{"paper_id":"3e3cf101-2d59-44b0-9f09-b4a20c0c7640","body_text":"Transgenic production of the mouse in vitro- and in vivo-derived embryos: Effect on the methylation pattern of OCT4 promoter, expression levels of Dnmts, and Oct4 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transgenic production of the mouse in vitro- and in vivo-derived embryos: Effect on the methylation pattern of OCT4 promoter, expression levels of Dnmts, and Oct4 Nahid Pashaie, Delsuz Rezaee, sara hosseini, Mohammad Salehi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4767253/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract We examined the methylation pattern of OCT4 promotor and expression levels of Dnmts and Oct4 genes in the transgenic mouse embryos obtained by in vivo and in vitro experiments. A gene construct consisting of selected parts of the region upstream from the human OCT4 promoter and enhanced green fluorescent protein as a reporter (OCT4-EGFP) was used for pronuclear microinjection into in vitro and in vivo-derived embryos. The rate of fertilization, cleavage and developmental competence of embryos was evaluated. Expression levels of targeted genes were investigated. DNA was extracted from embryos and treated using a bisulfite kit, and OCT4 methylation detection was done by PCR in both groups. After microinjection, GFP fluorescence was visualized in developing embryos. We observed a significant decrease in cleavage and blastulation rate in the IVM group compared with the in vivo group. Results showed higher gene expression for the selected genes in the in vivo embryos compare to the IVM. The band intensity of the PCR product loaded was different in both groups, which shows that the level of methylation is unlike in IVM and in vivo groups. DNA methylation during development plays an important role in embryonic development for the production of high-quality transgenic embryos. transgenic animal DNA methylation in vitro maturation gene expression Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION The injection of a gene of interest into mouse embryos can be a strong tool for the study of developmental genetic problems. The monitoring of the fate of donor cells can be used by sensitive probing techniques offered by recombinant DNA technology. By creating transgenic embryos, the study of the function of foreign genes, processes of gene regulation, and physiologic roles of products of such genes can be studied[ 1 ]. The natural development of mammalian embryos -from the totipotent zygote- is regulated by both genetic and epigenetic mechanisms [ 2 ]. Epigenetic mechanisms, including DNA methylation, histone modification, and chromatin regeneration, involve a range of reversible chemical changes in chromatin that impose a cellular memory and subsequently stable cell fate [ 3 ]. DNA methylation, as a stable epigenetic mark, plays a crucial role in maintaining genomic stability, cell differentiation, and embryonic development through transcriptional regulation, genomic imprinting, X chromosome inactivation, and transposon silencing [ 4 , 5 ]. Epigenetic reprogramming in the early stages of embryonic development is required to create totipotent or pluripotent states for producing the next generation [ 6 ]. In the mammalian life cycle, two extensive waves of reprogramming of global demethylation and de novo methylation occur during gametogenesis, fertilization, and preimplantation development [ 7 ]. In mammals, after active and passive demethylations during gametogenesis and early embryogenesis, de novo methylation patterns in gametes maturation and blastulation stages are established and maintained by the action of the de novo and maintenance DNA methyltransferase enzymes DNMT3a/3b/3l and DNMT1, respectively [ 8 , 9 ]. In fact, DNMTs methylate the promoters of genes, depending on the developmental stage [ 10 ]. OCT4, a multivalent specific transcription factor, plays a pivotal role in regulating the expression of genes involved in pluripotency and self-renewal, and the simultaneous repression of differentiation-promoting genes in mammalian embryonic stem cells (ESCs) and primordial germ cells (PGCs) [ 11 ]. Different expression patterns of OCT4 differentiate embryonic stem cells during different stages of mammalian development [ 12 ]. Also, incomplete expression of the OCT4 gene leads to fetal and placental defects that are abundantly observed in cloned animals [ 13 ]. In mice, under the demethylation process, the OCT4 gene is abundantly and uniformly expressed throughout the pre-implantation stages and reaches its maximum expression in the early blastocyst stage. Then, with the occurrence of de novo methylation and subsequent blastocyst differentiation, OCT4 expression is restricted to the inner cell mass (ICM) and decreases in trophectoderm (TE) cells [ 14 , 15 ]. Remarkably, many of the events that equip the oocyte for fertilization, regeneration of parental genomes, and subsequently support of embryo development until the blastocyst stage, occur during oocyte maturation [ 16 ]. Therefore, exposure of oocytes to environmental and in vitro stresses in the early stages of development can lead to disruption of various cellular processes, aberrant reprogramming of DNA methylation, abnormal development of the organism (or embryo), and also increased susceptibility of the organism to chronic and non-communicable diseases in the next stages of life [ 17 , 18 ]. Along with in vitro embryo production (IVP) system, like in vitro maturation (IVM) and fertilization (IVF), embryos created in vitro have also been growingly applied for mammalian embryo production[ 19 ]. Oocyte in vitro maturation is known as an alternative treatment technique, not conventional, to improve conventional in vitro fertilization in assisted reproductive therapy (ART) [ 20 ]. As studies have shown, environmental perturbations can lead to potential unrecognized and adverse epigenetic alterations in IVM oocytes compared to in vivo-matured oocytes [ 21 ]. In addition, IVM intervention raises concerns about the imprint acquisition and maintenance of DNA methylation patterns during oocyte development, and may also have adverse consequences in the ensuing embryologic developmental pathways [ 22 , 23 ]. Previous human and animal data suggest that the IVM oocytes display differential methylation patterns in the promoter regions of some species-specific genes [ 23 , 24 ]. Thus, loss or acquisition of key methylation components during oocyte maturation could potentially lead to embryo growth arrest, increased rates of multinuclear blastomeres, aneuploidy, and recurrent implantation failure of aneuploid embryos [ 25 ]. Several studies have been performed on the effects of different factors at different stages of embryonic development in both in vivo and IVM conditions. In this study, we assessed transgenic-mouse embryo production by DNA microinjection into IVM and in vivo-derived embryos, analyzing the methylation patterns of the OCT4 promote, and the relationship between methylation and subsequent gene expression by investigating the expression levels of Dnmts and Oct4 genes in the transgenic embryos obtained by IVM and in vivo methods. MATERIAL AND METHODS The B6D2F1 mice were carried out according to the Guideline Principles for Laboratory Animals, approved by the university's protocols for the care and use of laboratory animals. The animals were kept in a controlled setting with ad libitum access to food and water at room temperature (22°C) and a 12 hr:12 hr light/dark photoperiod. Unless otherwise noted, all the chemicals were purchased from Sigma chemical corporation (St. Louis, MO, MO, USA). Transfection of the vector into the DH5α bacteria and DNA purification The phOCT-4-EGFP plasmid was purchased from Addgene Company (Cambridge, Massachusetts, United States) and transfected into E. coli DH5. The phOCT4-EGFP vector was transformed chemically (calcium chloride protocol) into competent Escherichia coli DH5α[ 26 ]. In positive colonies, the phOCT4-EGFP plasmid was extracted using the Macherey-Nagel (MN) extraction kit (Düren, Germany) according to the manufacturer's protocol. The H-OCT4-EGFP fragment was excised from the plasmid using restriction enzyme digestion (Not I and BgI II). We used a gene construct consisting of selected parts of the region upstream from the human OCT 4 gene as a promoter and enhanced green fluorescent protein (EGFP) as a reporter in the phOCT4-EGFP vector. After ensuring the accuracy and size of the DNA fragment, amplified PCR products on the agarose gel were purified using the Qiaex II Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer's procedure. The purified construct was quantified by optical density and diluted in TE buffer (pH = 3.7). The DNA solution was placed at -20 prior to microinjection. Matured in vivo oocytes and in vitro maturation (IVM) of COCs To obtain matured in vivo oocytes, 6–8 weeks female BDF1 mice were super ovulated with 10 IU pregnant mare serum gonadotropin (PMSG) by intraperitoneal injection, followed by human chorionic gonadotropin (HCG) injection after 48 hours. Cumulus-oocyte complexes (COCs) were collected by tearing the ampulla of the oviducts, 13–14 hr after the HCG injection. To obtain IVM oocytes, the ovaries of 6 to 8-week-old female mice were collected, 50 hr after the 10 IU hCG injection. The COCs harvested from each follicle were washed in Hepes-TCM199 medium buffered with 10% fetal bovine serum (FBS, Gibco, Invitrogen, Barcelona, Spain). Next, the COCs were matured in a tissue culture medium (TCM199) supplemented with 0.2 mmol L − 1 sodium pyruvate, 2 mmol L − 1 L-glutamine, 10 µg/mL follicle-stimulating hormone (FSH), 10 µg/mL LH, 1 µg/mL beta-estradiol, and 10% FBS for 22–24 h at 37°C and 5% CO 2 . Following IVM, the COCs were washed in human tubular fluid (HTF) medium supplemented with 4 mg/mL bovine serum albumin (BSA). For both in vivo and IVM groups oocytes were used for in vitro fertilization (IVF). In vitro fertilization (IVF) Isolated COCs were placed in an FHM medium and subsequently in 50 µl drops of human tubal fluid (HTF) medium with 4 mg/ml BSA under mineral oil. For spermatozoa collection, Mature spermatozoa were obtained from the cauda epididymis and vasa deferentia. sperm suspension was placed in a prewarmed petri dish with 0.5 ml of HTF medium that contained 4 mg/ml of BSA. The dish was incubated in a humidified atmosphere (37°C, 5% CO2) for 45 min for capacitation and swim-up. For the IVF group, approximately 1 × 10 6 capacitated sperm/ml were added in 50 µl droplets of HTF fertilization media with the COCs. The mixture was allowed to incubate for 6 hr at 37°C in a humidified atmosphere and 5% CO2. The presumptive embryos were subsequently cultured for 24 hr in a potassium simplex optimized medium supplemented with 4% BSA under mineral oil at 37°C in a humidified atmosphere that contained 5% CO2. After this time, embryo development was assessed at 24 and 96 hr after IVF to analyze the rate of fertilization and blastocyst formation, respectively [ 27 ]. Pronuclear injection of DNA in the IVM and in vivo matured oocytes Six hr after insemination, fertilized oocytes were transferred in 10 µl of droplets of FHM in the center of a petri dish. Transfer of the selected construct OCT4-EGFP was carried out by microinjectors connected to a microscope with Hoffman modulation contrast created a visible visualization of the pronuclei at × 40 magnification. 2 ng/µl of DNA was injected into the male pronuclei and the volume of it was almost doubled by injecting. Observing the swelling in the pronuclei indicates a successful injection, and if no swelling is observed, it is assumed that the injection was not successful. The injected embryos were removed immediately, placed in KSOM droplets overlaid with mineral oil, and kept in an incubator. Blastocyst formation was assessed at 96 hr after fertilization. The GFP-positive blastocysts were used in our subsequent experiments. Evaluation of the presence of OCT4-EGFP DNA and GFP expression in microinjected embryos Evaluation of the expression OCT4-EGFP DNA in the microinjected embryos was evaluated by fluorescence microscopy. Non-injected embryos obtained from in vivo and IVM were used as a control group for each one. Bisulfite-treated DNA After DNA synthesis in the GFP-positive embryos derived from in vivo and IVM, was bisulfite-treated following the standards of the protocol EZ DNA Methylation-Lightning™ Kit Bisulfite (Zymo Research, Irvine, USA). To identify investigate and compare methylated and non-methylated regions on human OCT4 promoter injected in the two groups, was performed methylation-specific PCR (MSP) using MSP-H-OCT-4 promoter primers in a reaction mix containing 25 µl 2X Zymo Taq™ qPCR PreMix (Zymo Research, Irvine, USA), 3 µl template DNA, and 3.5 µl (10 µM) of each primer with double distilled water to a total volume of 50 µl. The reaction conditions included an activation step at 95°C for 10 min followed by 45 cycles of 94°C for 30 s, 60°C for 40 s, and 72°C for 55 s. Final extension (10 min at 72℃) was followed by cooling at 4℃. DNA of non-injected embryos was used as a control group. Primer of human OCT4 promoter was designed using Methyl Primer Express v1.0 (Applied Biosystems, CA, USA) and Bisulfite Primer Seeker’ (Zymo Research) software to investigate the methylation of CpG regions. Sequence details for both forward and reverse primers are as follows: forward primer: 5′-GGGGAGTTTAGGGTAGTTTTTTT-3′; reverse primer: 5′-TCCCCTCACACAAAATCCCCTTC-3′. RNA isolation, cDNA synthesis, and qRT-PCR analysis Primers were designed using Gene Runner version 5.1 (Informer Technologies Inc., Spain) and Oligo 7 software (Molecular Biology Insights, Inc., Cascade, CO, USA). Lists the primer information was shown in Table 1 . Reverse transcription and quantitative PCR were used to investigate the expressions of studied genes as previously described [ 28 ]. Hypoxanthine phosphoribosyl transferase 1 ( Hprt1 ) was used as the reference gene. Relative expression was determined using the 2 −ΔΔCT method. Table 1 List of primers for conventional PCR and Real-time PCR M- HPRT1: Hypoxanthine Phosphoribosyltransferase 1; M-DNMT3A: DNA Methyltransferase 3 Alpha; M-DNMT3B: DNA Methyltransferase 3 Beta; M-Dnmt1: DNA Methyltransferase 1; DNA Methyltransferase 3; DNMT3L: DNA Methyltransferase 3 Like; EGFP: enhanced green fluorescent protein. Gene symbol Primer Sequence 5'-------->3' Product size (bp) H-Oct4-EGFP F: CAAGTAAGTGGGGTGGGTAGATGG R: GCTCAGGTAGTGGTTGTCG 4709 M-Hprt1 F: TCCCAGCGTCGTGATTAG R: CGAGCAAGTCTTTCAGTCC 137 M- Dnmt3a F: GAGCACGGCAGAATAGC R: AACACCCTTTCCATTTCAG 146 M-Dnmt3b F: AACACCCTTTCCATTTCAG R: GACAGCAAAGTTAAAGAAAGTG 156 M-Dnmt1 F: ACACCGTTCCCGTTCAG R: TCATCCACAGCATCCTCAG 154 M-Dnmt3l F: GATGACCAAGAGACAACTACCC R: CCACACCCGCATAGCATTC 96 M-Oct4 F: GGCGTTCTCTTTGGAAAGGTG R: ACGGTTCTCAATGCTAGTTCG 207 Immunofluorescence staining technique To assess the presence of OCT4 protein in the oocytes, immunofluorescence staining was performed as previously described by szczepanska [ 11 ]. Briefly, the oocytes were fixed with 4% paraformaldehyde, including 0.1 mg/ml PVA for 60 min. The fixed oocytes were blocked for 40 min at 4°C and subsequently incubated for 1 h with OCT4 primary antibody (1:200). The oocytes were finally rinsed with PBS and incubated with fluorescein isothiocyanate conjugate (FITC) secondary antibody (1:500) for 1 h. Nuclei were counterstained with 5 gr/ml of 4',6diamidino2phenylindole (DAPI) for 5–10 s and visualized by a fluorescent microscope. The blastocyst cells were counted and the percentage of OCT4 expression in the TE and ICM was analyzed and compared by SPSS software (version 25.0; IBM Corp, Armonk, NY). Depending on the expression level of OCT4, blastocysts were divided into 4 grades: I, OCT4 protein found in all nuclei of cells that make up both ICM and TE, II: OCT-4 protein is present in all nuclei of cells in ICM and TE; TE has a lower level of OCT4 than ICM. III: OCT4 protein is present only in some nuclei of TE and in all nuclei of ICM cells. IV: Oct-4 protein is only found in ICM nuclei [ 11 ]. Statistical analysis All data were analyzed by SPSS version 20 software (SPSS, Chicago, IL). Development was analyzed by the nonparametric Mann–Whitney test and ChiSquere. Relative expression levels of genes and miRNAs were evaluated by REST 2009 software (Qiagen). Results are expressed as mean ± SDM; P < 0.05 was considered statistically significant. RESULTS Confirmation of isolated OCT4-GFP DNA fragment Observation of 8068 bp bands on the agarose gel confirmed the accuracy of plasmid extraction (Fig. 1 A). To generate OCT4 -EGFP fragment, the ph- OCT4 -EGFP vector was digested with restriction double enzymes (NotI and BgIII) which yielded the specific 4709-bp amplified product for OCT4 -EGFP fragment (Fig. 1 B). IVM declined the rates of fertilization, cleavage, and embryo development To examine the developmental process of embryos in IVM and in vivo groups with their controls from the two-cell stage to reaching the blastocyst, their number was counted and the average percentage of embryonic development was evaluated in each stage. Developmental process of embryos from the two-cell to the blastocyst stage was demonstrated in Fig. 2 a. The analysis of data demonstrates that there was a significant decrease in cleavage and blastulation rate in the IVM group vs IVF (P < 0.05) (Table 2 ). However, the fertilization rate in the IVM group was 83.86% compared to 95.76% in the in vivo group. According to the results of Table 2 , the percentage of blastocyst formation in IVF-derived oocytes increased by roughly 86.31% compared to the IVM matured one. Table 2 Comparison of fertilization, cleavage, and developmental competence rates among IVM and in vivo groups derived MII oocytes Group No. of oocytes Two-cell stage Four-cell stage Eight-cell stage Morula Blastocysts In vivo (control) 105 95.76 a 94.90 a 92.25 a 90.95 a 86.31 a In vivo microinjection 116 69.21 b 66.85 b 62.70 b 61.82 b 46.62 b IVM (control) 151 83.86 c 51.78 b 43.42 b 39.28 b 27.14 b IVM microinjection 220 40.79 d 27.90 c 25.94 c 24.61 c 16.33 c Note. Non similar letters, within the same column, show significantly different (p < 0.05). Validation of injected OCT4-EGFP fragment into embryos by microscopic examination of GFP expression and PCR After pronuclear injection, GFP expression was observed in the blastocyst-stage embryos derived from IVM and in vivo oocytes using fluorescence microscopy. Also, in the control group embryos (without pronuclear injection) of both groups, no expression was observed under microscopic examination (Fig. 2 b). The introduction of Oct4-GFP DNA into embryos affects the rates of fertilization, cleavage, and embryo development The DNA was injected into oocytes derived from in vivo and IVM via microinjection. We compared the fertilization rate and development of the embryos after DNA transmission among the groups to assay whether microinjection had an incompatible effect on embryo development. Table 2 shows the percentage of fertilization and the cleavage rate in vivo and IVM oocytes. The in vivo and IVM control groups had a higher fertilization rate (95.76% and 83.86%, respectively) compared to the both microinjected in vivo and IVM (69.21and 40.79%, respectively) groups. According to the results, there were significant differences among these groups. We demonstrated an increased cleavage rate from the four-cell to the morula stages in both control groups compared with the microinjected groups. This difference was statistically significant among in vivo control and IVM control groups. Similarly, the rate of blastocyst formation in the control groups was higher, and this difference was significant (p < 0.05), see Table 2 . Effects of bisulfite treatment on DNA methylation Methylation-specific PCR (MSP) was performed to examine the methylation level of the OCT4 promoter in cumulus cells of IVM, IVO, and control groups. The 339 bp bands on the agarose gel reveal that the OCT4 promoter is methylated in both IVM and in vivo groups. The emission intensity of the band for the methylated OCT4 promoter gene was higher in the in vivo group vs IVM group, showing that the level of methylation is unlike in IVM and in vivo groups. While no band was observed in the control groups (Fig. 3 a). Effect of OCT4 -EGFP Microinjection on Transcript Frequencies ( Oct4 , Dnmt3b , Dnmt1 , Dnmt3a , and Dnmt3l ) in microinjected IVM and in vivo embryos DNA was extracted from the injected embryos in both groups for evaluation of the studied genes expression level. Figure 3 b show that microinjection of the OCT4 -EGFP DNA into embryos significantly affected the relative abundances of the transcripts for genes that were investigated in the blastocyst stage. Elevated levels of the Dnmt3a transcript were observed in the IVM embryos compared to in vivo embryos, and the amount of Dnmt3a in the IVM group was 2.25-fold greater than in the in vivo embryos. Figure 3 b shows the significant decrease in Dnmt3l in the IVM group compared with the in vivo group. the expressions of the Dnmt1 and Dnm3l genes were not significantly different between the IVM and in vivo groups. A significant decrease (P < 0.05) in Oct4 (mouse gene) was recorded in the IVM group vs in vivo group (Fig. 3 b). Immunostaining of OCT-4 expression in cumulus cells To evaluate the expression level of OCT4 protein, immunocytochemistry was carried out, and OCT4 was detected in both IVM and in vivo cumulus cells (Fig. 4 a). As shown in Fig. 4 b, the intensity and accumulation of OCT4 protein expression increased with the development and expansion of blastocyst cells in the in vivo group from Grade I to Grade III, and in the IVM group from Grade III and II to Grade I. DISCUSSION Transgenesis as a necessary tool gives experimenters the probability to investigate the individual genes in their natural complex environment. Transgenic animal technology is now widely used for simple and rapid establishment of analyzing gene expression and function. Transgenesis animals can be obtained with IVF and IVM of oocytes followed by subsequent DNA microinjection of zygotes[ 1 ]. The use of a quality immature oocyte and the preparation of an appropriate environment for growth and maturation of the oocyte is essential to determine the success of fertilization, preimplantation embryo development, fetal growth, and offspring health [ 29 ]. Environmental stressors can lead to unrecognized epigenetic defects in IVM oocytes and impair the normal differentiation and growth of the fetus [ 21 , 30 ]. Acquisition and maintenance of abnormal patterns of DNA methylation during the establishment of a germ cell identity may disrupt the expression of certain pluripotency genes that affect fetal development [ 23 ]. In addition, DNMTs, both embryonic and maternal, play an important role in maintaining methylations produced during the early stages of embryonic development [ 31 ]. In the present study, we produced transgenic embryos-derived IVM and in vivo following human promoter OCT4 gene microinjection into zygotes and next, the DNA methylation patterns in the OCT4 pluripotency gene promoter, expression changes of Dnmt1, Dnmt3a, Dnmt3b, Dnmt3l, Dnmt2 and Oct4 were studied in transgenic embryos. Oct4 is a potent transcription factor for stimulating, differentiating, and protecting the pluripotency potency of inner cell masses [ 11 , 32 ]. It has been determined that the highest amount of methylation in the promoter of genes occurs in CPG regions and leads to gene silencing [ 33 , 34 ]. Therefore, to investigate the effect of oocyte maturation conditions on DNA methylation, a human OCT4 promoter fragment was injected into the pronucleus of mature oocytes in both groups. Based on our MSP results, the rate of exogenous OCT4 promoter methylation in cumulus cells of the in vivo group was higher than the IVM group. However, it should be noted that the observation of more band intensities in MSP is not a reason for further methylation. When an exogenous fragment enters the fetal genome, de novo methylation again begins in that fragment, whereas this gene may have been subjected to various methylation or dimethylation factors before the entry of this fragment [ 35 ]. Therefore, the chromosomal position and consequently the factors influencing the methylation of the studied fragment in the two groups are not clear [ 36 , 37 ]. The best way to accurately analyze the methylation of a piece is the bisulfite sequencing method [ 38 ]. In accordance with other studies, our findings showed that the developmental rate in injected pronuclear oocytes was much lower than in their control groups. Also, the cleavage and embryo development rates to the blastocyst stage were significantly lower in the IVM oocytes than in the in vivo oocytes [ 39 , 40 ]. In mouse embryos, OCT4 is uniformly expressed in both TE and ICM cells during the early stages of in vivo blastulation, whereas in the late blastocyst stage, the expression of this gene is restricted to ICMs so that this pluripotent state reaches a limited number of cells, and this state depends on the expression of DNMTs [ 14 , 15 , 41 ]. More expression of DNMTs leads to more methylation, thereby the expression of the OCT4 gene is more limited [ 42 ]. Based on our data and previous studies, the expression levels of Dnmt s vary in blastocyst-stage embryos derived from IVM and in vivo-matured oocytes. A significant increase in Dnmt3a expression, as well as a decrease (not significant) in Dnmt3l expression, was observed in the IVM oocytes compared to the in vivo embryos. However, the expression levels of Dnmt1 and Dnmt3b did not show significant changes in both groups [ 43 ]. Differences in the Dnmt s expression in the embryos of both groups may have several possibilities including the creation of different methylation patterns [ 44 ], the production of diverse Dnmt isoforms following these methylation patterns [ 44 , 45 ], and the formation of specific chromatin structures by various Dnmts [ 46 , 47 ]. In the present study, the expression of mouse Oct4 was evaluated by qRT‐PCR and immunocytochemical staining in both groups. Using real-time PCR assays, we observed that the expression level of Oct4 decreased in blastocyst stage embryos of the IVM oocytes compared to the in vivo oocytes, but this difference is not significant. Due to the overexpression of Dnmt3a in the IVM oocytes compared to the in vivo oocytes, we expect the methylation rate to increase and the expression of the OCT4 protein in the IVM group to decrease significantly. It should be noted that in the qRT‐PCR assay, used cDNAs were obtained from a mixture of all blastocyst cells (ICM + TE) with different expression levels of Dnmt s. As a result, real-time PCR results are not accurate, so to achieve more accurate results, only the ICM part of blastocysts should be isolated and tested at different stages of blastocyst development [ 48 ]. OCT4 protein is abundantly and uniformly expressed in all embryonic cells throughout the morula stage and has the highest expression in the early blastocyst stage, then its expression of its decreases in the delayed blastocyst stage. This protein is uniformly expressed in both TE and ICM cells in the early blastocyst stage, but in the late stages of the blastocyst, the regulatory role of OCT4 is reduced in TE, and its expression is limited to ICM cells [ 14 , 15 ]. On the other hand, it was found that OCT4 silencing is not necessary for the formation of TE cells, however complete target expression of this protein in TE cells is essential for embryo implantation [ 49 ]. Our immunohistochemistry data on the in vivo-matured embryos was in agreement with previous studies, while in the IVM-matured embryos during the early blastocyst stage, the expression level of OCT4 protein was higher in ICM cells and lower in TE cells, and with the developmental progression to blastocyst, the expression level of OCT4 in TEs and ICM cells begins to equalize. It is possible that the decrease of Dnmt3l expression affects Dnmt3a activity and prevents severe methylation [ 14 , 50 ]. Thus, expression of OCT4 protein is observed with the developmental progression to blastocyst in both ICM and TE cells of IVM-matured oocytes. Conclusion This study demonstrated that in vitro maturation as well as pronuclear injection significantly altered the methylation status of the OCT4 promoter and the expression levels of Dnmts and Oct4 mouse genes due to environmental changes compared with in vivo matured oocytes. These results proposed that DNA methylation during development plays an important role in embryonic development for production of high-quality transgenic embryos. However, further investigations are necessary to identify the other regulator mechanisms during development of embryos. Declarations Acknowledgments We thank services provided by the biotechnology department of the School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences. Funding information This work was supported by the Shahid Beheshti University of Medical Sciences, Tehran, Iran (grant number IR.REC.1396.40). Compliance with ethical standards Conflict of interest The authors declare that there is no conflict of interest in this work. Ethical Approval Female and male B6D2F1 (C57BL/6 ×DBA/2) mice were obtained from the Pasteur Institute (Tehran, Iran). Mice were exposed to controlled lighting and temperature conditions (22–28 ̊C, 12 h light, and 12 h dark) and received a standard diet of food and water. All experimental procedures were performed in accordance with standard guideline procedures approved by the Institutional Animal Care and Ethics of Shahid Beheshti University of Medical Sciences, Tehran, Iran (IR.REC.1396.40 design code). Author Contribution M.S. RN: Study Design, data analysisD.R. wrote the main manuscript text, prepared figuresS.H. Doing Experiment and Laboratory Test, data analysisN.P. Doing Experiment and Laboratory Test, data collection References REFERENCES : Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH (1980) Genetic transformation of mouse embryos by microinjection of purified DNA Proceedings of the National Academy of Sciences 77(12):7380-4 Hemberger M, Hanna CW, Dean W (2020) Mechanisms of early placental development in mouse and humans. Nat Rev Genet 21(1):27–43 Wong MPM, Ng RK Resetting cell fate by epigenetic reprogramming (2018) Chromatin and Epigenetics Kim M, Costello J (2017) DNA methylation: an epigenetic mark of cellular memory. Exp Mol Med 49(4):e322–e Suelves M, Carrió E, Núñez-Álvarez Y, Peinado MA (2016) DNA methylation dynamics in cellular commitment and differentiation. Brief Funct Genomics 15(6):443–453 Cantone I, Fisher AG (2013) Epigenetic programming and reprogramming during development. Nat Struct Mol Biol 20(3):282–289 Zeng Y, Chen T (2019) DNA methylation reprogramming during mammalian development. Genes 10(4):257 Guo F, Li X, Liang D, Li T, Zhu P, Guo H et al (2014) Active and passive demethylation of male and female pronuclear DNA in the mammalian zygote. Cell Stem Cell 15(4):447–459 Bogdanović O, Lister R (2017) DNA methylation and the preservation of cell identity. Curr Opin Genet Dev 46:9–14 Loaeza-Loaeza J, Beltran AS, Hernández-Sotelo D (2020) DNMTs and impact of CpG content, transcription factors, consensus motifs, lncRNAs, and histone marks on DNA methylation. Genes 11(11):1336 Szczepańska K, Stańczuk Ł, Maleszewski M (2011) Oct4 protein remains in trophectoderm until late stages of mouse blastocyst development. Reprod Biol 11(2):145–156 Koestenbauer S, Zech NH, Juch H, Vanderzwalmen P, Schoonjans L, Dohr G (2006) Embryonic stem cells: similarities and differences between human and murine embryonic stem cells. Am J Reprod Immunol 55(3):169–180 Lin L, Li Q, Zhang L, Zhao D, Dai Y, Li N (2008) Aberrant epigenetic changes and gene expression in cloned cattle dying around birth. BMC Dev Biol 8(1):1–10 Wu G, Schöler HR (2014) Role of Oct4 in the early embryo development. Cell Regeneration 3(1):1–10 Ovitt CE, Schöler HR (1998) The molecular biology of Oct-4 in the early mouse embryo. Mol Hum Reprod 4(11):1021–1031 Sabry R (2019) The effects of BPA and BPS on microRNAs during bovine oocyte maturation and early embryo development Liu J, He B, Yin C, Chang Z, Zhao R (2021) Transcriptomic responses of porcine cumulus cells to heat exposure during oocytes in vitro maturation. Mol Reprod Dev 88(1):43–54 Herceg Z, Vaissière T (2011) Epigenetic mechanisms and cancer: an interface between the environment and the genome. Epigenetics 6(7):804–819 Egashira J, Ihara Y, Khatun H, Wada Y, Konno T, Tatemoto H et al (2019) Efficient in vitro embryo production using in vivo-matured oocytes from superstimulated Japanese Black cows Journal of Reproduction and Development:2018 – 155 Hatırnaz Ş, Ata B, Hatırnaz ES, Dahan MH, Tannus S, Tan J et al (2018) Oocyte in vitro maturation: A sytematic review. Turkish J Obstet Gynecol 15(2):112 Tan K, An L, Miao K, Ren L, Hou Z, Tao L et al (2016) Impaired imprinted X chromosome inactivation is responsible for the skewed sex ratio following in vitro fertilization Proceedings of the National Academy of Sciences 113(12):3197 – 202 Obata Y, Kono T, Hatada I (2002) Maturation of mouse fetal germ cells in vitro. Nature 418(6897):497 Milroy C, Liu L, Hammoud S, Hammoud A, Peterson CM, Carrell DT (2011) Differential methylation of pluripotency gene promoters in in vitro matured and vitrified, in vivo-matured mouse oocytes. Fertil Steril 95(6):2094–2099 Lou H, Le F, Hu M, Yang X, Li L, Wang L et al (2019) Aberrant DNA methylation of IGF2-H19 locus in human fetus and in spermatozoa from assisted reproductive technologies. Reproductive Sci 26(7):997–1004 Jurema MW, Nogueira D (2006) vitro maturation of human oocytes for assisted reproduction. Fertil Steril 86(5):1277–1291 Rezaee D, Bandehpour M, Kazemi B, Hosseini S, Dehghan Z, Bastaminejad S et al (2022) Effects of human chorionic gonadotropin-producing peripheral blood mononuclear cells on the endometrial receptivity and implantation sites of the mouse uterus. Korean Journal of Fertility and Sterility Rezaee D, Hosseini S, Jajarmi V, Salehi M Efficient of Toll-Like Receptor 4 Knockout in Mouse Zygotes by CRISPER/Cas9. Novelty Biomed 9(3):132–137 Dehghan Z, Mohammadi-Yeganeh S, Rezaee D, Salehi M (2021) MicroRNA-21 is involved in oocyte maturation, blastocyst formation, and pre-implantation embryo development. Dev Biol 480:69–77 Krisher RL (2013) vivo and in vitro environmental effects on mammalian oocyte quality. Annu Rev Anim Biosci 1(1):393–417 Tarin JJ, García-Pérez MA, Cano A (2014) Assisted reproductive technology results: Why are live‐birth percentages so low? Mol Reprod Dev 81(7):568–583 Hirasawa R, Chiba H, Kaneda M, Tajima S, Li E, Jaenisch R et al (2008) Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development. Genes Dev 22(12):1607–1616 Emura N, Sakurai N, Takahashi K, Hashizume T, Sawai K (2016) OCT-4 expression is essential for the segregation of trophectoderm lineages in porcine preimplantation embryos. Journal of Reproduction and Development Chen Z, Zhang Y (2020) Role of mammalian DNA methyltransferases in development Annual review of biochemistry 89:135 – 58 Greenberg MVC, Bourc’his D (2019) The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol 20(10):590–607 Stocum DL, Zupanc GKH (2008) Stretching the limits: stem cells in regeneration science. Dev dynamics: official publication Am Association Anatomists 237(12):3648–3671 Jopling C, Boue S, Belmonte JCI (2011) Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol 12(2):79–89 Doerfler W, Böhm PDNA, Methylation (2006) Basic Mechanisms: Springer Science & Business Media Feng S, Zhong Z, Wang M, Jacobsen SE (2020) Efficient and accurate determination of genome-wide DNA methylation patterns in Arabidopsis thaliana with enzymatic methyl sequencing. Epigenetics chromatin 13(1):1–17 Wang N, Le F, Zhan Q-T, Li L, Dong M-Y, Ding G-L et al Effects of in vitro maturation on histone acetylation in metaphase II oocytes and early cleavage embryos (2010) Obstetrics and gynecology international 2010 Liu X-Y, Mal S-F, Miao D-Q, Liu D-J, Bao S, Tan J-H (2005) Cortical granules behave differently in mouse oocytes matured under different conditions. Hum Reprod 20(12):3402–3413 Hu Y-G, Hirasawa R, Hu J-L, Hata K, Li C-L, Jin Y et al (2008) Regulation of DNA methylation activity through Dnmt3L promoter methylation by Dnmt3 enzymes in embryonic development. Hum Mol Genet 17(17):2654–2664 Kellner S, Kikyo N (2010) Transcriptional regulation of the Oct4 gene, a master gene for pluripotency. Histol Histopathol 25(3):405 Uysal F, Ozturk S, Akkoyunlu G (2017) DNMT1, DNMT3A and DNMT3B proteins are differently expressed in mouse oocytes and early embryos. J Mol Histol 48(5):417–426 Hara S, Takano T, Fujikawa T, Yamada M, Wakai T, Kono T et al (2014) Forced expression of DNA methyltransferases during oocyte growth accelerates the establishment of methylation imprints but not functional genomic imprinting. Hum Mol Genet 23(14):3853–3864 Duymich CE, Charlet J, Yang X, Jones PA, Liang G (2016) DNMT3B isoforms without catalytic activity stimulate gene body methylation as accessory proteins in somatic cells. Nat Commun 7(1):1–9 Baubec T, Karemaker ID (2020) DNA methyltransferases hitchhiking on chromatin. Swiss Med Wkly 150:w20329 Vassena R, Dee Schramm R, Latham KE Species-dependent expression patterns of DNA methyltransferase genes in mammalian oocytes and preimplantation embryos (2005) Molecular Reproduction and Development. Incorporating Gamete Res 72(4):430–436 Xu J, Li Y, Xu Y, Ding C, Li T, Zhou C (2014) A simple and effective method for the isolation of inner cell mass samples from human blastocysts for gene expression analysis In Vitro Cellular & Developmental Biology-Animal 50(3):232-6 Celauro E, Mukaj A, Fierro-González JC, Wittung-Stafshede P (2017) Copper chaperone ATOX1 regulates pluripotency factor OCT4 in preimplantation mouse embryos. Biochem Biophys Res Commun 491(1):147–153 Veland N, Lu Y, Hardikar S, Gaddis S, Zeng Y, Liu B et al (2019) DNMT3L facilitates DNA methylation partly by maintaining DNMT3A stability in mouse embryonic stem cells. Nucleic Acids Res 47(1):152–167 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4767253\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":329495795,\"identity\":\"5ca8281d-06be-4e46-ba14-2add461da4ca\",\"order_by\":0,\"name\":\"Nahid Pashaie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Islamic Azad University of Hamadan\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Nahid\",\"middleName\":\"\",\"lastName\":\"Pashaie\",\"suffix\":\"\"},{\"id\":329495796,\"identity\":\"88038608-5bd8-4eb1-96c7-f6f5acbc5abb\",\"order_by\":1,\"name\":\"Delsuz Rezaee\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ilam University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Delsuz\",\"middleName\":\"\",\"lastName\":\"Rezaee\",\"suffix\":\"\"},{\"id\":329495797,\"identity\":\"1921b461-e6fb-425a-a4eb-1a1672499526\",\"order_by\":2,\"name\":\"sara hosseini\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shahid Beheshti University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"sara\",\"middleName\":\"\",\"lastName\":\"hosseini\",\"suffix\":\"\"},{\"id\":329495798,\"identity\":\"7b535488-0471-41c9-acb5-bd087a7ec2c3\",\"order_by\":3,\"name\":\"Mohammad Salehi\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYLCCBwwHePgZeKA8ZmK0JAC1SDaQqoXB4AAPYYVgoNvA/vBDQsUdGePzZ49u5mGwk2dg532AV4vZAR5jiYQzz3jMbuSl3eZhSDZsYGY3IKSFQSKx7TBQC48ZUAtzAgMzG36HmR1gf/wj8d9hHuP+MyAt9cRoYTCTSGw4zGPAkAPScpgILUAnWSQcO8wjAfTLzTkGxw3bCGo53v74xoeaw/b8/WeP3XhTUS3Pz38Mvxa0iAOGFQE7RsEoGAWjYBQQAwCAgj5EfbC6rAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Shahid Beheshti University of Medical Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Mohammad\",\"middleName\":\"\",\"lastName\":\"Salehi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-07-19 09:25:30\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4767253/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4767253/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":62428033,\"identity\":\"ae0ef1a6-2f18-45c9-a890-46fd67784931\",\"added_by\":\"auto\",\"created_at\":\"2024-08-14 05:48:58\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":551262,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA: lane 1 and 2: Plasmid phOCT4-EGFP (8068 bp). B: Electrophoresis of Double Digest Vector phOCT4-EGFP, lane1: Undigest vector, lane2: BgI II enzyme single digest, lane3: Not I enzyme single Digest, lane 4: BgI II \\u0026amp; Not I Double digest. The DNA molecular weight marker is shown in Lanes L (100 bp).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767253/v1/51bf86273b22393f26e703f6.jpg\"},{\"id\":62428031,\"identity\":\"4d3125b1-a6eb-439b-8814-857d3509306d\",\"added_by\":\"auto\",\"created_at\":\"2024-08-14 05:48:57\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":60836,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ea\\u003c/strong\\u003e) Embryonic development from the two-cell stage to the embryonic blastocyst stage. A: two-celled embryos, B: Four-cell embryos, C: Eight-cell embryos, D: morula embryos, E: Blastocyst stage embryos, F: Blastocysts are hatching. \\u003cstrong\\u003eb\\u003c/strong\\u003e) GFP expression in blastocyst (A) in vivo group, (B) IVM group, (C) control groups.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767253/v1/f9c3da5435ade1f5f06d3d5f.jpg\"},{\"id\":62428029,\"identity\":\"96a59763-8f9b-463f-b463-f7adf2c576ab\",\"added_by\":\"auto\",\"created_at\":\"2024-08-14 05:48:57\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":629378,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ea\\u003c/strong\\u003e) The OCT4 promoter methylation level (A) lane 1 and 2: in vivo, lane 3 and 4: in vivo control (B) lane 1: IVM, lane 2 and 3: IVM control. The DNA molecular weight marker is shown in Lanes L. (100 bp). \\u003cstrong\\u003eb\\u003c/strong\\u003e) A: A comparison of the expression of mouse blastocyst DNA methyltransferase genes in IVM and in vivo groups. B: A comparison of the expression of the \\u003cem\\u003eOCT4\\u003c/em\\u003epromoter gene in mouse blastocysts in IVM and in vivo groups. C: Lane 1: IVM group cDNA synthesis; Lane 2: in vivo group cDNA synthesis; Lane L: 100 bp ladder.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767253/v1/af01fea2097df9c2a0f3bf08.jpg\"},{\"id\":62428030,\"identity\":\"0d222351-5c98-4f2b-bf41-b7c3e0f7eb30\",\"added_by\":\"auto\",\"created_at\":\"2024-08-14 05:48:57\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":484048,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ea\\u003c/strong\\u003e) Detection of OCT4 protein in COCs. Each sample was counterstained with DAPI (blue) to visualize the nuclei. The images depict OCT4 protein in COCs from the in vivo group (A, B), and the IVM group (C, D). \\u003cstrong\\u003eb\\u003c/strong\\u003e) Expression of the OCT4 protein at different stages of blastocyst development. The embryos were classified into 6 groups depending on the developmental stage defined by the number of cells. In each group, the level and pattern of OCT4protein were estimated and shown as the percentage of occurrence of grade I, II, III, and IV of \\u003cem\\u003eOct-4\\u003c/em\\u003e expression pattern. A) OCT4 protein COC expression in in vivo groups. B) OCT4 protein COC expression in IVM groups.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767253/v1/8b62b0782a5651d8f55d1bbc.png\"},{\"id\":62478890,\"identity\":\"0ae03c38-40a5-4f07-a264-fd72d751f13b\",\"added_by\":\"auto\",\"created_at\":\"2024-08-14 16:16:37\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2652198,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4767253/v1/51a03d60-4390-41f6-84cb-f424d937bdf5.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Transgenic production of the mouse in vitro- and in vivo-derived embryos: Effect on the methylation pattern of OCT4 promoter, expression levels of Dnmts, and Oct4\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eThe injection of a gene of interest into mouse embryos can be a strong tool for the study of developmental genetic problems. The monitoring of the fate of donor cells can be used by sensitive probing techniques offered by recombinant DNA technology. By creating transgenic embryos, the study of the function of foreign genes, processes of gene regulation, and physiologic roles of products of such genes can be studied[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The natural development of mammalian embryos -from the totipotent zygote- is regulated by both genetic and epigenetic mechanisms [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Epigenetic mechanisms, including DNA methylation, histone modification, and chromatin regeneration, involve a range of reversible chemical changes in chromatin that impose a cellular memory and subsequently stable cell fate [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. DNA methylation, as a stable epigenetic mark, plays a crucial role in maintaining genomic stability, cell differentiation, and embryonic development through transcriptional regulation, genomic imprinting, X chromosome inactivation, and transposon silencing [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Epigenetic reprogramming in the early stages of embryonic development is required to create totipotent or pluripotent states for producing the next generation [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. In the mammalian life cycle, two extensive waves of reprogramming of global demethylation and de novo methylation occur during gametogenesis, fertilization, and preimplantation development [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. In mammals, after active and passive demethylations during gametogenesis and early embryogenesis, de novo methylation patterns in gametes maturation and blastulation stages are established and maintained by the action of the de novo and maintenance DNA methyltransferase enzymes DNMT3a/3b/3l and DNMT1, respectively [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. In fact, DNMTs methylate the promoters of genes, depending on the developmental stage [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. OCT4, a multivalent specific transcription factor, plays a pivotal role in regulating the expression of genes involved in pluripotency and self-renewal, and the simultaneous repression of differentiation-promoting genes in mammalian embryonic stem cells (ESCs) and primordial germ cells (PGCs) [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Different expression patterns of OCT4 differentiate embryonic stem cells during different stages of mammalian development [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Also, incomplete expression of the OCT4 gene leads to fetal and placental defects that are abundantly observed in cloned animals [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. In mice, under the demethylation process, the OCT4 gene is abundantly and uniformly expressed throughout the pre-implantation stages and reaches its maximum expression in the early blastocyst stage. Then, with the occurrence of de novo methylation and subsequent blastocyst differentiation, OCT4 expression is restricted to the inner cell mass (ICM) and decreases in trophectoderm (TE) cells [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Remarkably, many of the events that equip the oocyte for fertilization, regeneration of parental genomes, and subsequently support of embryo development until the blastocyst stage, occur during oocyte maturation [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Therefore, exposure of oocytes to environmental and \\u003cem\\u003ein vitro\\u003c/em\\u003e stresses in the early stages of development can lead to disruption of various cellular processes, aberrant reprogramming of DNA methylation, abnormal development of the organism (or embryo), and also increased susceptibility of the organism to chronic and non-communicable diseases in the next stages of life [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Along with in vitro embryo production (IVP) system, like in vitro maturation (IVM) and fertilization (IVF), embryos created in vitro have also been growingly applied for mammalian embryo production[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Oocyte in vitro maturation is known as an alternative treatment technique, not conventional, to improve conventional in vitro fertilization in assisted reproductive therapy (ART) [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. As studies have shown, environmental perturbations can lead to potential unrecognized and adverse epigenetic alterations in IVM oocytes compared to in vivo-matured oocytes [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. In addition, IVM intervention raises concerns about the imprint acquisition and maintenance of DNA methylation patterns during oocyte development, and may also have adverse consequences in the ensuing embryologic developmental pathways [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Previous human and animal data suggest that the IVM oocytes display differential methylation patterns in the promoter regions of some species-specific genes [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Thus, loss or acquisition of key methylation components during oocyte maturation could potentially lead to embryo growth arrest, increased rates of multinuclear blastomeres, aneuploidy, and recurrent implantation failure of aneuploid embryos [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Several studies have been performed on the effects of different factors at different stages of embryonic development in both in vivo and IVM conditions. In this study, we assessed transgenic-mouse embryo production by DNA microinjection into IVM and in vivo-derived embryos, analyzing the methylation patterns of the OCT4 promote, and the relationship between methylation and subsequent gene expression by investigating the expression levels of \\u003cem\\u003eDnmts\\u003c/em\\u003e and \\u003cem\\u003eOct4\\u003c/em\\u003e genes in the transgenic embryos obtained by IVM and in vivo methods.\\u003c/p\\u003e\"},{\"header\":\"MATERIAL AND METHODS\",\"content\":\"\\u003cp\\u003e The B6D2F1 mice were carried out according to the Guideline Principles for Laboratory Animals, approved by the university's protocols for the care and use of laboratory animals. The animals were kept in a controlled setting with ad libitum access to food and water at room temperature (22\\u0026deg;C) and a 12 hr:12 hr light/dark photoperiod. Unless otherwise noted, all the chemicals were purchased from Sigma chemical corporation (St. Louis, MO, MO, USA).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTransfection of the vector into the DH5α bacteria and DNA purification\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe phOCT-4-EGFP plasmid was purchased from Addgene Company (Cambridge, Massachusetts, United States) and transfected into E. coli DH5. The phOCT4-EGFP vector was transformed chemically (calcium chloride protocol) into competent \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e DH5α[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. In positive colonies, the phOCT4-EGFP plasmid was extracted using the Macherey-Nagel (MN) extraction kit (D\\u0026uuml;ren, Germany) according to the manufacturer's protocol. The H-OCT4-EGFP fragment was excised from the plasmid using restriction enzyme digestion (Not I and BgI II). We used a gene construct consisting of selected parts of the region upstream from the human \\u003cem\\u003eOCT\\u003c/em\\u003e4 gene as a promoter and enhanced green fluorescent protein (EGFP) as a reporter in the phOCT4-EGFP vector. After ensuring the accuracy and size of the DNA fragment, amplified PCR products on the agarose gel were purified using the Qiaex II Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer's procedure. The purified construct was quantified by optical density and diluted in TE buffer (pH\\u0026thinsp;=\\u0026thinsp;3.7). The DNA solution was placed at -20 prior to microinjection.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMatured in vivo oocytes and in vitro maturation (IVM) of COCs\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo obtain matured in vivo oocytes, 6\\u0026ndash;8 weeks female BDF1 mice were super ovulated with 10 IU pregnant mare serum gonadotropin (PMSG) by intraperitoneal injection, followed by human chorionic gonadotropin (HCG) injection after 48 hours. Cumulus-oocyte complexes (COCs) were collected by tearing the ampulla of the oviducts, 13\\u0026ndash;14 hr after the HCG injection. To obtain IVM oocytes, the ovaries of 6 to 8-week-old female mice were collected, 50 hr after the 10 IU hCG injection. The COCs harvested from each follicle were washed in Hepes-TCM199 medium buffered with 10% fetal bovine serum (FBS, Gibco, Invitrogen, Barcelona, Spain). Next, the COCs were matured in a tissue culture medium (TCM199) supplemented with 0.2 mmol L\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e sodium pyruvate, 2 mmol L\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e L-glutamine, 10 \\u0026micro;g/mL follicle-stimulating hormone (FSH), 10 \\u0026micro;g/mL LH, 1 \\u0026micro;g/mL beta-estradiol, and 10% FBS for 22\\u0026ndash;24 h at 37\\u0026deg;C and 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e. Following IVM, the COCs were washed in human tubular fluid (HTF) medium supplemented with 4 mg/mL bovine serum albumin (BSA). For both in vivo and IVM groups oocytes were used for in vitro fertilization (IVF).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eIn vitro fertilization (IVF)\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eIsolated COCs were placed in an FHM medium and subsequently in 50 \\u0026micro;l drops of human tubal fluid (HTF) medium with 4 mg/ml BSA under mineral oil. For spermatozoa collection, Mature spermatozoa were obtained from the cauda epididymis and vasa deferentia. sperm suspension was placed in a prewarmed petri dish with 0.5 ml of HTF medium that contained 4 mg/ml of BSA. The dish was incubated in a humidified atmosphere (37\\u0026deg;C, 5% CO2) for 45 min for capacitation and swim-up. For the IVF group, approximately 1 \\u0026times; 10\\u003csup\\u003e6\\u003c/sup\\u003e capacitated sperm/ml were added in 50 \\u0026micro;l droplets of HTF fertilization media with the COCs. The mixture was allowed to incubate for 6 hr at 37\\u0026deg;C in a humidified atmosphere and 5% CO2. The presumptive embryos were subsequently cultured for 24 hr in a potassium simplex optimized medium supplemented with 4% BSA under mineral oil at 37\\u0026deg;C in a humidified atmosphere that contained 5% CO2. After this time, embryo development was assessed at 24 and 96 hr after IVF to analyze the rate of fertilization and blastocyst formation, respectively [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePronuclear injection of DNA in the IVM and in vivo matured oocytes\\u003c/h2\\u003e \\u003cp\\u003eSix hr after insemination, fertilized oocytes were transferred in 10 \\u0026micro;l of droplets of FHM in the center of a petri dish. Transfer of the selected construct OCT4-EGFP was carried out by microinjectors connected to a microscope with Hoffman modulation contrast created a visible visualization of the pronuclei at \\u0026times; 40 magnification. 2 ng/\\u0026micro;l of DNA was injected into the male pronuclei and the volume of it was almost doubled by injecting. Observing the swelling in the pronuclei indicates a successful injection, and if no swelling is observed, it is assumed that the injection was not successful. The injected embryos were removed immediately, placed in KSOM droplets overlaid with mineral oil, and kept in an incubator. Blastocyst formation was assessed at 96 hr after fertilization. The GFP-positive blastocysts were used in our subsequent experiments.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e\\u003cb\\u003eEvaluation of the presence of OCT4-EGFP DNA and GFP expression in microinjected embryos\\u003c/b\\u003e\\u003c/h2\\u003e \\u003cp\\u003eEvaluation of the expression OCT4-EGFP DNA in the microinjected embryos was evaluated by fluorescence microscopy. Non-injected embryos obtained from in vivo and IVM were used as a control group for each one.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eBisulfite-treated DNA\\u003c/h2\\u003e \\u003cp\\u003eAfter DNA synthesis in the GFP-positive embryos derived from in vivo and IVM, was bisulfite-treated following the standards of the protocol EZ DNA Methylation-Lightning\\u0026trade; Kit Bisulfite (Zymo Research, Irvine, USA). To identify investigate and compare methylated and non-methylated regions on human \\u003cem\\u003eOCT4\\u003c/em\\u003e promoter injected in the two groups, was performed methylation-specific PCR (MSP) using MSP-H-OCT-4 promoter primers in a reaction mix containing 25 \\u0026micro;l 2X Zymo Taq\\u0026trade; qPCR PreMix (Zymo Research, Irvine, USA), 3 \\u0026micro;l template DNA, and 3.5 \\u0026micro;l (10 \\u0026micro;M) of each primer with double distilled water to a total volume of 50 \\u0026micro;l. The reaction conditions included an activation step at 95\\u0026deg;C for 10 min followed by 45 cycles of 94\\u0026deg;C for 30 s, 60\\u0026deg;C for 40 s, and 72\\u0026deg;C for 55 s. Final extension (10 min at 72℃) was followed by cooling at 4℃. DNA of non-injected embryos was used as a control group. Primer of human OCT4 promoter was designed using Methyl Primer Express v1.0 (Applied Biosystems, CA, USA) and Bisulfite Primer Seeker\\u0026rsquo; (Zymo Research) software to investigate the methylation of CpG regions. Sequence details for both forward and reverse primers are as follows: forward primer: 5\\u0026prime;-GGGGAGTTTAGGGTAGTTTTTTT-3\\u0026prime;; reverse primer: 5\\u0026prime;-TCCCCTCACACAAAATCCCCTTC-3\\u0026prime;.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA isolation, cDNA synthesis, and qRT-PCR analysis\\u003c/h2\\u003e \\u003cp\\u003ePrimers were designed using Gene Runner version 5.1 (Informer Technologies Inc., Spain) and Oligo 7 software (Molecular Biology Insights, Inc., Cascade, CO, USA). Lists the primer information was shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. Reverse transcription and quantitative PCR were used to investigate the expressions of studied genes as previously described [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Hypoxanthine phosphoribosyl transferase 1 (\\u003cem\\u003eHprt1\\u003c/em\\u003e) was used as the reference gene. Relative expression was determined using the 2 \\u003csup\\u003e\\u0026minus;ΔΔCT\\u003c/sup\\u003e method.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eList of primers for conventional PCR and Real-time PCR M- HPRT1: Hypoxanthine Phosphoribosyltransferase 1; M-DNMT3A: DNA Methyltransferase 3 Alpha; M-DNMT3B: DNA Methyltransferase 3 Beta; M-Dnmt1: DNA Methyltransferase 1; DNA Methyltransferase 3; DNMT3L: DNA Methyltransferase 3 Like; EGFP: enhanced green fluorescent protein.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene symbol\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer Sequence 5'--------\\u0026gt;3'\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eProduct size (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eH-Oct4-EGFP\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: CAAGTAAGTGGGGTGGGTAGATGG\\u003c/p\\u003e \\u003cp\\u003eR: GCTCAGGTAGTGGTTGTCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e4709\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eM-Hprt1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: TCCCAGCGTCGTGATTAG\\u003c/p\\u003e \\u003cp\\u003eR: CGAGCAAGTCTTTCAGTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e137\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eM- Dnmt3a\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: GAGCACGGCAGAATAGC\\u003c/p\\u003e \\u003cp\\u003eR: AACACCCTTTCCATTTCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e146\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eM-Dnmt3b\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: AACACCCTTTCCATTTCAG\\u003c/p\\u003e \\u003cp\\u003eR: GACAGCAAAGTTAAAGAAAGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e156\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eM-Dnmt1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: ACACCGTTCCCGTTCAG\\u003c/p\\u003e \\u003cp\\u003eR: TCATCCACAGCATCCTCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e154\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eM-Dnmt3l\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: GATGACCAAGAGACAACTACCC\\u003c/p\\u003e \\u003cp\\u003eR: CCACACCCGCATAGCATTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e96\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eM-Oct4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eF: GGCGTTCTCTTTGGAAAGGTG\\u003c/p\\u003e \\u003cp\\u003eR: ACGGTTCTCAATGCTAGTTCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e207\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunofluorescence staining technique\\u003c/h2\\u003e \\u003cp\\u003eTo assess the presence of OCT4 protein in the oocytes, immunofluorescence staining was performed as previously described by szczepanska [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Briefly, the oocytes were fixed with 4% paraformaldehyde, including 0.1 mg/ml PVA for 60 min. The fixed oocytes were blocked for 40 min at 4\\u0026deg;C and subsequently incubated for 1 h with OCT4 primary antibody (1:200). The oocytes were finally rinsed with PBS and incubated with fluorescein isothiocyanate conjugate (FITC) secondary antibody (1:500) for 1 h. Nuclei were counterstained with 5 gr/ml of 4',6diamidino2phenylindole (DAPI) for 5\\u0026ndash;10 s and visualized by a fluorescent microscope. The blastocyst cells were counted and the percentage of OCT4 expression in the TE and ICM was analyzed and compared by SPSS software (version 25.0; IBM Corp, Armonk, NY).\\u003c/p\\u003e \\u003cp\\u003eDepending on the expression level of OCT4, blastocysts were divided into 4 grades: I, OCT4 protein found in all nuclei of cells that make up both ICM and TE, II: OCT-4 protein is present in all nuclei of cells in ICM and TE; TE has a lower level of OCT4 than ICM. III: OCT4 protein is present only in some nuclei of TE and in all nuclei of ICM cells. IV: Oct-4 protein is only found in ICM nuclei [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll data were analyzed by SPSS version 20 software (SPSS, Chicago, IL). Development was analyzed by the nonparametric Mann\\u0026ndash;Whitney test and ChiSquere. Relative expression levels of genes and miRNAs were evaluated by REST 2009 software (Qiagen). Results are expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SDM; \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e \"},{\"header\":\"RESULTS\",\"content\":\"\\u003cdiv id=\\\"Sec9\\\" type=\\\"Results\\\" class=\\\"Section2\\\"\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eConfirmation of isolated OCT4-GFP DNA fragment\\u003c/h2\\u003e \\u003cp\\u003eObservation of 8068 bp bands on the agarose gel confirmed the accuracy of plasmid extraction (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). To generate \\u003cem\\u003eOCT4\\u003c/em\\u003e-EGFP fragment, the ph-\\u003cem\\u003eOCT4\\u003c/em\\u003e-EGFP vector was digested with restriction double enzymes (NotI and BgIII) which yielded the specific 4709-bp amplified product for \\u003cem\\u003eOCT4\\u003c/em\\u003e-EGFP fragment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB).\\u003c/p\\u003e\\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIVM declined the rates of fertilization, cleavage, and embryo development\\u003c/h2\\u003e \\u003cp\\u003eTo examine the developmental process of embryos in IVM and in vivo groups with their controls from the two-cell stage to reaching the blastocyst, their number was counted and the average percentage of embryonic development was evaluated in each stage. Developmental process of embryos from the two-cell to the blastocyst stage was demonstrated in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea. The analysis of data demonstrates that there was a significant decrease in cleavage and blastulation rate in the IVM group vs IVF (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). However, the fertilization rate in the IVM group was 83.86% compared to 95.76% in the in vivo group. According to the results of Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, the percentage of blastocyst formation in IVF-derived oocytes increased by roughly 86.31% compared to the IVM matured one.\\u003c/p\\u003e\\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eComparison of fertilization, cleavage, and developmental competence rates among IVM and in vivo groups derived MII oocytes\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGroup\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNo. of oocytes\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTwo-cell stage\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eFour-cell stage\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eEight-cell stage\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eMorula\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eBlastocysts\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIn vivo (control)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e105\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e95.76\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e94.90\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e92.25\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e90.95\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e86.31\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIn vivo microinjection\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e116\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e69.21\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e66.85\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e62.70\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e61.82\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e46.62\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIVM\\u003c/p\\u003e \\u003cp\\u003e(control)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e151\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e83.86\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e51.78\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e43.42\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e39.28\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e27.14\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIVM microinjection\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e220\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e40.79\\u003csup\\u003ed\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e27.90\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e25.94\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e24.61\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e16.33\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"7\\\"\\u003eNote. Non similar letters, within the same column, show significantly different (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05).\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eValidation of injected OCT4-EGFP fragment into embryos by microscopic examination of GFP expression and PCR\\u003c/h2\\u003e \\u003cp\\u003eAfter pronuclear injection, GFP expression was observed in the blastocyst-stage embryos derived from IVM and in vivo oocytes using fluorescence microscopy. Also, in the control group embryos (without pronuclear injection) of both groups, no expression was observed under microscopic examination (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eThe introduction of Oct4-GFP DNA into embryos affects the rates of fertilization, cleavage, and embryo development\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe DNA was injected into oocytes derived from in vivo and IVM via microinjection. We compared the fertilization rate and development of the embryos after DNA transmission among the groups to assay whether microinjection had an incompatible effect on embryo development. Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e shows the percentage of fertilization and the cleavage rate in vivo and IVM oocytes. The in vivo and IVM control groups had a higher fertilization rate (95.76% and 83.86%, respectively) compared to the both microinjected in vivo and IVM (69.21and 40.79%, respectively) groups. According to the results, there were significant differences among these groups. We demonstrated an increased cleavage rate from the four-cell to the morula stages in both control groups compared with the microinjected groups. This difference was statistically significant among in vivo control and IVM control groups. Similarly, the rate of blastocyst formation in the control groups was higher, and this difference was significant (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), see Table \\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEffects of bisulfite treatment on DNA methylation\\u003c/h2\\u003e \\u003cp\\u003eMethylation-specific PCR (MSP) was performed to examine the methylation level of the \\u003cem\\u003eOCT4\\u003c/em\\u003e promoter in cumulus cells of IVM, IVO, and control groups. The 339 bp bands on the agarose gel reveal that the \\u003cem\\u003eOCT4\\u003c/em\\u003e promoter is methylated in both IVM and in vivo groups. The emission intensity of the band for the methylated \\u003cem\\u003eOCT4\\u003c/em\\u003e promoter gene was higher in the in vivo group vs IVM group, showing that the level of methylation is unlike in IVM and in vivo groups. While no band was observed in the control groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea).\\u003c/p\\u003e\\u003cp\\u003e \\u003cb\\u003eEffect of\\u003c/b\\u003e \\u003cb\\u003eOCT4\\u003c/b\\u003e\\u003cb\\u003e-EGFP Microinjection on Transcript Frequencies (\\u003c/b\\u003e\\u003cb\\u003eOct4\\u003c/b\\u003e, \\u003cb\\u003eDnmt3b\\u003c/b\\u003e, \\u003cb\\u003eDnmt1\\u003c/b\\u003e, \\u003cb\\u003eDnmt3a\\u003c/b\\u003e, \\u003cb\\u003eand\\u003c/b\\u003e \\u003cb\\u003eDnmt3l\\u003c/b\\u003e\\u003cb\\u003e) in microinjected IVM and in vivo embryos\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eDNA was extracted from the injected embryos in both groups for evaluation of the studied genes expression level. Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb show that microinjection of the \\u003cem\\u003eOCT4\\u003c/em\\u003e-EGFP DNA into embryos significantly affected the relative abundances of the transcripts for genes that were investigated in the blastocyst stage. Elevated levels of the \\u003cem\\u003eDnmt3a\\u003c/em\\u003e transcript were observed in the IVM embryos compared to in vivo embryos, and the amount of \\u003cem\\u003eDnmt3a\\u003c/em\\u003e in the IVM group was 2.25-fold greater than in the in vivo embryos. Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb shows the significant decrease in \\u003cem\\u003eDnmt3l\\u003c/em\\u003e in the IVM group compared with the in vivo group. the expressions of the \\u003cem\\u003eDnmt1\\u003c/em\\u003e and \\u003cem\\u003eDnm3l\\u003c/em\\u003e genes were not significantly different between the IVM and in vivo groups. A significant decrease (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) in \\u003cem\\u003eOct4\\u003c/em\\u003e (mouse gene) was recorded in the IVM group vs in vivo group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunostaining of OCT-4 expression in cumulus cells\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate the expression level of OCT4 protein, immunocytochemistry was carried out, and OCT4 was detected in both IVM and in vivo cumulus cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea). As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb, the intensity and accumulation of OCT4 protein expression increased with the development and expansion of blastocyst cells in the in vivo group from Grade I to Grade III, and in the IVM group from Grade III and II to Grade I.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eTransgenesis as a necessary tool gives experimenters the probability to investigate the individual genes in their natural complex environment. Transgenic animal technology is now widely used for simple and rapid establishment of analyzing gene expression and function. Transgenesis animals can be obtained with IVF and IVM of oocytes followed by subsequent DNA microinjection of zygotes[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The use of a quality immature oocyte and the preparation of an appropriate environment for growth and maturation of the oocyte is essential to determine the success of fertilization, preimplantation embryo development, fetal growth, and offspring health [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Environmental stressors can lead to unrecognized epigenetic defects in IVM oocytes and impair the normal differentiation and growth of the fetus [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Acquisition and maintenance of abnormal patterns of DNA methylation during the establishment of a germ cell identity may disrupt the expression of certain pluripotency genes that affect fetal development [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. In addition, DNMTs, both embryonic and maternal, play an important role in maintaining methylations produced during the early stages of embryonic development [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. In the present study, we produced transgenic embryos-derived IVM and in vivo following human promoter \\u003cem\\u003eOCT4\\u003c/em\\u003e gene microinjection into zygotes and next, the DNA methylation patterns in the \\u003cem\\u003eOCT4\\u003c/em\\u003e pluripotency gene promoter, expression changes of \\u003cem\\u003eDnmt1, Dnmt3a, Dnmt3b, Dnmt3l, Dnmt2\\u003c/em\\u003e and \\u003cem\\u003eOct4\\u003c/em\\u003e were studied in transgenic embryos. Oct4 is a potent transcription factor for stimulating, differentiating, and protecting the pluripotency potency of inner cell masses [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. It has been determined that the highest amount of methylation in the promoter of genes occurs in CPG regions and leads to gene silencing [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Therefore, to investigate the effect of oocyte maturation conditions on DNA methylation, a human OCT4 promoter fragment was injected into the pronucleus of mature oocytes in both groups. Based on our MSP results, the rate of exogenous \\u003cem\\u003eOCT4\\u003c/em\\u003e promoter methylation in cumulus cells of the in vivo group was higher than the IVM group. However, it should be noted that the observation of more band intensities in MSP is not a reason for further methylation. When an exogenous fragment enters the fetal genome, de novo methylation again begins in that fragment, whereas this gene may have been subjected to various methylation or dimethylation factors before the entry of this fragment [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Therefore, the chromosomal position and consequently the factors influencing the methylation of the studied fragment in the two groups are not clear [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. The best way to accurately analyze the methylation of a piece is the bisulfite sequencing method [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. In accordance with other studies, our findings showed that the developmental rate in injected pronuclear oocytes was much lower than in their control groups. Also, the cleavage and embryo development rates to the blastocyst stage were significantly lower in the IVM oocytes than in the in vivo oocytes [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. In mouse embryos, OCT4 is uniformly expressed in both TE and ICM cells during the early stages of in vivo blastulation, whereas in the late blastocyst stage, the expression of this gene is restricted to ICMs so that this pluripotent state reaches a limited number of cells, and this state depends on the expression of DNMTs [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. More expression of DNMTs leads to more methylation, thereby the expression of the \\u003cem\\u003eOCT4\\u003c/em\\u003e gene is more limited [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Based on our data and previous studies, the expression levels of \\u003cem\\u003eDnmt\\u003c/em\\u003es vary in blastocyst-stage embryos derived from IVM and in vivo-matured oocytes. A significant increase in \\u003cem\\u003eDnmt3a\\u003c/em\\u003e expression, as well as a decrease (not significant) in \\u003cem\\u003eDnmt3l\\u003c/em\\u003e expression, was observed in the IVM oocytes compared to the in vivo embryos. However, the expression levels of \\u003cem\\u003eDnmt1\\u003c/em\\u003e and \\u003cem\\u003eDnmt3b\\u003c/em\\u003e did not show significant changes in both groups [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Differences in the \\u003cem\\u003eDnmt\\u003c/em\\u003es expression in the embryos of both groups may have several possibilities including the creation of different methylation patterns [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e], the production of diverse Dnmt isoforms following these methylation patterns [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e], and the formation of specific chromatin structures by various Dnmts [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. In the present study, the expression of mouse \\u003cem\\u003eOct4\\u003c/em\\u003e was evaluated by qRT‐PCR and immunocytochemical staining in both groups. Using real-time PCR assays, we observed that the expression level of \\u003cem\\u003eOct4\\u003c/em\\u003e decreased in blastocyst stage embryos of the IVM oocytes compared to the in vivo oocytes, but this difference is not significant. Due to the overexpression of \\u003cem\\u003eDnmt3a\\u003c/em\\u003e in the IVM oocytes compared to the in vivo oocytes, we expect the methylation rate to increase and the expression of the OCT4 protein in the IVM group to decrease significantly. It should be noted that in the qRT‐PCR assay, used cDNAs were obtained from a mixture of all blastocyst cells (ICM\\u0026thinsp;+\\u0026thinsp;TE) with different expression levels of \\u003cem\\u003eDnmt\\u003c/em\\u003es. As a result, real-time PCR results are not accurate, so to achieve more accurate results, only the ICM part of blastocysts should be isolated and tested at different stages of blastocyst development [\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. OCT4 protein is abundantly and uniformly expressed in all embryonic cells throughout the morula stage and has the highest expression in the early blastocyst stage, then its expression of its decreases in the delayed blastocyst stage. This protein is uniformly expressed in both TE and ICM cells in the early blastocyst stage, but in the late stages of the blastocyst, the regulatory role of OCT4 is reduced in TE, and its expression is limited to ICM cells [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. On the other hand, it was found that OCT4 silencing is not necessary for the formation of TE cells, however complete target expression of this protein in TE cells is essential for embryo implantation [\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e]. Our immunohistochemistry data on the in vivo-matured embryos was in agreement with previous studies, while in the IVM-matured embryos during the early blastocyst stage, the expression level of OCT4 protein was higher in ICM cells and lower in TE cells, and with the developmental progression to blastocyst, the expression level of OCT4 in TEs and ICM cells begins to equalize. It is possible that the decrease of \\u003cem\\u003eDnmt3l\\u003c/em\\u003e expression affects \\u003cem\\u003eDnmt3a\\u003c/em\\u003e activity and prevents severe methylation [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e]. Thus, expression of OCT4 protein is observed with the developmental progression to blastocyst in both ICM and TE cells of IVM-matured oocytes.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThis study demonstrated that in vitro maturation as well as pronuclear injection significantly altered the methylation status of the OCT4 promoter and the expression levels of \\u003cem\\u003eDnmts\\u003c/em\\u003e and \\u003cem\\u003eOct4\\u003c/em\\u003e mouse genes due to environmental changes compared with in vivo matured oocytes. These results proposed that DNA methylation during development plays an important role in embryonic development for production of high-quality transgenic embryos. However, further investigations are necessary to identify the other regulator mechanisms during development of embryos.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank services provided by the biotechnology department of the School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding information\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the\\u0026nbsp;Shahid Beheshti University of Medical Sciences, Tehran, Iran\\u0026nbsp;(grant number\\u0026nbsp;IR.REC.1396.40).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompliance with ethical standards\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that there is no conflict of interest in this work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical Approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFemale and male B6D2F1 (C57BL/6 \\u0026times;DBA/2) mice were obtained from the Pasteur Institute (Tehran, Iran). Mice were exposed to controlled lighting and temperature conditions (22\\u0026ndash;28 ̊C, 12 h light, and 12 h dark) and received a standard diet of food and water. All experimental procedures were performed in accordance with standard guideline procedures approved by the Institutional Animal Care and Ethics of Shahid Beheshti University of Medical Sciences, Tehran, Iran (IR.REC.1396.40 design code).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contribution\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eM.S. RN: Study Design, data analysisD.R. wrote the main manuscript text, prepared figuresS.H. Doing Experiment and Laboratory Test, data analysisN.P. Doing Experiment and Laboratory Test, data collection\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cdiv class=\\\"Heading\\\"\\u003e\\u003cb\\u003eREFERENCES\\u003c/b\\u003e:\\u003c/div\\u003e \\u003cli\\u003e\\u003cspan\\u003eGordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH (1980) Genetic transformation of mouse embryos by microinjection of purified DNA Proceedings of the National Academy of Sciences 77(12):7380-4\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHemberger M, Hanna CW, Dean W (2020) Mechanisms of early placental development in mouse and humans. Nat Rev Genet 21(1):27\\u0026ndash;43\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWong MPM, Ng RK Resetting cell fate by epigenetic reprogramming (2018) Chromatin and Epigenetics\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKim M, Costello J (2017) DNA methylation: an epigenetic mark of cellular memory. Exp Mol Med 49(4):e322\\u0026ndash;e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSuelves M, Carri\\u0026oacute; E, N\\u0026uacute;\\u0026ntilde;ez-\\u0026Aacute;lvarez Y, Peinado MA (2016) DNA methylation dynamics in cellular commitment and differentiation. Brief Funct Genomics 15(6):443\\u0026ndash;453\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCantone I, Fisher AG (2013) Epigenetic programming and reprogramming during development. Nat Struct Mol Biol 20(3):282\\u0026ndash;289\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZeng Y, Chen T (2019) DNA methylation reprogramming during mammalian development. Genes 10(4):257\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuo F, Li X, Liang D, Li T, Zhu P, Guo H et al (2014) Active and passive demethylation of male and female pronuclear DNA in the mammalian zygote. Cell Stem Cell 15(4):447\\u0026ndash;459\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBogdanović O, Lister R (2017) DNA methylation and the preservation of cell identity. Curr Opin Genet Dev 46:9\\u0026ndash;14\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoaeza-Loaeza J, Beltran AS, Hern\\u0026aacute;ndez-Sotelo D (2020) DNMTs and impact of CpG content, transcription factors, consensus motifs, lncRNAs, and histone marks on DNA methylation. Genes 11(11):1336\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSzczepańska K, Stańczuk Ł, Maleszewski M (2011) Oct4 protein remains in trophectoderm until late stages of mouse blastocyst development. Reprod Biol 11(2):145\\u0026ndash;156\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKoestenbauer S, Zech NH, Juch H, Vanderzwalmen P, Schoonjans L, Dohr G (2006) Embryonic stem cells: similarities and differences between human and murine embryonic stem cells. Am J Reprod Immunol 55(3):169\\u0026ndash;180\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin L, Li Q, Zhang L, Zhao D, Dai Y, Li N (2008) Aberrant epigenetic changes and gene expression in cloned cattle dying around birth. BMC Dev Biol 8(1):1\\u0026ndash;10\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu G, Sch\\u0026ouml;ler HR (2014) Role of Oct4 in the early embryo development. Cell Regeneration 3(1):1\\u0026ndash;10\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOvitt CE, Sch\\u0026ouml;ler HR (1998) The molecular biology of Oct-4 in the early mouse embryo. Mol Hum Reprod 4(11):1021\\u0026ndash;1031\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSabry R (2019) The effects of BPA and BPS on microRNAs during bovine oocyte maturation and early embryo development\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu J, He B, Yin C, Chang Z, Zhao R (2021) Transcriptomic responses of porcine cumulus cells to heat exposure during oocytes in vitro maturation. Mol Reprod Dev 88(1):43\\u0026ndash;54\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHerceg Z, Vaissi\\u0026egrave;re T (2011) Epigenetic mechanisms and cancer: an interface between the environment and the genome. Epigenetics 6(7):804\\u0026ndash;819\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEgashira J, Ihara Y, Khatun H, Wada Y, Konno T, Tatemoto H et al (2019) Efficient in vitro embryo production using in vivo-matured oocytes from superstimulated Japanese Black cows Journal of Reproduction and Development:2018\\u0026thinsp;\\u0026ndash;\\u0026thinsp;155\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHatırnaz Ş, Ata B, Hatırnaz ES, Dahan MH, Tannus S, Tan J et al (2018) Oocyte in vitro maturation: A sytematic review. Turkish J Obstet Gynecol 15(2):112\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTan K, An L, Miao K, Ren L, Hou Z, Tao L et al (2016) Impaired imprinted X chromosome inactivation is responsible for the skewed sex ratio following in vitro fertilization Proceedings of the National Academy of Sciences 113(12):3197\\u0026thinsp;\\u0026ndash;\\u0026thinsp;202\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eObata Y, Kono T, Hatada I (2002) Maturation of mouse fetal germ cells in vitro. Nature 418(6897):497\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMilroy C, Liu L, Hammoud S, Hammoud A, Peterson CM, Carrell DT (2011) Differential methylation of pluripotency gene promoters in in vitro matured and vitrified, in vivo-matured mouse oocytes. Fertil Steril 95(6):2094\\u0026ndash;2099\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLou H, Le F, Hu M, Yang X, Li L, Wang L et al (2019) Aberrant DNA methylation of IGF2-H19 locus in human fetus and in spermatozoa from assisted reproductive technologies. Reproductive Sci 26(7):997\\u0026ndash;1004\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJurema MW, Nogueira D (2006) vitro maturation of human oocytes for assisted reproduction. Fertil Steril 86(5):1277\\u0026ndash;1291\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRezaee D, Bandehpour M, Kazemi B, Hosseini S, Dehghan Z, Bastaminejad S et al (2022) Effects of human chorionic gonadotropin-producing peripheral blood mononuclear cells on the endometrial receptivity and implantation sites of the mouse uterus. Korean Journal of Fertility and Sterility\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRezaee D, Hosseini S, Jajarmi V, Salehi M Efficient of Toll-Like Receptor 4 Knockout in Mouse Zygotes by CRISPER/Cas9. Novelty Biomed 9(3):132\\u0026ndash;137\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDehghan Z, Mohammadi-Yeganeh S, Rezaee D, Salehi M (2021) MicroRNA-21 is involved in oocyte maturation, blastocyst formation, and pre-implantation embryo development. Dev Biol 480:69\\u0026ndash;77\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKrisher RL (2013) vivo and in vitro environmental effects on mammalian oocyte quality. Annu Rev Anim Biosci 1(1):393\\u0026ndash;417\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTarin JJ, Garc\\u0026iacute;a-P\\u0026eacute;rez MA, Cano A (2014) Assisted reproductive technology results: Why are live‐birth percentages so low? Mol Reprod Dev 81(7):568\\u0026ndash;583\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHirasawa R, Chiba H, Kaneda M, Tajima S, Li E, Jaenisch R et al (2008) Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development. Genes Dev 22(12):1607\\u0026ndash;1616\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEmura N, Sakurai N, Takahashi K, Hashizume T, Sawai K (2016) OCT-4 expression is essential for the segregation of trophectoderm lineages in porcine preimplantation embryos. Journal of Reproduction and Development\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen Z, Zhang Y (2020) Role of mammalian DNA methyltransferases in development Annual review of biochemistry 89:135\\u0026thinsp;\\u0026ndash;\\u0026thinsp;58\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGreenberg MVC, Bourc\\u0026rsquo;his D (2019) The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol 20(10):590\\u0026ndash;607\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStocum DL, Zupanc GKH (2008) Stretching the limits: stem cells in regeneration science. Dev dynamics: official publication Am Association Anatomists 237(12):3648\\u0026ndash;3671\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJopling C, Boue S, Belmonte JCI (2011) Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol 12(2):79\\u0026ndash;89\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDoerfler W, B\\u0026ouml;hm PDNA, Methylation (2006) Basic Mechanisms: Springer Science \\u0026amp; Business Media\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFeng S, Zhong Z, Wang M, Jacobsen SE (2020) Efficient and accurate determination of genome-wide DNA methylation patterns in Arabidopsis thaliana with enzymatic methyl sequencing. Epigenetics chromatin 13(1):1\\u0026ndash;17\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang N, Le F, Zhan Q-T, Li L, Dong M-Y, Ding G-L et al Effects of in vitro maturation on histone acetylation in metaphase II oocytes and early cleavage embryos (2010) Obstetrics and gynecology international 2010\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu X-Y, Mal S-F, Miao D-Q, Liu D-J, Bao S, Tan J-H (2005) Cortical granules behave differently in mouse oocytes matured under different conditions. Hum Reprod 20(12):3402\\u0026ndash;3413\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu Y-G, Hirasawa R, Hu J-L, Hata K, Li C-L, Jin Y et al (2008) Regulation of DNA methylation activity through Dnmt3L promoter methylation by Dnmt3 enzymes in embryonic development. Hum Mol Genet 17(17):2654\\u0026ndash;2664\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKellner S, Kikyo N (2010) Transcriptional regulation of the Oct4 gene, a master gene for pluripotency. Histol Histopathol 25(3):405\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUysal F, Ozturk S, Akkoyunlu G (2017) DNMT1, DNMT3A and DNMT3B proteins are differently expressed in mouse oocytes and early embryos. J Mol Histol 48(5):417\\u0026ndash;426\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHara S, Takano T, Fujikawa T, Yamada M, Wakai T, Kono T et al (2014) Forced expression of DNA methyltransferases during oocyte growth accelerates the establishment of methylation imprints but not functional genomic imprinting. Hum Mol Genet 23(14):3853\\u0026ndash;3864\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDuymich CE, Charlet J, Yang X, Jones PA, Liang G (2016) DNMT3B isoforms without catalytic activity stimulate gene body methylation as accessory proteins in somatic cells. Nat Commun 7(1):1\\u0026ndash;9\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBaubec T, Karemaker ID (2020) DNA methyltransferases hitchhiking on chromatin. Swiss Med Wkly 150:w20329\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVassena R, Dee Schramm R, Latham KE Species-dependent expression patterns of DNA methyltransferase genes in mammalian oocytes and preimplantation embryos (2005) Molecular Reproduction and Development. Incorporating Gamete Res 72(4):430\\u0026ndash;436\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu J, Li Y, Xu Y, Ding C, Li T, Zhou C (2014) A simple and effective method for the isolation of inner cell mass samples from human blastocysts for gene expression analysis In Vitro Cellular \\u0026amp; Developmental Biology-Animal 50(3):232-6\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCelauro E, Mukaj A, Fierro-Gonz\\u0026aacute;lez JC, Wittung-Stafshede P (2017) Copper chaperone ATOX1 regulates pluripotency factor OCT4 in preimplantation mouse embryos. Biochem Biophys Res Commun 491(1):147\\u0026ndash;153\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVeland N, Lu Y, Hardikar S, Gaddis S, Zeng Y, Liu B et al (2019) DNMT3L facilitates DNA methylation partly by maintaining DNMT3A stability in mouse embryonic stem cells. Nucleic Acids Res 47(1):152\\u0026ndash;167\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"transgenic animal, DNA methylation, in vitro maturation, gene expression\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4767253/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4767253/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eWe examined the methylation pattern of OCT4 promotor and expression levels of \\u003cem\\u003eDnmts\\u003c/em\\u003e and \\u003cem\\u003eOct4\\u003c/em\\u003e genes in the transgenic mouse embryos obtained by in vivo and in vitro experiments. A gene construct consisting of selected parts of the region upstream from the human OCT4 promoter and enhanced green fluorescent protein as a reporter (OCT4-EGFP) was used for pronuclear microinjection into in vitro and in vivo-derived embryos. The rate of fertilization, cleavage and developmental competence of embryos was evaluated. Expression levels of targeted genes were investigated. DNA was extracted from embryos and treated using a bisulfite kit, and OCT4 methylation detection was done by PCR in both groups. After microinjection, GFP fluorescence was visualized in developing embryos. We observed a significant decrease in cleavage and blastulation rate in the IVM group compared with the in vivo group. Results showed higher gene expression for the selected genes in the in vivo embryos compare to the IVM. The band intensity of the PCR product loaded was different in both groups, which shows that the level of methylation is unlike in IVM and in vivo groups. DNA methylation during development plays an important role in embryonic development for the production of high-quality transgenic embryos.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Transgenic production of the mouse in vitro- and in vivo-derived embryos: Effect on the methylation pattern of OCT4 promoter, expression levels of Dnmts, and Oct4\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-08-14 05:48:53\",\"doi\":\"10.21203/rs.3.rs-4767253/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"7c61e46e-797f-4013-bb0f-35946d848ee0\",\"owner\":[],\"postedDate\":\"August 14th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-08-14T16:08:30+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-08-14 05:48:53\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4767253\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4767253\",\"identity\":\"rs-4767253\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}