{"paper_id":"3df8f3b7-e1b0-4f2b-ab4e-065be1119690","body_text":"1 \n \nStaphylococcus aureus  counters organic acid anion-mediated inhibition of 1 \npeptidoglycan cross-linking through robust alanine racemase activity  2 \nSasmita Panda 1, Yahani P. Jayasinghe 2, Dhananjay D. Shinde 1, Emilio Bueno 3, Amanda 3 \nStastny1, Blake P. Bertrand 1, Sujata S. Chaudhari 1, Tammy Kielian 1, Felipe Cava 3, Donald R. 4 \nRonning2 and Vinai C. Thomas1*  5 \n  6 \n1Center for Staphylococcal Research, Department of Pathology and Microbiology, University of 7 \nNebraska Medical Center, Omaha, Nebraska 68198-5900, USA.  8 \n2Department of Pharmaceutical Sciences, University of Nebraska Medical Center, Omaha, NE, 9 \n68198, USA  10 \n3Laboratory for Molecular Infection Medicine Sweden (MIMS), Umeå Center for Microbial  11 \nResearch (UCMR), Department of Molecular Biology, Umeå University, Umea SE-90187, 12 \nSweden  13 \n*Corresponding author.   14 \n  15 \nMailing address:    Department of Pathology and Microbiology  16 \nUniversity of Nebraska Medical Center  17 \nOmaha, NE 68198-6495   18 \nTel: 402-559-3640, Fax: 402-559-4077   19 \nE-mail: vinai.thomas@unmc.edu  20 \n Keywords: Staphylococcus aureus, weak acids, acetate, D-alanyl-D-alanine ligase, Alanine 21 \nracemase  22 \n 23 \nRunning Title: Organic acid anions inhibit Ddl  24 \n 25 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n2 \n \nAbstract  26 \nWeak organic acids are commonly found in host niches colonized by bacteria, and they can 27 \ninhibit bacterial growth as the environment becomes acidic. This inhibition is often attributed to 28 \nthe toxicity resulting from the accumulation of high concentrations of organic anions in the 29 \ncytosol, which disrupts cellular homeostasis. However, the precise cellular targets that organic 30 \nanions poison and the mechanisms used to counter organic anion intoxication in bacteria have 31 \nnot been elucidated. Here, we utilize acetic acid , a weak organic acid abundantly found in the 32 \ngut to investigate its impact on the growth of Staphylococcus aureus . We demonstrate that 33 \nacetate anions bind to and inhibit D-alanyl-D-alanine ligase (Ddl) activity in S. aureus . Ddl 34 \ninhibition reduces intracellular D-alanyl-D-alanine ( D-Ala-D-Ala) levels, compromising 35 \nstaphylococcal peptidoglycan cro ss-linking and cell wall integrity. To overcome the effects of 36 \nacetate-mediated Ddl inhibition, S. aureus  maintains a high intracellular D-Ala pool through 37 \nalanine racemase (Alr1) activity and additionally limits the flux of D-Ala to D-glutamate by 38 \ncontrolling D-alanine aminotransferase (Dat) activity. Surprisingly, the modus operandi  of 39 \nacetate intoxication in S. aureus is common to multiple biologically relevant weak organic acids 40 \nindicating that Ddl is a conserved target of small organic anions. These findings suggest that S. 41 \naureus may have evolved to maintain high intracellular D-Ala concentrations, partly to counter 42 \norganic anion intoxication.  43 \n 44 \n 45 \n  46 \n 47 \n 48 \n 49 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n3 \n \nSignificance  50 \nUnder mildly acidic conditions, weak organic acids like acetic acid accumulate to high 51 \nconcentrations within the cytosol as organic anions. However, the physiological consequence of 52 \norganic anion accumulation is poorly defined. Here we investigate how the acetate anion 53 \nimpacts S. aureus. We show that acetate anions directly bind Ddl and inhibit its activity. The 54 \nresulting decrease in intracellular D-Ala-D-Ala pools impacts peptidoglycan integrity. Since 55 \nacetate is a weak inhibitor of Ddl, mechanisms that maintain a high intracellular D-Ala pools are 56 \nsufficient to counter the effect of acetate-mediated Ddl inhibition in S. aureus.   57 \n  58 \n  59 \n  60 \n  61 \n  62 \n  63 \n  64 \n  65 \n  66 \n  67 \n  68 \n  69 \n  70 \n  71 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n4 \n \nOrganic acids produced by host and bacterial metabolism are critical determinants of 72 \ninfection outcomes (1, 2). During infection, the host macrophages produce millimolar amounts 73 \nof itaconate, a dicarboxylic acid known to inhibit bacterial growth (3). Conversely, many 74 \nbacterial pathogens and the gut microflora excrete short-chain organic fatty acids, which exhibit 75 \nimmunomodulatory functions and can skew the host response during infection (4, 5). Upon 76 \nentry into the bacterial cell, organic acids can become toxic to bacteria when they disassociate 77 \nin the cytosol as protons and organic anions. The influx of protons can result in cytoplasmic 78 \nacidification and prove lethal for some pathogens if not adequately controlled (6). Similarly, 79 \norganic anions have been shown to accumulate to toxic levels in the bacterial cytoplasm (7) . 80 \nHowever, the precise consequences of organic anion toxicity and the mechanisms pathogens 81 \nemploy to withstand the effects of anion perturbations within cells are not clearly understood.   82 \nHere we focus on the response of Staphylococcus aureus  to acetic acid, which is th e 83 \nprimary end-product of glucose catabolism under aerobic conditions. S. aureus  also likely 84 \nencounters high concentrations (up to 100 mM) of acetic acid and other short-chain fatty acids 85 \nproduced by human gut microbiota during intestinal colonization (8). On average, 20% of adults 86 \ncarry S. aureus in their intestines (9), and the burden there often surpasses that found in nasal 87 \npassages by more than three orders of magnitude establishing the gut as a primary site for S. 88 \naureus colonization (10). We have previously shown that excreted acetic acid can promote 89 \ncytoplasmic acidification in cultures of S. aureus,  especially when the external environment 90 \nbecomes sufficiently acidic (pH< 5) (11). Cytoplasmic acidification promotes protein oxidation 91 \nand triggers a staphylococcal ClpP-dependent damage response that eliminates unfit cells from 92 \nthe population (12). In contrast, in mildly acidic environments (pH 5.5-6.5), although S. aureus 93 \nactively buffers its intracellular environment against acidification, the transmembrane pH 94 \ngradient (ΔpH) of S. aureus will drive the accumulation of millimolar quantities of acetate anions 95 \ninto the cytoplasm. Previous studies in Escherichia coli  have shown that acetate intoxication 96 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n5 \n \ncauses an osmotic imbalance that can transiently be accommodated by the efflux of 97 \nphysiological anions like glutamate (7). In addition, acetate anions have also been reported to 98 \nimpact enzymes in the methionine biosynthetic pathway, resulting in a toxic accumulation of 99 \nhomocysteine and a reduction in intracellular methionine leading to growth inhibition of E. coli 100 \n(13, 14). However, it remains unclear if these effects are common to other bacteria.  101 \n Here, we demonstrate that the primary target of acetate intoxication in S. aureus  is Ddl. 102 \nThis crucial enzyme produces the D-Ala-D-Ala dipeptide, that is incorporated into peptidoglycan 103 \nprecursors and is necessary for cell wall cross-linking. We also demonstrate that carbon flux 104 \nthrough alanine racemase and a tight control of Dat activity increases the cytosolic D-Ala pools 105 \nto counter acetate-mediated inhibition of Ddl. Importantly, these phenotypic effects are not 106 \nunique to acetate but are conserved across multiple biologically important organic acid anions. 107 \nTherefore, we propose that S. aureus may have evolved to maintain a high intracellular D-ala 108 \npool partly to offset the inhibition of Ddl by organic anions typically encountered during human 109 \ncolonization.  110 \nResults  111 \nAlanine racemase counters acetate intoxication  112 \nTo identify genetic determinants that counter the effects of acetate intoxication, we 113 \nscreened the Nebraska Transposon Mutant Library (NTML) for mutants sensitive to 20 mM 114 \nacetic acid in Tryptic Soy Broth (TSB) media, pH 6.0. Under these conditions, S. aur eus 115 \nmaintains its intracellular pH approx. 1.5 units above the external pH (15) and is estimated to 116 \naccumulate over 600 mM acetate in the cytosol (16). The NTML strains were grown under static 117 \nconditions at 37 °C, and the extent of growth was determined at 24 h by measuring the optical 118 \ndensity at 600 nm (OD 600). As a control, we performed an identical screen without acetic acid 119 \nsupplementation. We normalized the growth of each mutant in both screens ( ± acetic acid) to 120 \ntheir isogenic wild-type (WT) strain. A comparison of growth indices (OD 600 Tn-mut/WT) for each 121 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n6 \n \nmutant in the presence and absence of 20 mM acetic acid revealed that most mutants clustered 122 \nclose to an index of 1 in the plot (Figure 1A), which suggested that most mutants tolerated 123 \nacetate intoxication reasonably well. A few mutants that grew poorly following acetate 124 \nintoxication due to inherent growth defects were observed close to the plot diagonal, whereas 125 \nthose mutants that did not have intrinsic growth deficiencies were located further away from the 126 \ndiagonal. Among the latter class of mutants, we observed that the alr1 mutant had the most 127 \nsubstantial reduction in growth when subjected to acetate stress (Figure 1A, B). To confirm that 128 \nthe acetate- dependent growth defect of the alr1 mutant was not due to polar effects, we 129 \ncomplemented the mutant by inserting a functional copy of alr1 under the control of its native 130 \npromoter into the S. aureus  pathogenicity island (SaPI)  attachment site. Genetic 131 \ncomplementation completely restored the alr1 mutant phenotype to WT levels (Figure 1B). 132 \nThese results suggest that acetate intoxication impairs the growth of S. aureus in the absence 133 \nof a functional alanine racemase. Further supporting this conclusion, we could reduce acetate 134 \ntoxicity in the alr1 mutant by culturing this strain in glucose-free TSB media, which alleviates 135 \ncarbon catabolite repression and activates TCA cycle-dependent acetate catabolism ( Figure 136 \n1C) (17) . Conversely, the inactivation of citrate synthase ( citZ), the first enzyme of the TCA-137 \ncycle, re-imposed acetate toxicity in the alr1 mutant when cultured in glucose-free TSB media 138 \n(Figure 1C).   139 \nAcetate intoxication alters the intracellular D-Ala-D-Ala pools   140 \nAlr1 catalyzes the conversion of L-Ala to D-Ala during staphylococcal growth (Figure 1-figure 141 \nsupplement 1A). The D-Ala is further converted to D-Ala-D-Ala dipeptide by the ATP- dependent 142 \nDdl (Figure 1-figure supplement 1A) and incorporated into peptidoglycan (PG) muropeptide, 143 \nthus playing a crucial role in PG biosynthesis, cross-linking, and integrity (18, 19). Therefore, 144 \nwe hypothesized that under acetate stress, low concentrations of D-Ala in the alr1 mutant might 145 \nconcomitantly reduce D-Ala-D-Ala concentrations in the cell resulting in a growth defect. To test 146 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n7 \n \nthis hypothesis, we determined the intracellular pool of D-Ala-D-Ala using liquid 147 \nchromatography-tandem mass spectrometry (LC-MS/MS). In regular growth media (TSB), we 148 \nobserved that the inactivation of alr1 decreased the D-Ala-D-Ala pool by approximately 80% 149 \ncompared to the WT strain (Figure 1D). However, following acetate intoxication the level of D-150 \nAla-D-Ala was depleted by more than 99% (Figure 1D). The external supplementation of D-Ala 151 \n(5 mM) in the media fully restored the growth of the alr1 mutant to WT levels under acetic acid 152 \nstress (Figure 1E), which suggests that increased intracellular D-Ala pools can overcome the 153 \ndetrimental impact of acetate intoxication.  154 \nThe depletion of D-Ala-D-Ala following acetate intoxication is surprising since S. aureus is 155 \npredicted to have two additional pathways that can synthesize D-Ala and channel it to the 156 \nproduction of this dipeptide. For instance, S. aureus  harbors a second predicted alanine 157 \nracemase (Alr2) that could compensate for the lack of Alr1 activity (Figure 1-figure supplement 158 \n1A). Alternatively, Dat, which catalyzes the formation of D-Ala from pyruvate and D-glutamate 159 \n(D-Glu), may functionally complement the alr1 mutant under acetate stress (Figure 1-figure 160 \nsupplement 1A). However, the lack of functional complementation from these alternate 161 \npathways of D-Ala biosynthesis following acetate intoxication suggests that not all metabolic 162 \nroutes to D-Ala are operational or that regulatory bottlenecks limit pathway activity. To test 163 \nthese possibilities, we constructed a series of mutants in which all three predicted routes of D-164 \nAla biosynthesis (alr1 , alr2 and dat) were disrupted either individually or in various 165 \ncombinations and performed growth assays (Figure 1-figure supplement 1B). Surprisingly, we 166 \nobserved that the inactivation of alr1 and dat simultaneously ( alr1dat mutant) was synthetic 167 \nlethal in S. aureus, suggesting that alr1 and dat were the sole contributors of D-Ala in S. aureus. 168 \nIndeed, the supplementation of D-Ala fully restored the growth of the alr1dat mutant (Figure 1-169 \nfigure supplement 1C). 170 \nThe inactivation of alr2, either alone or in combination with other D-alanine-generating 171 \nenzymes, did not affect growth (Figure 1-figure supplement 1B). This observation suggests that 172 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n8 \n \nalr2 is unlikely to be a functional alanine racemase under the growth conditions tested. 173 \nCollectively, these results indicate that Dat activity accounts for D-Ala production in the absence 174 \nof alr1, but its contribution is insufficient to counter acetate intoxication. 175 \nInsufficient translation of dat impacts the alr1 mutant following acetate intoxication 176 \nSince Dat activity contributes to D-Ala production in the alr1 mutant, we questioned why Dat 177 \nis insufficient to sustain D-Ala-D-Ala pools under conditions of acetate intoxication. One possible 178 \nexplanation may relate to the maintenance of osmotic balance by S. aureus . It has been 179 \nproposed that the intracellular accumulation of acetate anions may bring about an efflux of L/D-180 \nGlu from cells to adjust for osmolarity, thus exhausting one of the key substrates for Dat activity 181 \nand limiting D-Ala production (7). However, this hypothesis is improbable since the expression 182 \nof dat from a multicopy vector rescued the alr1 mutant from the effects of acetate intoxication 183 \n(Figure 2-figure supplement 1A), suggesting that the intracellular D-Glu pools are sufficient to 184 \nsupport D-Ala production through Dat activity. Alternatively, we hypothesized that the alr1 185 \nmutant's heightened sensitivity to acetate toxicity could be due to a decrease in dat 186 \ntranscription which would effectively reduce intracellular D-Ala. However, we found no 187 \ndetrimental effect of acetate intoxication on dat transcription in the alr1 mutant (Figure 2-figure 188 \nsupplement 1B). Together, these observations raise the possibility that the depletion of D-Ala-D-189 \nAla in the alr1 mutant following acetate intoxication may arise from a post-transcriptional 190 \nregulatory bottleneck that limits dat from meeting the demand for intracellular D-Ala.   191 \nIn S. aureus, dat is part of a bicistronic operon (Figure 2A). The first gene, pepV, encodes 192 \nan extracellular dipeptidase (20, 21). Transcriptional start site (TSS) mapping of the pepV-dat 193 \noperon by the adaptor and radioactivity-free (ARF-TSS) method revealed a 30-nucleotide 194 \nuntranslated region (5'-UTR) extending upstream from the pepV initiation codon. The 5'-UTR 195 \nincludes a Shine-Dalgarno motif (ribosome binding site, SD1) upstream of the pepV start codon 196 \n(Figure 2A). In addition, a second SD motif (SD2) associated with dat was identified within the 197 \npepV coding region (Figu re 2A) and did not overlap with the pepV termination codon. The 198 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n9 \n \nlocation of SD2 within pepV suggests that the insufficient production of  D-Ala by dat following 199 \nacetate intoxication could be attributed to suboptimal translation of dat. This could occur as 200 \nribosomes (70S) that are moving from SD1 may interfere with the translation of dat from SD2. 201 \nTo test this hypothesis, we engineered a nonsense mutation in pepV (alr1pepVQ12STOP mutant) 202 \nthat would prevent the ribosomes originating from SD1 from moving forward (Figure 2A). 203 \nHowever, the alr1pepVQ12STOP mutant grew poorly compared to the alr1 mutant following 204 \nacetate intoxication (Figure 2B). This suggested that the translation of dat is coupled to that of 205 \npepV presumably through stable mRNA secondary structures that form within pepV. These 206 \nstructures may not be effectively resolved in the alr1pepVQ12STOP mutant due to the absence of 207 \nribosome traffic on pepV mRNA.  208 \nAs an alternative approach to determine if SD2 positioning within pepV impeded dat 209 \ntranslation, we deleted pepV along with SD1 in the alr1 mutant (alr1pepVΔSD1-467, Figure 2A). In 210 \nthe resulting strain, dat translation was under the sole control of its native SD2. Remarkably, 211 \nthe alr1pepVΔSD1-467 mutant did not display a heightened sensitivity to acetate stress and grew 212 \nidentical to the WT strain following acetate intoxication (Figure 2C). Similarly, an alr1 mutant in 213 \nwhich dat was linked to SD1 ( alr1pepV mutant, Figure 2A) also phenocopied the WT strain 214 \nfollowing acetate intoxication (Figure 2D). Notably, the observed growth differences in 215 \nalr1pepVΔSD1-467, alr1pepV and alr1pepVQ12STOP mutants following acetate intoxication did not 216 \nresult from any changes in dat transcription (Figure 2E). These findings collectively suggest 217 \nthat the native promoter elements, as well as the SD sites of pepV and dat can independently 218 \nsupport the robust expression and translation of dat to levels required for countering acetate 219 \nintoxication. However, the genetic arrangement of the dat translation initiation region (TIR) 220 \nwithin pepV offered tight control of dat translation and prevented cells from producing sufficient 221 \nenzyme following acetate intoxication. 222 \nWhy is the Dat tightly controlled? 223 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n10 \n \nThe need to tightly control Dat activity suggests that flux between D-Ala and D-Glu pools 224 \nmust be carefully balanced during staphylococcal growth. To gain insight into this process, we 225 \nprofiled the mass isotopologue distribution (MID) of D-Ala-D-Ala in the WT, alr1, and dat 226 \nmutants under isotopic steady-state conditions using 13C3\n15N1-L-Ala as the tracer during growth 227 \nexperiments in chemically defined medium (CDM). The flux of 13C3\n15N1-L-Ala through Alr1 228 \nshould result in 13C3\n15N1-D-Ala production (Figure 3A, D-Ala retains labeled nitrogen). On the 229 \nother hand, staphylococcal alanine dehydrogenases (Ald1 and Ald2) catalyze the conversion of 230 \n13C3\n15N1-L-Ala to 13C3-pyruvate and finally 13C3-D-Ala through Dat activity (Figure 3A). Thus, the 231 \nlabeled nitrogen in 13C3\n15N1-L-Ala is lost as 15N1-NH4 when fluxed through the Ald/Dat pathway 232 \n(Figure 3A). Since the intracellular pools of D-Ala are converted to D-Ala-D-Ala, the MID of the 233 \nlatter metabolite should mirror the isotopologue ratios of D-Ala produced from either Alr1 or Dat 234 \nactivities.  235 \nLC-MS/MS analysis revealed that ~ 80% of the intracellular D-Ala-D-Ala pool had 236 \nincorporated the labeled L-Ala supplemented in media (fractional contribution, 0. 80). As 237 \nexpected, the majority (~ 55%) of the D-Ala-D-Ala in the WT was composed of the C 6N2 238 \nisotopologue (in which both units of D-Ala contain labeled carbon and nitrogen), which 239 \nsuggested that alr1 was the major contributor of D-Ala in S. aureus (Figure 3B). Surprisingly, 240 \nthe sole contribution of dat activity (C6N0, C3N0, C 0N0) to D-Ala-D-Ala was less than 1% in the 241 \nWT strain and D-Ala-D-Ala isotopologues with at least one D-Ala originating from dat activity 242 \n(C6N1, C3N1, C3N2) although readily observed , were still in the minority. However, the D-Ala-D-243 \nAla originating from Dat activity expanded substantially upon alr1 mutation (Figure 3B). 244 \nInactivation of dat itself displayed few differences in the MID of D-Ala-D-Ala, compared to the 245 \nWT strain (Figure 3B). These results suggest that flux through Dat is most likely driven toward s 246 \nD-Glu in the WT strain rather than D-Ala. Only upon inactivation of alr1 does the Dat activity 247 \nreverse towards the production of D-Ala. 248 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n11 \n \nTo confirm these predictions, we measured the levels of 15N1-D-Glu in the WT, alr1, and dat 249 \nmutants following growth with the 13C3\n15N1-L-Ala tracer. Consistent with Dat activity funneling D-250 \nAla to D-Glu in the WT, approximately 78% of the D-Glu pool in the WT strain was 15N labeled. 251 \nFurthermore, we observed that inactivation of dat resulted in the complete depletion of 252 \nintracellular levels of 15N1-D-Glu (Figure 3C). Inactivation of alr1 also had a similar outcome with 253 \nloss of 15N1-D-Glu pools due to the lack of 13C3\n15N1-D-Ala in this mutant (Figure 3C). Together, 254 \nthese results strongly suggest that in the WT strain, Dat activity diverts D-Ala towards D-Glu 255 \nproduction. 256 \nGiven the critical need to produce D-Ala-D-Ala during acetate intoxication, any diversion of 257 \nits precursor pool (D-Ala) to D-Glu through Dat activity is bound to decrease cell fitness and thus 258 \nmay justify its tight translational control. To test this hypothesis, we determined the mean 259 \ncompetitive fitness (w) of cells that overexpressed dat compared to those that had native levels 260 \nof expression. Accordingly, we performed coculture competition assays of the WT strain with 261 \nan isogenic mutant strain that either harbored an empty vector (pAQ59) integrated into the 262 \nSaPI chromosomal site or a vector containing dat under control of its native promoter (pAS8), 263 \nfollowing acetate intoxicati on. Consistent with increased Dat activity in the WT strain being 264 \ndetrimental to the cell, the mean competitive fitness of the dat overexpressing strain was 265 \nsignificantly lower (w 4h= 0.91) in the exponential growth phase than its isogenic WT strain that 266 \nharbored the empty vector ( w4h= 1.26) (Figure 3D). Collectively, these results suggest that Dat 267 \ncatalyzes the production of D-Glu in the WT strain, and its tight regulation prevents excessive 268 \nflux of D-Ala to D-Glu which is necessary to maintain cell fitness following acetate intoxication. 269 \nAcetate intoxication impacts PG biosynthesis 270 \nSince acetate intoxication ultimately affects D-Ala-D-Ala pools (Figure 1D), we predicted 271 \npotential alterations to PG biosynthesis and cell wall integrity. To test this hypothesis, we 272 \nquantified various cytosolic PG intermediates in the WT strain by LC -MS/MS analysis. Acetate 273 \nintoxication caused a significant increase in the intracellular pools of multiple PG biosynthetic 274 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n12 \n \nintermediates, including Uridine diphosphate N-acetylglucosamine (UDP-NAG), UDP-N-275 \nacetylmuramic acid (UDP-NAM), UDP-NAM-L -Ala, UDP-NAM-L -Ala-D-Glu-L-Lys and UDP-276 \nNAM-L-Ala-D-Glu-L-Lys-D-Ala-D-Ala  (UDP-NAM-AEK AA) in the WT strain when compared to 277 \nthe unchallenged control (Figure 4A). However, the growth of the WT strain was slightly 278 \ninhibited by acetic acid (Figure 1B), which suggests that the observed accumulation of PG 279 \nintermediates may have been due to an imbalance between the rates of PG biosynthesis and 280 \ngrowth. Notably, the alr1 mutant showed higher levels of UDP-NAM-AEK compared to the WT 281 \nand the dat mutant following acetate intoxication (Figure 4A), indicating a metabolic block in the 282 \nproduction of UDP-NA M-AEKAA due to insufficient D-Ala-D-Ala. The effect of this metabolic 283 \nblock is also evident from the increased transcription of ddl and murF (Figure 4B) which encode 284 \nenzymes that incorporate D-Ala-D-Ala into PG precursors, suggesting a greater need to 285 \nmaintain peptidoglycan cross-linking following acetate intoxication. 286 \nUnsurprisingly, the dysregulation of D-Ala-D-Ala homeostasis following acetate intoxication 287 \nwas also reflected in the extent of cell wall cross-linking in the WT, alr1 and dat mutants. 288 \nMuropeptide analysis revealed that acetate intoxication in the WT strain increased levels of 289 \nmonomeric muropeptides (Figure 4C, Figure 4-figure supplement 1). Conversely, the 290 \npercentage of di- and trimeric muropeptides decreased relative to the WT control, as did the 291 \npercent cross-linking (Figure 4C). These observations suggest that acetate intoxication 292 \nconstrains the D-Ala-D-Ala pool in the WT strain and alters PG cross-linking despite Alr1 293 \nactivity. The extent of PG cross-linking in the dat mutant was similar to WT in the presence or 294 \nabsence of acetate, consistent with our finding that the Dat activity plays a limited role in 295 \nmaintaining the D-Ala-D-Ala pool in the WT strain (Figure 4C). In contrast, PG cross-linking in 296 \nthe alr1 mutant was lower than the WT strain by ~10% (Figure 4C). Acetate intoxication further 297 \ndecreased the cross-linking approximately 20% relative to WT as well as the ratio of dimeric to 298 \nmonomeric muropeptides in the alr1 mutant, which inevitably reduced the growth of this strain 299 \n(Figure 4C).  300 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n13 \n \nMuropeptide analysis also revealed the accumulation of a disaccharide tripeptide (NAG-301 \nNAM-AEK (M3); m/z. Da, 826.4080) in the peptidoglycan (PG) extracted from the alr1 mutant 302 \n(Figure 4-figure supplement 1B). This finding suggests that the significantly elevated levels of 303 \nUDP-NAM-AEK in the alr1 mutant could efficiently outcompete the substrate specificity of 304 \nphospho-N-acetylmuramyl pentapeptide translocase (MraY) for UDP- NAM-AEKAA, ultimately 305 \nbecoming integrated into the PG structure itself. Interestingly the incorporation of UDP-NAG-306 \nNAM-AEK into the alr1 mutant's PG only marginally increased following acetate treatment 307 \n(Figure 4-figure supplement 1B, see inset). The increase of UDP- NAG-NAM-AEK is most likely 308 \nan underestimate since cells with higher levels of incorporation are more likely to lyse due to a 309 \nreduction in PG cross-linking. Overall, these observations support a model wherein the 310 \nimmediate consequences of acetate intoxication are defects in PG crosslinking and 311 \nbiosynthesis.  312 \nAcetate intoxication inhibits Ddl activity  313 \nWhile the above observations point to the consequences of acetate intoxication of S. 314 \naureus, its molecular target was not initially identified. Since acetate intoxication dramatically 315 \nreduces D-Ala-D-Ala levels in the alr1 mutant (Figure 1D), we reasoned that acetate might 316 \ninhibit either Dat or Ddl activity. To distinguish between these two targets, we measured the 317 \nlevels of D-Ala in the alr1 mutant following acetate intoxication. Surprisingly, we observed that 318 \nthe D-Ala pools in the alr1 mutant did not significantly change in response to acetate 319 \nintoxication compared to the untreated control (Figure 5A). This suggested that Dat activity was 320 \npreserved in the alr1 mutant to the same extent as its untreated control and was not affected by 321 \nacetate. 322 \nConversely, these findings also indicate that the acetate-dependent decrease of the D-Ala-323 \nD-Ala pool in the alr1 mutant was most likely due to the inhibition of Ddl. To test this hypothesis, 324 \nwe cloned S. aureus  ddl under the control of a cadmium inducible promoter and induced its 325 \nexpression in the alr1 mutant following acetate intoxication (Figure 5B). Indeed, the growth of 326 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n14 \n \nthe alr1 mutant was restored to WT levels when ddl was overexpressed, strongly suggesting 327 \nthat Ddl was the target of acetate anion (Figure 5B).  328 \nTo confirm that acetate inhibits Ddl through direct interactions, we undertook two separate 329 \napproaches. As the first approach, 6xHis-tagged S. aureus  Ddl was purified, and in-vitro 330 \nenzyme kinetic assays were performed to determine the possible inhibitory mechanism of Ddl 331 \nby acetate. Considering the high concentration of acetate estimated to accumulate in the 332 \ncytoplasm, a concentration of 300 mM sodium acetate was used in the initial reactions to test 333 \ninhibition (Figure 5C). Interestingly, variation of acetate concentration showed that Ddl was 334 \ninhibited in vitro , and these conditions suggest an IC 50 of 400.3 ± 8 mM (Figure 5D). This 335 \nindicates significant inhibition of Ddl by acetate when the cellular concentration is near the 336 \nhypothesized 600 mM, further confirming that Ddl is a direct target of inhibition by acetate 337 \nanion. Furthermore, based on kinetic experiments performed under varying concentrations of 338 \neither ATP or D-Ala, the kcat values are shown to be distinctly different for each acetate 339 \nconcentration, which strongly suggests a mixed inhibition mechanism for acetate (Figure 5E 340 \nand F, Table S1). 341 \nDifferential Scanning Fluorometry (DSF) was used as another approach to assess the 342 \ndirect binding of acetate to Ddl (Table S2). The Ddl protein without any ligand bound shows a 343 \nmelting temperature (Tm) of 45 °C. After adding 300 mM sodium acetate, Ddl exhibited a 3.7 344 \n°C Tm shift indicating a slight thermal stabilization upon binding acetate. This is higher than the 345 \nshift in the Tm exhibited by a Ddl/ATP complex. The addition of ADP to Ddl results in a 346 \ndecrease of 3.2 °C, indicating a decrease in thermal stability compared to Ddl alone. 347 \nIntriguingly, when adding acetate to Ddl complexes with ATP or ADP, the Tm increased to 48.9 348 \n°C and 49.9 °C, respectively (Table S2). This represents a Tm increase of 2.3 °C when acetate 349 \nis added to a Ddl/ATP complex but a Tm increase of 8.1 °C when acetate is added to a 350 \nDdl/ADP complex. The addition of D-Ala to the reaction mixture increases the Tm of Ddl by 4.2 351 \n°C and adding acetate to the Ddl/ D-Ala mixture shows only a 0.3 °C Tm shift (Table S2). The 352 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n15 \n \nwidely varying changes in Tm for the tested complexes, particularly when comparing the Tm 353 \nvalues for ligand-free, ADP-bound, and the ADP/Acetate complex, further support a mixed 354 \ninhibition mechanism as these data suggest acetate may bind to multiple sites on Ddl or the 355 \nlocation of these binding sites may change depending on the ligand-bound state of the enzyme 356 \ndue to Ddl conformational changes as observed in Ddl orthologs (22).  357 \nDdl/Acetate complex structure shows binding of acetate at both substrate binding sites 358 \nTo gain further insight into the mechanism of acetate inhibition, the X-ray crystal structure of 359 \na Ddl/acetate complex was obtained using co-crystals of Ddl and acetate. The crystal diffracted 360 \nto 1.9 Å and data were consistent with a P 2 2 1 21 space group possessing one molecule of Ddl 361 \nin the asymmetric unit (Table S3). The crystal structure of the Ddl/acetate complex (PDB:8FFF) 362 \nshows difference density corresponding to acetate at two different sites of the protein. One 363 \nacetate is positioned within the adenine binding subsite of the ATP binding site and the other 364 \nacetate ion is positioned in the second D-Ala binding site (Figure 5G). The acetate ion in the 365 \nATP binding site interacts with the side chain of Lys177 and the backbone nitrogen of Val216. 366 \nAlso, the methyl group of acetate forms van der Waals interactions with the side chain of 367 \nLeu145 (Figure 5H). The acetate ion that binds to the D-Ala binding site forms a bidentate polar 368 \ninteraction with the side chain of Arg291 and a hydrogen-bonded interaction with the backbone 369 \nnitrogen of Gly312 (Figure 5I). These two residues are conserved in Ddl homologs and 370 \nprevious structural data clearly illustrate the crucial role these residues play in D-Ala binding 371 \n(22).  372 \nThe acetate-bound structure shows conformational differences compared to the previously 373 \npublished ligand-free  and ADP-bound structures (22). The 𝛚 loop, which is associated with 374 \nsubstrate binding, is disordered in both the S. aureus Ddl ligand-free  (PDB:2I87) and the Ddl-375 \nADP complex structures (PDB:2I8C) as well as other available Ddl crystal structures that lack 376 \nbound substrates or ligands (PDB:3K3P, 5DMX and 6U1C) (23-25) . Interestingly, this loop is 377 \nwell ordered in the acetate-bound structure described here (Figure 5J), which gives the first 378 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n16 \n \nview of the S. aureus Ddl 𝛚 loop and the interactions it may form with substrates or inhibitors. 379 \nThe structural stabilization of the 𝛚 loop is consistent with the DSF results exhibiting an 380 \nincrease in the melting temperature upon binding acetate. The 𝛚 loop is shifted towards the 381 \nATP binding site and repositions the conserved Tyr246 side chain within the ATP binding site, 382 \nwhich likely hinders the binding of ATP (Figure 5J). This positioning is comparable with the 383 \nMycobacterium tuberculosis Ddl (PDB:3LWB) ligand-free structure, which also takes a closed 384 \nconformation showing the 𝛚 loop positioned within the ATP binding site and obstructing ATP 385 \nbinding (26). Taken together, the kinetic, DSF, and structural data suggest that while acetate 386 \ncan directly bind within both substrate binding pockets of Ddl, it also stimulates conformational 387 \nchanges in the dynamic 𝛚 loop to afford more allosteric-like effects on enzyme activity. Each of 388 \nthese observations support a mixed inhibition modality. 389 \nMultiple organic acids inhibit the alr1 mutant in a D-Ala-dependent manner 390 \nFinally, we determined whether the growth inhibition of the alr1 mutant is unique to acetate 391 \nanion or is a more general phenomenon mirrored by addition of other small organic acids. 392 \nAccordingly, we initially performed molecular docking studies of three biologically relevant 393 \norganic anions: lactate, propionate and itaconate, in both the ATP and D-Ala binding pockets of 394 \nDdl (Figure 6A-D). The acetate anion-bound structure of Ddl was used as a reference for 395 \nanalysis. The docking results suggest reasonable poses for lactate, propionate and itaconate 396 \nwithin the ATP binding site forming polar interactions with Ddl residues conserved for binding 397 \nATP. Upon docking, the carboxylate moieties of both lactate and propionate form ionic 398 \ninteractions with the Lys177 side chain similar to those observed in the Ddl/acetate crystal 399 \nstructure (Figure 6A and B). Also, the side chain of Glu213 in Ddl forms a hydrogen bonded 400 \ninteraction with the hydroxyl of lactate (Figure 6A) and van der Waals interactions between 401 \npropionate and nearby side chains of Phe175 and Phe295 (Figure 6B) were indicated. The two 402 \ncarboxylate groups of itaconate form hydrogen bonded interactions with backbone amide 403 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n17 \n \nnitrogen atoms of Ala218 and Tyr246 as well as a van der Waals interaction with the nearby 404 \nside chain of Phe175 (Figure 6C). 405 \nThe molecular docking results for lactate, propionate, and itaconate in the D-Ala binding site 406 \nof Ddl also show similar types of interactions but with variable poses and slight orientation 407 \ndifferences compared to that observed for acetate in the crystal structure (Figure 6D). The D-408 \nAla binding site, consisting of primar ily charged and polar atoms, allows for a range of binding 409 \nmodes for these small anions, where the ligand size is a stronger factor in determining the 410 \nbinding location. Acetate and propionate, being smaller and less sterically hindered, bind 411 \npreferentially near the Arg 291 side chain that coordinates the acid moiety of D-ala during the 412 \nenzymatic reaction (Figure 6D). Meanwhile, itaconate and L-lactate bind in the more spacious 413 \nregion between Lys251 and Ser317 (Figure 6D). The Glide scores from the docking results, 414 \nwhich provide a rough estimate of the G of binding for each ligand suggest modest affinity to 415 \nthe identified binding sites (Table S4). 416 \nTo determine if these organic acids could impact Ddl function, the WT and the alr1 mutant 417 \nwere challenged with lactic, propionic and itaconic acids (Figure 6E-G). All three organic acids 418 \ninhibited the growth of the alr1 mutant. The addition of D-Ala to the culture media rescued the 419 \ngrowth of the alr1 mutant to WT levels (Figure 6E-G) consistent with Ddl being the target of 420 \nlactate, propionate and itaconate. Moreover, overexpression of ddl in the alr1 mutant also 421 \nrestored growth of the alr1 mutant following the organic acid challenge (Figure 6-figure 422 \nsupplement 1A-C). These findings collectively suggest that various organic acid anions can 423 \ninhibit Ddl activity in S. aureus. 424 \nDiscussion 425 \nIntracellular anion accumulation has long been hypothesized to drive weak organic acid 426 \ntoxicity in bacteria (16, 27, 28). However, few studies have investigated the mechanism by 427 \nwhich weak acid anions inhibit bacterial growth. Acetic acid is particularly interesting among 428 \nweak acids, given that it is a common byproduct of glucose catabolism in bacteria and is 429 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n18 \n \nexcreted in high concentrations (29). S. aureus does not catabolize acetate as a carbon source 430 \nunless glucose is first exhausted from the environment (30). This results in the intracellular 431 \naccumulation of acetate in S. aureus as a function of the bacterial transmembrane pH gradient, 432 \nespecially when acetic acid concentrations are high in the immediate vicinity of cells. Here we 433 \ndetermine that at high intracellular concentrations, acetate anions directly bind Ddl and inhibit 434 \nD-Ala-D-Ala production to adversely impact peptidoglycan cross-linking (Figure 7). However, S. 435 \naureus exhibits a remarkable tolerance to acetate intoxication due to the robust production of D-436 \nAla by Alr1, which ultimately increases D-Ala-D-Ala pools (Figure 7). 437 \nMultiple lines of evidence demonstrate Ddl to be the target of acetate anions. First, LC-438 \nMS/MS analysis revealed that acetate intoxication decreased D-Ala-D-Ala pools but not D-Ala in 439 \nS. aureus, pointing to Ddl as the target of acetate. Second, DSF and in-vitro enzyme kinetic 440 \nstudies showed that acetate could bind and inhibit purified rDdl through a mixed inhibition 441 \nmechanism. Third, structural analysis of the Ddl-inhibitor complex confirmed that acetate binds 442 \nto both the ATP-binding  and D-Ala binding sites within Ddl and further induced conformational 443 \nchanges to the dynamic 𝛚 loop, which weakens the binding of ATP to the Ddl active site. 444 \nFinally, overexpression of ddl alone was sufficient to overcome acetate-mediated inhibition of 445 \nthe alr1 mutant and restore growth to WT levels.  446 \nInhibitors that bind an enzyme's catalytic substrate binding sites are usually competed out 447 \nby high concentrations of substrates. However, acetate inhibits Ddl through a mixed inhibition 448 \nmechanism despite binding to the substrate binding pockets of Ddl. We suspect this is due to 449 \nadditional conformational changes observed in the dynamic 𝛚 loop that affords more allosteric-450 \nlike effects on enzyme activity. However, we cannot rule out that acetate might bind to 451 \nadditional sites in the Ddl-ATP complex, Ddl-ADP complex, or a Ddl-ADP-phospho-D-Ala 452 \ncomplex with varying affinities. The differences in the temperature shifts observed in DSF with 453 \nvarious substrate complexes support th is possibility. The crystal structures of Ddl/acetate 454 \ncomplexes with different substrates could provide a more precise conclusion about the 455 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n19 \n \ninhibitory modality of Ddl by acetate . In line with acetate's inhibitory effect on Ddl, we observed 456 \nthat acetate intoxication in the alr1 mutant led to a disproportionate increase in the cytosolic 457 \npool of PG tripeptide intermediate (UDP- NAM-AEK) compared to the pentapeptide form (UDP-458 \nNAM-AEKAA). Previous reports have suggested that MraY might facilitate the integration of 459 \nUDP-NAM-tripeptide into S. aureus PG, especially when its concentration within cells exceeds 460 \nthat of UDP-NAM -pentapeptide (31, 32). Our findings strongly support this hypothesis, as the 461 \nanalysis of the alr1 mutant's cell wall muropeptides revealed a clear elevation in the level of the 462 \ndisaccharide-tripeptide NAG-NAM-AEK. The inhibition of Ddl by acetate would further reduce 463 \nthe presence of terminal D-Ala-D-Ala moieties within alr1 muropeptides which likely leaves 464 \nthese cells incapable of withstanding the outward-directed cell turgor pressure, ultimately 465 \nleading to cell death (32).   466 \nDespite acetate inhibiting Ddl through a mixed inhibition mechanism, it should be noted that 467 \na functional Alr1 or even the supplementation of D-Ala in culture media can provide significant 468 \ntolerance against acetate intoxication in S. aureus. These observations suggest that Ddl is only 469 \nweakly inhibited by acetate, which is also evident from the relatively high IC 50 of approximately 470 \n400 mM observed in our kinetic experiments with S. aureus  Ddl. The weak inhibition of Ddl 471 \nwould suggest that inflating the cytosolic D-Ala pools could promote sufficient generation of D-472 \nAla-D-Ala to counter acetate intoxication. Indeed, it has been estimated that S. aureus  473 \nmaintains a high concentration of roughly 30 mM intracellular D-Ala (33), which we now 474 \ndemonstrate to be critical in countering acetate intoxication.  475 \nThe existence of pepV and dat within the same operon suggests that these genes may 476 \nhave evolved related functions. In Lactococcus lactis the PepV dipeptidase activity was shown 477 \nto be important for supplying cells with L-Ala which was eventually incorporated into PG (34). In 478 \nthis context, pepV and dat may have a similar role in modulating the intracellular alanine pool. 479 \nA surprising finding of our study was that dat expression is relatively stable and tightly 480 \ncontrolled in S. aur eus due to its SD motif being located within the coding region of pepV. 481 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n20 \n \nFurthermore, such a genetic arrangement has been linked to translational coupling (35), 482 \nwherein active translation from the first gene promotes the translation of the following gene in 483 \nthe operon, which in the case of dat was not sufficient to overcome acetate toxicity in the alr1 484 \nmutant. Two central mechanisms of translational coupling have been proposed. The first 485 \ninvolves secondary and tertiary mRNA structures that either occlude or encompass the SD 486 \nmotif of downstream genes and shield it from ribosomes, thus preventing its translation (36). 487 \nThese mRNA structures can be relieved when a ribosome initiates translation from the first 488 \ngene of the operon and exposes the downstream intragenic SD sequences to new 30S 489 \nribosomal subunits (34). In the second mechanism, continued translation of the first gene of the 490 \noperon is necessary to increase the abundance of ribosomes in the TIR of the second gene 491 \nresulting in its enhanced translation (35). Irrespective of the mechanism of translational 492 \ncoupling, our results suggest that genetic arrangements that promote translational coupling 493 \nmight also limit the overall production of dat and thus prevent it from functionally 494 \ncomplementing the alr1 mutant following acetate intoxication. Since our data suggest that Dat 495 \nprimarily promotes flux from D-Ala to D-Glu when Alr1 is active, the tight control of dat through 496 \ntranslational coupling could prevent the depletion of the intracellular reserves of D-Ala 497 \nnecessary to overcome Ddl inhibition during acetate intoxicat ion. Thus. the elevated D-Ala pool 498 \nmaintained within the cell could represent a strategic adaptation by S. aureus to combat Ddl 499 \ninhibition caused by organic acids typically present in the niches colonized by this bacterium. 500 \nIn conclusion, our findings demonstrate that Ddl is the primary target of acetate anion 501 \nintoxication in S. aureus . However, other biologically relevant organic anions like lactate, 502 \npropionate and itaconate could also inhibit the alr1 mutant similar to acetate. Furthermore, the 503 \ngrowth inhibition of the alr1 mutant by these organic acids could be rescued following D-Ala 504 \nsupplementation, which suggests that Ddl is a bona fide  and conserved target of various 505 \norganic acid anions. Indeed, it is tempting to speculate that the robust Alr1 activity leading to 506 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n21 \n \nthe accumulation of millimolar levels of D-Ala may have evolved in part to offset the inhibition of 507 \nDdl from the toxic effects of organic anions.   508 \nAcknowledgments   509 \nThis work was funded by NIH/NIAID R01AI125588 and 2P01A1083211 Metabolomics Core to 510 \nVCT, 2P 01AI083211 Project 4 to TK, respectively. This work was also supported in part by 511 \nNIH/NIAID R21AI151924 to DRR. X -ray diffraction data were collected at the Life Sciences 512 \nCollaborative Access Team beamline 21 -ID-F at the Advanced Photon Source, Argonne 513 \nNational Laboratory, which is a U.S. Department of Energy (DOE) Office of Science User 514 \nFacility operated for the DOE Office of Science by Argonne National Laboratory under Contract 515 \nNo. DE -AC02-06CH11357. Use of the LS -CAT Sector 21 was supported by the Michig an 516 \nEconomic Development Corporation and the Michigan Technology Tri -Corridor (Grant 517 \n085P1000817). The University of Nebraska Medical Center Mass Spectrometry and 518 \nProteomics Core Facility is administrated through the Office of the Vice Chancellor for 519 \nResearch and supported by state funds from the Nebraska Research Initiative (NRI).  Research 520 \nin the Cava lab is supported by the Swedish Research Council, the Laboratory for Molecular 521 \nInfection Medicine Sweden (MIMS), Umeå University, the Knut and Alice Wallenber g 522 \nFoundation (KAW) and the Kempe Foundation. The funders had no role in the study design, 523 \ndata collection, interpretation, and decision to submit this work for publication. The authors 524 \nhave no conflict of interest to declare.  525 \nData Availability  526 \nThe atomic coordinates and structure factors have been deposited in the Protein Data Bank, 527 \naccessible at www.pdb.org, with the PDB ID code 8FFF. 528 \nMaterials and Methods 529 \nBacterial strains and growth conditions 530 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n22 \n \nThe S. aureus  WT and mutant strains described in this study were cultured in TSB 531 \ncontaining 14 mM glucose. S. aureus  JE2 mutants were mainly obtained from the Nebraska 532 \nTransposon Mutant Library (37). These mutants were re-transduced into the WT strain using 533 \nФ11- bacteriophage to eliminate any off-target effects . To generate double or triple mutants, 534 \nthe Erm R antibiotic cassette in the transposon mutants w as exchanged with Kan R or Tet R 535 \ncassettes by allelic exchange before introducing an additional mutation. The allelic exchange 536 \nwas performed as described previously (38) . In -frame gene deletion mutants were created 537 \nusing a temperature-sensitive vector, pJB38, as described previously (38) . S. aureus mutants 538 \nwere complemented by inserting the WT allele of mutated genes under the control of their 539 \nnative promoter into the SaPI1 chromosomal site using the pJC1111 suicide vector (39) . For 540 \nexperiments involving the over-expression of ddl in S. aureus , ddl was cloned into a CdCl 2 541 \ninducible multicopy vector, pJB68  (38). The concentration of CdCl 2 was titrated to achieve full 542 \ngrowth complementation. All bacterial isolates, plasmids, and primers used in this study are 543 \nlisted in Table S5, S6, and S7, respectively.  544 \nNebraska Transposon Mutant Library (NTML) screen  545 \nThe NTML mutants were grown in 96-well plates in the presence and absence of 20 mM 546 \nacetic acid (pH~6.1) in TSB for 24 hours at 37 ºC. The growth of bacteria was determined by 547 \nmeasuring the optical density at 600 nm (OD 600) after 24 hours using a TECAN Infinite 200 548 \nspectrophotometer. To account for well-to -well variances that accompany 96-well cultures, the 549 \nWT strain was independently grown in all the wells of a 96-well plate, both in the presence and 550 \nabsence of acetic acid. Area under the curve (AUC) values for each mutant under a particular 551 \ncondition were obtained by normalizing the values to WT AUC. The graph was generated by 552 \nplotting the normalized AUC of a mutant under acetate stress versus the control (g rowth without 553 \nacetate).  554 \nCompetitive fitness assay  555 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n23 \n \nThe cultures of WT ( S. aureus JE2) and isogenic mutant strain with either pAQ59 (empty 556 \nvector) or pAS8 (containing dat gene under control of its native promoter) inserted at the SaPI1 557 \nchromosomal site were used to assess competitive fitness. Following the growth of these 558 \ncultures for 24 h, 10 7 colony forming units (cfu) per milliliter of each strain were used to 559 \nmeasure the competitive fitness in presence of 20 mM acetate. The bacterial cfu were 560 \nenumerated on TSA plates with or without 0.1 mM cadmium chloride immediately after initiation 561 \nof competition and at 4 h between tested strains allowing the bacteria to undergo approximately 562 \nseven replications to reach 10 9 cfu/ ml . The competitive fitness was calculated using the 563 \nMalthusian parameter for competitors using the following formula: w = ln (M f/Mi)/ln (W f/Wi), 564 \nwhere f and i represent cfu counts at final (4 h) and initial (time 0) of competition assay, 565 \nrespectively (11). M and W refer to mutant and WT, respectively.  566 \nSample collection for mass-spectrometry analysis  567 \nOvernight cultures of WT, alr1 and dat mutants were inoculated to an OD 600 of 0.06 units 568 \ninto 250 ml flasks containing 25ml of TSB 14 mM glucose. Acetic acid (20 mM) was added to 569 \nthe flasks whenever necessary. The flasks were incubated in a shaker incubator at 37 ºC and 570 \n250 rpm. A total of 10 OD 600 units of cells were collected following 3 hours of incubation by 571 \ncentrifuging the cultures at 10,000 rpm at 4 ºC. The pellet was then washed once with ice-cold 572 \nsaline (0.85% NaCl) and centrifuged again at 10,000 rpm at 4 ºC. The bacterial cells were then 573 \nresuspended in ice cold quenching solution consisting of 60% ethanol, 2 µM Br-ATP and 2 µM 574 \nribitol. The cytosolic metabolites were obtained by bead beating the cells, followed by 575 \ncentrifugation. The supernatant was collected and stored at -80 ºC until further use. For stable 576 \nisotope experiments, overnight cultures were inoculated into a chemically defined medium 577 \n(CDM, (40)) containing 13C3\n15N1-L-Ala (100 mg/ L) in place of L-Ala and the samples were 578 \ncollected in the exponential phase following 4 hours of incubation at 37 ºC.  579 \nChromatography for mass-spectrometry analysis 580 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n24 \n \nThe chromatographic separation of PG intermediates was performed by liquid 581 \nchromatography using XBridge Amide (150 × 2.1 mm ID; 1. 7 µm particle size, Waters, USA) 582 \nanalytical column; whereas D-Ala-D-Ala was analysed using XBridge Amide (10 0 × 2.1 mm ID; 583 \n1.7 µm particle size, Waters, USA). A guard XBridge Amide column (20 × 2.1 mm ID; 1.7µm 584 \nparticle size, Waters, USA) was connected in front of the analytical column. Mobile phase A 585 \nwas composed of 10 mM ammonium acetate, 10 mM ammonium hydroxide containing 5 % 586 \nacetonitrile in LC-MS grade water; mobile phase B was 100% LC-MS grade acetonitrile. The 587 \ncolumn was maintained at 35 °C and the autosampler temperature was maintained at 5 °C. The 588 \ngradient was started with the A/B solvent ratio at 15/85 for over 1 minute, followed by a gradual 589 \nincrease of A. A was reduced to 15% after separation and elution of all the interested 590 \ncompounds and equilibrated for 6.0 minutes before the next run. The needle was washed with 1 591 \nmL of strong wash solvent containing 100% acetonitrile followed by 1 mL of weak wash solvent 592 \ncomprised of 10% aqueous methanol after each injection. The sample injection volume was 5µl.  593 \nChiral separation of D- and L-isomers of alanine and glutamate was achieved on Astec 594 \nCHIROBIOTIC® T column (150 x 2.1 mm, 5 µm particle size) from Supelco. Mobile phase A 595 \nwas 20 mM ammonium acetate and mobile phase B was 100% ethanol. The mobile phase 596 \ncomposition was 40:60 v/v of A:B in isocratic elution mode pumped at 100 L/min flow rate. The 597 \ninjection volume was 5 L and the column was maintained at room temperature. Multiple 598 \nreaction monitoring (MRM) for D- and L- isomers of alanine are listed in Table S8. All other MS 599 \nparameters are discussed in the LC-MS/MS analysis section. The L-enantiomer of alanine and 600 \nglutamate elutes faster than their D-counterparts. The total run time was 15 minutes.  601 \nTargeted LC-MS/MS analysis 602 \nTriple-quadrupole-ion trap hybrid mass spectrometer viz., QTRAP 6500+ (Sciex, USA) 603 \nconnected with Waters UPLC was used for targeted analysis. The QTRAP 6500+ was operated 604 \nin polarity switching mode for targeted quantitation of amino acids through the Multiple Reaction 605 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n25 \n \nMonitoring (MRM) process. LC-MS MRM data for each metabolite w as acquired in centroid 606 \nmode as a default setting. MRM details for each analyte are listed in Table S8. The optimized 607 \nelectrospray ionization (ESI) parameters were as follows: electrospray ion voltage of -4200 V 608 \nand 5500 V in negative and positive mode, respectively, source temperature of 500 °C, curtain 609 \ngas of 40, and gas 1 and 2 of 40 and 40 psi, respectively. Compound-specific parameters were 610 \noptimized for each compound using manual tuning. These parameters include a declustering 611 \npotential (DP) of 65 V and -60 V in positive and negative mode, respectively, entrance potential 612 \n(EP) of 10 V and -10 V in positive and negative mode, respectively, and collision cell exi t 613 \npotential (CXP) maintained at 10 V and -10 V in positive and negative mode respectively. Other 614 \ncompound-specific parameters, such as Q1, Q3, and collision energies, are listed in Table S8. 615 \nMRM conditions for PG intermediates were adopted from Vemula et al (41). 616 \nHigh Resolution Mass Spectrometry 617 \nHRMS Orbitrap (Exploris 480) operated in polarity switching mode was used for the untargeted 618 \nanalysis of isotopologues of D-Ala-D-Ala and D-Glu in data-dependent MS/MS acquisition mode 619 \n(DDA). Electrospray ionization (ESI) parameters were optimized are as follows: electrospray 620 \nion voltage of -2700V  and 3500V in negative and positive mode respectively , Ion transfer tube 621 \ntemperature was maintained at 350°C, m/z scan range was 140-180 Da for non-chiral LC-622 \nmethod using Amide column whereas, it was 80-160 Da for chiral column method. Sheath gas, 623 \nauxiliary gas and sweep gas were optimized according to the UHPLC flow rate. Orbitrap 624 \nresolution for precursor ion as well as for fragment ion scan was maintained at 240000 and 625 \n60000 respectively. Normalized collision energies at 30, 50 and 150% were used for the 626 \nfragmentation. Data was acquired in profile mode. Xcaliber software from Thermo was used for 627 \ninstrument control and data acquisition. This software was equipped with Qual-, Quant- and 628 \nFreeStyle browsers which were used for profiling metabolites and their isotopologues in all 629 \nsamples. Selected precursor ion for each isotopologue is listed in Table S9. Identification and 630 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n26 \n \ndetection of all metabolites was aided by the Compound Discoverer (CD) software procured 631 \nfrom Thermo USA. The KEGG and HMDB databases plugged-in with CD software were used 632 \nfor metabolite identifications and annotations . Mass accuracy for all the ions was maintained at 633 \nor below 5 ppm. To correct for natural abundance, we utilized FluxFix, an open-source online 634 \nsoftware (42), and independently verified these calculations using the ChemCalc software (43). 635 \nFractional contribution of D-Ala-D-Ala from imported 13C3\n15N1-L-Ala 636 \nAn estimate of the fractional contribution (FC) of labeled carbon from 13C3\n15N1-L-Ala tracer 637 \nincorporated in to the intracellular D-Ala-D-Ala pool was calculated using equation 1, as 638 \npreviously described (44). 639 \n 𝐹𝐶 =\n∑ 𝑖.𝑚 𝑖 𝑛\n𝑖=0\n𝑛.∑ 𝑚 𝑖 𝑛\n𝑖=0\n  eq. 1  640 \nwhere, n is the number of carbon atoms in D-Ala-D-Ala, i represents the various carbon 641 \nisotopologues of D-Ala-D-Ala and m the abundance of the D-Ala-D-Ala isotopologues.  642 \nTranscription site identification of the dat operon 643 \nThe adaptor- and radiation-free transcription start site (ARF-TSS) identification method was 644 \nemployed to identify the 5 ՚-UTR region of the dat operon (45). In brief, 1 ug of RNA isolated 645 \nfrom JE2 WT was subjected to reverse transcription by using 5 ՚-phosphorylated primer 646 \npepV_TSS_R1 and the first strand cDNA synthesis kit (Invitrogen, Superscript III First-Strand 647 \nSynthesis System). RNA was degraded by using 1M NaOH at 65 ºC for 30 min and then 648 \nneutralized with 1M HCl. The resultant cDNA was ligated by using T4 RNA Ligase I (Thermo 649 \nScientific) to generate a circular cDNA. Two inverse primers: pepV_TSS_R2 and 650 \npepV_TSS_F3 were used to amplify the circular cDNA. The amplified product was cloned into a 651 \nTOPO Cloning vector and then sequenced using M13F(-20) and M13R primers. All the primers 652 \nused in this procedure are mentioned in Table S7. 653 \nQuantitative real-time PCR 654 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n27 \n \nQuantitative real-time PCR was performed to estimate the transcript levels of dat, ddl and 655 \nmurI in the presence and absence of acetate. The samples were collected during the 656 \nexponential growth phase and RNA was isolated using a Qiagen RNA isolation kit following the 657 \nmanufacturer's protocol. A total of 500 ng of RNA was used to synthesize cDNA using the 658 \nQuantiTech reverse transcription kit (Qiagen). The cDNA samples were then diluted 1:10 and 659 \nused as a template to perform RT-qPCR. The RT-qPCR was carried out using SYBR green 660 \nmaster mix (Roche Applied Science) in a QuantiFast light cycler (Applied Biosystems). The 661 \nrelative transcript levels were estimated by using the comparative threshold cycle method 662 \n(ΔΔCT) and sigA was used as the internal control for normalization. Primers used to perform 663 \nRT-qPCR are listed in Table S7.  664 \nMuropeptide analysis   665 \nThe WT and isogenic mutants were inoculated to an OD 600 of 0.06 into 1-liter flasks 666 \ncontaining 100 mL of TSB 14 mM glucose. Acetic acid (20 mM) was added to the media when 667 \nappropriate. A total of 95 OD 600 units of cells were collected following 6 hours of growth at 37 668 \nºC, 250 rpm. The pelleted cells were then resuspended in 50 % SDS and boiled for 3 hours. 669 \nOnce boiled, cell wall material was pelleted by ultracentrifugation and washed with water. 670 \nClean sacculi was digested with muramidase (100 µg/ml) and soluble muropeptides reduced 671 \nusing 0.5 M sodium borate pH 9.5 and 10 mg/mL sodium borohydride. The pH of the samples 672 \nwas then adjusted to 3.5 with phosphoric acid. UPLC analyses was performed on a Waters-673 \nUPLC system equipped with an ACQUITY UPLC BEH C18 Column, 130 Å, 1.7 µm, 2.1 mm × 674 \n150 mm (Waters Corporation, USA) and identified at Abs. 204 nm. Muropeptides were 675 \nseparated using a linear gradient from buffer A (0.1 % formic acid in water) to buffer B (0.1 % 676 \nformic acid in acetonitrile). Identification of individual peaks was assigned by comparison of the 677 \nretention times and profiles to validated chromatograms (46-48) . The identity of peak belonging 678 \nto disaccharide tripeptide , NAG-NAM-AEK (M3) was assigned by mass spectrometry using 679 \nUPLC system coupled to a Xevo G2/XS Q-TOF mass spectrometer (Waters Corp.). Data 680 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n28 \n \nacquisition and processing were performed using UNIFI software package (Waters Corp.). The 681 \nrelative amount of each muropeptide was calculated relative to the total area of the 682 \nchromatogram. Representative chromatograms for each sample type are depicted in (Figure 4-683 \nfigure supplement 1). The abundance of PG (total PG) was assessed by normalizing the total 684 \narea of the chromatogram to the OD 600. The degree of cross-linking refers to the number of 685 \npeptide bridges and was calculated as % of dimers + % of trimers x 2 + % of tetramers x 3 (49).  686 \nProtein purification  687 \nThe coding region of ddl was cloned into pET28a vector to generate a C-terminal 6 His tag 688 \nfusion protein before being transferred into E. coli BL21(DE3). The cells were grown in Luria 689 \nBroth Media (Research Product Internationals) containing 50 µg/mL Kanamycin (Gold 690 \nBiotechnology) at 37 °C. When OD 600 reached 0.6, 1 mM IPTG (Gold Biotechnology) was 691 \nadded to induce the protein expression. The cells were harvested by centrifugation (3724 g) 692 \nafter inducing them at 16 °C for 20 h. The harvested cells were resuspended in lysis buffer 693 \ncomprising 25 mM Tris pH 7.5, 150 mM NaCl, and 5 mM 2-Mercaptoethanol. The cells were 694 \nlysed by adding Lysozyme ( MP-Biomedicals) and DNase I (Roche Applied Sciences) and 695 \nincubating them on ice for 30 minutes. Then cells were subjected to sonication (Sonicator 696 \n3000, Misonix) to further lyse the cells. The crude cell lysate was refined by centrifuging at 697 \n18514 g for 40 min (Fixed angle rotor, 5810-R Centrifuge, Eppendorf). The clarified lysate was 698 \napplied to a 5 mL HisTrap™TALON™ crude cobalt column (Cytiva) aft er equilibrating the 699 \ncolumn with lysis buffer. The column was washed using the same buffer and the protein was 700 \neluted isocratically using 150 mM imidazole-containing buffer. The purified protein was dialyzed 701 \nin 20 mM Tris pH 8.0 buffer and 0.5 mM Tris (2-carboxyethyl) phosphine to use in 702 \ncrystallization experiments and biochemical assays.  703 \nCrystallization of Ddl and data collection 704 \nThe crystals of Ddl in complex with acetate were obtained by co-crystallization experiments 705 \nusing the hanging drop vapor diffusion method. The 10 mg/mL of protein was incubated with 30 706 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n29 \n \nmM potassium acetate, 5 mM magnesium chloride hexahydrate, and 1 mM ADP for 20 min 707 \nbefore the crystallization experiments. The co-crystals were achieved in crystallization drop 708 \nagainst a well solution consisting of 0.2 M sodium thiocyanate and 20 % polyethylene glycol 709 \nmonomethyl ether 2000. The crystals were flash cooled in liquid nitrogen immediately after 710 \nadding 40% polyethylene glycol 3350 to the crystallization drop for cryoprotection. The data 711 \nwere collected at the Advance Photon Source Argonne National Laboratory (APS-ANL, IL), LS-712 \nCAT ID-F beamline.  713 \nDdl enzyme kinetic assays 714 \nThe Invitrogen™  EnzChek™ Phosphate Assay Kit was used to detect the release of 715 \ninorganic phosphate by continuously monitoring the absorbance at 360 nm. The reaction 716 \ncomponents were added as specified by the kit with 200 nm Ddl (containing 1mM MgCl 2), 100 717 \nmM Potassium chloride, and ATP. The reaction mixture was incubated for 10 min and D-Ala 718 \nsubstrate was added to initiate the reaction. The inhibition of Ddl by acetate was determined 719 \nusing various concentrations of sodium acetate, D-Ala, and ATP to determine kinetic 720 \nparameters. 721 \nData processing and refinement 722 \nThe data was processed by CCP4 software (50) and S. aureus  D-alanyl D-alanine ligase 723 \napoprotein (PDB:2I87) was used for the molecular replacement followed by a rigid body 724 \nrefinement using PHENIX (51). Manual model refinement was performed using Coot (52). The 725 \nXYZ coordinate, B-factor, occupancy, and real space refinements were executed using 726 \nPHENIX between manual model refinements. The acetate was modeled using eLBOW and 727 \npositioned at the corresponding difference density. The structure was refined using PHENIX 728 \nand validated using Molprobity (53). 729 \nMolecular Docking Experiments 730 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n30 \n \n      The docking experiments of small organic acids were performed with the acetate-bound Ddl 731 \nstructure (PDB:8FFF) with acetate removed. The protein structure was first prepared with the 732 \nprotein preparation wizard. The lactate, propionate and itaconate ligands were prepared by 733 \nLigPrep. The docking experiments were performed using Schrödinger Glide (New York, NY).  734 \nDifferential Scanning Fluorometry 735 \nThe reaction mixture was prepared using 22 µM Ddl, 5 mM magnesium chloride, 100 mM 736 \npotassium chloride, 1 mM ADP, 300 mM potassium acetate, and 20 mM Tris pH 7.5 buffer as 737 \nrequired. The SyPro orange dye was added to a final concentration of 1 X Protein Thermal 738 \nShift™ Dye (Thermofisher) in the reaction mixture. The reactions were performed in triplicate. 739 \nThe samples were centrifuged in MicroAmp™ Optical 96 -Well Reaction Plate (Applied 740 \nBiosystems) at 2325 g for 10 minutes. The protein denaturation was monitored by obtaining the 741 \nfluorescence signal by increasing the temperature from 22 °C - 95 °C at 0.5 °C/minute rate 742 \nusing QuantStudio 3 real-time PCR (ThermoFisher). The melting temperature (Tm) was 743 \ndetermined by calculating the derivative of the fluorescent signal and identifying the centroid of 744 \nthe observed melting peak.   745 \n 746 \n 747 \n 748 \n 749 \n 750 \n 751 \n 752 \n 753 \n 754 \n 755 \n 756 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n31 \n \n 757 \n 758 \n 759 \n 760 \n 761 \n 762 \n 763 \n 764 \n 765 \n 766 \n 767 \n  768 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n32 \n \nFigures 769 \n 770 \n 771 \n 772 \nFigure 1. Alanine racemase activity counters acetate intoxication  (A) The Nebraska 773 \nTransposon Mutant library was screen against 20 mM acetic acid, pH 6.0 to identify mutants 774 \nwith altered growth phenotypes. The WT strain and transposon mutants were grown for 24 h in 775 \nTSB ± 20 mM acetic acid. The bacterial growth at 24 h was measured spectrophotometrically 776 \n(OD600) and normalized to WT growth. The X and Y-axis on the plot represent normalized 777 \ngrowth values for each mutant in the presence or absence of acetate. (B) The growth of the WT, 778 \nalr1 mutant, and alr1 complemented strain in TSB supplemented with 20 mM acetic acid. (C) 779 \nAerobic growth of WT, alr1, citZ, citZalr1 mutants in TSB media lacking glucose but 780 \nsupplemented with 20 mM acetic acid. (D) LC-MS/MS analysis was performed to quantify the 781 \nintracellular D-Ala-D-Ala pool in strains cultured for 3 h (exponential phase) in TSB ± 20 mM 782 \nacetic acid. (E) The growth of strains was monitored following D-Ala supplementation (5 mM) in 783 \nTSB + 20 mM acetate, (n=3, mean ± SD). Ac, acetate. 784 \n 785 \n 786 \n 787 \n 788 \n 789 \n 790 \n 791 \n 792 \n 793 \n 794 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n33 \n \n 795 \n 796 \nFigure 1-figure supplement 1.   Alr1 and Dat are the primary routes of D-Ala production in 797 \nS. aureus. (A) Schematic of the predicted D-Ala-D-Ala generating pathways in S. aureus . 798 \nGrowth curves of various S. aureus strains grown in the (B) absence or (C) presence of 5 mM 799 \nD-Ala (n=3, mean ± SD). 800 \n 801 \n 802 \n 803 \n 804 \n 805 \n 806 \n 807 \n 808 \n 809 \n 810 \n 811 \n 812 \n 813 \n 814 \n 815 \n 816 \n 817 \n 818 \n 819 \n 820 \n 821 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n34 \n \n 822 \n 823 \nFigure 2. Translational coupling of dat to pepV limits the alr1 mutant from countering 824 \nacetate intoxication (A)  Schematic representation of various engineered mutations in the 825 \npepV-dat locus.SD, Shine-Dalgarno motif; TSS, transcriptional start site. (B)-(D) Growth of 826 \nengineered mutants was monitored spectrophotometrically (OD 600) in TSB supplemented with 827 \n20 mM acetate (n=3, mean ± SD).  (E) RT-qPCR to determine dat transcription in various 828 \nmutants relative to the WT strain. 829 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n35 \n \n 830 \n 831 \nFigure 2-figure supplement 1 . Overexpression of dat rescues the growth defect of the 832 \nalr1 mutant (A)  dat was cloned in a multicopy vector (pSP4) controlled by its native promoter. 833 \nThe S. aureus  strains containing pSP4 and pLI50 (empty vector) were grown in TSB 834 \nsupplemented with 20 mM acetate (B) RT-qPCR analysis of dat expression in the alr1 mutant in 835 \nthe presence or absence of 20 mM acetic acid (n=3, mean ± SD). 836 \n 837 \n 838 \n 839 \n 840 \n 841 \n 842 \n 843 \n 844 \n 845 \n 846 \n 847 \n 848 \n 849 \n 850 \n 851 \n 852 \n 853 \n 854 \n 855 \n 856 \n 857 \n 858 \n 859 \n 860 \n 861 \n 862 \n 863 \n 864 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n36 \n \n 865 \n 866 \nFigure 3. Reaction orientation and fluxes through Alr1 and Dat (A)  Schematic 867 \nrepresentation of various isotopologues of D-Ala-D-Ala and D-Glu generated from 13C3\n15N1 868 \nlabeled L-Ala. Metabolites in blue mainly arise from Alr1, red, through the Ald1/2-Dat pathway 869 \nand yellow are unlabeled intermediates within cells. The mass isotopologue distribution of (B) D-870 \nAla-D-Ala and (C) D-Glu were determined by LC-MS/MS following the growth of S. aureus  in 871 \nchemically defined media supplemented with 13C3\n15N1 L-Ala (n=3, mean ± SD). Isotopologues of 872 \nD-Ala-D-Ala shown in grey color are minor species and are noted in Table S9. (D) The mean 873 \ncompetitive fitness ( w) was determined by co-culturing the WT strain with an isogenic mutant 874 \nthat contained either the empty pAQ59 vector integrated into the SaPI chromosomal site (WT EV) 875 \nor the pAS8 vector containing dat under the control of its native promoter (WT dat) (n=18, the 876 \ndotted lines indicate the median and quartiles). 877 \n 878 \n 879 \n 880 \n 881 \n 882 \n 883 \n 884 \n 885 \n 886 \n 887 \n 888 \n 889 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n37 \n \n 890 \nFigure 4. Acetate intoxication impacts soluble PG precursor pools and cell wall cross-891 \nlinking. (A) The intracellular pool of PG intermediates in exponential phase cultures of S. 892 \naureus was estimated using LC-MS/MS analysis. cps, counts per second (B) ddl and murF 893 \ntranscription in the exponential growth phase was determined by RT-qPCR analysis (n=3, mean 894 \n± SD).  (C) Cell wall muropeptide analysis of the WT, alr1 and dat mutants was determined 895 \nfollowing growth in TSB ± 20 mM acetate for 3 h. Cell wall cross-linking was estimated as 896 \npreviously described (49). Ac, acetate. 897 \n 898 \n 899 \n 900 \n 901 \n 902 \n 903 \n 904 \n 905 \n 906 \n 907 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n38 \n \n 908 \n 909 \nFigure 4-figure supplement 1 . Muropeptide analysis. Representative c hromatograms of 910 \nmuropeptide extracts from (A-C) WT, alr1 and dat mutants, and following (D-F) acetate 911 \nintoxication. A unique peak corresponding to NAG-NAM-AEK (M3, m/z, Da: 826.4080) was 912 \nidentified in the alr1 mutant. The peak area of M3 was normalized to the total area of peaks 913 \nobserved in the chromatogram and expressed as percent (see inset figure in B, n=3, mean ± 914 \nSD). M, monomer; D, dimer; T, trimer, Tt, tetramer. 915 \n 916 \n 917 \n 918 \n 919 \n 920 \n 921 \n 922 \n 923 \n 924 \n 925 \n 926 \n 927 \n 928 \n 929 \n 930 \n 931 \n 932 \n 933 \n 934 \n 935 \n 936 \n 937 \n 938 \n 939 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n39 \n \n 940 \nFigure 5. Acetate anion inhibits Ddl activity.  (A) The intracellular D-Ala was determined by 941 \nLC-MS/MS analysis. (B) The ddl gene was overexpressed in S. aureus  using a cadmium 942 \ninducible expression system (pSP36). CdCl 2, 0.312 µM. (C) Inhibition of recombinant His-943 \ntagged Ddl activity in the presence of 300 mM sodium acetate (D) IC50 curve of the inhibition of 944 \nrDdl by acetate. Michaelis-Menten kinetics of rDdl in varying concentrations of (E) D-Ala, and (F) 945 \nATP in the presence of acetate to assess the inhibition mechanism . (G) Structure of the acetate 946 \nbound Ddl (PDB:8FFF) . (H) Acetate bound to the ATP binding site of Ddl (I) Acetate bound to 947 \nthe second D-Ala binding site of Ddl. The calculated Fo-Fc omit maps are contoured to 3σ and 948 \nthe mesh is shown in blue. (J) Superimposed structure of acetate bound Ddl (slate blue) with 949 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n40 \n \nStaDdl apo structure (PDB:2I87, beige) and StaDdl-ADP complex structure (PDB:2I8C, grey) 950 \nshowing a shift of 𝛚 loop (red) to ATP binding site. The D-Ala-D-Ala was modeled at the D-Ala 951 \nbinding site using Thermos thermophius HB8 Ddl structure (PDB:2ZDQ). The bound ADP (grey) 952 \nof PDB:2I87 and modeled D-Ala-D-Ala (light blue) indicates the positioning of Ac at ATP and 953 \nsecond D-Ala binding sites respectively. Ac, acetate; V, velocity. 954 \n 955 \n 956 \n 957 \n 958 \n 959 \n 960 \n 961 \n 962 \n 963 \n 964 \n 965 \n 966 \n 967 \n 968 \n 969 \n 970 \n 971 \n 972 \n 973 \n 974 \n 975 \n 976 \n 977 \n 978 \n 979 \n 980 \n 981 \n 982 \n 983 \n 984 \n 985 \n 986 \n 987 \n 988 \n 989 \n 990 \n 991 \n 992 \n 993 \n 994 \n 995 \n 996 \n 997 \n 998 \n 999 \n 1000 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n41 \n \n 1001 \n 1002 \nFigure 6. Biologically relevant weak acids inhibit growth of the alr1 mutant . Molecular 1003 \ndocking of (A) lactate (B) propionate and  (C) itaconate to the ATP binding site of Ddl. (D) The 1004 \nrelative positions and poise of different organic anions in relation to acetate in the D-Ala binding 1005 \nsite of Ddl was determined using Schrödinger Glide. The growth (OD 600) of the WT and alr1 1006 \nmutant in TSB containing (E) lactic acid (40 mM) (F) propionic acid (20 mM)  and (G) itaconic 1007 \nacid (20 mM) in the presence or absence of 5 mM D-Ala. 1008 \n 1009 \n 1010 \n 1011 \n 1012 \n 1013 \n 1014 \n 1015 \n 1016 \n 1017 \n 1018 \n 1019 \n 1020 \n 1021 \n 1022 \n 1023 \n 1024 \n 1025 \n 1026 \n 1027 \n 1028 \n 1029 \n 1030 \n 1031 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n42 \n \n 1032 \n 1033 \nFigure 6-figure supplement 1. Overexpression of ddl rescues the growth defect of the 1034 \nalr1 mutant The growth (OD 600) of the WT and alr1 mutants overexpressing Ddl (pSP36; 1035 \ncadmium inducible expression of ddl) in TSB supplemented with (A) lactic acid (40 mM), (B) 1036 \npropionic acid (20 mM) and (C) Itaconic acid (20 mM) in the presence or absence of 5 mM D-Ala 1037 \n(n=3, mean ± SD). 1038 \n 1039 \n 1040 \n 1041 \n 1042 \n 1043 \n 1044 \n 1045 \n 1046 \n 1047 \n 1048 \n 1049 \n 1050 \n 1051 \n 1052 \n 1053 \n 1054 \n 1055 \n 1056 \n 1057 \n 1058 \n 1059 \n 1060 \n 1061 \n 1062 \n 1063 \n 1064 \n 1065 \n 1066 \n 1067 \n 1068 \n 1069 \n 1070 \n 1071 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n43 \n \n 1072 \n 1073 \nFigure 7. Model depicting the role of Alr1 in countering organic acid anion-mediated 1074 \ninhibition of Ddl. During its growth, S. aureus (WT) maintains a substantial intracellular pool of 1075 \nD-Ala through the activity of Alr1. Any excess D-Ala is subsequently converted into D-Glu by the 1076 \naction of the Dat enzyme. The high concentration of D-Ala is crucial for the optimal functioning 1077 \nof Ddl and serves to prevent the inhibition of Ddl by acetate (Ac -) and other organic acid anions. 1078 \nThis process generates sufficient D-Ala-D-Ala, which is rapidly incorporated into the PG 1079 \ntripeptide precursor UDP-NAM-AEKAA to form UDP-NAM-AEKAA, which ultimately contribut es 1080 \nto a robust cross-linked PG (murein) sacculus. In the alr1 mutant, the Dat reaction orientation is 1081 \nswitched to preserve intracellular D-Ala. Nevertheless, this change is inadequate to maintain 1082 \nsufficient D-Ala pool to shield Ddl from inhibition by Ac -, due to tight control of dat translation. 1083 \nThis results in an excess of UDP-NAM-AEK, which competes effectively with UDP-NAM-AEKAA 1084 \nfor PG incorporation. The absence of a terminal D-Ala-D-Ala in the PG hinders crosslinking and 1085 \nleads to impaired growth following acetate intoxication. 1086 \n 1087 \n 1088 \n 1089 \n 1090 \n 1091 \n 1092 \n 1093 \n 1094 \n 1095 \n 1096 \n 1097 \n 1098 \n 1099 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n44 \n \nTable S1: Effect of acetate on Ddl activity 1100 \n 1101 \nSubstrate Condition  Km (mM) Vmax (μM min -\n1) \nkcat (min-1) \n \nD-Ala 0 mM Acetate  7.0 ± 0.6 \n \n16.0 ± 0.4 \n \n80.1 ± 2.1 \n100 mM Acetate \n \n 6.8 ± 0.6 \n \n10.9 ± 0.3 \n \n54.4 ± 1.6 \n \n300 mM Acetate   8.4 ± 0.6 \n \n6.3 ± 0.1 \n \n31.5 ± 0.7 \n \nATP 0 mM Acetate \n \n 0.6 ± 0.1 \n \n12.3 ± 1.1 61.7 ± 5.7 \n200 mM Acetate \n \n 0.8 ± 0.2 \n \n6.9 ± 0.8 34.4 ± 3.8 \n300 mM Acetate  \n \n 0.8 ± 0.3 \n \n4.0 ± 0.7 19.9 ± 3.6 \n 1102 \n 1103 \n 1104 \n 1105 \n 1106 \n 1107 \n 1108 \n 1109 \n 1110 \n 1111 \n 1112 \n 1113 \n 1114 \n 1115 \n 1116 \n 1117 \n 1118 \n 1119 \n 1120 \n 1121 \n 1122 \n 1123 \n 1124 \n 1125 \n 1126 \n 1127 \n 1128 \n 1129 \n 1130 \n 1131 \n 1132 \n 1133 \n 1134 \n 1135 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n45 \n \nTable S2: Impact of acetate on Ddl stability assessed by \nDSF \nSample Tm D (ºC) ΔTm D \n(ºC)* \nDdl 45.0 ± 0.0 - \nDdl + Sodium acetate (Ac) 48.7 ± 0.0  3.7 \nDdl + ATP 46.4 ± 0.0 1.4 \nDdl + ATP + Ac 48.9 ± 0.1 3.9 \nDdl + ADP 41.9 ± 0.1 -3.2 \nDdl + ADP + Ac 49.7 ± 0.1 4.0 \nDdl + D-Ala 49.2 ± 0.1 4.2 \nDdl + D-Ala + Ac 49.6 ± 0.0 4.5 \nDdl + D-Ala + ATP + Ac 47.1 ± 0.1 2.0 \nDdl + D-Ala + ADP + Ac 49.8 ± 0.0 4.8 \n 1136 \n*The ∆Tm D values are calculated as the difference in melting temperature 1137 \n of the Ddl apo protein to Ddl with added substrates or acetate inhibitor.   1138 \n 1139 \n 1140 \n 1141 \n 1142 \n 1143 \n 1144 \n 1145 \n 1146 \n 1147 \n 1148 \n 1149 \n 1150 \n 1151 \n 1152 \n 1153 \n 1154 \n 1155 \n 1156 \n 1157 \n 1158 \n 1159 \n 1160 \n 1161 \n 1162 \n 1163 \n 1164 \n 1165 \n 1166 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n46 \n \n 1167 \nTable S3: Refinement statistics of Ddl/Acetate structure \nResolution Range 48.21 – 1.92 (1.989 – 1.92) \nSpace group P 2 21 21 \nUnit cell 55.123 65.817 99.423 90 90 90 \nTotal reflections 173526 (12202) \nUnique reflections 20366 (2806) \nMultiplicity 8.5 (9.3) \nCompleteness (%) 94.80 (50.46) \nMean I/sigma(I) 10.99 (1.72) \nWilson B-factor 37.29 \nR-merge 0.097 (0.33) \nR-meas 0.104 (0.35) \nR-pim 0.036 (0.12) \nCC1/2 0.998 (0.95) \nCC* 0.999 (0.99) \nReflections used in refinement 26870 (1416) \nReflections used for R-free 1601 (92) \nR-work 0.21 (0.42) \nR-free 0.27 (0.47) \nCC (work) 0.223 (0.07) \nCC (free) 0.217 (-0.16) \nNumber of non-hydrogen atoms 2963 \nmacromolecules 2777 \nligands 10 \nsolvent 176 \nProtein residues 355 \nRMS(bonds) 0.009 \nRMS(angles) 1.10 \nRamachandran favored (%) 93.70 \nRamachandran allowed (%) 6.02 \nRamachandran outliers (%) 0.29 \nRotamer outliers (%) 0.00 \nClashscore 6.88 \nAverage B-factor 43.60 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n47 \n \nmacromolecules 43.60 \nligands 45.09 \nsolvent 43.64 \n 1168 \n 1169 \n 1170 \n 1171 \n 1172 \n 1173 \n 1174 \n 1175 \n 1176 \n 1177 \n 1178 \n 1179 \n 1180 \n 1181 \n 1182 \n 1183 \n 1184 \n 1185 \n 1186 \n 1187 \n 1188 \n 1189 \n 1190 \n 1191 \n 1192 \n 1193 \n 1194 \n 1195 \n 1196 \n 1197 \n 1198 \n 1199 \n 1200 \n 1201 \n 1202 \n 1203 \n 1204 \n 1205 \n 1206 \n 1207 \n 1208 \n 1209 \n 1210 \n 1211 \n 1212 \n 1213 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n48 \n \n 1214 \n 1215 \nTable S4: Glide scores from molecular docking studies of organic anions  \n \nOrganic Anion ATP binding site D-Ala binding site \nL-lactate -4.851 -4.431 \nPropionate -2.317  -1.883 \nItaconate -3.572 -3.575 \n 1216 \n 1217 \n 1218 \n 1219 \n 1220 \n 1221 \n 1222 \n 1223 \n 1224 \n 1225 \n 1226 \n 1227 \n 1228 \n 1229 \n 1230 \n 1231 \n 1232 \n 1233 \n 1234 \n 1235 \n 1236 \n 1237 \n 1238 \n 1239 \n 1240 \n 1241 \n 1242 \n 1243 \n 1244 \n 1245 \n 1246 \n 1247 \n 1248 \n 1249 \n 1250 \n 1251 \n 1252 \n 1253 \n 1254 \n 1255 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n49 \n \n 1256 \n 1257 \nTable S5: Strains used in this study  \nStrains Description Source \nE. coli Electro-Ten-Blue General plasmid maintenance strain Stratagene \nS. aureus RN4220 Restriction-deficient strain is routinely used as a \ntransformation intermediate \n(54) \nS. aureus  RN4220: \npRN7023 \nRestriction deficient strain carrying pRN7023 plasmid \ncontaining integrase gene routinely used as a \ntransformation intermediate \n(39) \nE. coli DH5α General plasmid maintenance strain Thermo Fisher \nE. coli BL21(DE3) Protein over-expression and purification strain Novagen \nS. aureus JE2 S. aureus USA300 LAC cured of all 3 native plasmids (37) \nJE2 alr1 bursa aurealis transposon mutant, ErmR NTML \nJE2 alr1::alr1 WT copy of alr1 complemented at the SaPI1 site of \nbursa aurealis transposon mutant, ErmR \nThis study \nJE2 citZ bursa aurealis transposon mutant, ErmR NTML \nJE2 citZalr1 bursa aurealis transposon mutant, ErmR, KanR This study \nJE2 dat bursa aurealis transposon mutant, ErmR NTML \nJE2 Δalr2 Inframe isogenic deletion mutant of JE2 This study \nJE2 alr1Δalr2 bursa aurealis transposon mutant, Erm R, transduced \ninto inframe isogenic deletion mutant JE2 Δalr2 \nThis study \nJE2 alr1dat bursa aurealis transposon mutant, ErmR, TetR This study \nJE2 alr1: dat pLI50 dat plasmid (pSP4) transduced into bursa \naurealis transposon mutant, ErmR \n \nJE2 pepVΔSD1-467 Isogenic deletion mutant of SD1 and pepV  This study \nJE2 alr1pepVΔSD1-467 bursa aurealis transposon mutant, Erm R transduced \ninto isogenic deletion mutant of SD1 and pepV \nThis study \nJE2 ΔpepV Inframe isogenic deletion mutant of JE2 This study \nJE2 alr1ΔpepV bursa aurealis transposon mutant, Erm R transduced \ninto inframe isogenic deletion mutant JE2 ΔpepV \nThis study \nJE2 pepVQ12STOP Glutamine to STOP codon substitution at 12 th amino \nacid position in PepV \nThis study \nJE2 alr1pepVQ12STOP Bursa aurealis transposon mutant, Erm R transduced \ninto glutamine to STOP codon substitution at 12 th \namino acid position in PepV \nThis study \nJE2 WT: pJB68 pJB68 transduced into WT JE2 This study \nJE2 WT: pSP36 pSP36 transduced into WT JE2 This study \nJE2 alr1: pJB68 pJB68 transduced into JE2 alr1 This study \nJE2 alr1: pSP36 pSP36 transduced into WT alr1 This study \nJE2 WT::pAQ59 pAQ59 empty vector inserted at the SaPI1 site of WT \nJE2 \nThis study \nJE2 WT::pAS8 dat (under its native promoter) inserted at the SaPI1 \nsite of WT JE2 \nThis study \n 1258 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n50 \n \n 1259 \n 1260 \nTable S6: Plasmids used in this study \n \nPlasmids Description Source \npLI50 E. coli- S. aureus shuttle vector (55) \npJB38 E. coli- S. aureus allelic exchange vector (38) \npJC1111 E. coli- S. aureus SaPI1 site integration vector (39) \npJB68 E. coli- S. aureus cadmium inducible shuttle vector (38) \npET28a Expression vector for purification of protein in E. coli BL21 (DE3) Novagen \npAS3 pJC1111 based vector f or integration of WT copy of alr1 at the \nSaPI1 site \nThis study \npAS2 pJB38 based vector for alr2 chromosomal deletion This study \npSP4 pLI50 dat (under control of its native promoter) This study \npSP19 pJB38 based vector for pepV SD1 chromosomal deletion This study \npSP20 pJB38 based vector for pepV SD1-467 chromosomal deletion This study \npSP16 pJB38 based vector for pepV chromosomal deletion This study \npSP15 pJB38 based vector for  substitution of chromosomal pepV with \npepVQ12STOP \nThis study \npSP36 pJB68 based vector for overexpression of ddl  This study \npSP32 pET28a based vector for  purification of full length Ddl (C -terminal \nhis tag) \nThis study \npAQ59 E. coli - S. aureus  SaPI1 site integration vector with pSC101 ori \nregion \n(56) \npAS8 pAQ59 based vector for integration of dat gene under its native \npromoter at the SaPI1 site \nThis study \n 1261 \n 1262 \n 1263 \n 1264 \n 1265 \n 1266 \n 1267 \n 1268 \n 1269 \n 1270 \n 1271 \n 1272 \n 1273 \n 1274 \n 1275 \n 1276 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n51 \n \n 1277 \n 1278 \n 1279 \n       Table S7: Primers used in this study 1280 \n 1281 \nGene/Modification  Primer name  Primer sequence (5' – 3')  \nalr1  alr1_F  TGCTGACGAACCAGGAGATA  \n  alr1_R  TGTAGTTGGGTCAGTAGCTG  \nalr1 complementation alr1_comp_F  \n \nCGGCCGCTGCATGCCTGCAGACATGAGCAACGTAAA \nATTG \n alr1_comp_R  AGCTCGGTACCCGGGGATCCAATGACCTTTAATTACT \nCTAATGATAAC  \ncitZ  \n  \n1641_F  CAGCGGAGACTAAAATAAGTTC  \n 1641_R  CCCAATCTCAGATAACATCGTC  \ndat  \n  \ndat_F  ACTATAGGTGGCGGTACTTA  \n dat_R  ACCATCGGATATCTTCAACG  \nalr2 deletion  alr2_UP_F  CGAGGCCCTTTCGTCTTCAATACTTAGAAGGTAATGG \nCTC  \n alr2_UP2_R  TCATAGCACTTGCTGTCAATGTATTACAC  \n alr2_DN2_F  ATTGACAGCAAGTGCTATGAATCATGATTC  \n alr2_DN_R  TTGCATGCCTGCAGGTCGACGCTTCTTCATTTCTATTA \nACAAG \ndat  \ncomplementation  \ndat promoter_F  CCTTTCGTCTTCAAGAATTCGATGTGAGTAGGACAGA \nAATG  \n dat promoter_R  TTTTTTCCATTCGAAATCGACTTCCTTTTTTC  \n dat_pLI50_F  TCGATTTCGAATGGAAAAAATTTTTTTAAATGGTG  \n dat_pLI50_R  TTGCATGCCTGCAGGTCGACCGAAAGTTGATAAATTT \nAAGTAATTTAATC  \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n52 \n \nTSS identification of \ndat operon \n pepV_TSS_R1 P-CCATCTCTATGTGCAATTTC \n pepV_TSS_R2 GCGTCTTCTGATGCTTTTGC \n pepV_TSS_F3 GTCCTCGTAAGGCATTAGAC \n M13F (-20) GTAAAACGACGGCCAG \n M13R CAGGAAACAGCTATGAC \npepVΔSD1-467  RBS1pepV_UP_F  CCTTTCGTCTTCAAGAATTCAGCGACGCAATTAGGAA \nC  \n \nRBS1pepV_UP_R  \nTTATTCCTCCTTTTTCTATAAGTTAAATTCTATTTTACAT \nGAAAAG  \n 1282 \n  RBS1pepV_DN_F  TATAGAAAAAGGAGGAATAATATATGGAAAAAATTTTT \nTTAAATG  \n  \nRBS1pepV_DN_R  TATAGAAAAAGGAGGAATAATATATGGAAAAAATTTTT \nTTAAATG  \npepV deletion  pepV_UP2_F  CCTTTCGTCTTCAAGAATTCAACAATTAAAGAAGTAAA \nAACAAATC  \n  pepV_UP2_R  TTTTTTCCATTCGAAATCGACTTCCTTTTTTC  \n  pepV_DN2_F  TCGATTTCGAATGGAAAAAATTTTTTTAAATGGTG  \n  pepV_DN2_R  TTGCATGCCTGCAGGTCGACTTTCAACTGAAAATGAG \nAAAC  \npepVQ12STOP  pepV_STOP_UP \n_F  \nCCTTTCGTCTTCAAGAATTCCAAATCCGAAAGAATATG \nC  \n  pepV_STOP_UP \n_R  \nTAATGATTTAATCTTCGTATTGTTGAACTTTTTC  \n  pepV_STOP_D \nN_F  \nATACGAAGATTAAATCATTAATGACTTAAAAGGATTATT \nAG  \n  pepV_STOP_D \nN_R  \nTTGCATGCCTGCAGGTCGACAAAGACCTGCGTTTTCA \nTTATC  \nddl overexpression \nplasmid  \n  \nddl_pJB68_F  TTTATAAGGAGGAAAAACATATGACAAAAGAAAATATT \nTGTATCG  \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n53 \n \n ddl_pJB68_R  GAATAGGCGCGCCTGAATTCATCCATGATTGAATTTG \nCTTTAATG  \nDdl purification \nplasmid  \n  \nddl_C_Histag_F  CTTTAAGAAGGAGATATACCATGACAAAAGAAAATATT \nTGTATCG  \n ddl_C_Histag_R  CAGTGGTGGTGGTGGTGGTGGTCAATTTTGTATTTAT \nTTTTCTGTTTATC  \nddl RT-qPCR  ddl_RT_F   GGGCTTTTTGAAGTTTTGGA  \n  ddl_RT_R  TGGTAACCCTCGATGTTCAA  \nmurF RT-qPCR  murF_RT_F  TCACAATTGATTCACGAGCA  \n  murF_RT_R  CCCAGCACCATCTTGTAATG  \ndat RT-qPCR  dat RT_F  GATGGTTACGTTGCGACATT  \n  dat RT_R  CACCTCGATGTTGAATTGCT  \nsigA RT-qPCR  JE2_RT_sigA_F  AACTGAATCCAAGTGATCTTAGTG  \n  JE2_RT_sigA_R  TCATCACCTTGTTCAATACGTTTG  \ndat insertion at the \nSaPI1 site (pAS8)  \ndat_UP2_F  GAGCCGCTGCATGCCTGCAGGATGTGAGTAGGACAG \nAAATG  \n dat_UP_R  TTTTTTCCATTCGAAATCGACTTCCTTTTTTC  \n dat_DN_F  TCGATTTCGAATGGAAAAAATTTTTTTAAATGGTG  \n dat_DN_R  AGCTCGGTACCCGGGGATCCCGAAAGTTGATAAATTT \nAAGTAATTTAATC  \n  1283 \n  1284 \n  1285 \n 1286 \n 1287 \n 1288 \n 1289 \n 1290 \n 1291 \n 1292 \n  1293 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n54 \n \n  1294 \n  1295 \n  1296 \n 1297 \n  Table S8: Table of Multiple Reaction Monitoring (MRM) transitions  \nMetabolite  Polarity  MRM (Q1/Q3)  CE (V)  DP (V)  RT Column \nL-Ala (+)  90.1 / 44.0  17 65 6.4 C \nD-Ala (+)  90.1 / 44.0  17 65 9.5 C \nD-Ala-D-Ala (+)  161.0 / 44.2  30.5 65 3.4 XB \nUDP-NAG  (-)  606.0 / 79.0  -149 -80 12.7 XB \nUDP-NAM  (-)  678.1 / 79.0  -120 -80 13.2 XB \nUDP-NAM-A  (-)  749.1 / 403.0  -42 -90 13.4 XB \nUDP-NAM-AE (-)  878.2 / 403.0  -48 -105 14.3 XB \nUDP-NAM-AEK (-)  1006.2 / 403.0  -50 -130 14.9 XB \nUDP-NAM-AEKAA (-)  1148.5 / 403.0  -55 -140 14.6 XB \nNAM  (-)  292.0 / 89.0  -16 -30 6.2 XB \nNAG  (+)  204.0 / 138.1  18.9 30 5.6 XB \nBr-ATP (IS) (-)  588.0 / 159.0  -38.9 -60 6.0 XB \nRibitol (IS) (-)  151.1 / 89.0  -14.8 -60 5.3 XB \n 1298 \nCE: Collision energy ;DP: Declustering potential; RT: Retention Time; C: CHIROBIOTIC® T column; XB: 1299 \nXBridge Amide column 1300 \n 1301 \n 1302 \n 1303 \n 1304 \n 1305 \n 1306 \n 1307 \n 1308 \n 1309 \n 1310 \n 1311 \n 1312 \n 1313 \n 1314 \n 1315 \n 1316 \n 1317 \n 1318 \n 1319 \n 1320 \n 1321 \n 1322 \n 1323 \n 1324 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n55 \n \n 1325 \n 1326 \n 1327 \n 1328 \n 1329 \n 1330 \nTable S9: HRMS base peak identification of isotopologues  \n \n  Metabolite Isotopologues(13C15N) Base peak (m/z) \nD-Ala-D-Ala (Positive mode) \n1 C6H12N2O3 C0N0 161.0921 \n2 [13]C1C5H12N2O3 C1N0 162.0954 \n3 [13]C2C4H12N2O3 C2N0 163.0988 \n4 [13]C3C3H12N2O3 C3N0 164.1021 \n5 [13]C3C3H12[15]N1N1O3 C3N1 165.09917 \n6 [13]C3C3H12[15]N2O3 C3N2 166.0962 \n7 [13]C4C2H12N2O3 C4N0 165.10549 \n8 [13]C5C1H12N2O3 C5N0 166.10884 \n9 [13]C6H12N2O3 C6N0 167.1122 \n10 [13]C6H12[15]N1N1O3 C6N1 168.1092 \n11 [13]C6H12[15]N2O3 C6N2 169.1063 \n12 [13]C1C5H12[15]N1N1O3 C1N1 163.09246 \n13 [13]C1C5H12[15]N2O3 C1N2 164.0895 \n14 [13]C2C4H12[15]N1N1O3 C2N1 164.0958 \n15 [13]C2C4H12[15]N2O3 C2N2 165.09285 \n16 [13]C4C2H12[15]N1N1O3 C4N1 166.1025 \n17 [13]C4C2H12[15]N2O3 C4N2 167.09956 \n18 [13]C5C1H12[15]N1N1O3 C5N1 167.10588 \n19 [13]C5C1H12[15]N2O3 C5N2 168.1029 \n20 C6H12[15]N1N1O3 C0N1 162.0891 \n21 C6H12[15]N2O3 C0N2 163.0861 \n \nD-Glu (Negative mode) \n1 C5H9NO4 C0N0 146.04588 \n2 C5H9[15]NO4 C0N1 147.04292 \n3 [13]C1C4H9NO4 C1N0 147.04924 \n4 [13]C2C3H9NO4 C2N0 148.05259 \n5 [13]C2C3H9[15]NO4 C2N1 149.04963 \n6 [13]C1C4H9[15]NO4 C1N1 148.04627 \n7 [13]C3C2H9[15]NO4 C3N1 150.05298 \n8 [13]C4C1H9[15]NO4 C4N1 151.05634 \n9 [13]C5H9[15]NO4 C5N1 152.05969 \n10 [13]C3C2H9NO4 C3N0 149.05595 \n11 [13]C4C1H9NO4 C4N0 150.0593 \n12 [13]C5H9NO4 C5N0 151.06266 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n56 \n \n 1331 \nRT: D-Ala-D-Ala, 3.4 mins on 10 cm XBridge amide column; D-Glu, 6.4 mins on CHIROBIOTIC® T column 1332 \n 1333 \n 1334 \n 1335 \n 1336 \nReferences 1337 \n 1338 \n1. Passalacqua KD, Charbonneau ME, & O'Riordan MXD (2016) Bacterial metabolism 1339 \nshapes the host-pathogen interface. Microbiol Spectr 4(3). 1340 \n2. Brestoff JR & Artis D (2013) Commensal bacteria at the interface of host metabolism 1341 \nand the immune system. Nat Immunol 14(7):676-684. 1342 \n3. Tomlinson KL , et al.  (2021) Staphylococcus aureus induces an itaconate-dominated 1343 \nimmunometabolic response that drives biofilm formation. Nat Commun 12(1):1399. 1344 \n4. Heim CE, et al.  (2020) Lactate production by Staphylococcus aureus  biofilm inhibits 1345 \nHDAC11 to reprogramme the host immune response during persistent infection. Nat 1346 \nMicrobiol 5(10):1271-1284. 1347 \n5. Schlatterer K, Peschel A, & Kretschmer D (2021) Short-chain fatty acid and FFAR2 1348 \nActivation - A new option for treating infections? Front Cell Infect Microbiol 11:785833. 1349 \n6. Salmond CV, Kroll RG, & Booth IR (1984) The effect of food preservatives on pH 1350 \nhomeostasis in Escherichia coli. J Gen Microbiol 130(11):2845-2850. 1351 \n7. Roe AJ, McLaggan D, Davidson I, O'Byrne C, & Booth IR (1998) Perturbation of anion 1352 \nbalance during inhibition of growth of Escherichia col i by weak acids. J Bacteriol  1353 \n180(4):767-772. 1354 \n8. Cummings JH, Pomare EW, Branch WJ, Naylor CP, & Macfarlane GT (1987) Short 1355 \nchain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 1356 \n28(10):1221-1227. 1357 \n9. Acton DS, Plat-Sinnige MJ, van Wamel W, de Groot N, & van Belkum A (2009) Intestinal 1358 \ncarriage of Staphylococcus aureus: how does its frequency compare with that of nasal 1359 \ncarriage and what is its clinical impact? Eur J Clin Microbiol Infect Dis 28(2):115-127. 1360 \n10. Piewngam P , et al.  (2023) Probiotic for pathogen-specific Staphylococcus aureus 1361 \ndecolonisation in Thailand: a phase 2, double-blind, randomised, placebo-controlled trial. 1362 \nLancet Microbe 4(2):e75-e83. 1363 \n11. Thomas VC , et al. (2014) A central role for carbon-overflow pathways in the modulation 1364 \nof bacterial cell death. PLoS Pathog 10(6):e1004205. 1365 \n12. Alqarzaee AA , et al.  (2021) Staphylococcal ClpXP protease targets the cellular 1366 \nantioxidant system to eliminate fitness-compromised cells in stationary phase. Proc Natl 1367 \nAcad Sci U S A 118(47). 1368 \n13. Mordukhova EA & Pan JG (2013) Evolved cobalamin-independent methionine synthase 1369 \n(MetE) improves the acetate and thermal tolerance of Escherichia coli . Appl Environ 1370 \nMicrobiol 79(24):7905-7915. 1371 \n14. Roe AJ, O'Byrne C, McLaggan D, & Booth IR (2002) Inhibition of Escherichia coli growth 1372 \nby acetic acid: a problem with methionine biosynthesis and homocysteine toxicity. 1373 \nMicrobiology (Reading) 148(Pt 7):2215-2222. 1374 \n15. Gries CM , et al.  (2016) Potassium uptake modulates Staphylococcus aureus 1375 \nmetabolism. mSphere 1(3). 1376 \n16. Carpenter CE & Broadbent JR (2009) External concentration of organic acid anions and 1377 \npH: key independent variables for studying how organic acids inhibit growth of bacteria 1378 \nin mildly acidic foods. J Food Sci 74(1):R12-15. 1379 \n17. Halsey CR , et al.  (2017) Amino acid catabolism in Staphylococcus aureus  and the 1380 \nfunction of carbon catabolite repression. mBio 8(1). 1381 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n57 \n \n18. Moscoso M, Garcia P, Cabral MP, Rumbo C, & Bou G (2018) A D-Alanine auxotrophic 1382 \nlive vaccine is effective against lethal infection caused by Staphylococcus aureus . 1383 \nVirulence 9(1):604-620. 1384 \n19. Cava F, Lam H, de Pedro MA, & Waldor MK (2011) Emerging knowledge of regulatory 1385 \nroles of D-amino acids in bacteria. Cell Mol Life Sci 68(5):817-831. 1386 \n20. Burlak C , et al.  (2007) Global analysis of community-associated methicillin-resistant 1387 \nStaphylococcus aureus  exoproteins reveals molecules produced in vitro and during 1388 \ninfection. Cell Microbiol 9(5):1172-1190. 1389 \n21. Goldstein JM, Kordula T, Moon JL, Mayo JA, & Travis J (2005) Characterization of an 1390 \nextracellular dipeptidase from Streptococcus gordonii FSS2. Infect Immun  73(2):1256-1391 \n1259. 1392 \n22. Liu S , et al.  (2006) Allosteric inhibition of Staphylococcus aureus D-Alanine:D-Alanine 1393 \nligase revealed by crystallographic studies. Proc Natl Acad Sci U S A  103(41):15178-1394 \n15183. 1395 \n23. Lu Y, Xu H, & Zhao X (2010) Crystal structure of the apo form of D-Alanine:D-Alanine 1396 \nligase (Ddl) from Streptococcus mutans. Protein Pept Lett 17(8):1053-1057. 1397 \n24. Pederick JL, Thompson AP, Bell SG, & Bruning JB (2020) D-Alanine-D-alanine ligase as 1398 \na model for the activation of ATP-grasp enzymes by monovalent cations. J Biol Chem  1399 \n295(23):7894-7904. 1400 \n25. Huynh KH , et al.  (2015) The crystal structure of the D-alanine -D-alanine ligase from 1401 \nAcinetobacter baumannii suggests a flexible conformational change in the central 1402 \ndomain before nucleotide binding. J Microbiol 53(11):776-782. 1403 \n26. Bruning JB, Murillo AC, Chacon O, Barletta RG, & Sacchettini JC (2011) Structure of the 1404 \nMycobacterium tuberculosis D-Alanine:D-Alanine ligase, a target of the antituberculosis 1405 \ndrug D-Cycloserine. Antimicrob Agents Chemother 55(1):291-301. 1406 \n27. Russell JB & Diez-Gonzalez F (1998) The effects of fermentation acids on bacterial 1407 \ngrowth. Adv Microb Physiol 39:205-234. 1408 \n28. Russell JB (1992) Another explanation for the toxicity of fermentation acids at low pH: 1409 \nanion accumulation versus uncoupling. Journal of Applied Bacteriology 73(5):363-370. 1410 \n29. Wolfe AJ (2005) The acetate switch. Microbiol Mol Biol Rev 69(1):12-50. 1411 \n30. Somerville GA & Proctor RA (2009) At the crossroads of bacterial metabolism and 1412 \nvirulence factor synthesis in staphylococci. Microbiol Mol Biol Rev 73(2):233-248. 1413 \n31. Hammes WP & Neuhaus FC (1974) On the specificity of phospho-N-acetylmuramyl-1414 \npentapeptide translocase. The peptide subunit of uridine diphosphate -N-actylmuramyl-1415 \npentapeptide. J Biol Chem 249(10):3140-3150. 1416 \n32. Sobral RG, Ludovice AM, de Lencastre H, & Tomasz A (2006) Role of murF in cell wall 1417 \nbiosynthesis: isolation and characterization of a murF conditional mutant of 1418 \nStaphylococcus aureus. J Bacteriol 188(7):2543-2553. 1419 \n33. Vemula H, Ayon NJ, & Gutheil WG (2016) Cytoplasmic peptidoglycan intermediate 1420 \nlevels in Staphylococcus aureus. Biochimie 121:72-78. 1421 \n34. Huang C, Hernandez-Valdes JA, Kuipers OP, & Kok J (2020) Lysis of a  Lactococcus 1422 \nlactis dipeptidase mutant and rescue by mutation in the pleiotropic regulator CodY. Appl 1423 \nEnviron Microbiol 86(8). 1424 \n35. Huber M , et al.  (2019) Translational coupling via termination-reinitiation in archaea and 1425 \nbacteria. Nat Commun 10(1):4006. 1426 \n36. Rex G, Surin B, Besse G, Schneppe B, & McCarthy JE (1994) The mechanism of 1427 \ntranslational coupling in Escherichia coli. Higher order structure in the atpHA mRNA acts 1428 \nas a conformational switch regulating the access of de novo initiating ribosomes. J Biol 1429 \nChem 269(27):18118-18127. 1430 \n37. Fey PD, et al.  (2013) A genetic resource for rapid and comprehensive phenotype 1431 \nscreening of nonessential Staphylococcus aureus genes. mBio 4(1):e00537-00512. 1432 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint \n\n58 \n \n38. Bose JL, Fey PD, & Bayles KW (2013) Genetic tools to enhance the study of gene 1433 \nfunction and regulation in Staphylococcus aureus . Appl Environ Microbiol  79(7):2218-1434 \n2224. 1435 \n39. Chen J, Yoong P, Ram G, Torres VJ, & Novick RP (2014) Single-copy vectors for 1436 \nintegration at the SaPI1 attachment site for Staphylococcus aureus. Plasmid 76:1-7. 1437 \n40. Hussain M, Hastings JG, & White PJ (1991) A chemically defined medium for slime 1438 \nproduction by coagulase-negative staphylococci. J Med Microbiol 34(3):143-147. 1439 \n41. Vemula H, Bobba S, Putty S, Barbara JE, & Gutheil WG (2014) Ion-pairing liquid 1440 \nchromatography-tandem mass spectrometry-based quantification of uridine 1441 \ndiphosphate-linked intermediates in the Staphylococcus aureus cell wall biosynthesis 1442 \npathway. Anal Biochem 465:12-19. 1443 \n42. Trefely S, Ashwell P, & Snyder NW (2016) FluxFix: automatic isotopologue 1444 \nnormalization for metabolic tracer analysis. BMC Bioinformatics 17(1):485. 1445 \n43. Patiny L & Borel A (2013) ChemCalc: a building block for tomorrow's chemical 1446 \ninfrastructure. J Chem Inf Model 53(5):1223-1228. 1447 \n44. Fendt SM , et al.  (2013) Metformin decreases glucose oxidation and increases the 1448 \ndependency of prostate cancer cells on reductive glutamine metabolism. Cancer Res  1449 \n73(14):4429-4438. 1450 \n45. Wang C, Lee J, Deng Y, Tao F, & Zhang LH (2012) ARF-TSS: an alternative method for 1451 \nidentification of transcription start site in bacteria. Biotechniques 52(4). 1452 \n46. de Jonge BL, Chang YS, Gage D, & Tomasz A (1992) Peptidoglycan composition of a 1453 \nhighly methicillin-resistant Staphylococcus aureus strain. The role of penicillin binding 1454 \nprotein 2A. J Biol Chem 267(16):11248-11254. 1455 \n47. De Jonge BL, Gage D, & Xu N (2002) The carboxyl terminus of peptidoglycan stem 1456 \npeptides is a determinant for methicillin resistance in Staphylococcus aureus. Antimicrob 1457 \nAgents Chemother 46(10):3151-3155. 1458 \n48. Kuhner D, Stahl M, Demircioglu DD, & Bertsche U (2014) From cells to muropeptide 1459 \nstructures in 24 h: peptidoglycan mapping by UPLC-MS. Sci Rep 4:7494. 1460 \n49. Alvarez L, Hernandez SB, de Pedro MA, & Cava F (2016) Ultra-sensitive, high-resolution 1461 \nliquid chromatography methods for the high-throughput quantitative analysis of bacterial 1462 \ncell wall chemistry and structure. Methods Mol Biol 1440:11-27. 1463 \n50. Winn MD , et al.  (2011) Overview of the CCP4 suite and current developments. Acta 1464 \nCrystallogr D Biol Crystallogr 67(Pt 4):235-242. 1465 \n51. Afonine PV , et al.  (2012) Towards automated crystallographic structure refinement with 1466 \nphenix.refine. Acta Crystallogr D Biol Crystallogr 68(Pt 4):352-367. 1467 \n52. Emsley P, Lohkamp B, Scott WG, & Cowtan K (2010) Features and development of 1468 \nCoot. Acta Crystallogr D Biol Crystallogr 66(Pt 4):486-501. 1469 \n53. Chen VB, et al.  (2010) MolProbity: all-atom structure validation for macromolecular 1470 \ncrystallography. Acta Crystallogr D Biol Crystallogr 66(Pt 1):12-21. 1471 \n54. Kreiswirth BN , et al.  (1983) The toxic shock syndrome exotoxin structural gene is not 1472 \ndetectably transmitted by a prophage. Nature 305(5936):709-712. 1473 \n55. Lee CY, Buranen SL, & Ye ZH (1991) Construction of single-copy integration vectors for 1474 \nStaphylococcus aureus. Gene 103(1):101-105. 1475 \n56. Jacquet R , et al. (2019) Dual gene expression analysis identifies factors associated with 1476 \nStaphylococcus aureus virulence in diabetic mice. Infect Immun 87(5):e00163-00119. 1477 \n 1478 \n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted January 17, 2024. ; https://doi.org/10.1101/2024.01.15.575639doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}