen, J.M., Lucas, C.A., Rice, E.L., Scalzo, D., Shimi, T., Goldman, R.D., Smith, E.D., Le Beau, M.M., and Kosak, S.T. (2014). TRF2 and lamin A/C interact to facilitate the functional organization of chromosome ends. Nat Commun 5 , 5467. 10.1038/ncomms6467. Rai, R., Biju, K., Sun, W., Sodeinde, T., Al-Hiyasat, A., Morgan, J., Ye, X., Li, X., Chen, Y., and Chang, S. (2023). Homology directed telomere clustering, ultrabright telomere formation and nuclear envelope rupture in cells lacking TRF2(B) and RAP1. Nat Commun 14 , 2144. 10.1038/s41467-023-37761-w. Eriksson, M., Brown, W.T., Gordon, L.B., Glynn, M.W., Singer, J., Scott, L., Erdos, M.R., Robbins, C.M., Moses, T.Y., Berglund, P., et al. (2003). Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 423 , 293-298. 10.1038/nature01629. Haque, F., Lloyd, D.J., Smallwood, D.T., Dent, C.L., Shanahan, C.M., Fry, A.M., Trembath, R.C., and Shackleton, S. (2006). SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to provide a physical connection between the nuclear lamina and the cytoskeleton. Mol Cell Biol 26 , 3738-3751. 10.1128/MCB.26.10.3738-3751.2006. Lei, K., Zhu, X., Xu, R., Shao, C., Xu, T., Zhuang, Y., and Han, M. (2012). Inner nuclear envelope proteins SUN1 and SUN2 play a prominent role in the DNA damage response. Curr Biol 22 , 1609-1615. 10.1016/j.cub.2012.06.043. Chojnowski, A., Ong, P.F., Wong, E.S., Lim, J.S., Mutalif, R.A., Navasankari, R., Dutta, B., Yang, H., Liow, Y.Y., Sze, S.K., et al. (2015). Progerin reduces LAP2alpha-telomere association in Hutchinson-Gilford progeria. Elife 4 . 10.7554/eLife.07759. De Sandre-Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I., Lyonnet, S., Stewart, C.L., Munnich, A., Le Merrer, M., and Levy, N. (2003). Lamin a truncation in Hutchinson-Gilford progeria. Science 300 , 2055. 10.1126/science.1084125. Bhowmick, R., Minocherhomji, S., and Hickson, I.D. (2016). RAD52 Facilitates Mitotic DNA Synthesis Following Replication Stress. Mol Cell 64 , 1117-1126. 10.1016/j.molcel.2016.10.037. Min, J., Wright, W.E., and Shay, J.W. (2017). Alternative Lengthening of Telomeres Mediated by Mitotic DNA Synthesis Engages Break-Induced Replication Processes. Mol Cell Biol 37 . 10.1128/MCB.00226-17. Ozer, O., Bhowmick, R., Liu, Y., and Hickson, I.D. (2018). Human cancer cells utilize mitotic DNA synthesis to resist replication stress at telomeres regardless of their telomere maintenance mechanism. Oncotarget 9 , 15836-15846. 10.18632/oncotarget.24745. Tsouroula, K., Furst, A., Rogier, M., Heyer, V., Maglott-Roth, A., Ferrand, A., Reina-San-Martin, B., and Soutoglou, E. (2016). Temporal and Spatial Uncoupling of DNA Double Strand Break Repair Pathways within Mammalian Heterochromatin. Mol Cell 63 , 293-305. 10.1016/j.molcel.2016.06.002. Zhang, M., Wang, B., Li, T., Liu, R., Xiao, Y., Geng, X., Li, G., Liu, Q., Price, C.M., Liu, Y., and Wang, F. (2019). Mammalian CST averts replication failure by preventing G-quadruplex accumulation. Nucleic acids research 47 , 5243-5259. 10.1093/nar/gkz264. Henson, J.D., Lau, L.M., Koch, S., Martin La Rotta, N., Dagg, R.A., and Reddel, R.R. (2017). The C-Circle Assay for alternative-lengthening-of-telomeres activity. Methods 114 , 74-84. 10.1016/j.ymeth.2016.08.016. Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. (2013). Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10 , 1213-1218. 10.1038/nmeth.2688. Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9 , 357-359. 10.1038/nmeth.1923. Additional Declarations (Not answered) Supplementary Files FigureS1.tif Supplementary information Supplementary Fig. S1. LAP2α interacted with shelterin complex in SAOS2 cells. (A) PLA of LAP2α and TRF1 or TRF2 in SAOS2 cells transfected with control or LAP2α siRNA. Red dots represent PLA signals. (B)Metaphase chromosome spreads and telomere FISH in MG32 cells. Representative images showing fragile site (yellow arrows) and signal free ends (SFE, white arrows). (C) Quantification of fragile site and SFEs of MG32 cells. Values are mean ± SEM, n=3 (independent experiments); NS, no significance, two-tailed Student’s t-test. FigureS2.tif Supplementary Fig. S2.Q-FISH analysis of relative telomere length in U2OS cells. (A) Representative images showing telomeres hybridized with Cy3-labelled telomere probe (red). (B) Frequency distributions of relative telomere length telomere length is shown above each panel. The mean telomere length values ± SEM and the number of nuclei analyzed is indicated. Values are mean ± SEM, n=3 (independent experiments) ; *P<0.05 ,**P<0.01 , ***P<0.001, ****P<0.0001 (two-tailed Student’s t-test); NS: no significance. FigureS3.tif Supplementary Fig. S3. Telomeric DNA double strands break induced by CRISPR-CAS9 SgTel system（A）Dot blot of C-circle assay performed with genomic DNA from Hela cells and(top) MG32 cells(bottom). (B) APBs formation upon sustained telomeric DSBs induced by CRISPR/Cas9 in Hela cells. APBs in indicated cells were visualized by hybridization using antibody to PML (green, IF) and telomeric probe (red, FISH). (C) Quantification the percentage of positive cells with APBs of panel (B). (D) Hela became C-circle positive induced by CRISPR/Cas9 in Hela cells.: FigureS4.tif Supplementary Fig. S4. (A) Colocalization of RAD51 with telomeres was analyzed by IF-FISH using telomeric G-rich probe (green) and antibodies to RAD51(red) in U2OS. FigureS5.tif Supplementary Fig. S5. (A) qRT-PCR analysis of TERRA levels in the indicated SAOS2 cells. Supplementarytable1.docx Supplementary Table 1Primers used for RT-PCR Cite Share Download PDF Status: Published Journal Publication published 19 Oct, 2024 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 28 Mar, 2024 Review # 1 received at journal 21 Mar, 2024 Review # 2 received at journal 18 Mar, 2024 Reviewer # 2 agreed at journal 04 Mar, 2024 Reviewer # 1 agreed at journal 03 Mar, 2024 Reviewers invited by journal 03 Mar, 2024 Submission checks completed at journal 02 Feb, 2024 First submitted to journal 01 Feb, 2024 Editor assigned by journal 01 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3917613\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":276075728,\"identity\":\"4f8faf84-a2a3-40c9-988e-3e086e4967df\",\"order_by\":0,\"name\":\"Feng Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYLCCigoILUG8ljNnDEjVcraNFC0Gx88efnFw3p9ogwPMB2/zMNjlEdZyJi/N4uA2g9wNB9iSrXkYkosJajE7kGNm/BGshcdMmofhQGIDQS3n35gZHJwD0sL/jUgtN3KMHxxsANvCRpwW+xtvzBgOHDPOnXmYzdhyjkEyYS2S/TnGHw7UyOX2HW9+eONNhR1hLUDABokOZhBhQIR6kNoPxKkbBaNgFIyCEQsAe4BAYXfQO8kAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"School of Basic Medical Science,Tianjin Medical University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Feng\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-02-01 13:56:16\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3917613/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3917613/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41419-024-07116-4\",\"type\":\"published\",\"date\":\"2024-10-19T04:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":52044216,\"identity\":\"306a39ed-8d04-4a31-b5c6-f36ec3d30351\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:39\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1172112,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLAP2α interacted with shelterin complex and LAP2α deficiency induced dysfunctional telomeres of ALT positive cells.\\u003c/strong\\u003e (A) and (B) PLA of LAP2α and subunit of shelterin complex in U2OS cells and Hela cells transfected with control or LAP2α siRNA. Red dots represent PLA signals. (C) U2OS and Hela cells were infected with control or LAP2α siRNA for 3 days. Cell lysates were subjected to western blot analysis with anti-LAP2α and anti-GAPDH antibodies. GAPDH was used as the loading control. (D) and (F) Metaphase chromosome spreads and telomere FISH in U2OS and Hela cells. Representative images showing fragile site (yellow arrows) and signal free ends (SFE, white arrows). (E) and (G) Quantification of fragile site and SFEs of U2OS and Hela cells. Values are mean ± SEM, n=3 (independent experiments); *P\\u0026lt;0.05 ; **P\\u0026lt;0.01 ; NS, no significance, two-tailed Student’s t-test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/6995d2c4d4f243340a774855.jpg\"},{\"id\":52044217,\"identity\":\"f18e73ca-d8d1-48cc-831f-dbfff25480c1\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1816756,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eKnockdown LAP2α elevates the telomeric homologous recombination of ALT cells. \\u003c/strong\\u003e(A) LAP2α expression was measured by western blot after infecting with control or LAP2α siRNA inU2OS and SAOS2 cells. (B) Representative images showing telomere clustering of U2OS cells in the presence of control or LAP2α siRNA. (C) Quantification of (B), the percentage of cells containing clustered telomeres. (D) Representative images showing telomere clustering of SAOS2 cells. (E) Quantification of (D). (F) Telomeric DNA CO-FISH on metaphases from U2OS cells to reveal T-SCEs. Cells were harvested 3 days after siRNA transfection. (G) Quantification of the average number of T-SCEs per chromosome detected in U2OS cells. Error bars represent standard error of the mean (SEM). (H) Q-FISH analysis of relative telomere length in U2OS cells. Representative images showing telomeres hybridized with PNA Alexa 488-labelled telomere probe (green). (I) Frequency distributions of relative telomere length telomere length is of (H). The mean telomere length values ± SEM and the number of nuclei analyzed is indicated. Values are mean ± SEM, n=3 (independent experiments); *P\\u0026lt;0.05 ,**P\\u0026lt;0.01 , ***P\\u0026lt;0.001, ****P\\u0026lt;0.0001 (two-tailed Student’s t-test); NS: no significance.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/d1c9898fae6235db2c42fa40.jpg\"},{\"id\":52044222,\"identity\":\"57c7f528-9aac-4a48-aa76-ddc1cae80e41\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1489476,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eKnockdown LAP2α stimulates formation of C-circle and APBs in ALT cells. \\u003c/strong\\u003e(A) Western blot analyzes the expression of LAP2α in U2OS(left) and SAOS2(right) cells transiently transfected with control siRNA or LAP2α siRNA for 24 h and then re-expressing doxycycline (DOX)-inducible RNAi-resistant LAP2α for 48 h. (B) Representative images show the colocalization of telomere (green, detected by FISH) and PML (red, detected by immunofluorescence) to measure ALT-associated PML (APB) bodies formation upon LAP2α knockdown in U2OS cells (right panel). Quantification of average number of APBs in the U2OS cells (left panel). (C) The APBs formation upon LAP2α knockdown in SAOS2 cells (right panel). Quantification of average number of APBs (left panel). (D) C-circle assay in ALT-positive cell lines U2OS cells (right panel). Quantification of average number of C-circle (left panel) (E) C-circle assay in ALT-positive cell lines SAOS2 cells (right panel). Quantification of average number of C-circle (left panel). (F) The colocalization of telomere (green, FISH) and 53BP1 (red, IF) to measure dsDNA breaks at telomere generated by the CRISPR/Cas9 system. Quantification the percentage of cells with TIF of panel (right panel). (G) Depletion of LAP2α exacerbates the accumulation of C-circle induced by cas9-Tel in Hela cells. All values are mean ± SEM of three independent experiments, *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.001(two-tailed Student’s t-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/cdd45d6c9406fdb87a95e2c4.jpg\"},{\"id\":52044218,\"identity\":\"5b7fbfd1-3c48-4e91-83d9-c83104199e23\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1041077,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLAP2α affected the level of RAP1, therefore regulated the recruitment of RAD52 and RPA2 to telomeres. \\u003c/strong\\u003e(A)Analysis the colocalization of telomere (G-rich probe, green) and RPA2 (antibodies, red) by IF-FISH in U2OS cells were transiently transfected with control siRNA or LAP2α siRNA for 72h. (B) Quantification of panels(A). (C)Analysis the colocalization of telomere (green) and RAD52( red) by IF-FISH in U2OS cells. (D) Quantification of panels(C), respectively. Error bars represent the mean ± SEM of three independent experiments. Two-tailed unpaired student’s t-test was used to calculate P-values. *P\\u0026lt;0.05, **P\\u0026lt;0.01, ***P\\u0026lt;0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/1ddf73e35d825ca638498f1e.jpg\"},{\"id\":52044413,\"identity\":\"5a978dc6-3858-41dc-9f12-332820e55a4c\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:13:40\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1583998,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLack of LAP2α decreased the level of shelterin component RAP1. \\u003c/strong\\u003e(A) PLA assay was used to analysis the interaction between LAP2α and HDAC1 in U2OS over-expressing Flag-LAP2α. Red dots represent PLA signals. (B) U2OS cells were transiently transfected with control siRNA or LAP2α siRNA for 48h and then transfected with control siRNA or KDM4B siRNA for 48h, Cells were harvested and1subjected to ChIP experiments using antibodies raised against trimethylated H3K9, HP1 and control IgG binding to telomeres. Telomere repeat DNA was visualized by dot blot and probed with a telomere-specific probe. (C) and (D) Quantification of H3K9me3 and HP1 binding to telomeres at least three different ChIP assays represented by panel (B). ChIP DNA signals were normalized to input DNA signal and to siNC-treated cells. (E) C-circle assay in U2OS cells transfected with LAP2α siRNA and/or KDM4B siRNA. (F) Quantification of relative amount of C-circle. (G) Copy number normalized ATAC-seq counts mapped to telomere regions. (H) Average profiles of ATAC-seq peaks in control siRNA or LAP2α siRNA treated U2OS cells at transcription start site(TSS)±3kb(top). Heatmap of densities of ATAC-Seq peaks of genes in control siRNA or LAP2αsiRNA treated U2OS cells(bottom). (I) qRT-PCR analysis of TERRA levels in the indicated U2OS cells. TERRA levels were detected using primers specific for TERRA RNA transcribed from subtelomeres of human chromosome 9P, 17P, Xp,15q, as indicated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/2bfbd3e7a397c10edc9218dd.jpg\"},{\"id\":52044414,\"identity\":\"e1d23083-87e6-4d5d-99f3-7f2897bc2f62\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:13:40\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":873345,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLAP2α expression is lower in ALT-positive osteosarcomas(OS) and associated with poorer survival.\\u003c/strong\\u003e(A) Immunohistochemical staining with antibodies to LAP2α were performed on tumor and normal tissue from OS patients. (B) Quantitation of LAP2α staining and C-circle signal in OS(ALT+ and ALT-) and normal tissues from patients. (C) Kaplan-Meier metastasis-free survival curve for osteosarcoma patients showing the impact of ALT- or ALT+ on outcome. (D) Kaplan-Meier curves of overall survival for osteosarcoma patients based on LAP2α expression.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/a64782487a43e233f8142fb4.jpg\"},{\"id\":52044229,\"identity\":\"46debb74-d38f-4510-a014-e83dbc68f2d3\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:41\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1072474,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMethotrexate Reverses LAP2α-Induced Telomeric Chromatin decondensation, Offering Therapeutic Precision in Osteosarcoma. \\u003c/strong\\u003e(A) U2OS cells were transiently transfected with control siRNA or LAP2α siRNA and/or treated with MTX, Cells were harvested and subjected to ChIP experiments using antibodies raised against trimethylated H3K9, HP1 and control IgG binding to telomeres. Telomere repeat DNA was visualized by dot blot and probed with a telomere-specific probe. (B) Quantification of H3K9me3 and HP1 binding to telomeres (C)C-circle assay in U2OS cells treated with LAP2α siRNA and/or MTX. (D) Quantification the C-circle amount of (C).(E) PDX mouse model implanted with a human ALT+ or ALT- osteosarcoma tumor was divided into 4 groups (12 mice per group) and treated with vehicle, 0.5mg/kg MTX for 2 weeks, Treatment with MTX inhibits ALT+ osteosarcoma PDX tumor size compared with the vehicle group. ***P \\u0026lt; 0.001. (F)ALT+ PDX tumor morphology decreased after treatment with MTX compared to the control group. MTX did not significantly affect ALT- PDX tumor morphology mouse body weight compared with the vehicle group. (G)The graph of PDX tumor weight: ALT+ PDX tumor weight in the group treated with MTX was lower than the other groups. ***P \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/c9bf917e9799f598c3176443.jpg\"},{\"id\":67003481,\"identity\":\"e52b132c-a877-49b5-b9bb-3f1a79012285\",\"added_by\":\"auto\",\"created_at\":\"2024-10-19 07:09:20\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":9999768,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/263ba90a-374a-40b7-96f0-5f55ffc26289.pdf\"},{\"id\":52044220,\"identity\":\"ab234977-6daf-4dd4-9150-fa96ddfc4c9d\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"tif\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":2671840,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary information\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. S1. LAP2α interacted with shelterin complex in SAOS2 cells. \\u003c/strong\\u003e(A) PLA of LAP2α and TRF1 or TRF2 in SAOS2 cells transfected with control or LAP2α siRNA. Red dots represent PLA signals. (B)Metaphase chromosome spreads and telomere FISH in MG32 cells. Representative images showing fragile site (yellow arrows) and signal free ends (SFE, white arrows). (C) Quantification of fragile site and SFEs of MG32 cells. Values are mean ± SEM, n=3 (independent experiments); NS, no significance, two-tailed Student’s t-test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS1.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/718794c220cdc20953b68692.tif\"},{\"id\":52044223,\"identity\":\"0bf5b703-54e5-4878-95a7-88e723c154e1\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"tif\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":622236,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. S2.Q-FISH analysis of relative telomere length in U2OS cells. \\u003c/strong\\u003e(A) Representative images showing telomeres hybridized with Cy3-labelled telomere probe (red). (B) Frequency distributions of relative telomere length telomere length is shown above each panel. The mean telomere length values ± SEM and the number of nuclei analyzed is indicated. Values are mean ± SEM, n=3 (independent experiments) ; *P\\u0026lt;0.05 ,**P\\u0026lt;0.01 , ***P\\u0026lt;0.001, ****P\\u0026lt;0.0001 (two-tailed Student’s t-test); NS: no significance.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS2.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/e80fc1bdb61316c92f9690f4.tif\"},{\"id\":52044224,\"identity\":\"fdb07826-0abe-4858-b70d-3ef76e89b701\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"tif\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1563752,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. S3. Telomeric DNA double strands break induced by CRISPR-CAS9 SgTel system\\u003c/strong\\u003e（A）Dot blot of C-circle assay performed with genomic DNA from Hela cells and(top) MG32 cells(bottom). (B) APBs formation upon sustained telomeric DSBs induced by CRISPR/Cas9 in Hela cells. APBs in indicated cells were visualized by hybridization using antibody to PML (green, IF) and telomeric probe (red, FISH). (C) Quantification the percentage of positive cells with APBs of panel (B). (D) Hela became C-circle positive induced by CRISPR/Cas9 in Hela cells.\\u003cstrong\\u003e:\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS3.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/443e11fef71707ac95a7288a.tif\"},{\"id\":52044228,\"identity\":\"00d7e24e-c5f1-47f8-a9d1-bba76569af7a\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"tif\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":758144,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. S4.\\u003c/strong\\u003e (A) Colocalization of RAD51 with telomeres was analyzed by IF-FISH using telomeric G-rich probe (green) and antibodies to RAD51(red) in U2OS.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS4.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/cc6de15877f99ab495c303e0.tif\"},{\"id\":52044415,\"identity\":\"6007d819-11d3-47c4-b819-943339b61f04\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:13:40\",\"extension\":\"tif\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":764532,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig. S5. \\u003c/strong\\u003e(A) qRT-PCR analysis of TERRA levels in the indicated SAOS2 cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"FigureS5.tif\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/da55df292c66f309077b5bff.tif\"},{\"id\":52044226,\"identity\":\"a8c6ebc1-de5f-4164-8d2f-0149c098ac9a\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 19:05:40\",\"extension\":\"docx\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":15931,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Table 1\\u003c/strong\\u003ePrimers used for RT-PCR\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Supplementarytable1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3917613/v1/bd6a3dd3bcb86ad6dc10f793.docx\"}],\"financialInterests\":\"(Not answered)\",\"formattedTitle\":\"LAP2α Orchestrates Alternative Lengthening of Telomeres Suppression through Telomeric Heterochromatin Regulation with HDAC1: Unveiling a Potential Therapeutic Target\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eTelomere is a nucleoprotein structure found at the end of the linear chromosome, which is composed of TTAGGG repetitive DNA and shelterin complex. Human shelterin is a six-subunit complex (TRF2, TRF1, RAP1, TPP1, TIN2, and POT1) that binds telomeres and shields the ends of chromosomes from degradation and end-to-end fusions \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e. Due to the terminal replication problem, the length of the telomere gradually shortened with continuous cellular proliferation ,and the cells will eventually undergo cell cycle arrest then cellular senescence \\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e. Activation of telomere maintenance mechanism to prevent excessive telomere shortening is required for the sustained proliferation in cancer cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e. Most of cancers use telomerase to extend their telomeres \\u003csup\\u003e\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u003c/sup\\u003e but 10\\u0026ndash;15% of cancers elongate their telomere through telomerase independent pathway, which is named alternative lengthening of telomeres (ALT) \\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eALT was firstly found in the telomerase mutational budding yeast \\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e and then it was observed in human tumors. In the past decades, researchers have done a lot of work to uncover the molecular mechanism of ALT. Even though the precise molecular mechanism of ALT is still unclear. It is widely accepted that ALT is a DNA repair process dependent homologous recombination process \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e, which is represented by the appearance of a variety of hallmarks, including extra chromosome telomere repeat (CTR, such as C-circle), ALT associated PML bodies (APBs), heterogeneity of telomere length, and telomere sister chromatid exchange (T-SCE) \\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, accumulating evidence indicates that the long noncoding RNA (lncRNA) telomeric repeat-containing RNA (TERRA) are elevated in ALT cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe current studies revealed that the presence of recombinase RAD51 and RAD52 are essential for ALT telomere maintenance\\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. Inhibition of RAD52 decreases the natural ALT telomere synthesis at APBs in G2 cells\\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e, and the depletion of RAD51 leads to an increase of fragile telomeres and telomere dysfunction induced foci in ALT cells but not affects the mitotic DNA synthesis (MiDAS) at telomeres\\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. Instead of directly taking part in ALT DNA homologous recombination, RAD51 may mainly functions in lessening telomere fragility by suppressing the stalled replication forks. Moreover, RAD52-mediated telomeric MiDAS is observed in both ALT positive and telomerase positive cells when cells encounter with exogenous DNA damage or replication inhibitor, indicating that RAD52 is essential for break induce replication (BIR) at collapsed forks and fragile sites. Interestingly, a most recent study demonstrates that the c-circles levels are not altered in RAD52 knockdown cells, suggesting that there is a RAD52-independent ALT pathway, which is responsible for C-circles generation during telomere damage\\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, POLD3/POLD4 are reported to be required for the conservative DNA replication during BIR, which could be enhanced by BLM and reduced by SLX4\\u003csup\\u003e15\\u003c/sup\\u003e. In ALT positive human cells, telomeres undergo conservative synthesis also rely on POLD3/4, thereby linking ALT to BIR.\\u003c/p\\u003e \\u003cp\\u003e53BP1 nuclear bodies are formed when DNA damage occurs in S phase, however it is excluded from DNA breaks during mitosis. In contrast, the ssDNA-binding protein RPA can bind to exposed ssDNA in M-phase\\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e. Recent research reported that RPA plays critical roles in protecting resected ssDNA upon chromosome breakage and promoting the successful progress of telomeric MiDAS\\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, the elevated level of TERRA suggests it plays a crucial role in ALT telomeres recombinogenic by forming R-loop or RNA\\u0026ndash;DNA hybrids with the telomeric C-rich DNA strand, which contributes to activation of the DNA damage response (DDR) and promotes recruitment of the recombinase. \\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e. The aberrant accumulation of phosphorylated RPA at ALT telomeres when the RNaseH1 was deleted, which regulates the levels of RNA-DNA hybrids between telomeric, indicates that RPA itself could promote the forming of R-loop. Supporting this, it has been reported that the C-rich telomeric ssDNA accumulate in ALT cells when the RPA was depleted \\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, in yeast, the telomeres are bound by the Rap1 protein, Rap1 interacts with Sir3 and Sir4 that, together with the histone deacetylase Sir2, which initiate heterochromatin formation in subtelomeric regions\\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. The Sir2/Sir3/Sir4 complex also restricts TERRA expression via transcriptional repression\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e. So the roles of RPA and RAP1 in TERRA R-loop regulation in human ALT cells deserve further explore.\\u003c/p\\u003e \\u003cp\\u003ePrevious studies have shown that Lamin A/C is involved in DNA damage repair and telomere maintenance \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR24 CR25\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e. As a lamina associated protein, lamina associated polypeptide 2(LAP2) belongs to the LEM domain protein family. There are six splicing isoform encoded by the \\u003cem\\u003eTMPO\\u003c/em\\u003e, including LAP2 α, β, γ, δ, ε,and ζ \\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. All isoforms have LEM domain and LEM-like domain, by which to interact with BAF protein and bind to DNA \\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e. Unlike the other isoforms, LAP2α and ζ lacks transmembrane domain, thus they could only localize at nucleoplasm with Lamin A/C \\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, it is reported that LAP2α interacted with WRN helicase and Ku86 \\u003csup\\u003e25\\u003c/sup\\u003e, which are essential for classical non-homologous end joining repair and telomere integrity during telomeric DNA damage repair \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR33\\\" citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, it has been recently reported that LAP2α could promote the deposition of RPA on damaged DNA and facilitate the homologous recombination (HR) \\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. It has been demonstrated that, the distribution of LAP2α in cells changes with cell cycles \\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e, and it binds to telomere or sub-telomere at the anaphase and telophase of mitosis \\u003csup\\u003e\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e. Additionally, it has demonstrated that LAP2α could located at the end of chromosome and colocalized with telomere, during anaphase and telophase of mitosis. Thus, we speculate that LAP2α might play a critical role in break induced replication mediated alternative telomere lengthening.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we demonstrated the interaction of LAP2α with the shelterin complex. The knockdown of LAP2α resulted in a significant increase in ALT-associated hallmarks, including APBs, C-circles, and T-SCE, emphasizing LAP2α's crucial role in ALT maintenance. Subsequent investigations unveiled that LAP2α depletion led to the recruitment of recombination factors, such as RPA and RAD52, to telomeres. Moreover, LAP2α was found to interact with HDAC1, potentially contributing to the de-repression of the heterochromatin state of telomeric DNA, promoting telomere recombination and ALT occurrence. This observation aligns with our findings that LAP2α expression is low in ALT-positive osteosarcoma patients. Furthermore, methotrexate (MTX), a widely used drug for treating osteosarcoma, has been reported to enhance DNA heterochromatinization. Our discovery revealed that MTX treatment increased the aggregation of H3K9 trimethylation and HP1 in the telomeric region. Notably, in our patient-derived xenograft (PDX) model, MTX exhibited specific inhibition of the proliferation of LAP2α-low-expressing ALT-positive osteosarcoma tumors. Mechanistically, our data provide initial evidence that the lamina-associated protein LAP2α intricately participates in ALT telomere synthesis by regulating telomeric heterochromatin status. This breakthrough opens new avenues for unraveling the precise molecular mechanisms underlying ALT, offering promising insights for future investigations. Importantly, our findings enhance the targeted use of MTX, providing a critical context for its improved clinical performance.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLAP2α interacted with shelterin complex and LAP2α deficiency induced dysfunctional telomeres of ALT positive cells\\u003c/h2\\u003e \\u003cp\\u003ePrevious research has suggested that LAP2α, a lamin-associated protein, may participate in nuclear membrane reconstruction during mitosis and localize to the end of chromosomes during anaphase and telophase \\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e. This led us to investigate whether LAP2α was necessary for telomere maintenance. We initially validated the interaction between LAP2α and telomeres through proximity ligation assays (PLA), confirming the association between LAP2α and telomere binding proteins TRF1 and TRF2. This assessment was conducted in both ALT-positive U2OS and SAOS2 cells, as well as telomerase-positive HeLa cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA, B and Supplementary Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eA). PLA foci were present in all three cell lines, and the knockdown of LAP2α in these cell lines significantly reduced the PLA foci. These findings suggest that LAP2α interacts with the shelterin complex in vivo, regardless of whether the cells are ALT-positive or telomerase-positive. We then tested whether LAP2α plays a role in telomere maintenance by transiently transfecting cells with LAP2α siRNA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC) and examining telomere defects, including fragile telomere formation and telomere loss, in metaphase cells. Our results showed that LAP2α knockdown in U2OS cells significantly increased the number of fragile sites on telomeres and the number of chromosomes ends lacking telomere FISH signals (SFE) compared to siNC controls (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD, E). However, we did not observe any effect of LAP2α knockdown on telomere maintenance in HeLa cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF, G). To further confirm the non-specific role of LAP2α in osteosarcoma cells, telomerase-positive osteosarcoma cells MG32 were utilized. Even in MG32 cells, we did not observe any impact of LAP2α knockdown on telomere maintenance (Supplementary Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eB, C). These findings suggest that, despite LAP2α interacting with telomeres in multiple cell types, it is crucial for telomere maintenance specifically in ALT cells, not in telomerase-positive cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eKnockdown of LAP2α elevates the telomeric homologous recombination and extends the telomere length of ALT cell\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eNext, we aimed to further understand the role of LAP2α in ALT cells. Mechanistically, ALT is a telomere elongation mechanism that relies on homology-directed repair \\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e, which leaded to telomere aggregation termed \\\"telomere clustering\\\" \\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, we examined the effect of LAP2α disruption on telomere clustering in ALT cells. U2OS and SAOS2 cells were transfected with two different LAP2α siRNAs for 72 hours (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA), and the percentage of cells with clustered telomeres was determined. The results showed that the percentage of U2OS (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, C) and SAOS2(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD, E) cells with telomere clustering significantly increased upon LAP2α depletion. To directly observe telomeric homologous recombination in ALT cells, telomere chromosome orientation fluorescence in situ hybridization (CO-FISH) was carried out, and the occurrence of telomere sister chromatid exchange (T-SCE) events was determined. Consistent with the results of telomere clustering, the frequency of chromatid exchange was significantly increased in LAP2α-knockdown U2OS cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF, G). These findings support the idea that LAP2α inhibits telomeric homologous recombination in ALT cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFurthermore, we estimated telomere length by quantitative-FISH (Q-FISH) using two Alexa 488-labeled or Cy3-labeled PNA probes. The average fluorescence unit (AFU) was used to reflect relative telomere length. Our results showed that the telomere length was slightly extended when LAP2α was knocked down with both probes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH, I and Supplementary Fig. \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003e A, B).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLAP2α depletion stimulates the formation of hallmarks of ALT\\u003c/h2\\u003e \\u003cp\\u003eAlthough the precise molecular mechanism of ALT remains unclear, there are several hallmarks of ALT, including the formation of APBs and C-circles. To better understand the function of LAP2α in the ALT pathway, we examined the formation of APBs by determining the colocalization of PML and telomeric DNA in LAP2α knockdown U2OS and SAOS2 cells. The results showed that the average number of APBs per cell was significantly increased upon LAP2α removal (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA, B, C). Consequently, a rescue experiment was conducted by re-expressing the doxycycline (DOX)-inducible RNAi-resistant LAP2α in the knockdown cell lines, and we observed that the recovery of LAP2α restrained the formation of APBs in both cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA, B, C). In addition, upon LAP2α depletion, the formation of C-circles was significantly increased in two ALT cell lines, and subsequent rescue experiments further confirmed that LAP2α depletion stimulates the ALT process (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD, E). Meanwhile, LAP2α was knocked down in telomerase-positive HeLa cells and telomerase-positive osteosarcoma cells MG32, and the formation of C-circles was examined. We found that LAP2α deficiency alone could not enough to initiate the formation of C-circles (Supplementary Fig. \\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eA). These findings confirm that LAP2α inhibits the occurrence of ALT, but the knockdown of LAP2α alone is not sufficient to initiate ALT in telomerase-positive cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003ePrevious reports have shown that sustained double-strand breaks (DSBs) at telomeric DNA can lead to the formation of ALT-like characteristics and result in the initiation of recombination and elongation of telomeres in telomerase-positive cell lines \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. Thus, we attempted to deliberate the role of LAP2α in telomerase-positive cells upon telomeric DNA breaks. Firstly, double-strand telomeric DNA breaks were induced in HeLa cell lines using CRISPR-CAS9-sgTel system, which consists of sgRNA targeting telomeric DNA as previously reported\\u003csup\\u003e\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u003c/sup\\u003e. Immunofluorescence (IF) and fluorescence in situ hybridization (FISH) were performed to visualize the localization of 53BP1, an indicator of DNA damage response, with telomeres to verify the formation of telomeric-specific breaks. As expected, 53BP1 was recruited to telomeres to form telomere dysfunction foci (TIF) in HeLa cells after infection with CAS9-sgTel lentivirus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). And the hallmarks of ALT, such as the formation of APBs and C-circles, were observed be induced in HeLa cells upon treatment with CAS9-sgTel lentivirus (Supplementary Fig. \\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eB, C, D). Moreover, when we knocked down LAP2α after telomeric DNA breaks were induced, the formation of C-circles caused by CAS9-sgTel was significantly exacerbated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG). This finding again proves that LAP2α is crucial for telomeric break-induced repair and the initiation of telomere recombination in telomerase-positive cells upon breaks.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLAP2α repressing the recruitment of recombination factors to telomeres\\u003c/h2\\u003e \\u003cp\\u003eRPA (replication protein A), the sensor of single-stranded DNA (ssDNA) that plays an essential role in DNA damage repair and homologous recombination, has been shown to colocalize with telomeric DNA in human ALT cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, we examined the recruitment of RPA to telomeres by IF-FISH when LAP2α was knocked down. We observed a significant increase in the colocalization of RPA (RPA2) with telomeres upon LAP2α depletion (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA, B). Furthermore, RPA is crucial for the assembly of RAD52 recombinase during DNA double-strand break repair \\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e\\u003c/sup\\u003e, and RAD52 plays an important role in homologous telomere elongation in ALT cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, we also examined the recruitment of RAD52 to telomeres upon LAP2α depletion. Similarly, the recruitment of RAD52 to telomeres in U2OS cells increased after LAP2α knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC, D). We were unable to detect any foci of Rad51; therefore, we could not determine the colocalization of Rad51 and telomeres (Supplementary Fig. \\u003cspan refid=\\\"MOESM4\\\" class=\\\"InternalRef\\\"\\u003eS4\\u003c/span\\u003eA). Taken together, these findings indicate that the absence of LAP2α promotes the recruitment of recombination factors, including RPA and Rad52, to telomeres, thereby facilitating the ALT process.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLack of LAP2α decreased the heterchromatin status of telomere\\u003c/h2\\u003e \\u003cp\\u003eThe integrity of telomeric heterochromatin is thought to be a suppressor of ALT, given that the highly condensed chromatin structure inhibits recombination processes \\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e. Loss of nuclear lamina proteins, such as Lamin A/C\\u003csup\\u003e51,52\\u003c/sup\\u003e and SUN\\u003csup\\u003e\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e\\u003c/sup\\u003e, can alter the degree of DNA heterochromatinization. Additionally, LAP2α has been documented to interact with histone deacetylases (HDAC1), reinforcing the role of heterochromatin in chromatin condensation\\u003csup\\u003e\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, our subsequent investigation delved into the interaction between LAP2α and HDAC1, alongside the assessment of histone epigenetic modifications at the telomere region following LAP2α depletion. Proximity ligation assay (PLA) results demonstrated the in vivo interaction between endogenous LAP2α and HDAC1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). Moreover, LAP2α disruption led to a\\u0026thinsp;~\\u0026thinsp;30\\u0026ndash;40% reduction in H3K9 trimethylation and altered HP1 localization at telomeric repeats (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, C, D), suggesting that LAP2α depletion may impede the recruitment of HDAC1 to telomeres, consequently inducing telomeric chromatin decondensation. It has been reported that mutations in the demethylase KDM4B can reduce DNA heterochromatinization and enhance telomeric accessibility. This alteration correlates with increased levels of heterochromatin-associated proteins, including H3K9me3, ATRX, and HP1, observed in KDM4B knockout cells. To further validate the role of LAP2α in driving the formation of Alternative Lengthening of Telomeres (ALT) through the regulation of telomeric DNA heterochromatin status, KDM4B was depleted in siLAP2α U2OS cells to attenuate heterochromatinization in the telomeric region. Subsequently, its impact on ALT formation was elucidated by assessing C-circle formation. The current results indicate that the levels of H3K9me3 and HP1 at telomeres increased upon KDM4B knockdown in both siNC and siLAP2α U2OS cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, C, D). Furthermore, the heightened C-circle formation induced by LAP2α knockdown was rescued by depleting KDM4B (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE, F). These findings underscore the pivotal role of LAP2α in driving the formation of Alternative Lengthening of Telomeres (ALT) through the regulation of telomeric DNA heterochromatin status. To further investigate the impact of LAP2α on chromatin accessibility, we performed ATAC-seq analysis targeting the telomere region. Strikingly, our results demonstrated a significant increase in the number of accessible telomeres upon LAP2α depletion, providing further evidence for the stimulation of telomere accessibility by LAP2α disruption (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eG). Moreover, we explored the effect of LAP2α depletion on the accessibility of other genomic regions, including the 5\\u0026rsquo;-UTR, 3\\u0026rsquo;-UTR, gene body, and TSS. Remarkably, we observed a significant suppression of accessibility following LAP2α depletion, suggesting that LAP2α may exert a distinct regulatory function in modulating accessibility at various genomic loci (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eH). TERRA, transcribed from telomeric repeat-containing RNA, was reported to be down-regulated by the heterochromatic status of telomeric DNA (Nanavaty, Sandhu, Jehi, Pandya, \\u0026amp; Li, 2017). To further confirm the role of LAP2α in regulating the heterochromatin state, we detected TERRA transcripts from individual chromosomes (including 9p, 17p, and 5q) and found that the TERRA transcribed from these chromosomes was significantly elevated in LAP2α knockdown U2OS cells(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eI) and SAOS2 cells (Supplementary Fig. \\u003cspan refid=\\\"MOESM5\\\" class=\\\"InternalRef\\\"\\u003eS5\\u003c/span\\u003eA) Taken together, our data indicate that LAP2α knockdown results in the loss of telomeric heterochromatin, ultimately promoting the telomeric accessibility and the occurrence of ALT, potentially through the recruitment of deacetylase HDAC1 to chromosome ends.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLAP2α expression is lower in ALT-positive osteosarcomas(OS) and associated with poorer survival\\u003c/h2\\u003e \\u003cp\\u003eTo further explore the LAP2α expression and its impact on ALT positive tumor outcomes, we collected data from 39 OS cases, including 21 ALT-positive and 12 ALT-negative cases (Table.1). Through immunohistochemistry, we analyzed LAP2α expression in 33 osteosarcoma tissues and 4 normal tissues (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Expression levels were grouped as high or low based on a predetermined cut-off, and the C-circle signal distinguished ALT-negative and ALT-positive cases. Our analysis revealed significantly lower LAP2α expression in ALT-positive OS compared to ALT-negative OS and normal tissue (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). Kaplan-Meier analysis demonstrated poorer overall survival in ALT-positive cases (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC) and better outcomes with increased LAP2α expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD). Taken together, our findings suggest that the downregulation of LAP2α could serve as a potential marker or therapeutic target in managing the more aggressive ALT-positive osteosarcoma.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMethotrexate Reverses LAP2α-Induced Telomeric Chromatin decondensation, Offering Therapeutic Precision in Osteosarcoma\\u003c/h2\\u003e \\u003cp\\u003eAs previously mentioned, the knockdown of LAP2α has been associated with the promotion of ALT by decondensing telomeric chromatin. Given that methotrexate, a commonly used chemotherapy drug for osteosarcoma, has recently been identified as a heterochromatin-promoting agent by increasing the level of H3K9me3\\u003csup\\u003e56\\u003c/sup\\u003e, we aimed to investigate whether methotrexate could restore telomeric chromatin decondensation caused by LAP2α knockdown. Chromatin immunoprecipitation (ChIP) was performed, and telomeric heterochromatin markers H3K9me3 and HP1 were detected using dot blot analysis. The results demonstrated that the decrease in H3K9me3 and HP1 induced by LAP2α depletion was restored by methotrexate treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA, B), indicating the capacity of methotrexate treatment to counteract the decreased heterochromatinization induced by the knockdown of LAP2α. Subsequently, the C-Circle generation was determined. And we observed that the C-Circle signal was also reduced by ~\\u0026thinsp;34.5% after methotrexate treatment compared to the LAP2α depleted cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC, D). This additional observation lends further support to the notion that LAP2α plays a crucial role in influencing the occurrence of ALT, and that methotrexate can modulate this mechanism.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eGiven the subdivision of osteosarcoma into ALT\\u0026thinsp;+\\u0026thinsp;and ALT- categories, where ALT\\u0026thinsp;+\\u0026thinsp;exhibits a more open chromatin level in the telomere region compared to ALT-, we sought to determine if methotrexate exhibits differential sensitivity in these subtypes, aiming to offer improved guidance for clinical medication. To explore this, we established an osteosarcoma tumor patient-derived xenograft (PDX) mouse model, successfully generating one ALT-positive PDX and one ALT-negative PDX mouse. Subsequently, tumor tissues were extracted, dissociated into cells, and then re-implanted into NSG mice to establish a second generation of PDX mice. The mice were divided into four groups (n\\u0026thinsp;=\\u0026thinsp;12 mice per group) and subjected to treatment with either vehicle or 0.5 mg/kg/day methotrexate. Tumor volume and weight were closely monitored throughout the course of methotrexate treatment. These results revealed a significant reduction in ALT\\u0026thinsp;+\\u0026thinsp;tumor growth following methotrexate treatment compared to the vehicle-treated group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eE). Intriguingly, methotrexate exhibited no observable impact on ALT- PDX tumor growth relative to the vehicle-treated group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eF, G). These findings strongly suggest that for patients with the more aggressive ALT\\u0026thinsp;+\\u0026thinsp;phenotype, characterized by lower LAP2α expression, they may benefit from MTX treatment. Once again, this reaffirms that categorizing osteosarcoma based on the telomere extension pathway has the potential to enhance guidance for clinical medication decisions.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eTelomeres and telomerase are targets for anticancer drug development and specific inhibitors are currently under clinical investigation. However, only a few telomerase inhibition approach have been used in clinical settings, possibly due to the activation of the ALT pathway in response to persistent telomere DNA damage caused by these inhibitors, leading to increased tumor aggressiveness \\u003csup\\u003e\\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, understanding the telomere maintenance mechanism underlying the transition between the telomerase-dependent and ALT pathway is critical. This study reveals that LAP2α interacts with telomeres (TRF1/TRF2), suppressing ALT by inhibiting recombination factor recruitment. The occurrence is likely associated with its interaction with HDAC1, which contributed to a reduction in heterochromatinization and stimulated accessibility of telomere. In addition, the observation that LAP2α expression is increased in ALT-negative osteosarcoma patients further supports its significance in suppressing homologous recombination-mediated telomere lengthening. Patients with lower LAP2α expression in ALT-positive osteosarcoma exhibit a poorer prognosis and lower survival rates, prompting the consideration of whether enhancing heterochromatinization caused by LAP2α depletion can impede the growth of ALT tumors. Coincidentally, methotrexate (MTX), a common drug for osteosarcoma, is known to enhance DNA heterochromatinization. The administration of MTX was observed to inhibit ALT occurrence and suppress the proliferation of LAP2α lower-expressed ALT-positive patient-derived xenograft (PDX) tumors. In contrast, its impact on ALT-negative OS tumors was not pronounced. These findings offer valuable insights into the regulation of telomere maintenance and may have implications for the development of novel therapeutic strategies targeting telomere maintenance in ALT-positive cancers.\\u003c/p\\u003e \\u003cp\\u003eUntil now, the detailed molecular mechanism of the ALT pathway has not been fully understood. It has been suggested that ALT maintains telomeres through a homology-directed repair (HDR) process, involving various recombination factors, such as RPA, RAD51/RAD52, BLM, and SLX4 \\u003csup\\u003e59\\u003c/sup\\u003e. Upon DNA damage, cells initiate a DNA damage response process, resulting in a temporary opening of the chromatin structure around the damaged sites. This facilitates the access for DNA repair complexes to the affected regions. ALT is considered a telomere break-induced replication process, requiring the decondensation of telomeric DNA\\u003csup\\u003e\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eTypically, compacted heterochromatin is situated at the nuclear periphery, closely associated with the nuclear envelope (NE). Nuclear envelope proteins play roles in facilitating the attachment of telomere to the nuclear lamina (NL)\\u003csup\\u003e\\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e\\u003c/sup\\u003e. Although LAP2α's effect on telomeres is not well-explored, studies have elucidated the significant role of lamins in telomere homeostasis\\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e\\u003c/sup\\u003e. Lamin A, for instance, interacts with TRF2, contributing to the stabilization of chromosome-end structures\\u003csup\\u003e\\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e\\u003c/sup\\u003e. Diminished of lamin A/C or LMNA mutations stimulate telomere-telomere recombination\\u003csup\\u003e\\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e66\\u003c/span\\u003e\\u003c/sup\\u003e and reduced interstitial telomere-loop formation\\u003csup\\u003e\\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, the interaction between SUN1, a protein interacting with Lamin A, and RAP1 establishes a link between the nuclear envelope (NE) and the shelterin complex\\u003csup\\u003e\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e\\u003c/sup\\u003e. SUN1/2 interactions with the DNA-dependent protein kinase (DNAPK) complex contribute to telomere nonhomologous end-joining repair\\u003csup\\u003e\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e\\u003c/sup\\u003e. These collective insights shed light on the intricate interplay of nuclear envelope associated molecular components in the regulation of telomeres integrity.\\u003c/p\\u003e \\u003cp\\u003eNotably, LAP2α expression has been observed to mitigate the LMNA mutations-induced loss of H3K27me3, an epigenetics modification typically associated with gene silencing and chromatin compaction, especially in the telomere region\\u003csup\\u003e\\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, the co-localization of LAP2α with telomeres and H3K27me3 undergoes attenuation in Hutchinson-Gilford Progeria Syndrome (HGPS), a condition caused by mutations in the LMNA gene\\u003csup\\u003e\\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e\\u003c/sup\\u003e. These observations offer insights into the pivotal role of LAP2α in the regulation of chromatin organization. Mechanistically, our study demonstrates that LAP2α can interact with histone deacetylases to maintain a heterochromatic state at telomeres. These findings provide new insights into the role of nuclear architecture in regulating chromatin organization by LAP2α, particularly in its role of suppressing homology-directed repair in ALT cells or telomerase-positive cells in response to telomeric damage. Interestingly, the depletion of LAP2α is not sufficient to induce the formation of ALT features, indicating that it does not play a role in the initiation of ALT. Instead, it appears to balance homologous recombination to maintain telomere length after ALT activation.\\u003c/p\\u003e \\u003cp\\u003eWhile a recent study reported that LAP2α could associate with Replication Protein A (RPA) and facilitate its deposition to damaged chromatin during homologous recombination\\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. However, our findings reveal a distinctive occurrence at telomere, that the disruption of LAP2α increases the recruitment of RPA to telomeric DNA. Previous research in mammalian cells has established that ALT is a break-induced replication (BIR)-related process, representing a late DNA synthesis persisting through G2-M phase into mitosis, referred to as mitotic DNA synthesis (MiDAS) \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR73\\\" citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e\\u003c/sup\\u003e However, classical homologous recombination (HR), primarily activated during the S and G2 phases, repairs genomic DNA double-strand breaks (DSBs) \\u003csup\\u003e\\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e\\u003c/sup\\u003e. Our current data suggest that LAP2α's involvement in telomere homology-directed replication may differ from its role in ordinary genomic homologous recombination.\\u003c/p\\u003e \\u003cp\\u003eMethotrexate (MTX), a widely used drug in osteosarcoma treatment, has been identified as a potential molecule with the ability to increase heterochromatinization\\u003csup\\u003e\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e\\u003c/sup\\u003e. In our cell-based research, MTX induced enhanced heterochromatinization in the telomeric region, counteracting the chromatin decondensation caused by LAP2α depletion and subsequently suppressing ALT production. Furthermore, in the subsequent patient-derived xenograft (PDX) model, MTX effectively inhibited the growth of ALT-positive osteosarcoma tumors. However, the clinical subtyping of tumors based on ALT and the implementation of targeted therapies have not been actively pursued. Therefore, the use of MTX in the clinical treatment of ALT-positive osteosarcoma may potentially expand the benefits for relevant patients.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, the findings from this study illuminate LAP2α's pivotal role in suppressing telomere-telomere recombination and Alternative Lengthening of Telomeres (ALT) activity. The study underscores LAP2α's significance in ALT formation, emphasizing the intricate interplay between telomere-nuclear envelope association and ALT activity, closely linked with heterochromatin structure. Notably, in a patient-derived xenograft (PDX) model, methotrexate (MTX) exhibited a specific inhibitory effect on LAP2α-low-expressing ALT-positive osteosarcoma tumors. This discovery opens up a promising avenue for targeted clinical applications, suggesting MTX as a potential therapeutic agent for the specific treatment of ALT-positive osteosarcomas. The comprehensive nature of these findings not only emphasizes LAP2α's critical role in ALT but also positions MTX as a potential therapeutic option, potentially extending its applicability to other ALT-positive tumors. Further research and clinical investigations are warranted to explore the full scope of LAP2α and MTX as key players in the targeted therapy landscape for ALT-positive cancers.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture and treatment\\u003c/h2\\u003e \\u003cp\\u003eU2OS, HeLa, 293T, and SAOS2 cells were obtained from American Type Culture Collection (Manassas, VA). Cells were cultured at 37\\u0026deg;C and 5% CO2. U2OS and 293T cells were grown in DMEM (Corning) supplemented with 10% fetal bovine serum (FBS, gibco) and 1% penicillin/streptomycin (Hyclone). HeLa cells were grown in 1640 (Corning) with 10% FBS. SAOS2 cells were grown in McCoy's 5A (Hyclone) with 15% FBS and 1% penicillin/streptomycin (Hyclone). All cell lines were identified by standardized short tandem repeat analysis. Mycoplasma was regularly examined during cell culturing, and no contamination occurred during this study. Sequences of the various siRNAs used in the study are: NC(negative control): 5\\u0026prime;-UUCUCCGAACGUGUCACGUdTdT-3\\u0026prime;; siLAP2α-1:5\\u0026prime;-GCAACACAGAUAUUAU CAGdTdT-3\\u0026prime;; siLAP2α-2:5\\u0026prime;-GUCUAGAAGUGGCUAAGCAdTdT-3\\u0026prime;; siLAP2β-1: 5\\u0026prime;-GGGAUAUUCUUAAGGAAAUdTdT-3\\u0026prime;;siLAP2β-2:5\\u0026prime;-GGUGGAAACUUCAG-\\u003c/p\\u003e \\u003cp\\u003eAACAUdTdT-3\\u0026prime;.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRT-qPCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted with Eastep\\u0026reg; Super Total RNA Extraction kit (Promrga) and cDNA was prepared with HiScript II Q Select RT SuperMix for qPCR (Vazyme) following the manufacturer\\u0026rsquo;s instruction. qPCR reactions were performed with ChamQ SYBR qPCR Master Mix (Vazyme, China). GAPDH was used for normalization. qPCR primers are listed in the Supplementary Table.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eAntibodies and western blot analysis.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe antibodies used for western blot analysis were as follows: anti-GAPDH (affinity, AF0911, dilution1:5000), anti-LAP2α (Abcam, catalogue no. ab5162, dilution 1:1000). For immunoblotting, Whole cell lysates were isolated using RIPA buffer, quantified using the Pierce TM BCA protein assay kit (Thermo Scientific, Waltham, MA), separated by SDS-PAGE and transferred onto nitrocellulose membranes. The lysate was resolved on SDS\\u0026ndash;PAGE gel. The separated proteins were then blotted on a nitrocellulose plus membrane Membranes were blocked for 1hr in 5% non-fat dry milk in TBS/0.1% Tween-20 and incubated with appropriate primary antibody in blocking solution overnight at 4\\u0026deg;C. The membranes were washed 3\\u0026times;15 min with TBS/0.1% Tween-20 and incubated with appropriate secondary antibody in blocking solution for 1 h at room temperature. Chemiluminescence detection was performed using an ECL (MILLIPORE).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePlasmid Construction and Lentivirus Production\\u003c/h2\\u003e \\u003cp\\u003eThe pLenti-TRE-LAP2α-CBH-Tet-On@3G vector was gifts from Dr. Lei Shi (Tianjin medical University, China) and the lenti-CRISPRv2 consisting of Flag-Cas9 enzyme and sgRNA were gifts from Yong Zhao (Sun Yat-sen University, Guangzhou ). Briefly, the guiding sequence GTTAGGGTTAGGGTTAGGGTTA (referred to as sgTel in the text) was used to induce DSBs in telomeres. The scrambled sequence TGCTCCGTGCATCTGGCATC (referred to as sgScr in the text) was used as a control. For the production of the lentivirus, briefly, before transfection, plate 293T lentiviral packaging cells in a 10-cm dish in 10 ml of DMEM supplemented with 10% fetal bovine serum so that the cells are 70\\u0026ndash;80% confluent at the moment of transfection. In a sterile polypropylene tube, dilute 10 \\u0026micro;g of lentiviral expression plasmid into 500 \\u0026micro;l of Opti-MEM\\u0026reg; I (Invitrogen). In a separate tube, dilute 50 \\u0026micro;l of Polyetherimide (PEI) into 500 \\u0026micro;l of Opti-MEM I. Add diluted PEI reagent drop-wise to the plasmid solution while gently vortex the DNA-containing tube. Incubate the mixture for 20 minutes at room temperature to allow the plasmid-PEI complex to form. Add the complex directly to each dish. Replace the overnight culture medium with fresh DMEM medium. Collect the supernatant 48 hours post transfection and centrifuge the tubes at 500 g for 10 minutes to get rid of cell debris and stored at \\u0026minus;\\u0026thinsp;80\\u0026deg;C until use.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunofluorescence -fluorescence in situ hybridization (IF-FISH)\\u003c/h2\\u003e \\u003cp\\u003eCells were grown on a coverslip, washed with PBS and fixed in 4% paraformaldehyde for 5 minutes at room temperature, and then permeabilized in 0.5% Triton X-100 at room temperature for 30 minutes. The cells were washed thrice with PBS and blocked with 5% goat serum for 1 hour at room temperature. The cells were first incubated with primary antibody (anti-PML, Santa Cruz; anti-RPA2, Abcam; anti-RAD52, Santa Cruz; anti-53BP1, Abcam) overnight at 4\\u0026deg;C and then with secondary antibody conjugated with Alex488 or Alex555 for 1 hour at room temperature. The coverslip was washed with PBST and fixed in 4% paraformaldehyde for 10 minutes. Dehydrated in 70%, 95%, and 100%, denatured at 85\\u0026deg;C for 5 minutes, hybridized with Cy3-labeled or Alex488-labeled CCCTAA PNA probe (Panagene) for 2 hours at 37\\u0026deg;C, washed and mounted with the 4\\u0026prime;,6-diamidino-2-phenyl-indole (DAPI, D3571, Life Technologies, Carlsbad, CA). Fluorescence was detected and imaged using fluorescence microscope (Nikon, Tokyo, Japan).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eChromosome orientation fluorescence in suit hybridization (CO-FISH)\\u003c/h2\\u003e \\u003cp\\u003eAfter 54 hours of last transfection with siRNA, U2OS cells were incubated with BrdU for 18 hours; Colchicine (1\\u0026micro;g/ml) was added 5 hours before harvest. Cells were trypsinized and resuspended in a hypotonic solution of 0.075 M KCl incubated at 37\\u0026deg;C for 30 minutes. The cells were fixed thrice with methanol:acetic acid (3:1) for 10 minutes each time. The cells were then spread onto slides, digested with pepsin (1 mg/ml) for 40 seconds, and exposed to UV (365 nm, UVP-CL1000) in the presence of Hoechst for 35 minutes. The cells were treated with Exo III (200 U for 30 minutes at 37\\u0026deg;C), hybridized with G-rich probe (red, Cy3-labeled) and C-rich (green, Alex488-labeled) in sequence, mounted with DAPI, and observed using fluorescence microscope (Nikon, Tokyo, Japan).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTelomere Quantitative-FISH (Q-FISH)\\u003c/h2\\u003e \\u003cp\\u003eCells were treated with 1 \\u0026micro;g/ml colchicine for 3 hours to enrich cells at metaphase. Cells were harvested and q-FISH was performed as previously described \\u003csup\\u003e\\u003cspan citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e76\\u003c/span\\u003e\\u003c/sup\\u003e. Cy3-labeled or Alex488 labeled (CCCTAA)\\u003csub\\u003e3\\u003c/sub\\u003e PNA probe was used. Images were taken using a fluorescence microscope (Nikon, Tokyo, Japan). The fluorescence intensity of the telomeres was analyzed by Image J and the TFL-TELO program.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eC-circle assay\\u003c/h2\\u003e \\u003cp\\u003eThe C-circle assay was performed as described previously with minor modification \\u003csup\\u003e\\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e77\\u003c/span\\u003e\\u003c/sup\\u003e. Briefly, genomic DNA was was extracted with Tissue gDNA isolation kit (Biomiga) and a total of 30 ng genomic DNA was used for amplification with Φ29 DNA polymerase (NEB) at 30\\u0026deg;C for 8 hours followed by 65\\u0026deg;C for 20 minutes. The products were blotted onto nitrocellulose filter membrane, UV cross linked, and hybridized with a DIG-labeled probe (CCCTAA)4 to detect C-circle amplification products. Blots were washed, exposed to Tanon 5200 (Tanon Science and Technology Co., Ltd, Shanghai, China), and quantified using ImageJ.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eChromatin immunoprecipitation (ChIP) and Dot Blot\\u003c/h2\\u003e \\u003cp\\u003eChIP assays were carried out following the protocol from the truChIP Chromatin shearing Kit (Covaris). Briefly, cells were treated with 1% formaldehyde for 5 min at room temperature to crosslink proteins to DNA. The cell was harvested and lysised. After lysis, the nuclei pellet was collected and resuspended in CHIP buffer, and the chromatin was then sheared by AFA Focused-ultrasonicator (Covaris, Woburn, USA). A total of 25 \\u0026micro;l of sheared chromatin was taken to analysis the shearing efficiency, and the remaining chromatin was subjected to chromatin immunoprecipitation. An aliquot of each sample was set aside as input control, while the remaining portion was subjected to immunoprecipitation with anti-H3K9me3 (Abcam) overnight at 4\\u0026deg;C, with IgG (5 \\u0026micro;l/IP) as negative control. The complex of co-precipitation was captured by ChIP-Grade Protein G Dynabeads, and chromatin was eluted from antibody/Protein G Beads and reversed crosslinks. Subsequently, DNA was purified and eluted with PCR purification kits (QIAGEN, Hilden, Germany) for Dot-Blot.\\u003c/p\\u003e \\u003cp\\u003eFor dot blot the purified DNA was denatured in 0.2 M NaOH at 65\\u0026deg;C for 10 min, neutralized with 2\\u0026times; SSC, the samples were added to the membrane (Bio-Rad) using a dot-blotting apparatus loaded onto slot-blot Hybond N+ (GE healthcare) membrane, UV crosslinked to membrane, and pre-hybridized with DIG Easy Hyb solution (Roche) for 40 min and hybridized with DIG-labeled telomeric G-probe (TTAGGG)4 overnight at 42\\u0026deg;C. The membrane was washed twice in 2X SSC/0.1% SDS solution for 10 min then twice in 0.1X SSC/0.1% SDS for 10 min at 42\\u0026deg;C. The hybridization signal was detected using the DIG detection system (Roche) and quantitated using the ImageJ software. Calculate the amount of telomeric DNA immunoprecipitated relative to the signal of the corresponding inputs. The ChIP values are represented as a percentage of the total input telomeric DNA,\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eProximity ligation assay (PLA)\\u003c/h2\\u003e \\u003cp\\u003eThe protein interaction studies were performed with PLA. A Duolink\\u0026reg; In Situ Detection Reagents (DUO92002, Sigma, MO, USA) was used according to the manufacturer's instructions. Briefly, cells were cultured on sterile coverslips in 24-well plates and treated with siRNA. After being fixed with 4% PFA and permeabilized using 0.5% triton X-100, cells were blocked in Duolink II solution for 1 h. The slides were incubated with anti-TRF1 antibody (1:200) or anti-TRF2 antibody (1:200) and anti-LAP2α antibody (1:500) at 4\\u0026deg;C overnight, followed by incubation with Duolink PLA anti-Mouse PLUS and PLA anti-Rabbit PLUS proximity probes. After washing the slides three times, the ligation reaction was done for 30 min and the amplification was run for 100 min at 37\\u0026deg;C. Then the slides were visualized using a fluorescence microscope (Nikon, Tokyo, Japan).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eATAT-Seq\\u003c/h2\\u003e \\u003cp\\u003eATAC-seq was performed essentially as previously described\\u003csup\\u003e\\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e\\u003c/sup\\u003e. Briefly, U2OS cells were treated with siNC or 50 \\u0026micro;M siLAP2α RNA for 72 h. Then cells were harvested and sent to Beijing Novogene Co., Ltd. For ATAC-seq assay. ATAC-Seq were mapped to human genome (hg19 from UCSC genome browser) using Bowtie2 software package (version 2.3.0)\\u003csup\\u003e\\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e79\\u003c/span\\u003e\\u003c/sup\\u003e, followed by standard quality control and adapter removal. For telomere read analysis, the maximum number of times of consecutive appearance of telomere sequence (TTAGGG or the reverse complement CCCTAA) with exact match was counted.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemistry staining\\u003c/h2\\u003e \\u003cp\\u003eTissue sections were deparaffinized in xylene and microwaved in 10 mM sodium citrate buffer (pH 6.0) to unmask the epitopes. Endogenous peroxidase activity was blocked by incubating for 10 min with 3% hydrogen peroxide in methanol. Immunohistochemical staining for LAP2α (1:200) was performed by using the indirect avidin biotin-enhanced horseradish peroxidase method according to the manufacturer\\u0026rsquo;s instructions (Vector Laboratories, Burlingame, CA). After developing with 3,3\\u0026rsquo;-diaminobenzidine, all sections were counterstained with hematoxylin and observed by microscope (200\\u0026times; magnification). Quantitative analysis of immunohistochemical staining was performed using the Image-Pro Plus software (version 6.2) program (Media Cybernetics, Inc., Rockville, MD).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePatient-derived xenograft (PDX) mouse model\\u003c/h2\\u003e \\u003cp\\u003e PDX animal studies were preformed following guidelines approved by the Tianjin Medical University Institutional Animal Care and Use Committee (Tianjin, China). HumanALT\\u0026thinsp;+\\u0026thinsp;and ALT- osteosarcoma tumor fragments were obtained from The Tianjin Medical University Cancer Institute and Hospital and cut in smaller fragments (2\\u0026ndash;3 mm) and then implanted into severe combined immune deficient (SCID) mice. Mice were divided into 4 groups (12 mice per group). MTX (0.5 mg/kg) was dissolved in PBS with 2.5% dimethyl sulfoxide (DMSO), 5% polyethylene glycol 400 (PGE 400) and 5% tween 80. MTX was administered to mice by oral gavage. Tumor volume measurements were obtained every 2 days and tumor volume was calculated from measurements of 3 diameters of the individual tumor base using the ellipsoid formula: tumor volume (mm3) = (length \\u0026times; width \\u0026times; height \\u0026times; 0.52). Mice were monitored until tumor volume reached 1 cm3, at which time mice were euthanized and tumors were extracted.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe results are shown as means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM and the Student\\u0026rsquo;s two-tailed unpaired t-test was used to determine the statistical significance (*P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05; **P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01; ***P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001; ***P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). For every figure, statistical tests are justified as appropriate.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Basic Research Center of Tianjin Medical University for support. We thank Dr Yong Zhao (Sun Yat-sen University) for providing CRISPRv2 -sgScr and CRISPRv2-sgTel (plasmid). We thank Dr Ji-long Yang (\\u003cem\\u003eTianjin\\u003c/em\\u003e Medical University Cancer Institute and Hospital) for providing osteosarcoma tissues and 4 normal bone tissues.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of Interest Statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contribution Statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFW, LS, YL and YL conceived and designed the study. BW performed the analysis and prepared the manuscript drafts. HK assisted with analysis and helped supervise the project. QZ provided the siRNA and DOX-induced LAP2\\u0026alpha; over expression plasmid. YW assisted with PLA assay. DJ assisted with drawing. ZZ established PDX models and collected the data. YZ helped with ATAC-Seq data analysis. MZ and LS edited original draft. MZ edited and revised the manuscript. All the authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics Approval and Consent to Participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003esee supplementary file1\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the grant from the National Natural Science Foundation of China (No. 32170762, 3217050514, 31771520, 31471293, 91649102, 92149302, 81772243, 81771135, 81970958, 82303619), Tianjin Health Research Project (No. 19YFZCSY00600), Science and Technology Project of Tianjin Municipal Health Committee (No. TJWJ2022XK018, TJWJ2022QN030) and the Natural Science Foundation of Tianjin City (No. 19JCJQJC63500)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability Statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article [and itssupplementary information files]\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eSchmutz, I., and de Lange, T. (2016). Shelterin. Curr Biol \\u003cem\\u003e26\\u003c/em\\u003e, R397-399. 10.1016/j.cub.2016.01.056.\\u003c/li\\u003e\\n\\u003cli\\u003eShay, J.W., and Wright, W.E. (2000). Hayflick, his limit, and cellular ageing. Nat Rev Mol Cell Biol \\u003cem\\u003e1\\u003c/em\\u003e, 72-76. 10.1038/35036093.\\u003c/li\\u003e\\n\\u003cli\\u003eHanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next generation. Cell \\u003cem\\u003e144\\u003c/em\\u003e, 646-674. 10.1016/j.cell.2011.02.013.\\u003c/li\\u003e\\n\\u003cli\\u003eShay, J.W., and Bacchetti, S. (1997). A survey of telomerase activity in human cancer. Eur J Cancer \\u003cem\\u003e33\\u003c/em\\u003e, 787-791. 10.1016/S0959-8049(97)00062-2.\\u003c/li\\u003e\\n\\u003cli\\u003eHenson, J.D., and Reddel, R.R. (2010). Assaying and investigating Alternative Lengthening of Telomeres activity in human cells and cancers. FEBS Lett \\u003cem\\u003e584\\u003c/em\\u003e, 3800-3811. 10.1016/j.febslet.2010.06.009.\\u003c/li\\u003e\\n\\u003cli\\u003eAmorim, J.P., Santos, G., Vinagre, J., and Soares, P. (2016). The Role of ATRX in the Alternative Lengthening of Telomeres (ALT) Phenotype. Genes (Basel) \\u003cem\\u003e7\\u003c/em\\u003e. 10.3390/genes7090066.\\u003c/li\\u003e\\n\\u003cli\\u003eMcEachern, M.J., and Haber, J.E. (2006). Break-induced replication and recombinational telomere elongation in yeast. Annu Rev Biochem \\u003cem\\u003e75\\u003c/em\\u003e, 111-135. 10.1146/annurev.biochem.74.082803.133234.\\u003c/li\\u003e\\n\\u003cli\\u003eDunham, M.A., Neumann, A.A., Fasching, C.L., and Reddel, R.R. (2000). Telomere maintenance by recombination in human cells. Nat Genet \\u003cem\\u003e26\\u003c/em\\u003e, 447-450. 10.1038/82586.\\u003c/li\\u003e\\n\\u003cli\\u003eEpiskopou, H., Draskovic, I., Van Beneden, A., Tilman, G., Mattiussi, M., Gobin, M., Arnoult, N., Londono-Vallejo, A., and Decottignies, A. (2014). Alternative Lengthening of Telomeres is characterized by reduced compaction of telomeric chromatin. Nucleic Acids Res \\u003cem\\u003e42\\u003c/em\\u003e, 4391-4405. 10.1093/nar/gku114.\\u003c/li\\u003e\\n\\u003cli\\u003eAzzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007). Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science \\u003cem\\u003e318\\u003c/em\\u003e, 798-801. 10.1126/science.1147182.\\u003c/li\\u003e\\n\\u003cli\\u003eMladenov, E., Staudt, C., Soni, A., Murmann-Konda, T., Siemann-Loekes, M., and Iliakis, G. (2020). Strong suppression of gene conversion with increasing DNA double-strand break load delimited by 53BP1 and RAD52. Nucleic Acids Res \\u003cem\\u003e48\\u003c/em\\u003e, 1905-1924. 10.1093/nar/gkz1167.\\u003c/li\\u003e\\n\\u003cli\\u003eVerma, P., Dilley, R.L., Zhang, T., Gyparaki, M.T., Li, Y., and Greenberg, R.A. (2019). RAD52 and SLX4 act nonepistatically to ensure telomere stability during alternative telomere lengthening. Genes \\u0026amp; development \\u003cem\\u003e33\\u003c/em\\u003e, 221-235. 10.1101/gad.319723.118.\\u003c/li\\u003e\\n\\u003cli\\u003eCho, N.W., Dilley, R.L., Lampson, M.A., and Greenberg, R.A. (2014). Interchromosomal homology searches drive directional ALT telomere movement and synapsis. Cell \\u003cem\\u003e159\\u003c/em\\u003e, 108-121. 10.1016/j.cell.2014.08.030.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, J.M., Yadav, T., Ouyang, J., Lan, L., and Zou, L. (2019). Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways. Cell reports \\u003cem\\u003e26\\u003c/em\\u003e, 955-968 e953. 10.1016/j.celrep.2018.12.102.\\u003c/li\\u003e\\n\\u003cli\\u003eDilley, R.L., Verma, P., Cho, N.W., Winters, H.D., Wondisford, A.R., and Greenberg, R.A. (2016). Break-induced telomere synthesis underlies alternative telomere maintenance. Nature \\u003cem\\u003e539\\u003c/em\\u003e, 54-58. 10.1038/nature20099.\\u003c/li\\u003e\\n\\u003cli\\u003eKabeche, L., Nguyen, H.D., Buisson, R., and Zou, L. (2018). A mitosis-specific and R loop-driven ATR pathway promotes faithful chromosome segregation. Science \\u003cem\\u003e359\\u003c/em\\u003e, 108-114. 10.1126/science.aan6490.\\u003c/li\\u003e\\n\\u003cli\\u003eLezaja, A., Panagopoulos, A., Wen, Y., Carvalho, E., Imhof, R., and Altmeyer, M. (2021). RPA shields inherited DNA lesions for post-mitotic DNA synthesis. Nat Commun \\u003cem\\u003e12\\u003c/em\\u003e, 3827. 10.1038/s41467-021-23806-5.\\u003c/li\\u003e\\n\\u003cli\\u003eArora, R., Lee, Y., Wischnewski, H., Brun, C.M., Schwarz, T., and Azzalin, C.M. (2014). RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat Commun \\u003cem\\u003e5\\u003c/em\\u003e, 5220. 10.1038/ncomms6220.\\u003c/li\\u003e\\n\\u003cli\\u003eGraf, M., Bonetti, D., Lockhart, A., Serhal, K., Kellner, V., Maicher, A., Jolivet, P., Teixeira, M.T., and Luke, B. (2017). Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell \\u003cem\\u003e170\\u003c/em\\u003e, 72-85 e14. 10.1016/j.cell.2017.06.006.\\u003c/li\\u003e\\n\\u003cli\\u003eGrudic, A., Jul-Larsen, A., Haring, S.J., Wold, M.S., Lonning, P.E., Bjerkvig, R., and Boe, S.O. (2007). Replication protein A prevents accumulation of single-stranded telomeric DNA in cells that use alternative lengthening of telomeres. Nucleic Acids Res \\u003cem\\u003e35\\u003c/em\\u003e, 7267-7278. 10.1093/nar/gkm738.\\u003c/li\\u003e\\n\\u003cli\\u003eMoretti, P., Freeman, K., Coodly, L., and Shore, D. (1994). Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev \\u003cem\\u003e8\\u003c/em\\u003e, 2257-2269. 10.1101/gad.8.19.2257.\\u003c/li\\u003e\\n\\u003cli\\u003eIglesias, N., Redon, S., Pfeiffer, V., Dees, M., Lingner, J., and Luke, B. (2011). Subtelomeric repetitive elements determine TERRA regulation by Rap1/Rif and Rap1/Sir complexes in yeast. EMBO Rep \\u003cem\\u003e12\\u003c/em\\u003e, 587-593. 10.1038/embor.2011.73.\\u003c/li\\u003e\\n\\u003cli\\u003eGonzalez-Suarez, I., Redwood, A.B., Perkins, S.M., Vermolen, B., Lichtensztejin, D., Grotsky, D.A., Morgado-Palacin, L., Gapud, E.J., Sleckman, B.P., Sullivan, T., et al. (2009). Novel roles for A-type lamins in telomere biology and the DNA damage response pathway. EMBO J \\u003cem\\u003e28\\u003c/em\\u003e, 2414-2427. 10.1038/emboj.2009.196.\\u003c/li\\u003e\\n\\u003cli\\u003eHuang, S., Risques, R.A., Martin, G.M., Rabinovitch, P.S., and Oshima, J. (2008). Accelerated telomere shortening and replicative senescence in human fibroblasts overexpressing mutant and wild-type lamin A. Exp Cell Res \\u003cem\\u003e314\\u003c/em\\u003e, 82-91. 10.1016/j.yexcr.2007.08.004.\\u003c/li\\u003e\\n\\u003cli\\u003eLachapelle, S., Gagne, J.P., Garand, C., Desbiens, M., Coulombe, Y., Bohr, V.A., Hendzel, M.J., Masson, J.Y., Poirier, G.G., and Lebel, M. (2011). Proteome-wide identification of WRN-interacting proteins in untreated and nuclease-treated samples. J Proteome Res \\u003cem\\u003e10\\u003c/em\\u003e, 1216-1227. 10.1021/pr100990s.\\u003c/li\\u003e\\n\\u003cli\\u003eRedwood, A.B., Perkins, S.M., Vanderwaal, R.P., Feng, Z., Biehl, K.J., Gonzalez-Suarez, I., Morgado-Palacin, L., Shi, W., Sage, J., Roti-Roti, J.L., et al. (2011). A dual role for A-type lamins in DNA double-strand break repair. Cell Cycle \\u003cem\\u003e10\\u003c/em\\u003e, 2549-2560. 10.4161/cc.10.15.16531.\\u003c/li\\u003e\\n\\u003cli\\u003eCai, M., Huang, Y., Ghirlando, R., Wilson, K.L., Craigie, R., and Clore, G.M. (2001). Solution structure of the constant region of nuclear envelope protein LAP2 reveals two LEM-domain structures: one binds BAF and the other binds DNA. The EMBO journal \\u003cem\\u003e20\\u003c/em\\u003e, 4399-4407. 10.1093/emboj/20.16.4399.\\u003c/li\\u003e\\n\\u003cli\\u003eBrachner, A., and Foisner, R. (2011). Evolvement of LEM proteins as chromatin tethers at the nuclear periphery. Biochem Soc Trans \\u003cem\\u003e39\\u003c/em\\u003e, 1735-1741. 10.1042/BST20110724.\\u003c/li\\u003e\\n\\u003cli\\u003eLee, B., Lee, T.H., and Shim, J. (2017). Emerin suppresses Notch signaling by restricting the Notch intracellular domain to the nuclear membrane. Biochim Biophys Acta Mol Cell Res \\u003cem\\u003e1864\\u003c/em\\u003e, 303-313. 10.1016/j.bbamcr.2016.11.013.\\u003c/li\\u003e\\n\\u003cli\\u003eHarris, C.A., Andryuk, P.J., Cline, S.W., Mathew, S., Siekierka, J.J., and Goldstein, G. (1995). Structure and mapping of the human thymopoietin (TMPO) gene and relationship of human TMPO beta to rat lamin-associated polypeptide 2. Genomics \\u003cem\\u003e28\\u003c/em\\u003e, 198-205. 10.1006/geno.1995.1131.\\u003c/li\\u003e\\n\\u003cli\\u003eBrachner, A., and Foisner, R. (2014). Lamina-associated polypeptide (LAP)2alpha and other LEM proteins in cancer biology. Adv Exp Med Biol \\u003cem\\u003e773\\u003c/em\\u003e, 143-163. 10.1007/978-1-4899-8032-8_7.\\u003c/li\\u003e\\n\\u003cli\\u003eJaco, I., Munoz, P., and Blasco, M.A. (2004). Role of human Ku86 in telomere length maintenance and telomere capping. Cancer Res \\u003cem\\u003e64\\u003c/em\\u003e, 7271-7278. 10.1158/0008-5472.CAN-04-1381.\\u003c/li\\u003e\\n\\u003cli\\u003eMyung, K., Ghosh, G., Fattah, F.J., Li, G., Kim, H., Dutia, A., Pak, E., Smith, S., and Hendrickson, E.A. (2004). Regulation of telomere length and suppression of genomic instability in human somatic cells by Ku86. Mol Cell Biol \\u003cem\\u003e24\\u003c/em\\u003e, 5050-5059. 10.1128/MCB.24.11.5050-5059.2004.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y., Ghosh, G., and Hendrickson, E.A. (2009). Ku86 represses lethal telomere deletion events in human somatic cells. Proc Natl Acad Sci U S A \\u003cem\\u003e106\\u003c/em\\u003e, 12430-12435. 10.1073/pnas.0903362106.\\u003c/li\\u003e\\n\\u003cli\\u003eBao, K., Zhang, Q., Liu, S., Song, N., Guo, Q., Liu, L., Tian, S., Hao, J., Zhu, Y., Zhang, K., et al. (2022). LAP2alpha preserves genome integrity through assisting RPA deposition on damaged chromatin. Genome Biol \\u003cem\\u003e23\\u003c/em\\u003e, 64. 10.1186/s13059-022-02638-6.\\u003c/li\\u003e\\n\\u003cli\\u003eDechat, T., Gajewski, A., Korbei, B., Gerlich, D., Daigle, N., Haraguchi, T., Furukawa, K., Ellenberg, J., and Foisner, R. (2004). LAP2alpha and BAF transiently localize to telomeres and specific regions on chromatin during nuclear assembly. J Cell Sci \\u003cem\\u003e117\\u003c/em\\u003e, 6117-6128. 10.1242/jcs.01529.\\u003c/li\\u003e\\n\\u003cli\\u003eCrabbe, L., Cesare, A.J., Kasuboski, J.M., Fitzpatrick, J.A., and Karlseder, J. (2012). Human telomeres are tethered to the nuclear envelope during postmitotic nuclear assembly. Cell Rep \\u003cem\\u003e2\\u003c/em\\u003e, 1521-1529. 10.1016/j.celrep.2012.11.019.\\u003c/li\\u003e\\n\\u003cli\\u003eDilley, R.L., and Greenberg, R.A. (2015). ALTernative Telomere Maintenance and Cancer. Trends in cancer \\u003cem\\u003e1\\u003c/em\\u003e, 145-156. 10.1016/j.trecan.2015.07.007.\\u003c/li\\u003e\\n\\u003cli\\u003eHeaphy, C.M., Subhawong, A.P., Hong, S.M., Goggins, M.G., Montgomery, E.A., Gabrielson, E., Netto, G.J., Epstein, J.I., Lotan, T.L., Westra, W.H., et al. (2011). Prevalence of the alternative lengthening of telomeres telomere maintenance mechanism in human cancer subtypes. The American journal of pathology \\u003cem\\u003e179\\u003c/em\\u003e, 1608-1615. 10.1016/j.ajpath.2011.06.018.\\u003c/li\\u003e\\n\\u003cli\\u003eScherthan, H. (2007). Telomere attachment and clustering during meiosis. Cell Mol Life Sci \\u003cem\\u003e64\\u003c/em\\u003e, 117-124. 10.1007/s00018-006-6463-2.\\u003c/li\\u003e\\n\\u003cli\\u003eLovejoy, C.A., Li, W., Reisenweber, S., Thongthip, S., Bruno, J., de Lange, T., De, S., Petrini, J.H., Sung, P.A., Jasin, M., et al. (2012). Loss of ATRX, genome instability, and an altered DNA damage response are hallmarks of the alternative lengthening of telomeres pathway. PLoS Genet \\u003cem\\u003e8\\u003c/em\\u003e, e1002772. 10.1371/journal.pgen.1002772.\\u003c/li\\u003e\\n\\u003cli\\u003eMao, P., Liu, J., Zhang, Z., Zhang, H., Liu, H., Gao, S., Rong, Y.S., and Zhao, Y. (2016). Homologous recombination-dependent repair of telomeric DSBs in proliferating human cells. Nat Commun \\u003cem\\u003e7\\u003c/em\\u003e, 12154. 10.1038/ncomms12154.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, H., Xie, Y., Zhang, Z., Mao, P., Liu, J., Ma, W., and Zhao, Y. (2018). Telomeric Recombination Induced by DNA Damage Results in Telomere Extension and Length Heterogeneity. Neoplasia \\u003cem\\u003e20\\u003c/em\\u003e, 905-916. 10.1016/j.neo.2018.07.004.\\u003c/li\\u003e\\n\\u003cli\\u003eO\\u0026apos;Sullivan, R.J., Arnoult, N., Lackner, D.H., Oganesian, L., Haggblom, C., Corpet, A., Almouzni, G., and Karlseder, J. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nat Struct Mol Biol \\u003cem\\u003e21\\u003c/em\\u003e, 167-174. 10.1038/nsmb.2754.\\u003c/li\\u003e\\n\\u003cli\\u003eMarechal, A., and Zou, L. (2015). RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response. Cell Res \\u003cem\\u003e25\\u003c/em\\u003e, 9-23. 10.1038/cr.2014.147.\\u003c/li\\u003e\\n\\u003cli\\u003eCeccaldi, R., Rondinelli, B., and D\\u0026apos;Andrea, A.D. (2016). Repair Pathway Choices and Consequences at the Double-Strand Break. Trends Cell Biol \\u003cem\\u003e26\\u003c/em\\u003e, 52-64. 10.1016/j.tcb.2015.07.009.\\u003c/li\\u003e\\n\\u003cli\\u003eMehta, A., and Haber, J.E. (2014). Sources of DNA double-strand breaks and models of recombinational DNA repair. Cold Spring Harb Perspect Biol \\u003cem\\u003e6\\u003c/em\\u003e, a016428. 10.1101/cshperspect.a016428.\\u003c/li\\u003e\\n\\u003cli\\u003eMin, J., Wright, W.E., and Shay, J.W. (2019). Clustered telomeres in phase-separated nuclear condensates engage mitotic DNA synthesis through BLM and RAD52. Genes \\u0026amp; development \\u003cem\\u003e33\\u003c/em\\u003e, 814-827. 10.1101/gad.324905.119.\\u003c/li\\u003e\\n\\u003cli\\u003ePrice, B.D., and D\\u0026apos;Andrea, A.D. (2013). Chromatin remodeling at DNA double-strand breaks. Cell \\u003cem\\u003e152\\u003c/em\\u003e, 1344-1354. 10.1016/j.cell.2013.02.011.\\u003c/li\\u003e\\n\\u003cli\\u003eChen, Z., and Tyler, J.K. (2022). The Chromatin Landscape Channels DNA Double-Strand Breaks to Distinct Repair Pathways. Front Cell Dev Biol \\u003cem\\u003e10\\u003c/em\\u003e, 909696. 10.3389/fcell.2022.909696.\\u003c/li\\u003e\\n\\u003cli\\u003evan Steensel, B., and Belmont, A.S. (2017). Lamina-Associated Domains: Links with Chromosome Architecture, Heterochromatin, and Gene Repression. Cell \\u003cem\\u003e169\\u003c/em\\u003e, 780-791. 10.1016/j.cell.2017.04.022.\\u003c/li\\u003e\\n\\u003cli\\u003evan Schaik, T., Manzo, S.G., Vouzas, A.E., Liu, N.Q., Teunissen, H., de Wit, E., Gilbert, D.M., and van Steensel, B. (2022). Dynamic chromosomal interactions and control of heterochromatin positioning by Ki-67. EMBO Rep \\u003cem\\u003e23\\u003c/em\\u003e, e55782. 10.15252/embr.202255782.\\u003c/li\\u003e\\n\\u003cli\\u003eSosa, B.A., Kutay, U., and Schwartz, T.U. (2013). Structural insights into LINC complexes. Curr Opin Struct Biol \\u003cem\\u003e23\\u003c/em\\u003e, 285-291. 10.1016/j.sbi.2013.03.005.\\u003c/li\\u003e\\n\\u003cli\\u003eVidak, S., Kubben, N., Dechat, T., and Foisner, R. (2015). Proliferation of progeria cells is enhanced by lamina-associated polypeptide 2alpha (LAP2alpha) through expression of extracellular matrix proteins. Genes Dev \\u003cem\\u003e29\\u003c/em\\u003e, 2022-2036. 10.1101/gad.263939.115.\\u003c/li\\u003e\\n\\u003cli\\u003eGesson, K., Rescheneder, P., Skoruppa, M.P., von Haeseler, A., Dechat, T., and Foisner, R. (2016). A-type lamins bind both hetero- and euchromatin, the latter being regulated by lamina-associated polypeptide 2 alpha. Genome Res \\u003cem\\u003e26\\u003c/em\\u003e, 462-473. 10.1101/gr.196220.115.\\u003c/li\\u003e\\n\\u003cli\\u003eLoyola, A.C., Zhang, L., Shang, R., Dutta, P., Li, J., and Li, W.X. (2019). Identification of methotrexate as a heterochromatin-promoting drug. Sci Rep \\u003cem\\u003e9\\u003c/em\\u003e, 11673. 10.1038/s41598-019-48137-w.\\u003c/li\\u003e\\n\\u003cli\\u003eBechter, O.E., Zou, Y., Walker, W., Wright, W.E., and Shay, J.W. (2004). Telomeric recombination in mismatch repair deficient human colon cancer cells after telomerase inhibition. Cancer Res \\u003cem\\u003e64\\u003c/em\\u003e, 3444-3451. 10.1158/0008-5472.CAN-04-0323.\\u003c/li\\u003e\\n\\u003cli\\u003eCimino-Reale, G., Gandellini, P., Santambrogio, F., Recagni, M., Zaffaroni, N., and Folini, M. (2017). miR-380-5p-mediated repression of TEP1 and TSPYL5 interferes with telomerase activity and favours the emergence of an \\u0026quot;ALT-like\\u0026quot; phenotype in diffuse malignant peritoneal mesothelioma cells. J Hematol Oncol \\u003cem\\u003e10\\u003c/em\\u003e, 140. 10.1186/s13045-017-0510-3.\\u003c/li\\u003e\\n\\u003cli\\u003eGao, J., and Pickett, H.A. (2022). Targeting telomeres: advances in telomere maintenance mechanism-specific cancer therapies. Nat Rev Cancer \\u003cem\\u003e22\\u003c/em\\u003e, 515-532. 10.1038/s41568-022-00490-1.\\u003c/li\\u003e\\n\\u003cli\\u003eBhattacharjee, P., Das, A., Giri, A.K., and Bhattacharjee, P. (2020). Epigenetic regulations in alternative telomere lengthening: Understanding the mechanistic insight in arsenic-induced skin cancer patients. Sci Total Environ \\u003cem\\u003e704\\u003c/em\\u003e, 135388. 10.1016/j.scitotenv.2019.135388.\\u003c/li\\u003e\\n\\u003cli\\u003eShi, G., Hu, Y., Zhu, X., Jiang, Y., Pang, J., Wang, C., Huang, W., Zhao, Y., Ma, W., Liu, D., et al. (2020). A critical role of telomere chromatin compaction in ALT tumor cell growth. Nucleic Acids Res \\u003cem\\u003e48\\u003c/em\\u003e, 6019-6031. 10.1093/nar/gkaa224.\\u003c/li\\u003e\\n\\u003cli\\u003eShevelyov, Y.Y., and Ulianov, S.V. (2019). The Nuclear Lamina as an Organizer of Chromosome Architecture. Cells \\u003cem\\u003e8\\u003c/em\\u003e. 10.3390/cells8020136.\\u003c/li\\u003e\\n\\u003cli\\u003eTaimen, P., Pfleghaar, K., Shimi, T., Moller, D., Ben-Harush, K., Erdos, M.R., Adam, S.A., Herrmann, H., Medalia, O., Collins, F.S., et al. (2009). A progeria mutation reveals functions for lamin A in nuclear assembly, architecture, and chromosome organization. Proc Natl Acad Sci U S A \\u003cem\\u003e106\\u003c/em\\u003e, 20788-20793. 10.1073/pnas.0911895106.\\u003c/li\\u003e\\n\\u003cli\\u003eMakhija, E., Jokhun, D.S., and Shivashankar, G.V. (2016). Nuclear deformability and telomere dynamics are regulated by cell geometric constraints. Proc Natl Acad Sci U S A \\u003cem\\u003e113\\u003c/em\\u003e, E32-40. 10.1073/pnas.1513189113.\\u003c/li\\u003e\\n\\u003cli\\u003eWood, A.M., Rendtlew Danielsen, J.M., Lucas, C.A., Rice, E.L., Scalzo, D., Shimi, T., Goldman, R.D., Smith, E.D., Le Beau, M.M., and Kosak, S.T. (2014). TRF2 and lamin A/C interact to facilitate the functional organization of chromosome ends. Nat Commun \\u003cem\\u003e5\\u003c/em\\u003e, 5467. 10.1038/ncomms6467.\\u003c/li\\u003e\\n\\u003cli\\u003eRai, R., Biju, K., Sun, W., Sodeinde, T., Al-Hiyasat, A., Morgan, J., Ye, X., Li, X., Chen, Y., and Chang, S. (2023). Homology directed telomere clustering, ultrabright telomere formation and nuclear envelope rupture in cells lacking TRF2(B) and RAP1. Nat Commun \\u003cem\\u003e14\\u003c/em\\u003e, 2144. 10.1038/s41467-023-37761-w.\\u003c/li\\u003e\\n\\u003cli\\u003eEriksson, M., Brown, W.T., Gordon, L.B., Glynn, M.W., Singer, J., Scott, L., Erdos, M.R., Robbins, C.M., Moses, T.Y., Berglund, P., et al. (2003). Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature \\u003cem\\u003e423\\u003c/em\\u003e, 293-298. 10.1038/nature01629.\\u003c/li\\u003e\\n\\u003cli\\u003eHaque, F., Lloyd, D.J., Smallwood, D.T., Dent, C.L., Shanahan, C.M., Fry, A.M., Trembath, R.C., and Shackleton, S. (2006). SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to provide a physical connection between the nuclear lamina and the cytoskeleton. Mol Cell Biol \\u003cem\\u003e26\\u003c/em\\u003e, 3738-3751. 10.1128/MCB.26.10.3738-3751.2006.\\u003c/li\\u003e\\n\\u003cli\\u003eLei, K., Zhu, X., Xu, R., Shao, C., Xu, T., Zhuang, Y., and Han, M. (2012). Inner nuclear envelope proteins SUN1 and SUN2 play a prominent role in the DNA damage response. Curr Biol \\u003cem\\u003e22\\u003c/em\\u003e, 1609-1615. 10.1016/j.cub.2012.06.043.\\u003c/li\\u003e\\n\\u003cli\\u003eChojnowski, A., Ong, P.F., Wong, E.S., Lim, J.S., Mutalif, R.A., Navasankari, R., Dutta, B., Yang, H., Liow, Y.Y., Sze, S.K., et al. (2015). Progerin reduces LAP2alpha-telomere association in Hutchinson-Gilford progeria. Elife \\u003cem\\u003e4\\u003c/em\\u003e. 10.7554/eLife.07759.\\u003c/li\\u003e\\n\\u003cli\\u003eDe Sandre-Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I., Lyonnet, S., Stewart, C.L., Munnich, A., Le Merrer, M., and Levy, N. (2003). Lamin a truncation in Hutchinson-Gilford progeria. Science \\u003cem\\u003e300\\u003c/em\\u003e, 2055. 10.1126/science.1084125.\\u003c/li\\u003e\\n\\u003cli\\u003eBhowmick, R., Minocherhomji, S., and Hickson, I.D. (2016). RAD52 Facilitates Mitotic DNA Synthesis Following Replication Stress. Mol Cell \\u003cem\\u003e64\\u003c/em\\u003e, 1117-1126. 10.1016/j.molcel.2016.10.037.\\u003c/li\\u003e\\n\\u003cli\\u003eMin, J., Wright, W.E., and Shay, J.W. (2017). Alternative Lengthening of Telomeres Mediated by Mitotic DNA Synthesis Engages Break-Induced Replication Processes. Mol Cell Biol \\u003cem\\u003e37\\u003c/em\\u003e. 10.1128/MCB.00226-17.\\u003c/li\\u003e\\n\\u003cli\\u003eOzer, O., Bhowmick, R., Liu, Y., and Hickson, I.D. (2018). Human cancer cells utilize mitotic DNA synthesis to resist replication stress at telomeres regardless of their telomere maintenance mechanism. Oncotarget \\u003cem\\u003e9\\u003c/em\\u003e, 15836-15846. 10.18632/oncotarget.24745.\\u003c/li\\u003e\\n\\u003cli\\u003eTsouroula, K., Furst, A., Rogier, M., Heyer, V., Maglott-Roth, A., Ferrand, A., Reina-San-Martin, B., and Soutoglou, E. (2016). Temporal and Spatial Uncoupling of DNA Double Strand Break Repair Pathways within Mammalian Heterochromatin. Mol Cell \\u003cem\\u003e63\\u003c/em\\u003e, 293-305. 10.1016/j.molcel.2016.06.002.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, M., Wang, B., Li, T., Liu, R., Xiao, Y., Geng, X., Li, G., Liu, Q., Price, C.M., Liu, Y., and Wang, F. (2019). Mammalian CST averts replication failure by preventing G-quadruplex accumulation. Nucleic acids research \\u003cem\\u003e47\\u003c/em\\u003e, 5243-5259. 10.1093/nar/gkz264.\\u003c/li\\u003e\\n\\u003cli\\u003eHenson, J.D., Lau, L.M., Koch, S., Martin La Rotta, N., Dagg, R.A., and Reddel, R.R. (2017). The C-Circle Assay for alternative-lengthening-of-telomeres activity. Methods \\u003cem\\u003e114\\u003c/em\\u003e, 74-84. 10.1016/j.ymeth.2016.08.016.\\u003c/li\\u003e\\n\\u003cli\\u003eBuenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. (2013). Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods \\u003cem\\u003e10\\u003c/em\\u003e, 1213-1218. 10.1038/nmeth.2688.\\u003c/li\\u003e\\n\\u003cli\\u003eLangmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods \\u003cem\\u003e9\\u003c/em\\u003e, 357-359. 10.1038/nmeth.1923.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"LAP2α, nuclear envelope Telomere, ALT \",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3917613/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3917613/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eIn response to the challenge of telomere attrition during DNA replication, cancer cells predominantly employ telomerase or, in 10%-15% of cases, the alternative lengthening of telomeres (ALT). The intricate details of ALT, however, remain elusive. In this study, we unveil that the knockdown of lamina-associated polypeptide 2 alpha (LAP2α) in ALT cells results in telomere dysfunction, triggering a notable increase in ALT-associated hallmarks, including high frequencies of PML bodies (APBs), C-rich extrachromosomal circles (C-circles), and telomere sister chromatid exchange (T-SCE). Furthermore, LAP2α emerges as a crucial player in the process of break-induced telomere replication for telomerase-positive cells following telomeric double-strand breaks. Mechanistically, our investigation underscores LAP2α's role in hindering the recruitment of homologous recombination factors (e.g., RAD52 and RPA2) to telomeres. This occurs through the regulation of the heterochromatic state of telomeres, thereby increasing telomeric accessibility. Consistent with our findings, LAP2α expression is markedly diminished in ALT-positive Osteosarcoma. The use of methotrexate (MTX), which restores the lost heterochromatin state induced by LAP2α depletion, effectively reverses ALT characteristics. This is highlighted by a significant inhibition of tumor proliferation, specifically in ALT-positive patient-derived xenograft (PDX) mouse models. These results underscore the critical role of LAP2α in regulating ALT activity, offering significant insights into the interplay between lamina-associated proteins and telomeres for maintaining telomere length. Of paramount significance, our findings contribute to the identification of a more appropriate target population for the osteosarcoma therapeutic drug, MTX.\\u003c/p\\u003e\",\"manuscriptTitle\":\"LAP2α Orchestrates Alternative Lengthening of Telomeres Suppression through Telomeric Heterochromatin Regulation with HDAC1: Unveiling a Potential Therapeutic Target\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-03-05 19:05:35\",\"doi\":\"10.21203/rs.3.rs-3917613/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"revise\",\"date\":\"2024-03-28T16:00:36+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2024-03-21T21:55:17+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2024-03-18T09:25:39+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2024-03-04T08:27:54+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2024-03-03T23:19:06+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-03-03T17:28:01+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-02-02T10:52:28+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Cell Death \\u0026 Disease\",\"date\":\"2024-02-01T13:51:59+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-02-01T13:51:59+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"278f94fe-9013-4e16-80c2-b91ee5720af4\",\"owner\":[],\"postedDate\":\"March 5th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":29100543,\"name\":\"Biological sciences/Cell biology/Chromosomes/Telomeres\"},{\"id\":29100544,\"name\":\"Biological sciences/Cancer/Bone cancer\"}],\"tags\":[],\"updatedAt\":\"2024-10-19T07:08:59+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-3917613\",\"link\":\"https://doi.org/10.1038/s41419-024-07116-4\",\"journal\":{\"identity\":\"cell-death-and-disease\",\"isVorOnly\":false,\"title\":\"Cell Death \\u0026 Disease\"},\"publishedOn\":\"2024-10-19 04:00:00\",\"publishedOnDateReadable\":\"October 19th, 2024\"},\"versionCreatedAt\":\"2024-03-05 19:05:35\",\"video\":\"\",\"vorDoi\":\"10.1038/s41419-024-07116-4\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41419-024-07116-4\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3917613\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3917613\",\"identity\":\"rs-3917613\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}