{"paper_id":"3e7fc6bb-271e-47c2-a0fc-b107519ff3bb","body_text":"The deubiquitination enzyme USP14 regulates the tumourigenesis of gastric cancer by regulating c-MYC nuclear translocation through deubiquitination KPNA2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The deubiquitination enzyme USP14 regulates the tumourigenesis of gastric cancer by regulating c-MYC nuclear translocation through deubiquitination KPNA2 Xiaoxue Ke, Jia Li, Houyi Tang, Hongbo Chang, Erhu Zhao, Liang Du, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6295746/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Oct, 2025 Read the published version in Cell Death & Disease → Version 1 posted 10 You are reading this latest preprint version Abstract The deubiquitinating enzyme USP14, which belongs to the ubiquitin-specific protease family, is highly expressed in various malignant tumors. The regulatory mechanisms in tumors are complex and diverse, encompassing a range of cellular processes such as proliferation, apoptosis, inflammation, autophagy, and drug resistance. However, the functional role of USP14 in gastric cancer remains unclear. In the current investigation, a significant upregulation of USP14 expression was observed in gastric cancer, and its overexpression was associated with an unfavorable prognosis among patients. The involvement of USP14 is indispensable for promoting the growth, motility, and infiltration of gastric cancer cells, as revealed by our findings. Further investigations revealed that USP14 interacts with KPNA2 and is responsible for deubiquitinating it by removing ubiquitin. Moreover, the deubiquitylation process mediated by USP14 was found to be critically dependent on the K48 residue of ubiquitin. The knockdown of USP14 significantly suppressed the proliferation, migration, and invasion of gastric cancer cells. This effect was attributed to the regulation of c-MYC nuclear translocation through KPNA2 deubiquitination. The findings underscore the imperative for further evaluation of the potential therapeutic significance of USP14 in gastric cancer. Biological sciences/Cancer Biological sciences/Cancer/Cancer therapy Deubiquitinase USP14 KPNA2 Gastric cancer (GC) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. INTRODUCTION Globally, gastric cancer (GC) ranks among the top five most prevalent malignancies and represents the third leading cause of cancer-related mortality. Annually, there are nearly 1 million incident cases of stomach cancer worldwide, resulting in approximately 700,000 deaths[ 1 , 2 ]. The rate of metastasis in gastric cancer is among the highest compared to other types of malignant tumors, resulting in a significantly low five-year survival rate for patients with metastatic gastric cancer. The lymph, liver, and lung are the main target organs of gastric cancer metastasis, and it can also transfer to other parts through blood metastasis at a late stage. Inhibiting or reducing metastasis of gastric cancer has become a key link in the treatment of GC[ 3 , 4 ]. The exploration of the specific molecular mechanism behind gastric cancer metastasis can help identify more accurate bio-markers, which is crucial for designing improved treatment plans and enhancing patient prognosis and survival rates[ 5 ]. Ubiquitin-specific proteases 14(USP14) is a member of the ubiquitin-specific proteases (USPs) family. The level of the substrate protein can be stabilized by removing the ubiquitin label of the substrate protein, which is involved in a variety of signaling pathways and determines the fate of the cell[ 6 ]. For example, it plays an important role in the occurrence and development of human diseases by regulating the expression level and activity of multiple target proteins such as androgen receptors, cell cycle-related proteins, and apoptosis-related proteins. USP14 is abnormally highly expressed in a variety of malignant tumors, and its regulatory mechanisms are complex and diverse, covering the basic characteristics of tumors, such as cell proliferation, apoptosis, inflammation, autophagy, and drug resistance. Meanwhile, high USP14 expression is closely associated with poor prognosis in tumor patients. However, USP14 in tumorigenesis and progression are largely unknown. Especially its potential role in tumor metastasis remains to be explored[ 7 – 11 ]. KPNA2, a constituent of the karyopherin α family, is composed of 529 amino acid residues and plays a vital role as an intermediary in transporting molecules between the nucleus and cytoplasm 9,10. Research has shown that KPNA2 plays a role in regulating the transportation of molecules, both from the cytoplasm to the nucleus and vice versa. The expression of KPNA2 has been observed to be aberrant in various malignancies, including prostate cancer, colorectal cancer, and hepatocellular carcinoma[ 12 ]. The research conducted by Chen Li and colleagues has also discovered an increased expression of KPNA2[ 13 ], which has been associated with a negative prognosis for GC 16. Nevertheless, evidence of the potential regulatory mechanisms and specific functions of KPNA2 in gastric cancer metastasis is still lacking[ 14 ]. Our findings indicate a significant upregulation of USP14 expression in gastric cancer, which correlates with unfavorable prognosis among patients. Additionally, the suppression of USP14 hampers the migratory and invasive potential of gastric cancer cells. Mechanistically, we found that USP14 interacts with KPNA2 proteins, and USP14 regulates the stability of KPNA2 by deubiquitinating KPNA2, thus regulating the nuclear localization of c-MYC. 2. RESULTS 2.1 High USP14 expression is associated with poor prognosis in patients with gastric cancer To investigate the potential correlation between USP14 expression levels and the prognosis of patients diagnosed with gastric cancer, we first conducted preliminary mining in the database. According to the GEPIA database, a significant upregulation of USP14 expression was observed in gastric cancer tissues compared to normal tissues. (Fig. 1 A). The results of two GC datasets also showed that gastric cancer patients with high USP14 expression had poor prognosis (Fig. 1 B and C). At the cellular level, we further detected the expression of USP14 in five gastric cancer cell lines MKN-45, MGC-803, BGC-823, SGC-7901, HGC-27, and a normal gastric cell line GES-1 by qRT-PCR. We found that USP14 expression was significantly higher in four gastric cancer cell lines than in normal gastric mucosal cell line (Fig. 1 D). Further Western blot analysis also revealed high expression levels of this protein in GC cell lines (Fig. 1 E). Finally, the expression of USP14 in tumor tissues of patients with different grades of gastric cancer was detected by immunohistochemical staining. The results showed that most USP14 expression concentrated in the invasive edge of the tumor (Fig. 1 F), and the higher the grade, the higher the USP14 expression level (Fig. S1A). The combined findings suggest a significant upregulation of USP14 in gastric cancer tissues, indicating its potential implication in the development and progression of GC. 2.2 USP14 promotes the proliferation, migration, and invasion of gastric cancer cells To investigate the impact of USP14 on the progression of GC cells, we effectively suppressed the expression of USP14 by employing lentiviruses containing shRNA sequences to treat HGC-27 and SGC-7901 cells (Fig. 2 A). The MTT assay was utilized to evaluate the impact of downregulating USP14 expression on the growth of HGC-27 and SGC-7901 cells. The results demonstrated a significant inhibition in the proliferative capacity of gastric cancer cells following USP14 knockdown (Fig. 2 B). The plate cloning assay also demonstrated a significant inhibition of cell colony formation in HGC-27 and SGC-7901 cells upon knockdown of USP14 (Fig. S2A). In addition, the addition of USP14-specific inhibitor IU1 also inhibited the proliferation of GC cells (Fig. S2B and C).To confirm the crucial role of USP14 in GC metastasis, we performed migration and invasion assays (Fig. 2 C and D), which showed that the migration rate of GC cells was significantly reduced upon knockdown of USP14 compared to the control cells. The addition of the specific inhibitor of USP14 IU1 also showed that the migration and invasion ability of gastric cancer cells was inhibited (Fig. S2D and E). Furthermore, the study also examined the presence of certain proteins associated with metastasis. Results from Western blot assays indicated that USP14 knockdown had a significant impact on reducing the expression of proteins linked to proliferation and invasion (Fig. 2 E). The subcutaneous xenograft study demonstrated a significant reduction in growth rate, tumor volume, and weight of SGC-7901 cells with USP14 knockdown compared to control SGC-7901 cells. Moreover, immunohistochemical analysis revealed a decrease in Ki67 expression within tumor tissue sections following USP14 knockdown (Fig. 2 F-H). The findings suggest that suppression of USP14 expression hinders the proliferation, motility, infiltration, and progression of gastric cancer cells. 2.3 USP14 recovery rescues the cell proliferation, migration, and invasion of USP14 silenced GC cells To further validate the involvement of USP14 in the proliferation and metastasis of gastric cancer (GC) cells, we conducted a transfection experiment using a full-length USP14 sequence against shRNA#1 targeting USP14. The results demonstrated successful recovery of both USP14 protein and messenger RNA (mRNA) expression levels, thereby excluding any potential off-target effects (Fig. 3 A). Recovery of cell growth and proliferation was observed upon USP14 expression, as demonstrated by plate cloning (Fig. 3 B) and MTT (Fig. 3 C) assays. Furthermore, the migratory and invasive abilities of shUSP14 cells were significantly restored when USP14 expression was recovered(Fig. 3 D and E). In addition, the levels of various proteins associated with metastasis were assessed, and it was observed that the restoration of USP14 resulted in notable enhancements in the expression of MMP7, N-cadherin, and vimentin. (Fig. 3 F). Collectively, these results indicate that the role of USP14 is indispensable in facilitating the proliferation, migration, and invasion of gastric cancer cells. 2.4 USP14 interacts with KPNA2 and governs KPNA2 stability To investigate the regulatory mechanism of USP14, we performed Co-IP experiments and mass spectrometry to identify its interaction proteins. Subsequently, by utilizing the UbiBrowser 2.0 network database for prediction and intersection analysis, we obtained a gene list. Finally, through the preliminary experiment, we targeted the nuclear translocation of a variety of proteins that can regulate nuclear transport through the nuclear-cytoplasmic transport function, KPNA2, a member of the nuclear transporter family (Fig. 4 A). Previous studies have indicated a correlation between KPNA2 and unfavorable outcomes in patients with gastric cancer 16,17. qRT-PCR and Western blot assays showed that KPNA2 was highly expressed in gastric cancer cells, GEPIA2 database also showed that KPNA2 was highly expressed in gastric cancer(Fig. S2A-C). After obtaining KPNA2 stably down-regulated cell lines (Fig. S2D), we performed MTT, Wound-healing, and Transwell assays, and detected the expression levels of proliferation, migration, and invasion-related proteins (Fig. S2E-H). These results demonstrated that the knockdown of KPNA2 inhibited the proliferation, migration, and invasion of gastric cancer cells. This was consistent with the changes after USP14 knockdown, Next, we restored KPNA2 expression after knocking down USP14 in gastric cancer cells, performed MTT, Wound-healing, and Transwell assays, and detected the expression levels of proliferation, migration, and invasion proteins (Fig. S3A-D). These results indicated that the knockdown of USP14 followed by restoration of KPNA2 expression partially restored gastric cancer cell proliferation, migration, and invasion ability. We co-transfected MYC-USP14 plasmid and Flag-KPNA2 plasmid into HEK293FT cells, followed by co-immunoprecipitation using MYC and Flag Tag antibodies to detect their interaction. The results demonstrated a reciprocal interaction between exogenous USP14 and KPNA2. (Fig. 4 B). The same co-immunoprecipitation assay was used to examine the interaction of endogenous USP14 to KPNA2 in gastric cancer cells HGC-27 and SGC-7901, and the results showed that USP14 interacted with KPNA2. (Fig. 4 C). Furthermore, we conducted a proximity ligation assay (PLA) by utilizing antibodies anti-KPNA2 and MYC in HGC-27 and SGC-7901 cells that were transiently transfected with USP14 protein tagged with MYC (Fig. 4 D), which further verified the interaction between USP14 and KPNA2. The Western blot assays revealed a significant decrease in the protein level of KPNA2 in gastric cancer cells with USP14 knockdown (Fig. 4 E). However, there was no notable reduction observed in the mRNA level of KPNA2 (Fig. 4 F), suggesting that posttranscriptional regulation might be involved in the modulation of KPNA2 expression by USP14. Then, we found that overexpression of USP14 decreased the turnover rate of KPNA2 in gastric cancer cells by using the de novo protein synthesis inhibitor CHX(cycloheximide) (Fig. 4 G). Furthermore, we found that the decrease in KPNA2 protein expression in USP14 knockdown gastric cancer cells was rescued by using the proteasome inhibitor MG132 (Fig. 4 H). In brief, the findings of this study suggest that there is an interaction between USP14 and KPNA2, leading to the regulation of KPNA2 stability through inhibition of its degradation. Additionally, it appears that KPNA2-mediated migration and invasion in gastric cancer cells the control of USP14. 2.5 USP14 promotes KPNA2 deubiquitination USP14 is an important member of the deubiquitinating enzyme family of USP. Based on the above research, we speculated that USP14 plays a deubiquitinating enzyme activity to regulate the ubiquitination level of KPNA2, regulates the degradation of KPNA2, and then affects the proliferation, migration, and invasion of gastric cancer cells. We overexpressed the Flag-tagged KPNA2 plasmid in HEK293FT cells and performed ubiquitination assays with overexpression of the MYC-tagged USP14 plasmid as a variable. The results showed that the ubiquitination level of KPNA2 was reduced after USP14 overexpression (Fig. 5 A). In gastric cancer cells, we found that the ubiquitination of KPNA2 was significantly enhanced after USP14 knockdown (Fig. 5 B). The results of experiments with the addition of a specific inhibitor of USP14, IU1, also confirmed that USP14 inhibition leads to increased ubiquitination of KPNA2 (Fig. 5 C and D). An experiment was conducted to determine which domain(s) of USP14 mediated its interaction with KPNA2. Two mutants were constructed: USP14 C114A, which had an active site mutation, and USP14 lacking the ubiquitin-like domain (UBL) 18, and verify whether it affects KPNA2 ubiquitination (Fig. 5 E and F). The overexpression of USP14 significantly reduced K48 ubiquitination levels, while no significant change was observed in K63 ubiquitination levels of KPNA2 (Fig. 5 G and H). In summary, these results suggested that KPNA2 can bind to USP14 in its UBL domain. In addition, USP14 deubiquitinated KPNA2 by removing the K48 polyubiquitination chains from KPNA2. 2.6 USP14 regulates c-MYC nuclear transport and expression through KPNA2 To further explore the specific mechanism by which USP14 regulates gastric cancer cell migration and invasion through KPNA2, we verified the interaction of KPNA2 with c-MYC by Co-IP experiments in HEK293FT and gastric cancer cells, respectively (Fig. 6 A and B). Then, we performed nucleoplasmic separation experiments on gastric cancer cells with USP14 and KPNA2 knockdown, respectively. Knockdown of USP14 and KPNA2 reduced the expression of c-MYC in the nucleus (Fig. 6 C), and immunofluorescence experiments also showed that the fluorescence signal in the nucleus was significantly reduced after knocking down USP14 and KPNA2. However, the restoration of KPNA2 expression restored c-MYC signaling in the nucleus (Fig. 6 D). After transfecting LUC-SGC-7901 cells with USP14 and KPNA2 interference, and then injecting them into mice via the tail vein, it was found that their metastatic ability was significantly reduced compared to the control group (Fig. 6 E). These results suggested that USP14 regulates the migration and invasion of gastric cancer cells by regulating KPNA2 and regulating the nuclear translocation of c-MYC. 3. DISCUSSION Gastric cancer (GC) is a prevalent form of cancer globally, known for its frequent recurrences and extensive infiltration into the adjacent healthy tissue and blood vessel formation[ 15 ]. Despite the worldwide decrease in occurrence throughout the last century, gastric cancer (GC) continues to be a major cause of death globally. Hence, it is imperative to explore the molecular mechanisms that underlie GC. USP14, a member of the ubiquitin-specific protease family, has been observed to display increased expression in certain types of human cancers and is involved in crucial functions related to tumor formation and advancement[ 9 – 11 ]. In this study, functionally we identified an important role of USP14 in promoting gastric cancer proliferation and metastasis, which was also supported by previous findings in different cell lines, suggesting that USP14 may be a potential therapeutic target in gastric cancer. Mechanistically, we found that USP14 deubiquitinated KPNA2 and regulated c-MYC nuclear localization through KPNA2. As a member of the nuclear transport protein family, KPNA2 regulates the nuclear translocation of a variety of proteins through its nucleoplasmic transport function and participates in a variety of life activities such as proliferation, apoptosis, migration, invasion, transcriptional regulation, immune response, and virus infection[ 12 , 16 , 17 ]. Recent studies have shown that the expression of KPNA2 is up-regulated in a variety of tumor tissues, including gastric cancer[ 18 ], and the abnormal expression of KPNA2 is associated with poor prognosis of patients[ 19 ]. There are currently some reports on Mechanisms of action of KPNA2 in tumors. For example, the knockdown of KPNA2 in Non-small cell lung cancer resulted in the subcellular redistribution of E2F[ 20 ]. Similarly, the knockdown of KPNA2 downregulated c-MYC and reduced its transcriptional activity [ 21 ]. These results suggest that KPNA2 plays a vital role in tumor formation and progression. The regulation of various transcriptional programs and the crucial role in the progression of numerous human cancers are attributed to the transcriptional activator c-MYC. Under normal physiological conditions, multiple cellular mechanisms strictly govern the expression of c-MYC[ 22 ]. While the normal growth and proliferation of cells necessitate c-MYC, the abnormal activation or excessive expression of c-MYC is linked to the onset and progression of a majority of human malignancies[ 23 ]. The impact of the c-MYC gene on controlling the proliferation, migration, and invasion of GC cells is examine[ 24 ]. In addition, it has been reported that KPNA2 can regulate the nuclear translocation of c-MYC in breast cancer[ 25 ], and KPNA2 can regulate c-MYC expression in the nucleus by mediating the nuclear translocation of E2F1 in glioma[ 26 ]. In our investigation, it was observed that the depletion of USP14 and KPNA2 resulted in a reduction in the nuclear abundance of c-MYC. The reintroduction of KPNA2 expression led to a restoration of c-MYC localization within the nucleus. The fact that there are still unresolved issues deserving further investigation is worth noting. For example, Whether USP14 promotes cell apoptosis, the specific ubiquitination site of KPNA2 is still unknown, where is the specific binding amino acid of USP14 to KPNA2, and what is the specific mechanism by which USP14 controls the deubiquitination of KPNA2, and are there any additional genes implicated in the regulation of this ubiquitination process? Clinically, whether targeting the USP14 gene can be used in combination with other clinical first-line drugs such as 5-fluorouracil remains to be explored. Further investigation into these matters will contribute to a comprehensive comprehension of the increased stability of KPNA2 resulting from the elevated expression of USP14, thereby presenting a more valuable prospective focus for targeted therapy in GC. These aspects present intriguing subjects that merit additional exploration. Taken together, this study showed that USP14 promotes the proliferation, migration, invasion, and tumor growth of gastric cancer cells. Furthermore, we found that USP14 plays a regulatory role in gastric cancer cells by regulating KPNA2 mediated c-MYC nuclear translocation through deubiquitination. These findings provide new insights into the biological function of USP14 and suggest that USP14 can serve as a promising target for the treatment of gastric cancer. 4. Materials and Methods 4.1 Cell lines, drugs, reagents and antibodies All human GC cell lines (BGC-823, HGC-27, MGC-803, MKN-45, and SGC-7901), Human normal gastric cell line (GES-1), and human embryonic renal cell line HEK293FT were obtained from the American Type Culture Collection (ATCC, Beijing, China). All cell lines were tested mycoplasma-negative. MG132 and CHX were obtained from Sigma (Shanghai, China). IU1 was purchased from MedChemExpress (Shanghai, China). Anti-KPNA2, anti-MMP2, anti-MMP3, anti-MMP7, anti-Slug, anti-E-Cadherin, anti-N-cadherin, anti-α-Tubulin, anti-HA, anti-Ub antibodies were purchased from Proteintech (Wuhan, China). Anti-MYC, anti-Flag, anti-c-MYC, anti-Vimentin, anti-USP14, and anti-β-catenin antibodies were obtained from Cell Signaling Technology (Shanghai, China). Anti-Ki67 antibody was purchased from BD Biosciences. All antibodies were diluted according to the manufacturer’s instructions. 4.2 Transfection and infection experiments and plasmids Small-hairpin shRNAs for USP14 and KPNA2 and a negative control shRNA (shGFP) were obtained from Sangon Biotech. (Shanghai, China) and were inserted into the pLKO.1 vector. The ubiquitination plasmid that contained an HA tag and recombinant plasmids containing full-length human USP14 and KPNA2 cDNA cloned into the PCDH-CMV-MCS-EF1-Hygro vector were purchased from Youbao Company (Changsha, China). The ubiquitin mutant plasmids (K48, K63) containing the HA tag were also purchased from Youbao Company (Changsha, China). For transfection and infection experiments, the target plasmids and packaging plasmids were transfected into HEK293FT cells by using the transfection reagent Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Lentiviruses were collected 48 h later and used to infect GC cells twice, 24 h per infection. The infected cells were screened by treatment with puromycin for 36 h, and the surviving cells were frozen and stored in liquid nitrogen for subsequent experiments. For shUSP14 and shKPNA2 without sequence number indicated, interference sequence number 2 was the default. All the primers for the shRNA sequences are given in Table 1 . Table 1 Sequence of the shRNA primers. The shRNA sequences are listed below: shUSP14#1-F CCGGCCCAAGATTCAGCAGTCAGATCTCGAGA TCTGACTGCTGAATCTTGGGTTTTTG shUSP14#1-R AATTCAAAAACCCAAGATTCAGCAGTCAGATC TCGAGATCTGACTGCTGAATCTTGGG shUSP14#2-F CCGGCGCAGAGTTGAAATAATGGAACTCGAGT TCCATTATTTCAACTCTGCGTTTTTG shUSP14#2-R AATTCAAAAACGCAGAGTTGAAATAATGGAAC TCGAGTTCCATTATTTCAACTCTGCG shKPNA2#1-F AATTCAAAAAGCTGGTTTGATTCCGAAATTTCT CGAGAAATTTCGGAATCAAACCAGC shKPNA2#1-R AATTCAAAAAGCTGGTTTGATTCCGAAATTTCT CGAGAAATTTCGGAATCAAACCAGC shKPNA2#2-F CCGGCCTGGACACTTTCTAATCTTTCTCGAGAA AGATTAGAAAGTGTCCAGGTTTTTG shKPNA2#2-R AATTCAAAAACCTGGACACTTTCTAATCTTTCT CGAGAAAGATTAGAAAGTGTCCAGG 4.3 Immunohistochemistry staining Paraffin-embedded tumors were cut into 5 mm thick slices, and then the paraffin sections were dewaxed and hydrated. Then, paraffin slices were placed in citrate buffer (pH 6.0) and heated in a microwave oven to 95°C for 20 min to facilitate antigen retrieval. Then, endogenous peroxidase activity was quenched, followed by blocking with normal goat serum. Then, USP14 and Ki67 antibodies were diluted with BSA according to the manufacturer’s instructions, and the antibodies were added to the paraffin sections and incubated overnight at 4°C. Then, a horseradish peroxidase-linked secondary antibody was added and incubated with the sections, which was followed by the addition of DBA reagent. The results were observed under a microscope before counterstaining with hematoxylin. 4.4 Quantitative and Reverse Transcription PCR Total RNA was extracted from cells using TRIzol reagent. Then, 2 µg of RNA was reverse-transcribed into cDNA. The normalized expression control was based on the glyceraldehyde-3-phosphate dehydrogenase value. Finally, mRNA expression was determined as the CT value. All quantitative primers are given in Table 2 . RIPA was used for cell lysis to extract protein from the cells, and then, proteins were denatured and separated. Proteins of different molecular weights were separated by SDS-polyacrylamide gel electrophoresis and electrotransferred to polyvinylidene difluoride membranes. The membrane is sealed with skimmed milk to detect the proteins, and BSA to detect the phosphorylated proteins, and the membrane sections were incubated sequentially with primary antibodies, and then, secondary antibodies. The membranes were exposed to ECL Reagent (Cell Signaling) and visualized by Western blot analysis detection system (Thermo Fisher, Shanghai, China). Table 2 Sequence of the RT-PCR primers. USP14-forward CCGGCCCAAGATTCAGCAGTCAGATCTCGAGATC TGACTGCTGAATCTTGGGTTTTTG USP14-reverse AATTCAAAAACCCAAGATTCAGCAGTCAGATCTC GAGATCTGACTGCTGAATCTTGGG KPNA2-forward CCGGCGCAGAGTTGAAATAATGGAACTCGAGTT CCATTATTTCAACTCTGCGTTTTTG KPNA2-reverse AATTCAAAAACGCAGAGTTGAAATAATGGAACT CGAGTTCCATTATTTCAACTCTGCG GAPDH-forward CCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAA TTTCGGAATCAAACCAGCTTTTTG GAPDH-reverse AATTCAAAAAGCTGGTTTGATTCCGAAATTTCTC GAGAAATTTCGGAATCAAACCAGC 4.5 Plate cloning To clone plates, a six-well plate was seeded with 1 × 10^3 cells on coverslips. After two weeks, crystal violet staining solution was used to stain the cells and they were scanned using a scanner. The cells were then decolorized with absolute ethanol and shaken sufficiently before measuring absorbance at 560 nm. A graph was plotted based on the absorbance data obtained. 4.6 MTT assay 1 × 10^3 cells were seeded in each well of a 96-well plate and cultured for seven days. MTT reagent was added to the well and incubated at 37 degrees for two hours. After all the liquid in the well was discarded, DMSO(CAS:67-68-5, Sangon Biotech) reagent was added to each well and incubated at 37 degrees for 10 minutes. The absorbance value was detected and plotted at 560nm after the plate was shaken by the microplate reader. All experiments were independently performed three times. 4.7 Wound-healing assays The cells were grown until they reached 80% confluence and subjected to 24 hours of nutrient deprivation (0.1% FBS). A single wound was inflicted using a micropipette tip. Following rinsing, the cells were exposed to a medium containing 3% FBS at 37°C to facilitate cell migration. 4.8 Transwell migration and invasion assay Migration and invasion assay were conducted using chambers comprising Transwell membrane filter inserts (Cat # 3422, Corning Costar). Briefly, a total of 5 × 10^4 cells were seeded into each well of the 24-well Transwell chamber (with an 8 µm pore size) for the migration assay. For the invasion assay, cells were seeded into Matrigel-coated chambers. The seeding was performed in complete medium supplemented with 10% FBS. Non-penetrating cells on the filter were removed by wiping, and the cells on the lower surface of the filter were stained using a solution containing 0.4% crystal violet dye. The number of migrating or invading cells was determined by counting under a light microscope from three fields within one chamber per sample (mean ± SE). 4.9 Xenograft assay The Animal Protection and Utilization Committee of Southwest University approved conducting animal experiments. All experimental procedures adhered to the Guidelines for Use (Ministry of Science and Technology, China, 2006). Female NOD/SCID mice were procured and housed in a specific pathogen-free (SPF) room with controlled temperature and humidity at four weeks old. Each mouse received a slow injection of 1 × 10^5 human GC cells (SGC-7901) stably transfected with shGFP or shUSP14#2 into one side of their armpit. Upon completion of the experiment, the tumors were excised, processed, and subjected to analysis. Randomization was employed along with single blinding during measurements. Finally, the tumors were collected and photographed for subsequent immunohistochemical staining following previously established protocols. 4.10 Immunoprecipitation To begin, HEK293FT cells or gastric cancer cells were transfected with a specific plasmid and subsequently lysed IP lysis buffer. Following this, proteins were extracted from the cells. The target protein was then incubated overnight at 4°C with a specific proportion of primary antibody. Subsequently, a solution containing 50 µl protein A + G agarose beads was added to the protein and antibody mixture and incubated for 4 hours at 4°C. After incubation, the target proteins became attached to the beads, which were washed using precooled PBS buffer to eliminate impurities. To prepare for further analysis, the protein samples were mixed with 40 µl of 1×loading buffer and subjected to heat-denaturation. Next, these samples underwent separation through SDS polyacrylamide gel electrophoresis before being electrotransferred onto polyvinylidene difluoride membranes. These membranes were left to incubate overnight at 4°C with primary antibodies followed by an additional 2-hour incubation period with secondary antibodies. Finally, exposure and analysis of the membranes took place utilizing a Chemiscope 6000 imaging system. 4.11 Proximity ligation assay (PLA) The lentivirus-infected cells were sequentially subjected to puromycin selection, paraformaldehyde fixation, goat serum blocking, and overnight incubation with MYC and KPNA2 antibodies. Subsequently, The cells underwent exposure to a secondary antibody that was labeled with Alexa Fluor 594 (1:1000), along with utilization of a PLA assay Kit provided by Sigma-Aldrich®. Finally, confocal fluorescence microscopy (Olympus Fv1000, Japan) was employed for visualization and photography of the cells. 4.12 Turnover assay The cells infected with the virus were puromycin for a duration of 48 hours, followed by treatment with CHX at a concentration of 50 µg/ml. Subsequently, the cells were gathered, lysed, and subjected to Western blot analysis. 4.13 Ubiquitination assay To conduct the in vivo ubiquitination assay, designated plasmids were transfected into either HEK293FT cells or gastric cancer cells using a co-transfection approach. After 48 hours of transfection, the cells were exposed to MG132, a proteasome inhibitor, at a concentration of 50 µg/ml for a duration of 8 hours. Subsequently, Cell Lysis Buffer (Sigma) was employed to lyse the cells for Western blot and IP analysis following an identical protocol utilized for Co-immunoprecipitation. 4.14 Subcellular fractionation The cells were harvested and washed twice with PBS. Subcellular fractionation was then performed using the Nuclear and Cytoplasmic Protein kit (Beyotime Biotechnology, Wuhan, China) according to the manufacturer's instructions. The effectiveness of fractionation was assessed through immunoblotting analysis utilizing anti-Lamin A/C antibody (Proteintech, Wuhan, China) as a marker for nuclear proteins and anti-α-Tubulin antibody (Proteintech, Wuhan, China) as a marker for cytosolic proteins. 4.15 Immunofluorescence assay An immunofluorescence analysis was conducted to identify the presence of c-MYC in GC cells. In brief, cells were gathered, fixed, and coated. Following blocking, the cells were exposed to an anti-c-MYC antibody (1:500) overnight at 4°C. Subsequently, the cells were treated with a secondary antibody labeled with Alexa Fluor 594 (1:2000). The nuclear staining was performed using Hoechst 3334 2 (1:2000) subsequently. Under a fluorescence microscope, images of the cells were captured. 4.16 Patient data analysis The gene expression data were obtained from the GEPIA2 database ( http://gepia2.cancer-pku.cn ), while the prognostic data were acquired from the R2:Genome Analysis and Visualization Platform ( https://hgserver1.amc.nl/cgi-bin/r2/main.cgi ). Additionally, we utilized Kaplan-Meier Plotter database ( www.kmplot.com ) to determine the critical value for segregating the high-expression group and low-expression group, based on algorithms provided by these databases. 4.17 Statistical analysis The experiments were conducted in triplicate, and the figure captions provide information on statistical parameters such as sample size and significance analysis. A two-tailed Student's t-test was employed to determine significance at a 95% confidence level, assuming a normal distribution with slightly different yet comparable standard deviations. The quantitative data is presented as mean ± s.d., and statistical significance was considered for P values less than 0.05. Declarations SUPPLEMENTARY INFORMATION Supplementary information is available at cell death discovery’s website” at the end of the article and before the references. COMPETING INTERESTS The authors declare no competing interests. ETHICS All experiments involving cancer patients’ samples were obtained from Chaoying Biotechnology Co., Ltd. (Henan, China), and the studies were approved by the Medical Ethics Committee of Tongxu County People’s Hospital of Henan Province. All of the patients were informed consent. Animal welfare and experimental procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the animal ethics committee of Southwest University. FUNDING This work was supported by National Natural Science Foundation of China(81972626). AUTHOR CONTRIBUTIONS JL, HYT, HBC, EHZ, LQY have participated in the investigation, methodology, and validation of data presented in this article. JL, LD, and HJC are responsible for the formal analysis of data. JL and HBC wrote and edited this manuscript, LD and HJC read and revised this manuscript. All authors read and approved the final manuscript. DATA AVAILABILITY All data are available in the main text or the supplementary materials References Chia NY, Tan P. Molecular classification of gastric cancer. Ann Oncol 27 , 763-9 (2016). https://doi.org/10.1093/annonc/mdw040 Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Ca Cancer J Clin 71 , 209-49 (2021). https://doi.org/10.3322/caac.21660 Yamashita K, Sakuramoto S, Watanabe M. Genomic and epigenetic profiles of gastric cancer: potential diagnostic and therapeutic applications. Surg Today 41 , 24-38 (2011). https://doi.org/10.1007/s00595-010-4370-5 Jiang H, Yu D, Yang P, Guo R, Kong M, Gao Y, Yu X, Lu X, Fan X. Revealing the transcriptional heterogeneity of organ-specific metastasis in human gastric cancer using single-cell rna sequencing. Clin Transl Med 12 , e730 (2022). https://doi.org/10.1002/ctm2.730 Zheng Z, Lin F, Zhao B, Chen G, Wei C, Chen X, Nie R, Zhang R, Zhao Z, Zhou Z, Li Y, Dai W, Lin Y, Chen Y. Alkbh5 suppresses gastric cancer tumorigenesis and metastasis by inhibiting the translation of uncapped wrap53 rna isoforms in an m6a-dependent manner. Mol Cancer 24 , 19 (2025). https://doi.org/10.1186/s12943-024-02223-4 Wang D, Ma H, Zhao Y, Zhao J. Ubiquitin-specific protease 14 is a new therapeutic target for the treatment of diseases. J Cell Physiol 236 , 3396-405 (2021). https://doi.org/10.1002/jcp.30124 Wu N, Liu C, Bai C, Han YP, Cho WC, Li Q. Over-expression of deubiquitinating enzyme usp14 in lung adenocarcinoma promotes proliferation through the accumulation of beta-catenin. Int J Mol Sci 14 , 10749-60 (2013). https://doi.org/10.3390/ijms140610749 Shinji S, Naito Z, Ishiwata S, Ishiwata T, Tanaka N, Furukawa K, Suzuki H, Seya T, Matsuda A, Katsuta M, Tajiri T. Ubiquitin-specific protease 14 expression in colorectal cancer is associated with liver and lymph node metastases. Oncol Rep 15 , 539-43 (2006) Zhu L, Yang S, He S, Qiang F, Cai J, Liu R, Gu C, Guo Z, Wang C, Zhang W, Zhang C, Wang Y. Downregulation of ubiquitin-specific protease 14 (usp14) inhibits breast cancer cell proliferation and metastasis, but promotes apoptosis. J Mol Histol 47 , 69-80 (2016). https://doi.org/10.1007/s10735-015-9650-3 Zhu Y, Zhang Y, Sui Z, Zhang Y, Liu M, Tang H. Usp14 de-ubiquitinates vimentin and mir-320a modulates usp14 and vimentin to contribute to malignancy in gastric cancer cells. Oncotarget 8 , 48725-36 (2017). https://doi.org/10.18632/oncotarget.10706 Fu Y, Ma G, Liu G, Li B, Li H, Hao X, Liu L. Usp14 as a novel prognostic marker promotes cisplatin resistance via akt/erk signaling pathways in gastric cancer. Cancer Med 7 , 5577-88 (2018). https://doi.org/10.1002/cam4.1770 Han Y, Wang X. The emerging roles of kpna2 in cancer. Life Sci 241 , 117140 (2020). https://doi.org/10.1016/j.lfs.2019.117140 Li C, Ji L, Ding ZY, Zhang QD, Huang GR. Overexpression of kpna2 correlates with poor prognosis in patients with gastric adenocarcinoma. Tumour Biol 34 , 1021-6 (2013). https://doi.org/10.1007/s13277-012-0641-7 Tsai MM, Huang HW, Wang CS, Lee KF, Tsai CY, Lu PH, Chi HC, Lin YH, Kuo LM, Lin KH. Microrna-26b inhibits tumor metastasis by targeting the kpna2/c-jun pathway in human gastric cancer. Oncotarget 7 , 39511-26 (2016). https://doi.org/10.18632/oncotarget.8629 Ajani JA, D'Amico TA, Bentrem DJ, Chao J, Cooke D, Corvera C, Das P, Enzinger PC, Enzler T, Fanta P, Farjah F, Gerdes H, Gibson MK, Hochwald S, Hofstetter WL, Ilson DH, Keswani RN, Kim S, Kleinberg LR, Klempner SJ, Lacy J, Ly QP, Matkowskyj KA, Mcnamara M, Mulcahy MF, Outlaw D, Park H, Perry KA, Pimiento J, Poultsides GA, Reznik S, Roses RE, Strong VE, Su S, Wang HL, Wiesner G, Willett CG, Yakoub D, Yoon H, Mcmillian N, Pluchino LA. Gastric cancer, version 2.2022, nccn clinical practice guidelines in oncology. J Natl Compr Canc Netw 20 , 167-92 (2022). https://doi.org/10.6004/jnccn.2022.0008 Park SH, Ham S, Lee A, Moller A, Kim TS. Nlrp3 negatively regulates treg differentiation through kpna2-mediated nuclear translocation. J Biol Chem 294 , 17951-61 (2019). https://doi.org/10.1074/jbc.RA119.010545 Christiansen A, Dyrskjot L. The functional role of the novel biomarker karyopherin alpha 2 (kpna2) in cancer. Cancer Lett 331 , 18-23 (2013). https://doi.org/10.1016/j.canlet.2012.12.013 Chen X, Wei H, Yue A, Zhang H, Zheng Y, Sun W, Zhou Y, Wang Y. Kpna2 promotes the progression of gastric cancer by regulating the alternative splicing of related genes. Sci Rep 14 , 17140 (2024). https://doi.org/10.1038/s41598-024-66678-7 Ohhara Y, Kinoshita I, Suzuki A, Imagawa M, Taguchi J, Noguchi T, Takeuchi S, Shimizu Y, Seki H, Suzuki J, Dosaka-Akita H. Expression of karyopherin alpha 2 and karyopherin beta 1 correlate with poor prognosis in gastric cancer. Oncology 100 , 685-95 (2022). https://doi.org/10.1159/000526807 Xiang S, Wang Z, Ye Y, Zhang F, Li H, Yang Y, Miao H, Liang H, Zhang Y, Jiang L, Hu Y, Zheng L, Liu X, Liu Y. E2f1 and e2f7 differentially regulate kpna2 to promote the development of gallbladder cancer. Oncogene 38 , 1269-81 (2019). https://doi.org/10.1038/s41388-018-0494-7 Li J, Liu Q, Liu Z, Xia Q, Zhang Z, Zhang R, Gao T, Gu G, Wang Y, Wang D, Chen X, Yang Y, He D, Xin T. Kpna2 promotes metabolic reprogramming in glioblastomas by regulation of c-myc. J Exp Clin Cancer Res 37 , 194 (2018). https://doi.org/10.1186/s13046-018-0861-9 Fatma H, Maurya SK, Siddique HR. Epigenetic modifications of c-myc: role in cancer cell reprogramming, progression and chemoresistance. Semin Cancer Biol 83 , 166-76 (2022). https://doi.org/10.1016/j.semcancer.2020.11.008 Pelengaris S, Khan M, Evan G. C-myc: more than just a matter of life and death. Nat Rev Cancer 2 , 764-76 (2002). https://doi.org/10.1038/nrc904 Zhang L, Hou Y, Ashktorab H, Gao L, Xu Y, Wu K, Zhai J, Zhang L. The impact of c-myc gene expression on gastric cancer cell. Mol Cell Biochem 344 , 125-35 (2010). https://doi.org/10.1007/s11010-010-0536-0 Duan M, Hu F, Li D, Wu S, Peng N. Silencing kpna2 inhibits il-6-induced breast cancer exacerbation by blocking nf-kappab signaling and c-myc nuclear translocation in vitro. Life Sci 253 , 117736 (2020). https://doi.org/10.1016/j.lfs.2020.117736 Wang T, Huang Z, Huang N, Peng Y, Gao M, Wang X, Feng W. Inhibition of kpnb1 inhibits proliferation and promotes apoptosis of chronic myeloid leukemia cells through regulation of e2f1. Onco Targets Ther 12 , 10455-67 (2019). https://doi.org/10.2147/OTT.S210048 Additional Declarations (Not answered) Supplementary Files supply.docx supplementary figure XXXXXX.zip Original data of qPCR WB.zip Original data of WB Cite Share Download PDF Status: Published Journal Publication published 21 Oct, 2025 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 29 May, 2025 Review # 2 received at journal 22 May, 2025 Review # 1 received at journal 03 May, 2025 Reviewer # 2 agreed at journal 02 May, 2025 Reviewer # 1 agreed at journal 01 May, 2025 Reviewers invited by journal 29 Apr, 2025 Submission checks completed at journal 31 Mar, 2025 First submitted to journal 31 Mar, 2025 Unknown event 25 Mar, 2025 Editor assigned by journal 24 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6295746\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":449714474,\"identity\":\"64e4028c-98a2-40ae-9208-5d3cf74a20f6\",\"order_by\":0,\"name\":\"Xiaoxue Ke\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYBACCSA+AGaxNzY++ECaFp7DzYYziNUCZaW3SXMQo0WyvcfwwI+Kw4n9kg8bpBkY7OR0GwhokeY5lnCw50xa4szZiQ3GBQzJxmYHCGiRk0g+cIC3zSZxw+3EhuQZDAcStxHUIv+w4eDfNonE/TcPNhzmIUaLtATzgcNgWyQYG5uJ0iLZk5ZwWOZMmvGMM4nNjDMMiPCLxPEzxh/fVByW7W8//vzHhwo7OYJa0IABacpHwSgYBaNgFOAAAJC/R3MCxP+8AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Southwest University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Xiaoxue\",\"middleName\":\"\",\"lastName\":\"Ke\",\"suffix\":\"\"},{\"id\":449714475,\"identity\":\"11c5444c-c5c0-439e-89f5-4db520acad38\",\"order_by\":1,\"name\":\"Jia Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Beijing Forestry University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jia\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":449714476,\"identity\":\"1cd0698f-5d32-468f-a28e-d8113d304b2c\",\"order_by\":2,\"name\":\"Houyi Tang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Southwest University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Houyi\",\"middleName\":\"\",\"lastName\":\"Tang\",\"suffix\":\"\"},{\"id\":449714477,\"identity\":\"4aaa4206-bb00-4a13-bba0-12800abaf4b0\",\"order_by\":3,\"name\":\"Hongbo Chang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Silkworm Genome Biology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hongbo\",\"middleName\":\"\",\"lastName\":\"Chang\",\"suffix\":\"\"},{\"id\":449714478,\"identity\":\"680cbdcc-8393-41f9-8e22-8ed04dbabb36\",\"order_by\":4,\"name\":\"Erhu Zhao\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-5606-5450\",\"institution\":\"Medical Research Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Erhu\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":449714479,\"identity\":\"b9d3741b-e5a4-4d30-8c9c-a7bc7c800a54\",\"order_by\":5,\"name\":\"Liang Du\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Beijing Forestry University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Liang\",\"middleName\":\"\",\"lastName\":\"Du\",\"suffix\":\"\"},{\"id\":449714480,\"identity\":\"c9c0f6f6-5296-4715-8158-e6529d03d113\",\"order_by\":6,\"name\":\"Liqun Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Southwest University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Liqun\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-03-24 13:17:23\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6295746/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6295746/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41419-025-08065-2\",\"type\":\"published\",\"date\":\"2025-10-21T04:00:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":82154593,\"identity\":\"c94c056e-a8aa-45c0-a4de-3ebc4cb6f322\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:31:10\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1838246,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHigh USP14 expression is associated with poor prognosis in patients with gastric cancer.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Box plot of USP14 expression levels in the peritumoral tissues (normal) and GC tumors with log-rank test P values \\u0026lt; 0.05. (B, C) Kaplan–Meier analysis of progression-free survival using data from the R2 database and Kaplan-Meier Plotter database. (D, E) qRT-PCR and Western blot assays were used to detect the expression of USP14 in the human normal gastric cell line (GES-1) and GC cell lines (MKN-45, MGC-803, BGC-823, SGC-7901, HGC-27). (F) Immunohistochemical staining analysis showed the expression of USP14 in different stages of gastric cancer tissues. Scale bar(black) = 200 μm. Scale bar(red) = 50 μm. All data are expressed as the mean ± SD. Student’s t-test was performed to analyze significance. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure01.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/2b5feaa4cc0bca5399de1c5e.jpg\"},{\"id\":82152223,\"identity\":\"80c0c210-734d-456f-909c-a821b72dd495\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:23:10\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1242556,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP14 promotes the proliferation, migration, and invasion of gastric cancer cells.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) qRT-PCR and Western blot assays were performed to characterize the expression of USP14 in the control and USP14-knockdown HGC-27 and SGC-7901 cells. (B) MTT assay was performed to test the proliferation of the control and USP14-knockdown HGC-27 and SGC-7901 cells. (C) Wound healing assay was performed in USP14-knockdown cells. (D) Migration and invasion assays were performed in USP14-knockdown cells. Scale bar = 50 μm. (E) Western blot assay was performed to characterize the expression of some key metastasis-related proteins in USP14-knockdown cells. (F, G) Photographs, growth monitoring, and weights of the indicated xenograft tumors. Data were analyzed using two-tailed Student’s t-tests. (H) IHC analysis of USP14 and Ki67 expression was carried out in the indicated xenograft tumors. Scale bar = 50 μm. All data were expressed as the mean ± SD. Student’s t-test was performed to analyze significance. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure02.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/cd27f5a1f13995940d0248b2.jpg\"},{\"id\":82152229,\"identity\":\"e155ff43-7e24-4ed3-abea-261128c7e491\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:23:10\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1034826,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP14 recovery rescues the cell proliferation, migration, and invasion of USP14-silenced GC cells.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) qRT-PCR and Western blot assays were used to confirm USP14 expression in USP14-rescued USP14-knockdown HGC-27 and SGC-7901 gastric cancer cells. (B) Plate cloning assays were performed to examine the proliferation of the USP14-rescued USP14-knockdown cells HGC-27 and SGC-7901 cells. (C) Growth curves are shown for the USP14-rescued USP14-knockdown cells. (D) Wound healing assay was performed in USP14-rescued USP14 knockdown cells. (E) Migration and invasion assays were performed with USP14-rescued USP14-knockdown HGC-27 and SGC-7901 cells (left), and the quantification of migratory or invasive cells (right). Cells were stained with crystal violet and counted. Scale bar = 50 μm. (F) Western blot assay was used to detect the protein expression levels of metastasis-related proteins in USP14-rescued USP14-knockdown HGC-27 and SGC-7901 gastric cancer cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure03.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/64c8eab5daab01f6bbf234ec.jpg\"},{\"id\":82155926,\"identity\":\"27625b78-9334-41ca-a3c9-a275c9194f94\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:39:10\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":856378,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP14 interacts with KPNA2 and governs KPNA2 stability.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Venn diagram showing the number of USP14 interaction candidates identified from the prediction (green), USP14 interaction candidates identified in the Co-IP process (blue), and overlapping proteins in the datasets. The chart below shows the potential substrates of the overlapped proteins.(B) HEK293FT cells were co-transfected with MYC-USP14 and Flag-KPNA2 plasmids and analyzed after co-precipitation with anti-Flag or anti-MYC antibody immunoprecipitation.(C) HGC-27 and SGC-7901 cells were immunoprecipitated with anti-USP14 or anti-KPNA2 antibodies and analyzed.(D) PLA assay was performed after MYC-USP14 expression in HGC-27 and SGC7901 cells using anti-MYC and anti-KPNA2 antibodies. Scale bar, 2 μm.(E) Western blot assay was used to detect the expression level of KPNA2 in gastric cancer cells after USP14 knockdown.(F) qRT-PCR assay was used to analyze the expression level of KPNA2 in gastric cancer cells after USP14 knockdown.(G) The KPNA2 turnover rate in HGC-27 and SGC-7901 cells with USP14 knockdown.(H) Cell lysates were prepared from knocked-down USP14 cells that had been previously treated with or without MG132 for 8 h.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure04.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/254d5a488d87daee5c0d6ebd.jpg\"},{\"id\":82152224,\"identity\":\"9c363bf2-e6e3-49a4-9122-168391840e4e\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:23:10\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":633857,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP14 promotes KPNA2 deubiquitination.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) HEK293FT cells were transfected with HA-Ubiquitin, Flag-KPNA2, and MYC-USP14 as indicated. Poly-ubiquitination of KPNA2 was then examined by immunoprecipitation with Protein A + G agarose and analyzed. Cells were treated with MG132 (10 μM) for 8 h before being harvested. (B) USP14-knockdown and control HGC-27 and SGC-7901 cells were treated with MG132 (10 μM) for 8 h before being harvested. (C) HEK293FT cells were transfected with Flag-KPNA2 as indicated, treated with IU1 (50 μM) for 24 h, and then treated with MG132 (10 μM) for 8 h before being harvested. Lysates were immunoprecipitated with anti-KPNA2 antibody and analyzed. (D) HGC-27 and SGC-7901 cells treated with IU1 (50 μM) for 24 h were treated with MG132 (10 μM) for 8 h before being harvested. Lysates were immunoprecipitated with anti-KPNA2 antibody and analyzed. (E, F) HEK293FT cells were transfected with Flag-KPNA2 and indicated constructs, treated with MG132 (10 μM) for 8 h before being harvested. Lysates were immunoprecipitated with anti-Flag antibody and analyzed. (G, H) HEK293FT cells were transfected with HA-K48-Ub, HA-K63-Ub, and Flag-KPNA2 with or without MYC-USP14 as indicated and cultured for 48 h. Cells were immunoprecipitated with anti-Flag antibody and analyzed.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure05.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/96839790e311d1fa1744f733.jpg\"},{\"id\":82154597,\"identity\":\"c6ace65e-5f58-45f5-ac59-cf800ece6bc9\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:31:10\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1416235,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP14 regulates c-MYC nuclear transport and expression through KPNA2.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) HEK293FT cells were transfected with Flag-KPNA2 plasmids and analyzed after co-precipitation with anti-Flag antibody immunoprecipitation. (B) HGC-27 and SGC-7901 cells were immunoprecipitated with anti-KPNA2 or anti-c-MYC antibodies and analyzed. (C, D) The subcellular distribution of c-MYC in the USP14-shRNA, KPNA2-shRNA, and control transfected cells by nuclear/cytosol fractionation and immunofluorescence was shown. α-Tubulin was used as the cytoplasmic control and Lamin A/C as the nuclear control. (E) In vivo imaging experiments were conducted to assess the metastatic behavior of gastric cancer SGC-7901 cells with USP14 and KPNA2 interference in mice.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure06.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/491a128cf69f16d6e3dec614.jpg\"},{\"id\":94062658,\"identity\":\"fe873217-b88b-4e1b-98d9-5dc72603a10d\",\"added_by\":\"auto\",\"created_at\":\"2025-10-22 07:13:39\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":8011386,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/708845e7-0270-4b29-a81e-4b115aac5bac.pdf\"},{\"id\":82152228,\"identity\":\"6d689c68-7fd8-4b21-bb33-2d2545af314f\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:23:10\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":3786050,\"visible\":true,\"origin\":\"\",\"legend\":\"supplementary figure\",\"description\":\"\",\"filename\":\"supply.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/fe7c4716df26c39ecb6afdab.docx\"},{\"id\":82152262,\"identity\":\"5e4e869b-25f5-43e2-a904-8c9231744db9\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:23:12\",\"extension\":\"zip\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":71203473,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOriginal data of qPCR\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"XXXXXX.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/908a15b762a9421873ad3aae.zip\"},{\"id\":82152380,\"identity\":\"3dd77971-494d-4e0f-bfaf-c753f718a5ac\",\"added_by\":\"auto\",\"created_at\":\"2025-05-07 07:23:24\",\"extension\":\"zip\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":379218636,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOriginal data of WB\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"WB.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6295746/v1/5bbadd288a82c35f43cf1204.zip\"}],\"financialInterests\":\"(Not answered)\",\"formattedTitle\":\"The deubiquitination enzyme USP14 regulates the tumourigenesis of gastric cancer by regulating c-MYC nuclear translocation through deubiquitination KPNA2\",\"fulltext\":[{\"header\":\"1. INTRODUCTION\",\"content\":\"\\u003cp\\u003eGlobally, gastric cancer (GC) ranks among the top five most prevalent malignancies and represents the third leading cause of cancer-related mortality. Annually, there are nearly 1\\u0026nbsp;million incident cases of stomach cancer worldwide, resulting in approximately 700,000 deaths[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The rate of metastasis in gastric cancer is among the highest compared to other types of malignant tumors, resulting in a significantly low five-year survival rate for patients with metastatic gastric cancer. The lymph, liver, and lung are the main target organs of gastric cancer metastasis, and it can also transfer to other parts through blood metastasis at a late stage. Inhibiting or reducing metastasis of gastric cancer has become a key link in the treatment of GC[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. The exploration of the specific molecular mechanism behind gastric cancer metastasis can help identify more accurate bio-markers, which is crucial for designing improved treatment plans and enhancing patient prognosis and survival rates[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eUbiquitin-specific proteases 14(USP14) is a member of the ubiquitin-specific proteases (USPs) family. The level of the substrate protein can be stabilized by removing the ubiquitin label of the substrate protein, which is involved in a variety of signaling pathways and determines the fate of the cell[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. For example, it plays an important role in the occurrence and development of human diseases by regulating the expression level and activity of multiple target proteins such as androgen receptors, cell cycle-related proteins, and apoptosis-related proteins. USP14 is abnormally highly expressed in a variety of malignant tumors, and its regulatory mechanisms are complex and diverse, covering the basic characteristics of tumors, such as cell proliferation, apoptosis, inflammation, autophagy, and drug resistance. Meanwhile, high USP14 expression is closely associated with poor prognosis in tumor patients. However, USP14 in tumorigenesis and progression are largely unknown. Especially its potential role in tumor metastasis remains to be explored[\\u003cspan additionalcitationids=\\\"CR8 CR9 CR10\\\" citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eKPNA2, a constituent of the karyopherin α family, is composed of 529 amino acid residues and plays a vital role as an intermediary in transporting molecules between the nucleus and cytoplasm 9,10. Research has shown that KPNA2 plays a role in regulating the transportation of molecules, both from the cytoplasm to the nucleus and vice versa. The expression of KPNA2 has been observed to be aberrant in various malignancies, including prostate cancer, colorectal cancer, and hepatocellular carcinoma[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. The research conducted by Chen Li and colleagues has also discovered an increased expression of KPNA2[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e], which has been associated with a negative prognosis for GC 16. Nevertheless, evidence of the potential regulatory mechanisms and specific functions of KPNA2 in gastric cancer metastasis is still lacking[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Our findings indicate a significant upregulation of USP14 expression in gastric cancer, which correlates with unfavorable prognosis among patients. Additionally, the suppression of USP14 hampers the migratory and invasive potential of gastric cancer cells. Mechanistically, we found that USP14 interacts with KPNA2 proteins, and USP14 regulates the stability of KPNA2 by deubiquitinating KPNA2, thus regulating the nuclear localization of c-MYC.\\u003c/p\\u003e\"},{\"header\":\"2. RESULTS\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 High USP14 expression is associated with poor prognosis in patients with gastric cancer\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the potential correlation between USP14 expression levels and the prognosis of patients diagnosed with gastric cancer, we first conducted preliminary mining in the database. According to the GEPIA database, a significant upregulation of USP14 expression was observed in gastric cancer tissues compared to normal tissues. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). The results of two GC datasets also showed that gastric cancer patients with high USP14 expression had poor prognosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB and C). At the cellular level, we further detected the expression of USP14 in five gastric cancer cell lines MKN-45, MGC-803, BGC-823, SGC-7901, HGC-27, and a normal gastric cell line GES-1 by qRT-PCR. We found that USP14 expression was significantly higher in four gastric cancer cell lines than in normal gastric mucosal cell line (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). Further Western blot analysis also revealed high expression levels of this protein in GC cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). Finally, the expression of USP14 in tumor tissues of patients with different grades of gastric cancer was detected by immunohistochemical staining. The results showed that most USP14 expression concentrated in the invasive edge of the tumor (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF), and the higher the grade, the higher the USP14 expression level (Fig. S1A). The combined findings suggest a significant upregulation of USP14 in gastric cancer tissues, indicating its potential implication in the development and progression of GC.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 USP14 promotes the proliferation, migration, and invasion of gastric cancer cells\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the impact of USP14 on the progression of GC cells, we effectively suppressed the expression of USP14 by employing lentiviruses containing shRNA sequences to treat HGC-27 and SGC-7901 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The MTT assay was utilized to evaluate the impact of downregulating USP14 expression on the growth of HGC-27 and SGC-7901 cells. The results demonstrated a significant inhibition in the proliferative capacity of gastric cancer cells following USP14 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). The plate cloning assay also demonstrated a significant inhibition of cell colony formation in HGC-27 and SGC-7901 cells upon knockdown of USP14 (Fig. S2A). In addition, the addition of USP14-specific inhibitor IU1 also inhibited the proliferation of GC cells (Fig. S2B and C).To confirm the crucial role of USP14 in GC metastasis, we performed migration and invasion assays (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC and D), which showed that the migration rate of GC cells was significantly reduced upon knockdown of USP14 compared to the control cells. The addition of the specific inhibitor of USP14 IU1 also showed that the migration and invasion ability\\u003c/p\\u003e \\u003cp\\u003eof gastric cancer cells was inhibited (Fig. S2D and E). Furthermore, the study also examined the presence of certain proteins associated with metastasis. Results from Western blot assays indicated that USP14 knockdown had a significant impact on reducing the expression of proteins linked to proliferation and invasion (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE).\\u003c/p\\u003e \\u003cp\\u003eThe subcutaneous xenograft study demonstrated a significant reduction in growth rate, tumor volume, and weight of SGC-7901 cells with USP14 knockdown compared to control SGC-7901 cells. Moreover, immunohistochemical analysis revealed a decrease in Ki67 expression within tumor tissue sections following USP14 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF-H).\\u003c/p\\u003e \\u003cp\\u003eThe findings suggest that suppression of USP14 expression hinders the proliferation, motility, infiltration, and progression of gastric cancer cells.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 USP14 recovery rescues the cell proliferation, migration, and invasion of USP14 silenced GC cells\\u003c/h2\\u003e \\u003cp\\u003eTo further validate the involvement of USP14 in the proliferation and metastasis of gastric cancer (GC) cells, we conducted a transfection experiment using a full-length USP14 sequence against shRNA#1 targeting USP14. The results demonstrated successful recovery of both USP14 protein and messenger RNA (mRNA) expression levels, thereby excluding any potential off-target effects (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Recovery of cell growth and proliferation was observed upon USP14 expression, as demonstrated by plate cloning (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB) and MTT (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC) assays. Furthermore, the migratory and invasive abilities of shUSP14 cells were significantly restored when USP14 expression was recovered(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD and E). In addition, the levels of various proteins associated with metastasis were assessed, and it was observed that the restoration of USP14 resulted in notable enhancements in the expression of MMP7, N-cadherin, and vimentin. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). Collectively, these results indicate that the role of USP14 is indispensable in facilitating the proliferation, migration, and invasion of gastric cancer cells.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 USP14 interacts with KPNA2 and governs KPNA2 stability\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the regulatory mechanism of USP14, we performed Co-IP experiments and mass spectrometry to identify its interaction proteins. Subsequently, by utilizing the UbiBrowser 2.0 network database for prediction and intersection analysis, we obtained a gene list. Finally, through the preliminary experiment, we targeted the nuclear translocation of a variety of proteins that can regulate nuclear transport through the nuclear-cytoplasmic transport function, KPNA2, a member of the nuclear transporter family (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003ePrevious studies have indicated a correlation between KPNA2 and unfavorable outcomes in patients with gastric cancer 16,17. qRT-PCR and Western blot assays showed that KPNA2 was highly expressed in gastric cancer cells, GEPIA2 database also showed that KPNA2 was highly expressed in gastric cancer(Fig. S2A-C). After obtaining KPNA2 stably down-regulated cell lines (Fig. S2D), we performed MTT, Wound-healing, and Transwell assays, and detected the expression levels of proliferation, migration, and invasion-related proteins (Fig. S2E-H). These results demonstrated that the knockdown of KPNA2 inhibited the proliferation, migration, and invasion of gastric cancer cells. This was consistent with the changes after USP14 knockdown, Next, we restored KPNA2 expression after knocking down USP14 in gastric cancer cells, performed MTT, Wound-healing, and Transwell assays, and detected the expression levels of proliferation, migration, and invasion proteins (Fig. S3A-D). These results indicated that the knockdown of USP14 followed by restoration of KPNA2 expression partially restored gastric cancer cell proliferation, migration, and invasion ability.\\u003c/p\\u003e \\u003cp\\u003eWe co-transfected MYC-USP14 plasmid and Flag-KPNA2 plasmid into HEK293FT cells, followed by co-immunoprecipitation using MYC and Flag Tag antibodies to detect their interaction. The results demonstrated a reciprocal interaction between exogenous USP14 and KPNA2. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). The same co-immunoprecipitation assay was used to examine the interaction of endogenous USP14 to KPNA2 in gastric cancer cells HGC-27 and SGC-7901, and the results showed that USP14 interacted with KPNA2. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Furthermore, we conducted a proximity ligation assay (PLA) by utilizing antibodies anti-KPNA2 and MYC in HGC-27 and SGC-7901 cells that were transiently transfected with USP14 protein tagged with MYC (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD), which further verified the interaction between USP14 and KPNA2. The Western blot assays revealed a significant decrease in the protein level of KPNA2 in gastric cancer cells with USP14 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE). However, there was no notable reduction observed in the mRNA level of KPNA2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF), suggesting that posttranscriptional regulation might be involved in the modulation of KPNA2 expression by USP14. Then, we found that overexpression of USP14 decreased the turnover rate of KPNA2 in gastric cancer cells by using the de novo protein synthesis inhibitor CHX(cycloheximide) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG). Furthermore, we found that the decrease in KPNA2 protein expression in USP14 knockdown gastric cancer cells was rescued by using the proteasome inhibitor MG132 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eH).\\u003c/p\\u003e \\u003cp\\u003eIn brief, the findings of this study suggest that there is an interaction between USP14 and KPNA2, leading to the regulation of KPNA2 stability through inhibition of its degradation. Additionally, it appears that KPNA2-mediated migration and invasion in gastric cancer cells the control of USP14.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 USP14 promotes KPNA2 deubiquitination\\u003c/h2\\u003e \\u003cp\\u003eUSP14 is an important member of the deubiquitinating enzyme family of USP. Based on the above research, we speculated that USP14 plays a deubiquitinating enzyme activity to regulate the ubiquitination level of KPNA2, regulates the degradation of KPNA2, and then affects the proliferation, migration, and invasion of gastric cancer cells. We overexpressed the Flag-tagged KPNA2 plasmid in HEK293FT cells and performed ubiquitination assays with overexpression of the MYC-tagged USP14 plasmid as a variable. The results showed that the ubiquitination level of KPNA2 was reduced after USP14 overexpression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). In gastric cancer cells, we found that the ubiquitination of KPNA2 was significantly enhanced after USP14 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). The results of experiments with the addition of a specific inhibitor of USP14, IU1, also confirmed that USP14 inhibition leads to increased ubiquitination of KPNA2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC and D). An experiment was conducted to determine which domain(s) of USP14 mediated its interaction with KPNA2. Two mutants were constructed: USP14 C114A, which had an active site mutation, and USP14 lacking the ubiquitin-like domain (UBL) 18, and verify whether it affects KPNA2 ubiquitination (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE and F). The overexpression of USP14 significantly reduced K48 ubiquitination levels, while no significant change was observed in K63 ubiquitination levels of KPNA2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eG and H).\\u003c/p\\u003e \\u003cp\\u003eIn summary, these results suggested that KPNA2 can bind to USP14 in its UBL domain. In addition, USP14 deubiquitinated KPNA2 by removing the K48 polyubiquitination chains from KPNA2.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 USP14 regulates c-MYC nuclear transport and expression through KPNA2\\u003c/h2\\u003e \\u003cp\\u003eTo further explore the specific mechanism by which USP14 regulates gastric cancer cell migration and invasion through KPNA2, we verified the interaction of KPNA2 with c-MYC by Co-IP experiments in HEK293FT and gastric cancer cells, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA and B). Then, we performed nucleoplasmic separation experiments on gastric cancer cells with USP14 and KPNA2 knockdown, respectively. Knockdown of USP14 and KPNA2 reduced the expression of c-MYC in the nucleus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC), and immunofluorescence experiments also showed that the fluorescence signal in the nucleus was significantly reduced after knocking down USP14 and KPNA2. However, the restoration of KPNA2 expression restored c-MYC signaling in the nucleus (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD). After transfecting LUC-SGC-7901 cells with USP14 and KPNA2 interference, and then injecting them into mice via the tail vein, it was found that their metastatic ability was significantly reduced compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE). These results suggested that USP14 regulates the migration and invasion of gastric cancer cells by regulating KPNA2 and regulating the nuclear translocation of c-MYC.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. DISCUSSION\",\"content\":\"\\u003cp\\u003eGastric cancer (GC) is a prevalent form of cancer globally, known for its frequent recurrences and extensive infiltration into the adjacent healthy tissue and blood vessel formation[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Despite the worldwide decrease in occurrence throughout the last century, gastric cancer (GC) continues to be a major cause of death globally. Hence, it is imperative to explore the molecular mechanisms that underlie GC.\\u003c/p\\u003e \\u003cp\\u003eUSP14, a member of the ubiquitin-specific protease family, has been observed to display increased expression in certain types of human cancers and is involved in crucial functions related to tumor formation and advancement[\\u003cspan additionalcitationids=\\\"CR10\\\" citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. In this study, functionally we identified an important role of USP14 in promoting gastric cancer proliferation and metastasis, which was also supported by previous findings in different cell lines, suggesting that USP14 may be a potential therapeutic target in gastric cancer. Mechanistically, we found that USP14 deubiquitinated KPNA2 and regulated c-MYC nuclear localization through KPNA2.\\u003c/p\\u003e \\u003cp\\u003eAs a member of the nuclear transport protein family, KPNA2 regulates the nuclear translocation of a variety of proteins through its nucleoplasmic transport function and participates in a variety of life activities such as proliferation, apoptosis, migration, invasion, transcriptional regulation, immune response, and virus infection[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Recent studies have shown that the expression of KPNA2 is up-regulated in a variety of tumor tissues, including gastric cancer[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e], and the abnormal expression of KPNA2 is associated with poor prognosis of patients[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. There are currently some reports on Mechanisms of action of KPNA2 in tumors. For example, the knockdown of KPNA2 in Non-small cell lung cancer resulted in the subcellular redistribution of E2F[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Similarly, the knockdown of KPNA2 downregulated c-MYC and reduced its transcriptional activity [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. These results suggest that KPNA2 plays a vital role in tumor formation and progression.\\u003c/p\\u003e \\u003cp\\u003eThe regulation of various transcriptional programs and the crucial role in the progression of numerous human cancers are attributed to the transcriptional activator c-MYC. Under normal physiological conditions, multiple cellular mechanisms strictly govern the expression of c-MYC[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. While the normal growth and proliferation of cells necessitate c-MYC, the abnormal activation or excessive expression of c-MYC is linked to the onset and progression of a majority of human malignancies[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. The impact of the c-MYC gene on controlling the proliferation, migration, and invasion of GC cells is examine[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. In addition, it has been reported that KPNA2 can regulate the nuclear translocation of c-MYC in breast cancer[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e], and KPNA2 can regulate c-MYC expression in the nucleus by mediating the nuclear translocation of E2F1 in glioma[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIn our investigation, it was observed that the depletion of USP14 and KPNA2 resulted in a reduction in the nuclear abundance of c-MYC. The reintroduction of KPNA2 expression led to a restoration of c-MYC localization within the nucleus. The fact that there are still unresolved issues deserving further investigation is worth noting. For example, Whether USP14 promotes cell apoptosis, the specific ubiquitination site of KPNA2 is still unknown, where is the specific binding amino acid of USP14 to KPNA2, and what is the specific mechanism by which USP14 controls the deubiquitination of KPNA2, and are there any additional genes implicated in the regulation of this ubiquitination process? Clinically, whether targeting the USP14 gene can be used in combination with other clinical first-line drugs such as 5-fluorouracil remains to be explored. Further investigation into these matters will contribute to a comprehensive comprehension of the increased stability of KPNA2 resulting from the elevated expression of USP14, thereby presenting a more valuable prospective focus for targeted therapy in GC. These aspects present intriguing subjects that merit additional exploration.\\u003c/p\\u003e \\u003cp\\u003eTaken together, this study showed that USP14 promotes the proliferation, migration, invasion, and tumor growth of gastric cancer cells. Furthermore, we found that USP14 plays a regulatory role in gastric cancer cells by regulating KPNA2 mediated c-MYC nuclear translocation through deubiquitination. These findings provide new insights into the biological function of USP14 and suggest that USP14 can serve as a promising target for the treatment of gastric cancer.\\u003c/p\\u003e\"},{\"header\":\"4. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.1 Cell lines, drugs, reagents and antibodies\\u003c/h2\\u003e \\u003cp\\u003eAll human GC cell lines (BGC-823, HGC-27, MGC-803, MKN-45, and SGC-7901), Human normal gastric cell line (GES-1), and human embryonic renal cell line HEK293FT were obtained from the American Type Culture Collection (ATCC, Beijing, China). All cell lines were tested mycoplasma-negative. MG132 and CHX were obtained from Sigma (Shanghai, China). IU1 was purchased from MedChemExpress (Shanghai, China). Anti-KPNA2, anti-MMP2, anti-MMP3, anti-MMP7, anti-Slug, anti-E-Cadherin, anti-N-cadherin, anti-α-Tubulin, anti-HA, anti-Ub antibodies were purchased from Proteintech (Wuhan, China). Anti-MYC, anti-Flag, anti-c-MYC, anti-Vimentin, anti-USP14, and anti-β-catenin antibodies were obtained from Cell Signaling Technology (Shanghai, China). Anti-Ki67 antibody was purchased from BD Biosciences. All antibodies were diluted according to the manufacturer\\u0026rsquo;s instructions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.2 Transfection and infection experiments and plasmids\\u003c/h2\\u003e \\u003cp\\u003eSmall-hairpin shRNAs for USP14 and KPNA2 and a negative control shRNA (shGFP) were obtained from Sangon Biotech. (Shanghai, China) and were inserted into the pLKO.1 vector. The ubiquitination plasmid that contained an HA tag and recombinant plasmids containing full-length human USP14 and KPNA2 cDNA cloned into the PCDH-CMV-MCS-EF1-Hygro vector were purchased from Youbao Company (Changsha, China). The ubiquitin mutant plasmids (K48, K63) containing the HA tag were also purchased from Youbao Company (Changsha, China). For transfection and infection experiments, the target plasmids and packaging plasmids were transfected into HEK293FT cells by using the transfection reagent Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Lentiviruses were collected 48 h later and used to infect GC cells twice, 24 h per infection. The infected cells were screened by treatment with puromycin for 36 h, and the surviving cells were frozen and stored in liquid nitrogen for subsequent experiments. For shUSP14 and shKPNA2 without sequence number indicated, interference sequence number 2 was the default. All the primers for the shRNA sequences are given in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSequence of the shRNA primers. The shRNA sequences are listed below:\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshUSP14#1-F\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGGCCCAAGATTCAGCAGTCAGATCTCGAGA TCTGACTGCTGAATCTTGGGTTTTTG\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshUSP14#1-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAACCCAAGATTCAGCAGTCAGATC TCGAGATCTGACTGCTGAATCTTGGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshUSP14#2-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGGCGCAGAGTTGAAATAATGGAACTCGAGT TCCATTATTTCAACTCTGCGTTTTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshUSP14#2-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAACGCAGAGTTGAAATAATGGAAC TCGAGTTCCATTATTTCAACTCTGCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshKPNA2#1-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAAGCTGGTTTGATTCCGAAATTTCT CGAGAAATTTCGGAATCAAACCAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshKPNA2#1-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAAGCTGGTTTGATTCCGAAATTTCT CGAGAAATTTCGGAATCAAACCAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshKPNA2#2-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGGCCTGGACACTTTCTAATCTTTCTCGAGAA AGATTAGAAAGTGTCCAGGTTTTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eshKPNA2#2-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAACCTGGACACTTTCTAATCTTTCT CGAGAAAGATTAGAAAGTGTCCAGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.3 Immunohistochemistry staining\\u003c/h2\\u003e \\u003cp\\u003eParaffin-embedded tumors were cut into 5 mm thick slices, and then the paraffin sections were dewaxed and hydrated. Then, paraffin slices were placed in citrate buffer (pH 6.0) and heated in a microwave oven to 95\\u0026deg;C for 20 min to facilitate antigen retrieval. Then, endogenous peroxidase activity was quenched, followed by blocking with normal goat serum. Then, USP14 and Ki67 antibodies were diluted with BSA according to the manufacturer\\u0026rsquo;s instructions, and the antibodies were added to the paraffin sections and incubated overnight at 4\\u0026deg;C. Then, a horseradish peroxidase-linked secondary antibody was added and incubated with the sections, which was followed by the addition of DBA reagent. The results were observed under a microscope before counterstaining with hematoxylin.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.4 Quantitative and Reverse Transcription PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from cells using TRIzol reagent. Then, 2 \\u0026micro;g of RNA was reverse-transcribed into cDNA. The normalized expression control was based on the glyceraldehyde-3-phosphate dehydrogenase value. Finally, mRNA expression was determined as the CT value. All quantitative primers are given in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003eRIPA was used for cell lysis to extract protein from the cells, and then, proteins were denatured and separated. Proteins of different molecular weights were separated by SDS-polyacrylamide gel electrophoresis and electrotransferred to polyvinylidene difluoride membranes. The membrane is sealed with skimmed milk to detect the proteins, and BSA to detect the phosphorylated proteins, and the membrane sections were incubated sequentially with primary antibodies, and then, secondary antibodies. The membranes were exposed to ECL Reagent (Cell Signaling) and visualized by Western blot analysis detection system (Thermo Fisher, Shanghai, China).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSequence of the RT-PCR primers.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eUSP14-forward\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGGCCCAAGATTCAGCAGTCAGATCTCGAGATC TGACTGCTGAATCTTGGGTTTTTG\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eUSP14-reverse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAACCCAAGATTCAGCAGTCAGATCTC GAGATCTGACTGCTGAATCTTGGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eKPNA2-forward\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGGCGCAGAGTTGAAATAATGGAACTCGAGTT CCATTATTTCAACTCTGCGTTTTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eKPNA2-reverse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAACGCAGAGTTGAAATAATGGAACT CGAGTTCCATTATTTCAACTCTGCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH-forward\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGGGCTGGTTTGATTCCGAAATTTCTCGAGAAA TTTCGGAATCAAACCAGCTTTTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH-reverse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATTCAAAAAGCTGGTTTGATTCCGAAATTTCTC GAGAAATTTCGGAATCAAACCAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.5 Plate cloning\\u003c/h2\\u003e \\u003cp\\u003eTo clone plates, a six-well plate was seeded with 1 \\u0026times; 10^3 cells on coverslips. After two weeks, crystal violet staining solution was used to stain the cells and they were scanned using a scanner. The cells were then decolorized with absolute ethanol and shaken sufficiently before measuring absorbance at 560 nm. A graph was plotted based on the absorbance data obtained.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.6 MTT assay\\u003c/h2\\u003e \\u003cp\\u003e1 \\u0026times; 10^3 cells were seeded in each well of a 96-well plate and cultured for seven days. MTT reagent was added to the well and incubated at 37 degrees for two hours. After all the liquid in the well was discarded, DMSO(CAS:67-68-5, Sangon Biotech) reagent was added to each well and incubated at 37 degrees for 10 minutes. The absorbance value was detected and plotted at 560nm after the plate was shaken by the microplate reader. All experiments were independently performed three times.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.7 Wound-healing assays\\u003c/h2\\u003e \\u003cp\\u003eThe cells were grown until they reached 80% confluence and subjected to 24 hours of nutrient deprivation (0.1% FBS). A single wound was inflicted using a micropipette tip. Following rinsing, the cells were exposed to a medium containing 3% FBS at 37\\u0026deg;C to facilitate cell migration.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.8 Transwell migration and invasion assay\\u003c/h2\\u003e \\u003cp\\u003eMigration and invasion assay were conducted using chambers comprising Transwell membrane filter inserts (Cat # 3422, Corning Costar). Briefly, a total of 5 \\u0026times; 10^4 cells were seeded into each well of the 24-well Transwell chamber (with an 8 \\u0026micro;m pore size) for the migration assay. For the invasion assay, cells were seeded into Matrigel-coated chambers. The seeding was performed in complete medium supplemented with 10% FBS. Non-penetrating cells on the filter were removed by wiping, and the cells on the lower surface of the filter were stained using a solution containing 0.4% crystal violet dye. The number of migrating or invading cells was determined by counting under a light microscope from three fields within one chamber per sample (mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SE).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.9 Xenograft assay\\u003c/h2\\u003e \\u003cp\\u003e The Animal Protection and Utilization Committee of Southwest University approved conducting animal experiments. All experimental procedures adhered to the Guidelines for Use (Ministry of Science and Technology, China, 2006). Female NOD/SCID mice were procured and housed in a specific pathogen-free (SPF) room with controlled temperature and humidity at four weeks old. Each mouse received a slow injection of 1 \\u0026times; 10^5 human GC cells (SGC-7901) stably transfected with shGFP or shUSP14#2 into one side of their armpit. Upon completion of the experiment, the tumors were excised, processed, and subjected to analysis. Randomization was employed along with single blinding during measurements. Finally, the tumors were collected and photographed for subsequent immunohistochemical staining following previously established protocols.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.10 Immunoprecipitation\\u003c/h2\\u003e \\u003cp\\u003eTo begin, HEK293FT cells or gastric cancer cells were transfected with a specific plasmid and subsequently lysed IP lysis buffer. Following this, proteins were extracted from the cells. The target protein was then incubated overnight at 4\\u0026deg;C with a specific proportion of primary antibody. Subsequently, a solution containing 50 \\u0026micro;l protein A\\u0026thinsp;+\\u0026thinsp;G agarose beads was added to the protein and antibody mixture and incubated for 4 hours at 4\\u0026deg;C. After incubation, the target proteins became attached to the beads, which were washed using precooled PBS buffer to eliminate impurities. To prepare for further analysis, the protein samples were mixed with 40 \\u0026micro;l of 1\\u0026times;loading buffer and subjected to heat-denaturation. Next, these samples underwent separation through SDS polyacrylamide gel electrophoresis before being electrotransferred onto polyvinylidene difluoride membranes. These membranes were left to incubate overnight at 4\\u0026deg;C with primary antibodies followed by an additional 2-hour incubation period with secondary antibodies. Finally, exposure and analysis of the membranes took place utilizing a Chemiscope 6000 imaging system.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.11 Proximity ligation assay (PLA)\\u003c/h2\\u003e \\u003cp\\u003eThe lentivirus-infected cells were sequentially subjected to puromycin selection, paraformaldehyde fixation, goat serum blocking, and overnight incubation with MYC and KPNA2 antibodies. Subsequently, The cells underwent exposure to a secondary antibody that was labeled with Alexa Fluor 594 (1:1000), along with utilization of a PLA assay Kit provided by Sigma-Aldrich\\u0026reg;. Finally, confocal fluorescence microscopy (Olympus Fv1000, Japan) was employed for visualization and photography of the cells.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.12 Turnover assay\\u003c/h2\\u003e \\u003cp\\u003eThe cells infected with the virus were puromycin for a duration of 48 hours, followed by treatment with CHX at a concentration of 50 \\u0026micro;g/ml. Subsequently, the cells were gathered, lysed, and subjected to Western blot analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.13 Ubiquitination assay\\u003c/h2\\u003e \\u003cp\\u003eTo conduct the in vivo ubiquitination assay, designated plasmids were transfected into either HEK293FT cells or gastric cancer cells using a co-transfection approach. After 48 hours of transfection, the cells were exposed to MG132, a proteasome inhibitor, at a concentration of 50 \\u0026micro;g/ml for a duration of 8 hours. Subsequently, Cell Lysis Buffer (Sigma) was employed to lyse the cells for Western blot and IP analysis following an identical protocol utilized for Co-immunoprecipitation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec24\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.14 Subcellular fractionation\\u003c/h2\\u003e \\u003cp\\u003eThe cells were harvested and washed twice with PBS. Subcellular fractionation was then performed using the Nuclear and Cytoplasmic Protein kit (Beyotime Biotechnology, Wuhan, China) according to the manufacturer's instructions. The effectiveness of fractionation was assessed through immunoblotting analysis utilizing anti-Lamin A/C antibody (Proteintech, Wuhan, China) as a marker for nuclear proteins and anti-α-Tubulin antibody (Proteintech, Wuhan, China) as a marker for cytosolic proteins.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec25\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.15 Immunofluorescence assay\\u003c/h2\\u003e \\u003cp\\u003eAn immunofluorescence analysis was conducted to identify the presence of c-MYC in GC cells. In brief, cells were gathered, fixed, and coated. Following blocking, the cells were exposed to an anti-c-MYC antibody (1:500) overnight at 4\\u0026deg;C. Subsequently, the cells were treated with a secondary antibody labeled with Alexa Fluor 594 (1:2000). The nuclear staining was performed using Hoechst 3334\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003cp\\u003e2 (1:2000) subsequently. Under a fluorescence microscope, images of the cells were captured.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec27\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.16 Patient data analysis\\u003c/h2\\u003e \\u003cp\\u003eThe gene expression data were obtained from the GEPIA2 database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://gepia2.cancer-pku.cn\\u003c/span\\u003e\\u003cspan address=\\\"http://gepia2.cancer-pku.cn\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), while the prognostic data were acquired from the R2:Genome Analysis and Visualization Platform (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://hgserver1.amc.nl/cgi-bin/r2/main.cgi\\u003c/span\\u003e\\u003cspan address=\\\"https://hgserver1.amc.nl/cgi-bin/r2/main.cgi\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). Additionally, we utilized Kaplan-Meier Plotter database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.kmplot.com\\u003c/span\\u003e\\u003cspan address=\\\"http://www.kmplot.com\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to determine the critical value for segregating the high-expression group and low-expression group, based on algorithms provided by these databases.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec28\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e4.17 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe experiments were conducted in triplicate, and the figure captions provide information on statistical parameters such as sample size and significance analysis. A two-tailed Student's t-test was employed to determine significance at a 95% confidence level, assuming a normal distribution with slightly different yet comparable standard deviations. The quantitative data is presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;s.d., and statistical significance was considered for P values less than 0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003ch2\\u003eSUPPLEMENTARY INFORMATION\\u003c/h2\\u003e \\u003cp\\u003eSupplementary information is available at cell death discovery\\u0026rsquo;s website\\u0026rdquo; at the end of the article and before the references.\\u003c/p\\u003e \\u003c/p\\u003e\\u003cp\\u003e \\u003ch2\\u003eCOMPETING INTERESTS\\u003c/h2\\u003e \\u003cp\\u003eThe authors declare no competing interests.\\u003c/p\\u003e \\u003c/p\\u003e\\u003cp\\u003e \\u003ch2\\u003eETHICS\\u003c/h2\\u003e \\u003cp\\u003e All experiments involving cancer patients\\u0026rsquo; samples were obtained from Chaoying Biotechnology Co., Ltd. (Henan, China), and the studies were approved by the Medical Ethics Committee of Tongxu County People\\u0026rsquo;s Hospital of Henan Province. All of the patients were informed consent. Animal welfare and experimental procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the animal ethics committee of Southwest University.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFUNDING\\u003c/h2\\u003e \\u003cp\\u003eThis work was supported by National Natural Science Foundation of China(81972626).\\u003c/p\\u003e\\u003ch2\\u003eAUTHOR CONTRIBUTIONS\\u003c/h2\\u003e \\u003cp\\u003eJL, HYT, HBC, EHZ, LQY have participated in the investigation, methodology, and validation of data presented in this article. JL, LD, and HJC are responsible for the formal analysis of data. JL and HBC wrote and edited this manuscript, LD and HJC read and revised this manuscript. All authors read and approved the final manuscript.\\u003c/p\\u003e\\u003ch2\\u003eDATA AVAILABILITY\\u003c/h2\\u003e \\u003cp\\u003eAll data are available in the main text or the supplementary materials\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eChia NY, Tan P. Molecular classification of gastric cancer. \\u003cem\\u003eAnn Oncol\\u003c/em\\u003e \\u003cstrong\\u003e27\\u003c/strong\\u003e, 763-9 (2016). https://doi.org/10.1093/annonc/mdw040\\u003c/li\\u003e\\n\\u003cli\\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \\u003cem\\u003eCa Cancer J Clin\\u003c/em\\u003e \\u003cstrong\\u003e71\\u003c/strong\\u003e, 209-49 (2021). https://doi.org/10.3322/caac.21660\\u003c/li\\u003e\\n\\u003cli\\u003eYamashita K, Sakuramoto S, Watanabe M. Genomic and epigenetic profiles of gastric cancer: potential diagnostic and therapeutic applications. \\u003cem\\u003eSurg Today\\u003c/em\\u003e \\u003cstrong\\u003e41\\u003c/strong\\u003e, 24-38 (2011). https://doi.org/10.1007/s00595-010-4370-5\\u003c/li\\u003e\\n\\u003cli\\u003eJiang H, Yu D, Yang P, Guo R, Kong M, Gao Y, Yu X, Lu X, Fan X. Revealing the transcriptional heterogeneity of organ-specific metastasis in human gastric cancer using single-cell rna sequencing. \\u003cem\\u003eClin Transl Med\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e, e730 (2022). https://doi.org/10.1002/ctm2.730\\u003c/li\\u003e\\n\\u003cli\\u003eZheng Z, Lin F, Zhao B, Chen G, Wei C, Chen X, Nie R, Zhang R, Zhao Z, Zhou Z, Li Y, Dai W, Lin Y, Chen Y. Alkbh5 suppresses gastric cancer tumorigenesis and metastasis by inhibiting the translation of uncapped wrap53 rna isoforms in an m6a-dependent manner. \\u003cem\\u003eMol Cancer\\u003c/em\\u003e \\u003cstrong\\u003e24\\u003c/strong\\u003e, 19 (2025). https://doi.org/10.1186/s12943-024-02223-4\\u003c/li\\u003e\\n\\u003cli\\u003eWang D, Ma H, Zhao Y, Zhao J. Ubiquitin-specific protease 14 is a new therapeutic target for the treatment of diseases. \\u003cem\\u003eJ Cell Physiol\\u003c/em\\u003e \\u003cstrong\\u003e236\\u003c/strong\\u003e, 3396-405 (2021). https://doi.org/10.1002/jcp.30124\\u003c/li\\u003e\\n\\u003cli\\u003eWu N, Liu C, Bai C, Han YP, Cho WC, Li Q. Over-expression of deubiquitinating enzyme usp14 in lung adenocarcinoma promotes proliferation through the accumulation of beta-catenin. \\u003cem\\u003eInt J Mol Sci\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 10749-60 (2013). https://doi.org/10.3390/ijms140610749\\u003c/li\\u003e\\n\\u003cli\\u003eShinji S, Naito Z, Ishiwata S, Ishiwata T, Tanaka N, Furukawa K, Suzuki H, Seya T, Matsuda A, Katsuta M, Tajiri T. Ubiquitin-specific protease 14 expression in colorectal cancer is associated with liver and lymph node metastases. \\u003cem\\u003eOncol Rep\\u003c/em\\u003e \\u003cstrong\\u003e15\\u003c/strong\\u003e, 539-43 (2006)\\u003c/li\\u003e\\n\\u003cli\\u003eZhu L, Yang S, He S, Qiang F, Cai J, Liu R, Gu C, Guo Z, Wang C, Zhang W, Zhang C, Wang Y. Downregulation of ubiquitin-specific protease 14 (usp14) inhibits breast cancer cell proliferation and metastasis, but promotes apoptosis. \\u003cem\\u003eJ Mol Histol\\u003c/em\\u003e \\u003cstrong\\u003e47\\u003c/strong\\u003e, 69-80 (2016). https://doi.org/10.1007/s10735-015-9650-3\\u003c/li\\u003e\\n\\u003cli\\u003eZhu Y, Zhang Y, Sui Z, Zhang Y, Liu M, Tang H. Usp14 de-ubiquitinates vimentin and mir-320a modulates usp14 and vimentin to contribute to malignancy in gastric cancer cells. \\u003cem\\u003eOncotarget\\u003c/em\\u003e \\u003cstrong\\u003e8\\u003c/strong\\u003e, 48725-36 (2017). https://doi.org/10.18632/oncotarget.10706\\u003c/li\\u003e\\n\\u003cli\\u003eFu Y, Ma G, Liu G, Li B, Li H, Hao X, Liu L. Usp14 as a novel prognostic marker promotes cisplatin resistance via akt/erk signaling pathways in gastric cancer. \\u003cem\\u003eCancer Med\\u003c/em\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e, 5577-88 (2018). https://doi.org/10.1002/cam4.1770\\u003c/li\\u003e\\n\\u003cli\\u003eHan Y, Wang X. The emerging roles of kpna2 in cancer. \\u003cem\\u003eLife Sci\\u003c/em\\u003e \\u003cstrong\\u003e241\\u003c/strong\\u003e, 117140 (2020). https://doi.org/10.1016/j.lfs.2019.117140\\u003c/li\\u003e\\n\\u003cli\\u003eLi C, Ji L, Ding ZY, Zhang QD, Huang GR. Overexpression of kpna2 correlates with poor prognosis in patients with gastric adenocarcinoma. \\u003cem\\u003eTumour Biol\\u003c/em\\u003e \\u003cstrong\\u003e34\\u003c/strong\\u003e, 1021-6 (2013). https://doi.org/10.1007/s13277-012-0641-7\\u003c/li\\u003e\\n\\u003cli\\u003eTsai MM, Huang HW, Wang CS, Lee KF, Tsai CY, Lu PH, Chi HC, Lin YH, Kuo LM, Lin KH. Microrna-26b inhibits tumor metastasis by targeting the kpna2/c-jun pathway in human gastric cancer. \\u003cem\\u003eOncotarget\\u003c/em\\u003e \\u003cstrong\\u003e7\\u003c/strong\\u003e, 39511-26 (2016). https://doi.org/10.18632/oncotarget.8629\\u003c/li\\u003e\\n\\u003cli\\u003eAjani JA, D\\u0026apos;Amico TA, Bentrem DJ, Chao J, Cooke D, Corvera C, Das P, Enzinger PC, Enzler T, Fanta P, Farjah F, Gerdes H, Gibson MK, Hochwald S, Hofstetter WL, Ilson DH, Keswani RN, Kim S, Kleinberg LR, Klempner SJ, Lacy J, Ly QP, Matkowskyj KA, Mcnamara M, Mulcahy MF, Outlaw D, Park H, Perry KA, Pimiento J, Poultsides GA, Reznik S, Roses RE, Strong VE, Su S, Wang HL, Wiesner G, Willett CG, Yakoub D, Yoon H, Mcmillian N, Pluchino LA. Gastric cancer, version 2.2022, nccn clinical practice guidelines in oncology. \\u003cem\\u003eJ Natl Compr Canc Netw\\u003c/em\\u003e \\u003cstrong\\u003e20\\u003c/strong\\u003e, 167-92 (2022). https://doi.org/10.6004/jnccn.2022.0008\\u003c/li\\u003e\\n\\u003cli\\u003ePark SH, Ham S, Lee A, Moller A, Kim TS. Nlrp3 negatively regulates treg differentiation through kpna2-mediated nuclear translocation. \\u003cem\\u003eJ Biol Chem\\u003c/em\\u003e \\u003cstrong\\u003e294\\u003c/strong\\u003e, 17951-61 (2019). https://doi.org/10.1074/jbc.RA119.010545\\u003c/li\\u003e\\n\\u003cli\\u003eChristiansen A, Dyrskjot L. The functional role of the novel biomarker karyopherin alpha 2 (kpna2) in cancer. \\u003cem\\u003eCancer Lett\\u003c/em\\u003e \\u003cstrong\\u003e331\\u003c/strong\\u003e, 18-23 (2013). https://doi.org/10.1016/j.canlet.2012.12.013\\u003c/li\\u003e\\n\\u003cli\\u003eChen X, Wei H, Yue A, Zhang H, Zheng Y, Sun W, Zhou Y, Wang Y. Kpna2 promotes the progression of gastric cancer by regulating the alternative splicing of related genes. \\u003cem\\u003eSci Rep\\u003c/em\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e, 17140 (2024). https://doi.org/10.1038/s41598-024-66678-7\\u003c/li\\u003e\\n\\u003cli\\u003eOhhara Y, Kinoshita I, Suzuki A, Imagawa M, Taguchi J, Noguchi T, Takeuchi S, Shimizu Y, Seki H, Suzuki J, Dosaka-Akita H. Expression of karyopherin alpha 2 and karyopherin beta 1 correlate with poor prognosis in gastric cancer. \\u003cem\\u003eOncology\\u003c/em\\u003e \\u003cstrong\\u003e100\\u003c/strong\\u003e, 685-95 (2022). https://doi.org/10.1159/000526807\\u003c/li\\u003e\\n\\u003cli\\u003eXiang S, Wang Z, Ye Y, Zhang F, Li H, Yang Y, Miao H, Liang H, Zhang Y, Jiang L, Hu Y, Zheng L, Liu X, Liu Y. E2f1 and e2f7 differentially regulate kpna2 to promote the development of gallbladder cancer. \\u003cem\\u003eOncogene\\u003c/em\\u003e \\u003cstrong\\u003e38\\u003c/strong\\u003e, 1269-81 (2019). https://doi.org/10.1038/s41388-018-0494-7\\u003c/li\\u003e\\n\\u003cli\\u003eLi J, Liu Q, Liu Z, Xia Q, Zhang Z, Zhang R, Gao T, Gu G, Wang Y, Wang D, Chen X, Yang Y, He D, Xin T. Kpna2 promotes metabolic reprogramming in glioblastomas by regulation of c-myc. \\u003cem\\u003eJ Exp Clin Cancer Res\\u003c/em\\u003e \\u003cstrong\\u003e37\\u003c/strong\\u003e, 194 (2018). https://doi.org/10.1186/s13046-018-0861-9\\u003c/li\\u003e\\n\\u003cli\\u003eFatma H, Maurya SK, Siddique HR. Epigenetic modifications of c-myc: role in cancer cell reprogramming, progression and chemoresistance. \\u003cem\\u003eSemin Cancer Biol\\u003c/em\\u003e \\u003cstrong\\u003e83\\u003c/strong\\u003e, 166-76 (2022). https://doi.org/10.1016/j.semcancer.2020.11.008\\u003c/li\\u003e\\n\\u003cli\\u003ePelengaris S, Khan M, Evan G. C-myc: more than just a matter of life and death. \\u003cem\\u003eNat Rev Cancer\\u003c/em\\u003e \\u003cstrong\\u003e2\\u003c/strong\\u003e, 764-76 (2002). https://doi.org/10.1038/nrc904\\u003c/li\\u003e\\n\\u003cli\\u003eZhang L, Hou Y, Ashktorab H, Gao L, Xu Y, Wu K, Zhai J, Zhang L. The impact of c-myc gene expression on gastric cancer cell. \\u003cem\\u003eMol Cell Biochem\\u003c/em\\u003e \\u003cstrong\\u003e344\\u003c/strong\\u003e, 125-35 (2010). https://doi.org/10.1007/s11010-010-0536-0\\u003c/li\\u003e\\n\\u003cli\\u003eDuan M, Hu F, Li D, Wu S, Peng N. Silencing kpna2 inhibits il-6-induced breast cancer exacerbation by blocking nf-kappab signaling and c-myc nuclear translocation in vitro. \\u003cem\\u003eLife Sci\\u003c/em\\u003e \\u003cstrong\\u003e253\\u003c/strong\\u003e, 117736 (2020). https://doi.org/10.1016/j.lfs.2020.117736\\u003c/li\\u003e\\n\\u003cli\\u003eWang T, Huang Z, Huang N, Peng Y, Gao M, Wang X, Feng W. Inhibition of kpnb1 inhibits proliferation and promotes apoptosis of chronic myeloid leukemia cells through regulation of e2f1. \\u003cem\\u003eOnco Targets Ther\\u003c/em\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e, 10455-67 (2019). https://doi.org/10.2147/OTT.S210048\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Deubiquitinase, USP14, KPNA2, Gastric cancer (GC)\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6295746/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6295746/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe deubiquitinating enzyme USP14, which belongs to the ubiquitin-specific protease family, is highly expressed in various malignant tumors. The regulatory mechanisms in tumors are complex and diverse, encompassing a range of cellular processes such as proliferation, apoptosis, inflammation, autophagy, and drug resistance. However, the functional role of USP14 in gastric cancer remains unclear. In the current investigation, a significant upregulation of USP14 expression was observed in gastric cancer, and its overexpression was associated with an unfavorable prognosis among patients. The involvement of USP14 is indispensable for promoting the growth, motility, and infiltration of gastric cancer cells, as revealed by our findings. Further investigations revealed that USP14 interacts with KPNA2 and is responsible for deubiquitinating it by removing ubiquitin. Moreover, the deubiquitylation process mediated by USP14 was found to be critically dependent on the K48 residue of ubiquitin. The knockdown of USP14 significantly suppressed the proliferation, migration, and invasion of gastric cancer cells. This effect was attributed to the regulation of c-MYC nuclear translocation through KPNA2 deubiquitination. The findings underscore the imperative for further evaluation of the potential therapeutic significance of USP14 in gastric cancer.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The deubiquitination enzyme USP14 regulates the tumourigenesis of gastric cancer by regulating c-MYC nuclear translocation through deubiquitination KPNA2\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-05-07 07:23:05\",\"doi\":\"10.21203/rs.3.rs-6295746/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"revise\",\"date\":\"2025-05-29T09:54:56+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2025-05-22T14:03:12+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"editorInvitedReview\",\"content\":\"This content is not available.\",\"date\":\"2025-05-03T21:05:11+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2025-05-03T01:28:04+00:00\",\"index\":2,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewerAgreed\",\"content\":\"This content is not available.\",\"date\":\"2025-05-01T22:07:38+00:00\",\"index\":1,\"fulltext\":\"This content is not available.\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-04-29T13:12:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-03-31T11:05:17+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Cell Death \\u0026 Disease\",\"date\":\"2025-03-31T04:22:36+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksFailed\",\"content\":\"\",\"date\":\"2025-03-25T11:47:30+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-03-24T13:13:22+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"cell-death-and-disease\",\"isNatureJournal\":false,\"hasQc\":false,\"allowDirectSubmit\":false,\"externalIdentity\":\"cddis\",\"sideBox\":\"Learn more about [Cell Death \\u0026 Disease](http://www.nature.com/cddis/)\",\"snPcode\":\"41419\",\"submissionUrl\":\"https://mts-cddis.nature.com/cgi-bin/main.plex\",\"title\":\"Cell Death \\u0026 Disease\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"ejp\",\"reportingPortfolio\":\"Nature AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"ef98fe3a-d316-4606-a89f-87f6bf5c7b0c\",\"owner\":[],\"postedDate\":\"May 7th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":47854348,\"name\":\"Biological sciences/Cancer\"},{\"id\":47854349,\"name\":\"Biological sciences/Cancer/Cancer therapy\"}],\"tags\":[],\"updatedAt\":\"2025-10-22T07:13:32+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6295746\",\"link\":\"https://doi.org/10.1038/s41419-025-08065-2\",\"journal\":{\"identity\":\"cell-death-and-disease\",\"isVorOnly\":false,\"title\":\"Cell Death \\u0026 Disease\"},\"publishedOn\":\"2025-10-21 04:00:00\",\"publishedOnDateReadable\":\"October 21st, 2025\"},\"versionCreatedAt\":\"2025-05-07 07:23:05\",\"video\":\"\",\"vorDoi\":\"10.1038/s41419-025-08065-2\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41419-025-08065-2\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6295746\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6295746\",\"identity\":\"rs-6295746\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}