{"paper_id":"3d61c660-7dd4-4c8b-9aaa-8623d628163b","body_text":"MCM8 Promotes NSCLC Progression by Competitively Inhibiting HRD1-Mediated CDC42 Ubiquitination and Degradation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MCM8 Promotes NSCLC Progression by Competitively Inhibiting HRD1-Mediated CDC42 Ubiquitination and Degradation Siyi Qian, Longwu Zeng, Fuxin Chen, Yuxuan Tian, Binjie Zhao, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7116246/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Jan, 2026 Read the published version in Journal of Translational Medicine → Version 1 posted 4 You are reading this latest preprint version Abstract Colon cancer ranks among the top three in both the incidence and mortality rates of malignant tumors worldwide. Moreover, radical surgery is difficult for patients with advanced colon cancer, and chemotherapy drugs are prone to drug resistance. The five-year survival rate is only 13.1%. Therefore, an in-depth analysis of the occurrence, development and drug resistance mechanism of colon cancer is of great clinical significance for optimizing the treatment plan of patients and improving prognosis. As one of the homologous recombination repair proteins, micrormosomal maintenance protein 8 (MCM8) plays an important role in the normal physiological process of cells. In recent years, the research on its role in tumorigenesis and development has gradually deepened, but the role of MCM8 in the malignant progression of colon cancer still remains to be explored. MCM8 is abnormally highly expressed in colon cancer cells and tissues, and is positively correlated with the pathological stage progression and poor prognosis of patients. Our study indicated that MCM8 promotes the transition of the cell cycle from the G1 phase to the S phase. Moreover, our study showed that MCM8 interacted with Cdc42 and promoted its protein stability by competitively inhibiting the ubiquitination modification of Cdc42's E3 ubiquitin ligase HRD1. The rescue experiment showed that MCM8 promoted the proliferation, cell cycle progression, invasion, tumor-forming ability in vivo and resistance to 5-FU of colon cancer cells through Cdc42, while inhibiting cell apoptosis. Collectively, MCM8 is abnormally highly expressed in colon cancer and stabilizes Cdc42 protein by competitively inhibiting HRD1, thereby promoting the occurrence and development of colon cancer and the formation of 5-FU resistance. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction According to the latest evaluation data from the International Agency for Research on Cancer (IARC) of the World Health Organization, approximately 1.93 million new cases of colorectal cancer were reported globally in 2022, accounting for 9.6% of all new cancer cases, ranking third [ 1 ]. Colorectal cancer is also a major cause of cancer-related deaths, with approximately 900,000 deaths in 2022, representing 9.3% of global cancer deaths, ranking second world wide [ 1 ]. Currently, the primary treatment strategies for colorectal cancer are surgery combined with radiotherapy and chemotherapy [ 2 ]. However, most patients present at advanced stages of the disease, losing the opportunity for surgical intervention, and chemotherapy often leads to drug resistance, resulting in a very low 5-year survival rate for patients with advanced colorectal cancer [ 3 ][ 4 ][ 5 ]. Therefore, in-depth research into the pathogenesis and drug resistance mechanisms of colorectal cancer, as well as the identification of etiological-based diagnostic and therapeutic molecular targets, is crucial for improving chemotherapy resistance and enhancing patient efficacy and survival rates. The standard first-line chemotherapy regimen for colorectal cancer is the FOLFOX regimen, which combines 5-fluorouracil (5-FU), leucovorin, and oxaliplatin. This regimen is widely used for advanced or recurrent colorectal cancer, as well as for adjuvant therapy following colorectal cancer resection [ 6 ]. Among these, 5-fluorouracil is an antimetabolite pyrimidine analog that is activated to 5-fluoro-2'-deoxyuridine monophosphate (5-FdUMP) [ 7 ]. It binds to and inhibits thymidylate synthase activity, blocking the production of thymidylate, which is essential for DNA synthesis, thereby inhibiting cancer cell division and growth [ 8 ]. During the treatment with these chemotherapy drugs, chemotherapy resistance often develops. Therefore, studying the mechanisms of tumor resistance and improving existing chemotherapy and targeted therapies is of significant importance for improving survival rates, efficacy, and prognosis in cancer patients. MCM8 is located on human chromosome 20q12.3 and possesses ATPase and helicase activities. It participates in homologous recombination (HR) repair and is involved in the formation of replication forks during the early stages of DNA replication, as well as in the recruitment of other DNA replication-related proteins [ 9 ]. Previous studies have shown that MCM8 plays a significant role in diseases such as ovarian insufficiency and spermatogenesis disorders by influencing the cell cycle, mitosis, and E2F-mediated DNA replication regulation [ 10 ][ 11 ][ 12 ]. Recent studies have found that MCM8 is highly expressed in tumors such as glioblastoma, cholangiocarcinoma, and bladder cancer, promoting malignant progression [ 13 ][ 14 ][ 15 ]. Research has also revealed that MCM8 is positively correlated with the gemcitabine resistance marker RRM1 in pancreatic cancer, suggesting that MCM8 may be involved in gemcitabine resistance [ 16 ]. However, whether MCM8 promotes the occurrence, development, and drug resistance of colorectal cancer remains unclear. It is well-established that proteins serve as the primary carriers of cellular life activities, and abnormal protein expression levels can lead to the development of various diseases, including cancer. The ubiquitin-proteasome system (UPS) is the major pathway for intracellular protein degradation, regulating the degradation of 80% of cellular proteins. The UPS consists of specific enzymes that modify substrate proteins with ubiquitin and the 26S proteasome, which is responsible for the hydrolysis of ubiquitinated substrate proteins [ 17 ]. The conjugation of ubiquitin to substrates occurs through a multistep cascade reaction involving the ubiquitin-activating enzyme (E1), the ubiquitin-conjugating enzyme (E2), and the ubiquitin ligase (E3), which transfers the activated ubiquitin to the target substrate [ 18 ][ 19 ]. This process, known as ubiquitination, ultimately leads to the proteasomal degradation of the ubiquitinated proteins. Previous studies have indicated that dysregulation of the UPS results in the abnormal expression of various proteins, contributing to the onset and progression of tumors [ 18 ][ 20 ][ 21 ]. Hydroxymethylglutary l reductase degradation protein 1 (HRD1), a member of the E3 ubiquitin ligase family, is a critical molecule in the endoplasmic reticulum-associated degradation (ERAD) pathway. It directly catalyzes the conjugation of ubiquitin to unfolded or misfolded proteins for proteasomal degradation [ 22 ]. However, whether MCM8 and HRD1 influence the expression levels of oncogenic proteins via the UPS to promote the malignant progression of colorectal cancer remains unclear and warrants further investigation. Cell Division Cycle 42 (Cdc42), a member of the small GTPase Rho family, is a critical regulator of the actin cytoskeleton and plays a pivotal role in controlling cell motility, polarity, and cell cycle progression [ 23 ]. In the absence of Cdc42, the levels of cyclin D1 decrease, while the levels of p16ink4a increase, leading to cell cycle arrest and ultimately inhibiting cell proliferation [ 24 ]. Previous studies have indicated that Cdc42 is a major factor in the acquisition of trastuzumab resistance in HER2-positive gastric cancer [ 25 ]. Furthermore, Cdc42 has been shown to promote migration and invasion in hepatocellular carcinoma [ 26 ]. Notably, there is limited research on whether Cdc42 is regulated by the UPS in colorectal cancer. In this study, our experimental results demonstrate that MCM8 competitively inhibits the binding of HRD1 to Cdc42, thereby suppressing Cdc42 ubiquitination and promoting its protein stability. This, in turn, facilitates cell cycle arrest, leading to the development of 5-fluorouracil resistance in colorectal cancer. Results 1. High expression of MCM8 in CRC is indicative of unfavorable prognosis To determine if MCM8 expression correlates with malignancy progression and clinical outcomes in CRC, we first analyzed MCM8 levels in the GEO data set. Subsequently, the overall survival (OS) and disease-specific survival (DSS) outcomes were assessed through Kaplan Meier survival analysis. As depicted in Fig. 1 A and 1 B, the expression of MCM8 was found to be elevated in 13 of 16 categories of cancer types, particularly in CRC tumor tissues compared to their respective normal tissue. Furthermore, Kaplan-Meier survival analysis revealed that patients with higher MCM8 expression had reduced DSS rates (Fig. 1 C). A subsequent examination of MCM8 expression utilizing IHC and Western blotting in CRC patients biopsy tissues and adjacent tissues confirmed that MCM8 expression was significantly higher in CRC tissues compared to adjacent tissues (Fig. 1 D and 1 E). Additionally, a comparison to the normal human colon epithelial cell line NCM460 evidenced a marked overexpression of MCM8 in a range of human CRC cell lines (CX-1, HCT-116, HT-29, RKO, SW480, SW620) (Fig. 1 F). These findings collectively suggest that MCM8 serve as a potential prognostic biomarker, indicating higher malignancy and poorer prognosis in CRC. Therefore, we established cell lines with a significant knockdown of MCM8 expression in SW620 and CX-1 cells, and established cell lines with a significant overexpress of MCM8 expression in HCT116 cells. The efficacy of MCM8 knockdown and overexpression was confirmed by Western blotting. (Figure S1 A and S1B). 2. MCM8 functions as an oncogene in CRC To evaluate the influence of MCM8 on CRC cell viability, apoptosis, metastasis and cell cycle, we firstly assessed the impact of MCM8 knockdown and overexpression on cell proliferation. CCK-8 assays indicated that compared with the control group, the cell proliferation and viability of the knockdown group were significantly decreased in SW620 cells and CX-1 cells (Fig. 2 A and S2A), while those of the overexpression group were significantly increased in HCT116 cells (Fig. 2 B). Additionally, to evaluate the effect of MCM8 on CRC cell migration and invasion, we performed wound healing and transwell assays. The results demonstrated a significant decrease in migration and invasion abilities following MCM8 knockdown in SW620 cells and CX-1 cells (Fig. 2 C, 2 E, S2B and S2D), while MCM8 overexpression promoted cell migration and invasion in HCT116 cells (Fig. 2 D and 2 F). Furthermore, MCM8 knockdown cells manifested a higher percentage of apoptotic cells in SW620 cells and CX-1 cells (Fig. 2 G and S2C), whereas MCM8 overexpression cells presented a lower percentage in HCT116 cells (Fig. 2 H). Additionally, flow cytometry was used to detect the effect of MCM8 expression changes on the cell cycle. The results indicated that MCM8 knockdown led to cell cycle arrest at the G1 phase (Fig. 2 I and S2E), while MCM8 overexpression was the opposite, and the Western Blot results showed that after MCM8 knockdown (Fig. 2 J), the cell cycling-related proteins Cyclin D1 and CDK4 in colon cancer cells were downregulated, while the results were the opposite when MCM8 was overexpressed (Fig. 2 I ang 2J). These findings provide strong evidence that MCM8 plays a crucial role in promoting the malignant progression of colon cancer. 3 MCM8 stabilizes CDC42 expression via ubiquitylation To further investigate the molecular mechanism of MCM8, we attempted to identify potential binding proteins of MCM8. We obtained the TOP100 proteins with the highest similarity of MCM8 through the GEPIA2 database and conducted enrichment analysis using the Metascape database. The results of Go-biological process analysis indicated that MCM8-related proteins were significantly enriched in Cell cycle-related pathways such as the Mitotic Cell Cycle and the Regulation of the cell Cycle process (Figure S3 A). The employing tandem affinity purification and LC-MS/MS analysis, the secondary peptide map of MCM8 and the protein set interacting with MCM8 were obtained. We selected the cell cycle-related protein Cdc42 from the IP-MS results for further study (Fig. 3 A and 3 B). Through bioinformatics analysis, we found a significant positive correlation between Cdc42 and MCM8 (FigurecS3B), Cdc42 was highly expressed in colon cancer (Figure S3 C), and the Kaplan-Meier survival curve prediction results revealed that the high expression of Cdc42 was positively correlated with the poor prognosis of colon cancer patients (Figure S3 D). The expression of Cdc42 in the clinical tissues of colon cancer was further analyzed. The immunohistochemical results showed that among 97 patients with colon cancer (collected at Xiangya Hospital of Central South University), the expression of Cdc42 in the tumor tissues of 74 patients was significantly higher than that in the adjacent tissues (Fig. 3 C). The clinical information was statistically analyzed. The results showed that among 74 patients with high expression of Cdc42, 65 patients were in the clinical stage of T2-T4, indicating that high expression of Cdc42 was positively correlated with the clinical stage of colon cancer (Table 1). To clarify the interaction between MCM8 and Cdc42, we conducted detection through Immunocoprecipitation (Co-IP) and immunofluorescence co-localization experiments. The results indicated that MCM8 and Cdc42 interacted in colon cancer cells. (Fig. 3 D and 3 E). To elucidated the regulatory effect of MCM8 on Cdc42, we detected the influence of MCM8 expression changes on the expression of Cdc42 protein by Western Blot and qPCR. The results showed that after knockdown of MCM8, the expression of Cdc42 protein was significantly down-regulated while the mRNA level remained unchanged (Figure S3 E and 3 F). After overexpression of MCM8, the expression of Cdc42 protein increased significantly (Figures S3 G). The above results indicate that in colon cancer cells, MCM8 can positively regulate the protein level of Cdc42.Studies have shown that the mutual binding between protein molecules can affect the stability of target proteins. Therefore, we applied the Cycloheximide (CHX) half-life experiments to demonstrated that when MCM8 was knocked down, the expression level and stability of Cdc42 protein in colon cancer cells decreased significantly (Fig. 3 F). Approximately 80% of intracellular proteins in eukaryotic cells are degraded through the Ubiquitin-Proteasome System (UPS) [ 27 ]. We further explored whether MCM8 achieves stability regulation of Cdc42 protein through UPS. We knocked down MCM8 in colon cancer cell SW620 and treated it with the proteasome inhibitor MG132. The Western Blot results showed that MG132 treatment in colon cancer cells could restore the decreased expression of Cdc42 protein caused by MCM8 knockdown (Fig. 3 G). The degradation of proteins by UPS depends on the ubiquitination modification of the target protein. Therefore, we further explored whether MCM8 would have an impact on the ubiquitination level of Cdc42. The effect of MCM8 on the ubiquitination level of Cdc42 protein was detected by the Ub-IP assay. The results showed that the ubiquitination level of Cdc42 protein decreased significantly after overexpression of MCM8 in colon cancer cells (Fig. 3 H), while the ubiquitination level of Cdc42 protein increased significantly after knockdown of MCM8 (Fig. 3 I). The above results indicate that MCM8 can inhibit the ubiquitination level of Cdc42 protein. 4. MCM8 competes with HRD1 for binding CDC42 to increase its stability in CRC cells The above results indicate that MCM8 can inhibit the ubiquitination modification of Cdc42. To explore the possible mechanism, we analyzed the IP-MS results of MCM8 and took the intersection of the top 200 interacting proteins with the 600 common E3 enzymes in the human body [ 28 ]. E3 ligases HRD1, STUB1 and OTUB1 were discovered (Figure S4 A). Further bioinformatics analysis revealed that among the three, only HRD1 had a significant negative correlation with Cdc42 in colon cancer. Therefore, we speculated that HRD1 might be the E3 ligase of Cdc42 (Figure S3 B-S3D). Meanwhile, Co- IP and immunofluorescence experiment showed that HRD1 physically interacted with CDC42 in the SW620 cells. The results of the Ub-IP experiment showed that the ubiquitination level of Cdc42 protein significantly increased after overexpression of HRD1 in colon cancer cells (Fig. 4 C). After gradient overexpression of HRD1 in the SW620 cells, CDC42 increased in a dose-dependent manner (Fig. 4 D). Moreover, we expressed MCM8 and HRD1 in colon cancer cells. The protein expression levels of MCM8, Cdc42 and HRD1 were detected by Western Blot. The results showed that the protein level of MCM8 was not regulated by the expression level of HRD1. Moreover, the decrease in the expression level of Cdc42 protein caused by overexpression of HRD1 can be restored by the overexpression of MCM8, and the increase in the expression level of Cdc42 protein caused by overexpression of MCM8 can be restored by the overexpression of HRD1 (Fig. 4 E). The results suggest that in colon cancer cells, MCM8 promotes the stability of Cdc42 protein by competitively inhibiting HRD1. Subsequently, we further verified whether the effect of MCM8 on the ubiquitination of Cdc42 was also achieved through competitive inhibition of HRD1. MCM8 and HRD1 were co-expressed in colon cancer cell line HCT116. The ubiquitination levels of Cdc42 protein were detected by Ub-IP. The results showed that the ubiquitination level of Cdc42 protein significantly increased after overexpression of HRD1, while the increased ubiquitination level of Cdc42 protein was restored after overexpression of MCM8 (Fig. 4 F). It is indicated that MCM8 can inhibit the ubiquitination modification of Cdc42 protein by HRD1. Moreover, molecular docking indicates that both MCM8 (G2215) and HRD1 (S363) bind to the same site (E18) of Cdc42, therefore, the Cdc42 binding interface of MCM8 and HRD1 is mutually exclusive (Fig. 4 G), indicating that MCM8 competes with HRD1 for the binding of Cdc42. To sum up, MCM8 in colon cancer cells by competitive inhibition HRD1 of Cdc42 protein ubiquitin modification, inhibit the degradation of UPS, and promote the Cdc42 protein stability. 5. MCM8 promotes malignant progression of CRC through CDC42 in vitro and in vivo Due to the significant overexpression of MCM8 in colorectal cancer and its biological function in promoting malignant progression, we identified that MCM8 regulates and stabilizes CDC42 by competitively inhibiting HRD1. Therefore, we hypothesize that MCM8 promotes the malignant progression of colorectal cancer through the modulation of CDC42. CCK8 assay results demonstrated that knockdown of MCM8 significantly suppressed the proliferation of colorectal cancer cells in the SW620 cell line, whereas overexpression of CDC42 significantly rescued the reduction in cell proliferation caused by MCM8 knockdown in SW620 and CX-1 cells (Fig. 5 A and S5A). This suggests that MCM8 promotes the proliferation of colorectal cancer cells through the regulation of CDC42. Furthermore, flow cytometry results revealed that MCM8 knockdown significantly induced apoptosis in colorectal cancer cells, while overexpression of CDC42 could reverse this effect (Fig. 5 B and S5C). The wound healing assay and Transwell assay showed that the reduction in cell migration and invasion due to MCM8 knockdown was significantly restored by CDC42 overexpression, while MCM8 overexpression enhanced cell migration and invasion, which could be significantly reversed by CDC42 knockdown (Fig. 5 B, 5 E, S5B and S5E). Flow cytometry analysis of cell cycle distribution revealed that following MCM8 knockdown, the cell cycle was arrested at the G1 phase, while co-transfection with the CDC42 expression plasmid led to progression from the G1 to the S phase, promoting the cell cycle. Additionally, Western blot analysis showed that co-transfection with the CDC42 expression plasmid restored the downregulation of cycle-related proteins, including Cyclin D1 and CDK4, caused by MCM8 knockdown (Fig. 5 D and S5D). In summary, these results suggest that MCM8 promotes the malignant progression of colorectal cancer in vitro through the regulation of CDC42 expression. Subsequently, we investigated the effect of MCM8 and CDC42 on the tumorigenic ability of colorectal cancer cells by knocking down MCM8 and simultaneously overexpressing CDC42 in the SW620 cell line, followed by a xenograft tumor formation assay in nude mice. The results showed that overexpression of CDC42 could reverse the tumor volume and weight reduction caused by MCM8 knockdown (Fig. 5 F- 5 H). Western blot analysis of tumor tissues revealed the expression levels of MCM8 and CDC42 (Figure S5 F). Additionally, hematoxylin and eosin (HE) staining and immunohistochemistry (IHC) were performed to examine the expression differences of Ki-67, MCM8, and CDC42 in the tumor tissues. HE staining results demonstrated a reduction in the proportion of parenchymal cells in tumors following MCM8 knockdown, which was partially restored by overexpression of CDC42 (Figure S5 G). IHC analysis showed that CDC42 overexpression could reverse the decrease in the proliferation marker Ki-67 caused by MCM8 knockdown (Fig. 5 I). 6. MCM8 promotes the tumorigenesis ability and 5-FU resistance of SW620-FR cells Oncogenes not only influence tumor initiation and progression but also often promote the development of drug resistance. In particular, the development of resistance to the first-line chemotherapy drug 5-fluorouracil (5-FU) in colorectal cancer is one of the most common issues in clinical practice and frequently leads to poor prognosis and recurrence in patients. Therefore, after investigating the role of MCM8 in promoting colorectal cancer initiation and progression through CDC42, we further explored its impact on the formation of 5-FU resistance in colorectal cancer. We assessed the half-maximal inhibitory concentration (IC50) of 5-FU in parental SW620 cells and 5-FU-resistant SW620-FR cells using the CCK-8 assay. The results showed that the IC50 of SW620-FR cells (677.68 µM) was significantly higher compared to the parental cells (85.45 µM) (Fig. 6 A). The result of western blot showed that the expression of MCM8 and CDC42 was significantly increased in SW620-FR cells compared to the parental cells (Fig. 6 B). We knocked down MCM8 in the SW620-FR cell line. The CCK-8 assay results showed that knocking down MCM8 could significantly reduce the IC50 value of the SW620-FR cell line (Fig. 6 C and 6 D). Further, MCM8 was knocked down and Cdc42 was overexpressed in the SW620-FR cell line. The CCK-8 assay results showed that overexpression of Cdc42 could restore the decrease in IC50 value caused by knocking down MCM8 (Fig. 6 E and 6 F). To investigate the impact of MCM8 on the malignant phenotype of colorectal cancer drug-resistant cell lines, we employed CCK-8 and flow cytometry assays to assess changes in cell proliferation, cell cycle progression, and apoptosis levels following MCM8 knockdown in SW620-FR cells. The results showed that knockdown of MCM8 significantly reduced the proliferation capacity of the colorectal cancer resistant cells, arrested the cell cycle at the G1 phase, and markedly increased the level of apoptosis (Fig. 6 G- 6 I). To validate the role of MCM8 in promoting tumorigenicity and 5-FU resistance in SW620-FR cells, we performed a xenograft tumor formation assay using MCM8 knockdown SW620-FR cells in nude mice. Mice were treated with intraperitoneal injections of 5-FU to investigate the effects of MCM8 on the in vivo tumorigenic ability and drug resistance of colorectal cancer resistant cells. The results showed that, compared to the control group, MCM8 knockdown improved the therapeutic effect of 5-FU and led to a reduction in tumor volume. Western blot analysis of tumor tissues revealed the expression of MCM8, while hematoxylin and eosin (HE) staining and immunohistochemistry (IHC) were used to assess the differences in the expression of Ki-67 and MCM8 in tumor tissues. HE staining results demonstrated that, compared to the control group, MCM8 knockdown combined with 5-FU treatment reduced the proportion of parenchymal cells in the tumor tissues. IHC results further showed that MCM8 knockdown combined with 5-FU treatment led to a further decrease in the expression of the proliferation marker Ki-67. Discussion Colorectal cancer (CRC) is the third most common cancer globally and the second leading cause of cancer-related death worldwide. Its pathogenesis is complex and poses a serious threat to human health. Currently, most patients are diagnosed at advanced stages of the disease, losing the opportunity for surgery. Chemotherapy based on 5-fluorouracil (5-FU) remains the primary treatment modality [ 29 , 30 ]. However, primary or secondary resistance to 5-FU frequently occurs in clinical settings, significantly limiting the effectiveness of treatment [ 31 ]. Therefore, understanding the mechanisms of 5-FU resistance in CRC and identifying potential molecular targets to predict and counteract this resistance are crucial. In this study, we analyzed pathological slides and clinical data from 97 colorectal cancer patients and found that MCM8 and Cdc42 were highly expressed in tumor tissues, and their expression levels were positively correlated with tumor progression, particularly with the T-stage of the tumors MCM8 is a key member of the MCM protein family, plays a central role in DNA replication initiation, homologous recombination repair, and the maintenance of genome stability [ 32 ]. Numerous studies have shown that MCM8 is highly expressed in various tumor tissues, including glioblastoma, gastric cancer, bladder cancer, and colorectal cancer (CRC), where it promotes malignant progression [ 14 , 33 – 35 ]. In recent years, a few studies have reported the mechanisms by which MCM8 promotes the malignant progression of colorectal cancer. For example, research by Mariano Golubicki et al. demonstrated that the knockout of MCM8 leads to defects in DNA mismatch repair (MMR) in colorectal cancer cells, contributing to a recessive genetic pattern of CRC susceptibility [ 36 ]. Furthermore, in colorectal cancer, MCM8 also promotes carcinogenesis through non-DNA damage repair pathways. Shaojun Yu et al. suggested that MCM8 may regulate the expression of CHSY1 by affecting Nedd4-mediated ubiquitination, thereby exerting its tumor-promoting effects [ 35 ]. However, this study is the first to discover that MCM8, by binding to and stabilizing Cdc42, promotes the proliferation, cell cycle progression, and inhibits apoptosis of colorectal cancer cells, thereby promoting the malignant progression of colorectal cancer. This study found that MCM8 positively regulates CDK4 and cyclin D1 proteins, promoting the transition of the cell cycle from the G1 phase to the S phase. Bioinformatics analysis revealed that MCM8 interacting proteins are enriched in signaling pathways regulating cell cycle processes. Further analysis of IP-MS results identified the cell cycle-related protein Cdc42 as an MCM8 interacting protein. It was further confirmed that MCM8 binds to and stabilizes Cdc42 by inhibiting its degradation via the UPS pathway. Abnormal expression of Cdc42 is associated with the development of various diseases, including autoimmune disorders, neurodegenerative diseases, and cardiovascular diseases [ 36 – 38 ]. Recent studies have shown that Cdc42 is highly expressed in multiple tumors, such as ovarian cancer, gastric cancer, and prostate cancer, and its expression is linked to tumor cell invasion, proliferation, and resistance to chemotherapy drugs such as sorafenib and cisplatin [ 40 – 42 ], contributing to malignant progression. In addition to transcriptional regulation and epigenetic abnormalities leading to the high expression of Cdc42 in tumors, studies have also found that dysregulation of the UPS pathway of Cdc42 contributes to its overexpression, thereby promoting tumor malignancy To identify the E3 ligase associated with Cdc42 and MCM8 in colorectal cancer, this study employed IP-MS screening and identified HRD1. HRD1 is an E3 ligase localized to the endoplasmic reticulum, and recent studies have shown that HRD1 can degrade PD-L1 via the UPS pathway in colorectal cancer, alleviating T cell immune suppression and enhancing the activity of tumor-infiltrating T cells, thereby exerting antitumor effects [ 43 ]. In this study, we for the first time confirmed that HRD1 ubiquitinates Cdc42 in colorectal cancer, and this process is competitively inhibited by MCM8. Although we could not completely rule out the possibility that MCM8 regulates Cdc42 through the lysosomal pathway, our experiments, including CHX, MG132, and Ub-IP, strongly support that MCM8 regulates Cdc42 via the UPS pathway. Additionally, through molecular docking, we identified the specific binding sites of MCM8 and HRD1 with Cdc42, although this result has not been experimentally verified. Future experiments will be conducted to further validate these findings. 5-Fluorouracil (5-FU) is a first-line chemotherapeutic agent for various cancers, particularly colorectal cancer (CRC). However, its efficacy is often limited by the development of resistance. Research has shown that 5-FU resistance can arise through multiple mechanisms, including the impact on MDR transporters, DNA damage repair, and the tumor microenvironment [ 30 ]. Chinmayee Sethy et al. reported that 5-FU is metabolized into several active metabolites that disrupt thymidylate synthase (TS) activity and DNA/RNA synthesis, leading to DNA/RNA damage and cell death [ 8 ]. Furthermore, an increasing body of research has demonstrated that MCM family genes can also influence chemotherapeutic resistance through cell cycle regulation[ 44 ]. Additionally, it has been reported that in CRC, Cdc42 promotes oxaliplatin resistance by downregulating the expression of drug efflux proteins P-gp and MRP1 [ 45 ]. In this study, we found that MCM8 and Cdc42 are highly expressed in 5-FU-resistant colorectal cancer cells. MCM8 regulates Cdc42 to affect the IC50 value of 5-FU in CRC, and knockdown of MCM8 enhances 5-FU sensitivity. These findings further support the role of MCM8 in promoting 5-FU resistance in colorectal cancer via Cdc42. In subsequent experiments, we will combine clinical resistance specimens, single-cell sequencing, and various molecular functional assays to explore the specific molecular mechanisms by which MCM8 promotes the development of 5-FU resistance in colorectal cancer. In summary, this study systematically elucidates the specific mechanisms by which MCM8 contributes to the development, progression, and drug resistance of colorectal cancer. It confirms that MCM8 competitively inhibits HRD1-mediated ubiquitin degradation of Cdc42, enhancing the stability of Cdc42 protein, thereby promoting colorectal cancer cell proliferation, cell cycle progression, migration, invasion, and resistance. The findings provide new potential targets for the clinical diagnosis and treatment of colorectal cancer, offering theoretical support and novel strategies to improve the prognosis of colorectal cancer patients. Materials and Methods Data Collection Transcriptomic data from CRC patient samples, along with corresponding clinical information, were retrieved from repositories such as The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. Only datasets with comprehensive clinical annotations and gene expression profiles were included in the analysis. Clinical tissue samples Colorectal Cancer Fresh Tissue: Eight paired fresh samples were obtained from Hunan Provincial Cancer Hospital for Western Blot analysis of MCM8 expression. Colorectal Cancer Patient Tissue Sections: Ninety-seven pathological tissue sections were obtained from Xiangya Hospital, Central South University, for immunohistochemical analysis of MCM8 and Cdc42 expression. All tissue samples were collected with informed consent from the patients and approved by the ethics committees of Hunan Provincial Cancer Hospital and Xiangya Hospital. Tumor samples were identified by pathologists. Cell culture and transfection The normal colonic epithelial cell line NCM460 and CRC cell lines CX-1、HCT116、HT29、RKO、SW480、SW620 were purchased from the Cell Bank of the Chinese Academy of Science (Shanghai, China). These cells were cultured in DMEM medium (Gibco, USA), with all media enriched with 10% fetal bovine serum. streptomycin (Gibco, USA) at 37℃ in 5%CO 2 . Plasmid Transfection: Taking one well of a six-well plate as an example, cells in the logarithmic growth phase were used for transfection when the cell density reached 60–80%. Neofect transfection reagent was used for transfection, and the transfection reagent was prepared according to the manufacturer's instructions: 100 µL pure DMEM culture medium, 2 µL Neofect transfection reagent, and 2 µg of the target plasmid were mixed, followed by incubation at room temperature for 15–30 minutes. After incubation, the mixture was added dropwise to the well containing 1.9 mL of complete culture medium. The cells were then transferred to a cell incubator and cultured for 36–48 hours before performing transfection efficiency assays and subsequent experiments.2.4 Immunohistochemistry (IHC) analysis We collected formalin-fixed paraffin-embedded (FFPE) samples from 98 CRC patients treated at Hunan Cancer Hospital (Changsha, China) between February 2016 and November 2020. Pathological sections were dried in a desiccator at 60–70°C for 1hour, then rehydrated through an alcohol concentration gradient and placed in 0.01 M sodium citrate buffer at 100°C for antigen retrieval. Endogenous peroxidase activity was blocked by incubation with 3% hydrogen peroxide solution at room temperature for 10 minutes. After three washes with PBS (three minutes each), the slides were incubated with the primary antibody (1:100 dilution) at 4°C overnight and then with the secondary antibody (Transgon, China) at room temperature for 20 minutes. 3,3′-diaminobenzidine (DAB) staining and hematoxylin counterstaining were performed. The sections were examined under a microscope after dehydration through an alcohol gradient and coating with neutral resin. Western blot analysis Proteins were extracted utilizing TPEB buffer (Invitrogen, Carlsbad, CA), and their concentrations were determined through a BCA analysis kit (Beyotime Biotechnology, Shanghai, China). Protein samples were separated by SDS-PAGE gel and transferred to a 0.25 µm PVDF membrane (Millipore, Bedford, MA). After blocking with 5% skim milk in TBST (Tris-buffered saline and Tween-20) for 1 hour, the membranes were incubated overnight at 4◦C with primary antibodies against MCM8 (proteintech, CN, 16451-1-AP), Cdc42(Santa, USA, sc-8401),Ub (proteintech, CN, 10201-2-AP) Cyclin D1 (proteintech, CN, 60186-1-Ig), CDK4 (proteintech, CN, 11026-1-AP), HRD1 (proteintech, CN, 16451-1-AP) and Ki67 (GeneTex, USA, GTX103436). Following incubation with a secondary antibody (Transgon, China) for 2 hours at room temperature, an appropriate amount of Enhanced Chemiluminescence (ECL) reagent was prepared by mixing reagent A and B in equal volumes and then applied to the surface of the PVDF membrane. The protein blot was visualized via a chemiluminescence imaging system, and ImageLab (Bio-Rad, California, USA) was utilized to process the images. Quantitative reverse transcriptase-PCR (qRT-RCR) Total RNA was isolated employing TRIzol reagent (Invitrogen, Carlsbad, CA), with reverse transcription conducted using a reverse transcription kit (Takara, Japan); thereafter, cDNA was ampliffed in accordance with the manufacturer’s guidelines. The primer sequences essential for ampliffcation were as follows: MCM8 forward: GCTCTCCTCTCACAGTTACGATGG, reverse: GTGGAATCCGACCTGCTTCTCTC; Ccd42 forward: CCCTCTACTATTGAGAAACTTG, reverse: AGAACACTCCACATACTTGA. Construction of cell lines stably expressing MCM8 shRNA3, and corresponding control lentivirus shNC (ZV101-Amp-GFP-puromycin) were synthesized by Zorin Biological. Following a 48-hour infection, CRC cells were subjected to puromycin selection (1 µg/mL) for two weeks to establish stably transfected cells. Cell viability assay Cell viability was assessed using CCK-8 kits (Biosharp, China) according to the manufacturer’s instructions. Cells were plated into 96- well plates and, after adhesion, were treated with varying concentration gradients of drugs for 24 hours. Subsequently, CCK-8 reagent was introduced (10 µL/well) and incubated at 37 ◦C for 2 hours. Absorbance was recorded at 450 nm, and cell viability was computed as follow: (cell viability (%) = [A (dosing) − A (blank)]/[A (0 dosing) − A (blank)] × 100). Wound healing assay and transwell assay Wound Healing Assay: Transfected cells were seeded in 6-well plates, and images were taken at 0, 24, and 48 hours to monitor cell migration. Transwell Assay: After 24 hours of incubation, migrated cells were fixed and stained with 0.1% crystal violet. Invasion was quantified by counting the cells that invaded Matrigel and adhered to the lower membrane surface. Cell apoptosis assay Cell suspensions and cells digested with EDTA-free trypsin were gathered and washed with pre-cooled PBS, followed by staining with an apoptosis detection kit (Vazyme, China). After 10 minutes of incubation at room temperature in obscurity, flow cytometry analyzed the stained specimens within one hour. Co-immunoprecipitation (Co-IP) assays Following expansion of a substantial number of SW620 cells, proteins were collected and extracted. Magnetic beads were added to the protein solution and incubated at 4°C for 30 min. Subsequently, the magnetic beads were separated using a magnetic rack, and the remaining protein solution was transferred to a new EP tube. The protein solutions were divided into two groups: the IgG group and the target molecular antibody group. Corresponding antibodies (MCM8: proteintech, CN, 16451-1-AP, 1:1000; CDC42: Santa, USA, sc-8401, 1:1000; HRD1: proteintech, CN, 13473-1-AP, 1:1000) were added to each group and incubated overnight on a shaking table at 4°C. A suitable amount of magnetic bead solution was divided into two groups, washed twice with pre-cooled PBS, and added to the protein-antibody complex, reacting at4°C for approximately 4–6 h. The EP tube was placed on a magnetic rack to separate the magnetic beads from the protein solution. After separation, the solution underwent boiling at 100°C for 10 min until protein denaturation. Following centrifugation and magnetic bead separation, the upper liquid was collected for subsequent Western blot detection. All blots and gels were derived from the same experiment and were processed in parallel. Silver nitrate staining In this experiment, the Beyotime rapid silver dyeing kit (P0017S) was employed for silver staining of the gel obtained through electrophoresis. The subsequent differential bands were acquired for mass spectrometry analysis and detection. The procedure involved the following steps: The gel blocks post-electrophoresis were placed in a clean box and fixed at room temperature on a shaking table for 2 h. Subsequently, after absorbing the fixed solution and cleaning with ethanol, the gel blocks were rinsed twice with ddH2O. Following water absorption, silver sensitizing solution was added for 2 min. After absorbing and discarding ddH2O, an appropriate volume of silver solution was added, and incubation ensued at room temperature for 10 min. The previous liquid was discarded, and the gel blocks were washed twice. The reaction was terminated after absorbing and discarding water, by adding silver dye coloring solution and incubating for 3–10 min until clear and distinct protein bands emerged. Finally, the differentiated bands were photographed in a well-lit environment and excised for subsequent mass spectrometry analysis. Immunofluorescence Cells were fixed on a cell pad using 4% paraformaldehyde for 15–30 min, cleaned with PBS to remove excess fixative. A 0.1–0.5% Triton X-100 PBS solution enhanced antibody penetration. The sample was blocked with a PBS solution containing bovine serum albumin or other blockers for 30 min to 1h. Overnight incubation at 4°C with diluted primary antibodies was followed by PBS cleaning to remove unbound antibodies. Fluorescently labeled secondary antibodies were added and incubated for 1–2 h, with PBS cleaning to remove unbound secondary antibodies. Nuclei were stained with DAPI or other dyes. After covering with anti-fading sealant, fluorescence microscopy was used for observation and image capture to analyze fluorescence signal distribution and intensity. Animal experiments Four-week-old nude male mice (BALB/c nu/nu) were obtained from the Laboratory Animal Center of Central South University and maintained in pathogen-free conditions. All animal experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals of Xiangya Hospital, Central South University (Changsha, China), with the approval of the Institutional Animal Ethics Committee. Xenograft mouse models: Cells in the active growth phase were digested with trypsin and counted. After resuspension in saline, an equal volume of matrigel was added, ensuring a concentration of 1×10 7 cells/ml. The cell suspension was kept on ice for use. Based on a dose of 1×10 6 cells per mouse, the cell suspension was injected subcutaneously into the back of nude mice. Mouse body weight (in grams) and tumor volume (calculated as volume = length × short diameter 2 , in mm 3 ) were measured every three days. When the tumor size reached approximately 3000 mm 3 , the nude mice were euthanized, and the xenograft tumors were harvested. Tumor volume and weight were measured, and the samples were prepared for subsequent experiments. Intraperitoneal Injection: The 5-FU (AmBeed) powder was dissolved in PBS containing 2% DMSO according to the manufacturer's instructions, and the solution was prepared and stored at -20°C for later use. At a dosage of 25 mg/kg, 5-FU (with the control group receiving PBS containing 2% DMSO) was injected into the peritoneal cavity of nude mice every three days. Statistical analysis Statistical analysis: All statistical analyses utilized R software or GraphPad Prism 8. Student’s t test determined statistical differences between the experimental and control groups. One-way ANOVA, followed by Tukey’s post hoc test, assessed differences among multiple groups. Unless otherwise stated, significance was defined as P < 0.05. Declarations Authors' contributions Qiang Liu. and Bin Zhang contributed the idea for the article. Yuxuan Tian. performed the bioinformatics analysis. Siyi Qian and Longwu Zeng performed the experiments and wrote the original manuscript. Fuxin Chen and Binjei Zhao analyzed the data. Qiang Liu. and Bin Zhang revised the manuscript. All authors read and approved the final manuscript. Siyi Qian and Longwu Zeng have made equally significant contributions to the work and share equal responsibility and accountability for it. Funding This article was funded by the National Natural Science Foundation of China (Grant No. 82073099), Natural Science Foundation of Hunan Province (Grant No. 2024JJ5462) and the Hunan Province University Reform and Development funds of Hunan Provincial financial Department (xiang cai jiao zhi [2023] No.31). Ethics approval and consent to participate Ethical permissions were granted by the institutional review board of the Hunan Cancer Hospital of Central South University. All patients provided their informed written consent to participate in this study. Consent for publication Not applicable. Availability of data and material Raw RNA sequence data that support the findings of this study are available from the TCGA or GEO, respectively. Further inquiries can be directed to the corresponding author. References TIRENDI S, MARENGO B, DOMENICOTTI C, et al. Colorectal cancer and therapy response: a focus on the main mechanisms involved [J]. Front Oncol, 2023, 13: 1208140. SIMON K. Colorectal cancer development and advances in screening [J]. Clin Interv Aging, 2016, 11: 967-976. XIE Y H, CHEN Y X, FANG J Y. Comprehensive review of targeted therapy for colorectal cancer [J]. Signal Transduct Target Ther, 2020, 5(1): 22. TAMRAZ M, AL GHOSSAINI N, TEMRAZ S. Optimization of colorectal cancer screening strategies: New insights [J]. World J Gastroenterol, 2024, 30(28): 3361-3366. LEOWATTANA W, LEOWATTANA P, LEOWATTANA T. Systemic treatment for metastatic colorectal cancer [J]. World J Gastroenterol, 2023, 29(10): 1569-1588. SHIN A E, GIANCOTTI F G, RUSTGI A K. Metastatic colorectal cancer: mechanisms and emerging therapeutics [J]. Trends Pharmacol Sci, 2023, 44(4): 222-236. Ludwig PS, Schwendener RA, Schott H. Synthesis and anticancer activities of amphiphilic 5-fluoro-2'-deoxyuridylic acid prodrugs. Eur J Med Chem. 2005;40(5):494-504. doi:10.1016/j.ejmech.2004.12.006. Sethy C, Kundu CN. 5-Fluorouracil (5-FU) resistance and the new strategy to enhance the sensitivity against cancer: Implication of DNA repair inhibition. Biomed Pharmacother. 2021;137:111285. doi:10.1016/j.biopha.2021.111285. Griffin WC, Trakselis MA. The MCM8/9 complex: A recent recruit to the roster of helicases involved in genome maintenance. DNA Repair (Amst). 2019 Apr;76:1-10. Park J, Long DT, Lee KY, Abbas T, Shibata E, Negishi M, Luo Y, Schimenti JC, Gambus A, Walter JC, Dutta A. The MCM8-MCM9 complex promotes RAD51 recruitment at DNA damage sites to facilitate homologous recombination. Mol Cell Biol. 2013 Apr;33(8):1632-44. ]Lee KY, Im JS, Shibata E, Park J, Handa N, Kowalczykowski SC, Dutta A. c. Nat Commun. 2015 Jul 28;6:7744. Zhang YX, He WB, Xiao WJ, Meng LL, Tan C, Du J, Lu GX, Lin G, Tan YQ. Novel loss-of-function mutation in MCM8 causes premature ovarian insufficiency. Mol Genet Genomic Med. 2020 Apr;8(4):e1165. Ren Z, Li J, Zhao S, Qiao Q, Li R. Knockdown of MCM8 functions as a strategy to inhibit the development and progression of osteosarcoma through regulating CTGF. Cell Death Dis. 2021 Apr 7;12(4):376. Wang X, Zhang L, Song Y, Jiang Y, Zhang D, Wang R, Hu T, Han S. MCM8 is regulated by EGFR signaling and promotes the growth of glioma stem cells through its interaction with DNA-replication-initiating factors. Oncogene. 2021 Jul;40(27):4615-4624. Desai S, Wood-Trageser M, Matic J, Chipkin J, Jiang H, Bachelot A, Dulon J, Sala C, Barbieri C, Cocca M, Toniolo D, Touraine P, Witchel S, Rajkovic A. MCM8 and MCM9 Nucleotide Variants in Women With Primary Ovarian Insufficiency. J Clin Endocrinol Metab. 2017 Feb 1;102(2):576-582. Peng YP, Zhu Y, Yin LD, Zhang JJ, Guo S, Fu Y, Miao Y, Wei JS. The Expression and Prognostic Roles of MCMs in Pancreatic Cancer. PLoS One. 2016 Oct 3;11(10):e0164150. NARAYANANS, CAICY, ASSARAFYG, et al. Targeting the ubiquitin-proteasome pathway to overcome anti-cancer drug resistance [J]. Drug Resist Updat, 2020, 48: 100663. PARK J, CHO J, SONG E J. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment [J]. Arch Pharm Res, 2020, 43(11): 1144-1161. YUAN T, YAN F, YING M, et al. Inhibition of Ubiquitin-Specific Proteases as a Novel Anticancer Therapeutic Strategy [J]. Front Pharmacol, 2018, 9: 1080 GIELSDORF W, SCHUBERT K. [Biotransformation of doxylamine: isolation, identification and synthesis of some metabolites (author's transl)] [J]. J Clin Chem Clin Biochem, 1981, 19(7): 485-490. ARPALAHTI L, HAGLUND C, HOLMBERG C I. Proteostasis Dysregulation in Pancreatic Cancer [J]. Adv Exp Med Biol, 2020, 1233: 101-115. XU Y, FANG D. Endoplasmic reticulum-associated degradation and beyond: The multitasking roles for HRD1 in immune regulation and autoimmunity [J]. J Autoimmun, 2020, 109: 102423. MURPHY N P, MOTT H R, OWEN D. Progress in the therapeutic inhibition of Cdc42 signalling [J]. Biochem Soc Trans, 2021, 49(3): 1443-1456. STENGEL K R, ZHENG Y. Essential role of Cdc42 in Ras-induced transformation revealed by gene targeting [J]. PLoS One, 2012, 7(6): e37317. HU X, MA Z, XU B, et al. Glutamine metabolic microenvironment drives M2 macrophage polarization to mediate trastuzumab resistance in HER2-positive gastric cancer [J]. Cancer Commun (Lond), 2023, 43(8): 909-937. WANG T, RAO D, YU C, et al. RHO GTPase family in hepatocellular carcinoma [J]. Exp Hematol Oncol, 2022, 11(1): 91. FHU C W, ALI A. Dysregulation of the Ubiquitin Proteasome System in Human Malignancies: A Window for Therapeutic Intervention [J]. Cancers (Basel), 2021, 13(7): 13071513. LEE J, LEE Y, JUNG Y M, et al. Discovery of E3 Ligase Ligands for Target Protein Degradation [J]. Molecules, 2022, 27(19): 27196515. LI Q, GENG S, LUO H, et al. Signaling pathways involved in colorectal cancer: pathogenesis and targeted therapy [J]. Signal Transduct Target Ther, 2024, 9(1): 266. VODENKOVA S, BUCHLER T, CERVENA K, et al. 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future [J]. Pharmacol Ther, 2020, 206: 107447. ZENG H, CHEN W, ZHENG R, et al. Changing cancer survival in China during 2003-15: a pooled analysis of 17 population-based cancer registries [J]. Lancet Glob Health, 2018, 6(5): e555-e567. HELDERMAN N C, TERLOUW D, BONJOCH L, et al. Molecular functions of MCM8 and MCM9 and their associated pathologies [J]. iScience, 2023, 26(6): 106737. HUANG B, LIN M, LU L, et al. Identification of mini-chromosome maintenance 8 as a potential prognostic marker and its effects on proliferation and apoptosis in gastric cancer [J]. J Cell Mol Med, 2020, 24(24): 14415-14425. ZHU W, GAO F, ZHOU H, et al. Knockdown of MCM8 inhibits development and progression of bladder cancer in vitro and in vivo [J]. Cancer Cell Int, 2021, 21(1): 242. YU S, DAI W, ZHAO S, et al. Function and mechanism of MCM8 in the development and progression of colorectal cancer [J]. J Transl Med, 2023, 21(1): 623. Golubicki M, Bonjoch L, Acuña-Ochoa JG, et al. Germline biallelic Mcm8 variants are associated with early-onset Lynch-like syndrome. JCI Insight. 2020;5(18):e140698. Published 2020 Sep 17. doi:10.1172/jci.insight.140698 ZHANG Q, JIN D, MOU X, et al. PBMC CDC42 reveals the disease activity and treatment efficacy of TNF inhibitor in patients with ankylosing spondylitis [J]. J Clin Lab Anal, 2022, 36(3): e24267. ZHU M, XIAO B, XUE T, et al. Cdc42GAP deficiency contributes to the Alzheimer's disease phenotype [J]. Brain, 2023, 146(10): 4350-4365. MAILLET M, LYNCH J M, SANNA B, et al. Cdc42 is an antihypertrophic molecular switch in the mouse heart [J]. J Clin Invest, 2009, 119(10): 3079-3088. XIE W, HAN Z, ZUO Z, et al. ASAP1 activates the IQGAP1/CDC42 pathway to promote tumor progression and chemotherapy resistance in gastric cancer [J]. Cell Death Dis, 2023, 14(2): 124. NOVAK C M, HORST E N, LIN E, et al. Compressive Stimulation Enhances Ovarian Cancer Proliferation, Invasion, Chemoresistance, and Mechanotransduction via CDC42 in a 3D Bioreactor [J]. Cancers (Basel), 2020, 12(6): 12061521. MALDONADO M D M, MEDINA J I, VELAZQUEZ L, et al. Targeting Rac and Cdc42 GEFs in Metastatic Cancer [J]. Front Cell Dev Biol, 2020, 8: 201. XIA J, XU M, HU H, et al. 5,7,4'-Trimethoxyflavone triggers cancer cell PD-L1 ubiquitin-proteasome degradation and facilitates antitumor immunity by targeting HRD1 [J]. Med Comm (2020), 2024, 5(7): e611. Liu X, Zhang F, Fan Y, Qiu C, Wang K. MCM4 potentiates evasion of hepatocellular carcinoma from sorafenib-induced ferroptosis through Nrf2 signaling pathway. Int Immunopharmacol. 2024;142(Pt A):113107. doi:10.1016/j.intimp.2024.113107 WANG L, LIU X. Pan-Cancer Multi-Omics Analysis of Minichromosome Maintenance Proteins (MCMs) Expression in Human Cancers [J]. Front Biosci (Landmark Ed), 2023, 28(9): 230. Table 1 Table 1 is available in the Supplementary Files section. Supplementary Files Table1.docx S1.pdf renamed31086.pdf Figure S2 S3.pdf S4.pdf S5.pdf S6.pdf Cite Share Download PDF Status: Published Journal Publication published 16 Jan, 2026 Read the published version in Journal of Translational Medicine → Version 1 posted Reviewers agreed at journal 06 Aug, 2025 Reviewers invited by journal 06 Aug, 2025 Editor assigned by journal 05 Aug, 2025 First submitted to journal 03 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7116246\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":496764969,\"identity\":\"ade39ab2-d869-43d1-93f7-4704a06926b9\",\"order_by\":0,\"name\":\"Siyi Qian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Siyi\",\"middleName\":\"\",\"lastName\":\"Qian\",\"suffix\":\"\"},{\"id\":496764970,\"identity\":\"55ad1899-afc4-4614-86be-1f67027f020e\",\"order_by\":1,\"name\":\"Longwu Zeng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Longwu\",\"middleName\":\"\",\"lastName\":\"Zeng\",\"suffix\":\"\"},{\"id\":496764971,\"identity\":\"6ab6993a-625b-4061-a2b9-6c8ea4ce9337\",\"order_by\":2,\"name\":\"Fuxin Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fuxin\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":496764972,\"identity\":\"e9080d62-25f9-4b20-9912-44b8f0ce768e\",\"order_by\":3,\"name\":\"Yuxuan Tian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuxuan\",\"middleName\":\"\",\"lastName\":\"Tian\",\"suffix\":\"\"},{\"id\":496764973,\"identity\":\"05407e8f-40fe-4729-9d15-889e6b893fbd\",\"order_by\":4,\"name\":\"Binjie Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Binjie\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":496764974,\"identity\":\"9ae8455f-4df0-4919-9a87-1b720fa3091b\",\"order_by\":5,\"name\":\"Qiang Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qiang\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":496764975,\"identity\":\"e996fcbf-2dff-4432-8e55-888df39ea5cb\",\"order_by\":6,\"name\":\"Bin Zhang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYDACCSBmbJAA0wcYGGx4+PkbiNbCDNKSJiM54wBRWhjAWoDgsI1BQwJ+HfKzm589/LrDIk+yvf/gwZ9t53kMGA4wfviYg1sL45xj5sayZySKpXkOMxyQbLvNY87cwCw5cxtuLcwSCWbSkm0SifMkkhkOGAK1WDYcYGPmxaOFTSL9G0SL/GOGA4lt53gMDiTg18IjkWMm+RGoZbYEMMQOth0grEVCIqdMmvGMROLMnmSDgw3nknkkZxxsxusX+Rnp2yR/7qhLnHH84OOPP8rs7Pn5mw9++IhHCzgIeFD5oGgiABh/EFQyCkbBKBgFIxoAAJsEUcvCT9a+AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Central South University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Bin\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-14 02:38:33\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7116246/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7116246/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12967-026-07687-0\",\"type\":\"published\",\"date\":\"2026-01-16T16:30:15+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":88894630,\"identity\":\"a972fe54-3b82-4288-b8fd-04c87fd4fc29\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:02:58\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":572461,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHigh expression of MCM8 in CRC is indicative of unfavorable prognosis.\\u003c/strong\\u003e (A). Differential analysis of PTPN12 protein levels across the TCGA database; (B). Expression profiles from dataset GSE71187; (C). Kaplan-Meier plots illustrating Disease-free survival and overall survival in CRC patients with high vs. low MCM8 expression from TCGA-CRC; (D). Validation of MCM8 protein expression in clinical samples analyzed by immunohistochemistry (IHC); (E). Western blot assay elucidating the differential expression of MCM8 in tissue samples derived from patients; (F) The protein levels of MCM8 in normal colonic epithelial cells NCM460C and colon cancer cell lines (CX-1, HCT116, HT29, RKO, SW480, SW620) were detected by Western blot. * P \\u0026lt; 0.05, ** P \\u0026lt; 0.01, *** P \\u0026lt; 0.001, **** P \\u0026lt; 0.001, and ns represents not significant\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/b65c9523f526310e7e1151c2.png\"},{\"id\":88897033,\"identity\":\"f62352a5-7e3c-4127-bdde-443aa5ebc3fa\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:10:58\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":614544,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMCM8 functions as an oncogene in CRC (A.B.) CCK-8 assays with SW620 cells and HCT116 cells partially knocked down MCM8 by shRNA or expressing MCM8; (C.D.) Cell migration assessed by wound healing assay; (E. F.) Cell invasion measured using the transwell invasion assay; (G.H.) Flow cytometry methodologies were employed to scrutinize the impact of MCM8 modulation on the apoptotic landscape in SW620 cells and HCT116 cells with either knocked down oroverexpressed MCM8; (I.J.) Flow cytometry methodologies were employed to scrutinize the impact of MCM8 modulation on the cell cycle in SW620 cells and HCT116 cells with either knocked down oroverexpressed MCM8. * P \\u0026lt; 0.05, ** P \\u0026lt; 0.01, *** P \\u0026lt; 0.001, and ns represents not significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/57cdaeb5236507e231abb016.png\"},{\"id\":88894632,\"identity\":\"e5a6bcd4-7bfc-4f7e-b27f-19270a373f6c\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:02:59\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":591336,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMCM8 stabilizes CDC42 expression via ubiquitylation (A). IP experiment capturing MCM8 interacting proteins for subsequent silver nitrate staining; (B). MCM8 secondary peptide segment map; (C). The expression of Cdc42 was detected by IHC in normal colon tissues and colon cancer tissue samples of 97 pairs of colon cancer patients. The above figure is a representative graph of the results; (D). Co-IP was used to detect the interaction between MCM8 and Cdc42 in colon cancer cells; (E). The localization of MCM8 (TrITC-labeled) and Cdc42 (FITC-labeled) proteins in colon cancer cells was observed by laser confocal microscopy, and the cell nuclei were stained with DAPI. The representative field of view is shown in the figure, with a scale of 5μm; (F). MCM8 was knocked down in SW620 cells. After applying CHX with a time gradient, the Cdc42 protein level at each time period was detected by Western Blot to observe the changes in protein stability; (G). MCM8 was knocked down in SW620 cells. After treatment with proteasome inhibitor MG132, the protein expression changes of MCM8 and Cdc42 were detected by Western Blot; (H). MCM8 was overexpressed in HCT116 cells, and the effect of overexpression of MCM8 on the ubiquitination level of Cdc42 protein was detected by Ub-IP; (I). MCM8 was knocked down in SW620 cells, and the effect of knocking down MCM8 on the ubiquitination level of Cdc42 protein was detected by Ub-IP. * P \\u0026lt; 0.05, ** P \\u0026lt; 0.01, *** P \\u0026lt; 0.001, and ns represents not significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/4f1cf57bdf9920e919dee095.png\"},{\"id\":88897034,\"identity\":\"6eaa025d-77e6-48ec-96c7-87d72ad6626e\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:10:59\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":464170,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMCM8 competes with HRD1 for binding CDC42 to increase its stability in CRC cells. \\u003c/strong\\u003e(A). Co-IP was used to detect the interaction between Cdc42 and HRD1 in colon cancer cells; (B). The localization of Cdc42 (FITC-labeled) and HRD1 (TrITC-labeled) proteins in colon cancer cells was observed by laser confocal microscopy, and the cell nuclei were stained with DAPI. The figure shows the representative field of view, with a scale of 5μm; (C). HRD1 was overexpressed in colon cancer cell SW620, and the ubiquitination level of Cdc42 protein was detected by the Ub-IP assay; (D). HRD1 was gradientially overexpressed in colon cancer cell SW620, and the changes in the protein levels of Cdc42 and MCM8 were detected by Western Blot; (E). HRD1 and MCM8 were overexpressed simultaneously in HCT116, and the protein expression levels of MCM8, Cdc42 and HRD1 were detected by Western Blot; (F). MCM8 was overexpressed, HRD1 was overexpressed, and both MCM8 and HRD1 were overexpressed simultaneously in HCT116. The changes in the ubiquitination level of Cdc42 protein were detected by Ub-IP; (G). Both the D140 and T143 of MCM8 (yellow, Protein Data Bank code: 7dp3) and the E19 and Q17 of HRD1 (green, Protein Data Bank code: 6a3z) bind to the Q316, S283 and K328 of PD-L1 (pink, Protein Data Bank code: 1a4r). * P \\u0026lt; 0.05, ** P \\u0026lt; 0.01, *** P \\u0026lt; 0.001, *** P \\u0026lt; 0.0001, and ns represents not significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/71394db0b7722fe5c2b16bd9.png\"},{\"id\":88897035,\"identity\":\"849fd7c2-5672-471e-8011-4f92c3a35ae7\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:10:59\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":760574,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A). MCM8 was knocked down and Cdc42 was overexpressed in SW620 cells, and the proliferation ability of cells in each group was detected by CCK-8 assay. (B). The cell migration assessed by wound healing assay. (C). The apoptosis of each group of cells was detected by flow cytometry. (D). The degree of cell cycle arrest in each group was detected by flow cytometry, and the expression changes of cycl-related proteins were detected by Western Blot. (E). The changes in cell invasion ability were detected by Transwell assay. (F). Comparison of tumor size between the experimental group and the control group in the nude mouse tumor model. (G). The growth curve of tumor volume in mice (volume = long diameter × short diameter × short diameter, unit: mm\\u003csup\\u003e3\\u003c/sup\\u003e) was drawn, and the differences in tumor volume growth among each group were compared (*P \\u0026lt; 0.05, the difference was statistically significant). (H). Tumor weight dynamics were monitored tri-weekly (n=4). (I). Immunohistochemical staining was employed to evaluate the expression levels of MCM8, Cdc42, and Ki67 in subcutaneous tumors. Scale bar: 100 μm. * P \\u0026lt; 0.05, ** P \\u0026lt; 0.01, *** P \\u0026lt; 0.001, *** P \\u0026lt; 0.0001, and ns represents not significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/90ad370bfdf6a0851580b315.png\"},{\"id\":88897988,\"identity\":\"efcadfe3-c8a5-47c1-ad4d-608f146aaf00\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:18:59\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":689140,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A). After treating colon cancer cells SW620 and 5-FU-resistant cells SW620-FR with A 5-FU concentration gradient, the difference in IC50 against 5-FU between the two was detected by CCK-8; (B). Western Blot was used to detect the differences in the expression of MCM8 and Cdc42 proteins in colon cancer cell SW620 and 5-FU-resistant cell SW620-FR; (C. D.) An MCM8 knockdown model was constructed in the 5-FU-resistant colon cancer cell SW620-FR, and the effect of knockdown MCM8 on the IC50 of drug-resistant cells was detected by the CCK-8 assay; (E. F.) A MCM8 knockdown and overexpression Cdc42 response model was constructed in the 5-FU-resistant colon cancer cell SW620-FR, and the effect of MCM8 knockdown on the IC50 of drug-resistant cells was detected by the CCK-8 assay; (G). Knockdown of MCM8 in 5-FU-resistant colon cancer cells SW620-FR, and the effect of MCM8 changes on the proliferation ability of colon cancer drug-resistant cells was detected by CCK-8 reagent (***P \\u0026lt; 0.001, the difference was statistically significant); (H). The effect of MCM8 changes on the apoptosis of colon cancer drug-resistant cells by flow cytometry; (I). The effect of MCM8 changes on the cell cycle process of colon cancer drug-resistant cells by flow cytometry; (J). Comparison of tumor size between the experimental group and the control group in the nude mouse tumor model; (K). After the injection of xenograft tumors, the tumor volume growth curve of mice (volume = long diameter × short diameter × short diameter, unit: mm\\u003csup\\u003e3\\u003c/sup\\u003e) was plotted, and the differences in tumor volume growth among each group were compared (*P \\u0026lt; 0.05, the difference was statistically significant); (L). Tumor weight dynamics were monitored tri-weekly (n=4); (M). Western Blot was used to detect the expression of MCM8 in tumors of each group; (N). Immunohistochemical staining was employed to evaluate the expression levels of MCM8 and Ki67 in subcutaneous tumors. Scale bar: 100 μm. * P \\u0026lt; 0.05, ** P \\u0026lt; 0.01, *** P \\u0026lt; 0.001, *** P \\u0026lt; 0.0001, and ns represents not significant.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/4fe5b9baad8db844ae6bcd6d.png\"},{\"id\":100614803,\"identity\":\"dc2d9c44-66ea-46cd-90da-217265956ce1\",\"added_by\":\"auto\",\"created_at\":\"2026-01-19 17:25:38\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":4465608,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/f9078e22-5527-402a-b2f2-0b3f4cd373a4.pdf\"},{\"id\":88894628,\"identity\":\"988cea44-3422-4c04-aad0-9035c35c1604\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:02:58\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":36646,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Table1.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/7e591835ae44144323699779.docx\"},{\"id\":88894634,\"identity\":\"0513e5d2-4a40-4986-9be4-9749a460fbc4\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:02:59\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":316153,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/d337e7c4059b21281b98f686.pdf\"},{\"id\":88897038,\"identity\":\"84edd046-a92d-4107-8c03-560f385b01da\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:10:59\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":983142,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFigure S2\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"renamed31086.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/3d87a28f957487d80164aa01.pdf\"},{\"id\":88897037,\"identity\":\"de527956-e3fe-4ab8-9cad-d5e7b763e553\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:10:59\",\"extension\":\"pdf\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1164856,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/e207a8be4014f060cef26144.pdf\"},{\"id\":88894646,\"identity\":\"8a53ff85-ffbb-49f9-a870-5b2b63579d78\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:02:59\",\"extension\":\"pdf\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":966387,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S4.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/e869143bc25add8a74595cc8.pdf\"},{\"id\":88894667,\"identity\":\"20c58c49-b822-4d42-9914-6e4d3d9bc2fc\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:02:59\",\"extension\":\"pdf\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":36180408,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S5.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/cd7b18434e69f025ed3f42ea.pdf\"},{\"id\":88899245,\"identity\":\"660bc00a-fb99-41d3-a8fd-e57e1b2be7e2\",\"added_by\":\"auto\",\"created_at\":\"2025-08-12 13:26:59\",\"extension\":\"pdf\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":8696008,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"S6.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7116246/v1/e9f651775eec244b5d86d94a.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"MCM8 Promotes NSCLC Progression by Competitively Inhibiting HRD1-Mediated CDC42 Ubiquitination and Degradation\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAccording to the latest evaluation data from the International Agency for Research on Cancer (IARC) of the World Health Organization, approximately 1.93\\u0026nbsp;million new cases of colorectal cancer were reported globally in 2022, accounting for 9.6% of all new cancer cases, ranking third [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Colorectal cancer is also a major cause of cancer-related deaths, with approximately 900,000 deaths in 2022, representing 9.3% of global cancer deaths, ranking second world wide [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Currently, the primary treatment strategies for colorectal cancer are surgery combined with radiotherapy and chemotherapy [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. However, most patients present at advanced stages of the disease, losing the opportunity for surgical intervention, and chemotherapy often leads to drug resistance, resulting in a very low 5-year survival rate for patients with advanced colorectal cancer [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Therefore, in-depth research into the pathogenesis and drug resistance mechanisms of colorectal cancer, as well as the identification of etiological-based diagnostic and therapeutic molecular targets, is crucial for improving chemotherapy resistance and enhancing patient efficacy and survival rates.\\u003c/p\\u003e\\u003cp\\u003eThe standard first-line chemotherapy regimen for colorectal cancer is the FOLFOX regimen, which combines 5-fluorouracil (5-FU), leucovorin, and oxaliplatin. This regimen is widely used for advanced or recurrent colorectal cancer, as well as for adjuvant therapy following colorectal cancer resection [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Among these, 5-fluorouracil is an antimetabolite pyrimidine analog that is activated to 5-fluoro-2'-deoxyuridine monophosphate (5-FdUMP) [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. It binds to and inhibits thymidylate synthase activity, blocking the production of thymidylate, which is essential for DNA synthesis, thereby inhibiting cancer cell division and growth [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. During the treatment with these chemotherapy drugs, chemotherapy resistance often develops. Therefore, studying the mechanisms of tumor resistance and improving existing chemotherapy and targeted therapies is of significant importance for improving survival rates, efficacy, and prognosis in cancer patients.\\u003c/p\\u003e\\u003cp\\u003eMCM8 is located on human chromosome 20q12.3 and possesses ATPase and helicase activities. It participates in homologous recombination (HR) repair and is involved in the formation of replication forks during the early stages of DNA replication, as well as in the recruitment of other DNA replication-related proteins [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Previous studies have shown that MCM8 plays a significant role in diseases such as ovarian insufficiency and spermatogenesis disorders by influencing the cell cycle, mitosis, and E2F-mediated DNA replication regulation [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Recent studies have found that MCM8 is highly expressed in tumors such as glioblastoma, cholangiocarcinoma, and bladder cancer, promoting malignant progression [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Research has also revealed that MCM8 is positively correlated with the gemcitabine resistance marker RRM1 in pancreatic cancer, suggesting that MCM8 may be involved in gemcitabine resistance [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. However, whether MCM8 promotes the occurrence, development, and drug resistance of colorectal cancer remains unclear.\\u003c/p\\u003e\\u003cp\\u003eIt is well-established that proteins serve as the primary carriers of cellular life activities, and abnormal protein expression levels can lead to the development of various diseases, including cancer. The ubiquitin-proteasome system (UPS) is the major pathway for intracellular protein degradation, regulating the degradation of 80% of cellular proteins. The UPS consists of specific enzymes that modify substrate proteins with ubiquitin and the 26S proteasome, which is responsible for the hydrolysis of ubiquitinated substrate proteins [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. The conjugation of ubiquitin to substrates occurs through a multistep cascade reaction involving the ubiquitin-activating enzyme (E1), the ubiquitin-conjugating enzyme (E2), and the ubiquitin ligase (E3), which transfers the activated ubiquitin to the target substrate [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. This process, known as ubiquitination, ultimately leads to the proteasomal degradation of the ubiquitinated proteins. Previous studies have indicated that dysregulation of the UPS results in the abnormal expression of various proteins, contributing to the onset and progression of tumors [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e][\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Hydroxymethylglutary l reductase degradation protein 1 (HRD1), a member of the E3 ubiquitin ligase family, is a critical molecule in the endoplasmic reticulum-associated degradation (ERAD) pathway. It directly catalyzes the conjugation of ubiquitin to unfolded or misfolded proteins for proteasomal degradation [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. However, whether MCM8 and HRD1 influence the expression levels of oncogenic proteins via the UPS to promote the malignant progression of colorectal cancer remains unclear and warrants further investigation.\\u003c/p\\u003e\\u003cp\\u003eCell Division Cycle 42 (Cdc42), a member of the small GTPase Rho family, is a critical regulator of the actin cytoskeleton and plays a pivotal role in controlling cell motility, polarity, and cell cycle progression [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. In the absence of Cdc42, the levels of cyclin D1 decrease, while the levels of p16ink4a increase, leading to cell cycle arrest and ultimately inhibiting cell proliferation [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Previous studies have indicated that Cdc42 is a major factor in the acquisition of trastuzumab resistance in HER2-positive gastric cancer [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Furthermore, Cdc42 has been shown to promote migration and invasion in hepatocellular carcinoma [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Notably, there is limited research on whether Cdc42 is regulated by the UPS in colorectal cancer. In this study, our experimental results demonstrate that MCM8 competitively inhibits the binding of HRD1 to Cdc42, thereby suppressing Cdc42 ubiquitination and promoting its protein stability. This, in turn, facilitates cell cycle arrest, leading to the development of 5-fluorouracil resistance in colorectal cancer.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\n\\u003ch3\\u003e1. High expression of MCM8 in CRC is indicative of unfavorable prognosis\\u003c/h3\\u003e\\n\\u003cp\\u003eTo determine if MCM8 expression correlates with malignancy progression and clinical outcomes in CRC, we first analyzed MCM8 levels in the GEO data set. Subsequently, the overall survival (OS) and disease-specific survival (DSS) outcomes were assessed through Kaplan Meier survival analysis. As depicted in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB, the expression of MCM8 was found to be elevated in 13 of 16 categories of cancer types, particularly in CRC tumor tissues compared to their respective normal tissue. Furthermore, Kaplan-Meier survival analysis revealed that patients with higher MCM8 expression had reduced DSS rates (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). A subsequent examination of MCM8 expression utilizing IHC and Western blotting in CRC patients biopsy tissues and adjacent tissues confirmed that MCM8 expression was significantly higher in CRC tissues compared to adjacent tissues (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). Additionally, a comparison to the normal human colon epithelial cell line NCM460 evidenced a marked overexpression of MCM8 in a range of human CRC cell lines (CX-1, HCT-116, HT-29, RKO, SW480, SW620) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF). These findings collectively suggest that MCM8 serve as a potential prognostic biomarker, indicating higher malignancy and poorer prognosis in CRC. Therefore, we established cell lines with a significant knockdown of MCM8 expression in SW620 and CX-1 cells, and established cell lines with a significant overexpress of MCM8 expression in HCT116 cells. The efficacy of MCM8 knockdown and overexpression was confirmed by Western blotting. (Figure\\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eA and S1B).\\u003c/p\\u003e\\n\\u003ch3\\u003e2. MCM8 functions as an oncogene in CRC\\u003c/h3\\u003e\\n\\u003cp\\u003eTo evaluate the influence of MCM8 on CRC cell viability, apoptosis, metastasis and cell cycle, we firstly assessed the impact of MCM8 knockdown and overexpression on cell proliferation. CCK-8 assays indicated that compared with the control group, the cell proliferation and viability of the knockdown group were significantly decreased in SW620 cells and CX-1 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and S2A), while those of the overexpression group were significantly increased in HCT116 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Additionally, to evaluate the effect of MCM8 on CRC cell migration and invasion, we performed wound healing and transwell assays. The results demonstrated a significant decrease in migration and invasion abilities following MCM8 knockdown in SW620 cells and CX-1 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC, \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE, S2B and S2D), while MCM8 overexpression promoted cell migration and invasion in HCT116 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF). Furthermore, MCM8 knockdown cells manifested a higher percentage of apoptotic cells in SW620 cells and CX-1 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG and S2C), whereas MCM8 overexpression cells presented a lower percentage in HCT116 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH). Additionally, flow cytometry was used to detect the effect of MCM8 expression changes on the cell cycle. The results indicated that MCM8 knockdown led to cell cycle arrest at the G1 phase (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eI and S2E), while MCM8 overexpression was the opposite, and the Western Blot results showed that after MCM8 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eJ), the cell cycling-related proteins Cyclin D1 and CDK4 in colon cancer cells were downregulated, while the results were the opposite when MCM8 was overexpressed (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eI ang 2J). These findings provide strong evidence that MCM8 plays a crucial role in promoting the malignant progression of colon cancer.\\u003c/p\\u003e\\n\\u003ch3\\u003e3 MCM8 stabilizes CDC42 expression via ubiquitylation\\u003c/h3\\u003e\\n\\u003cp\\u003eTo further investigate the molecular mechanism of MCM8, we attempted to identify potential binding proteins of MCM8. We obtained the TOP100 proteins with the highest similarity of MCM8 through the GEPIA2 database and conducted enrichment analysis using the Metascape database. The results of Go-biological process analysis indicated that MCM8-related proteins were significantly enriched in Cell cycle-related pathways such as the Mitotic Cell Cycle and the Regulation of the cell Cycle process (Figure\\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eA). The employing tandem affinity purification and LC-MS/MS analysis, the secondary peptide map of MCM8 and the protein set interacting with MCM8 were obtained. We selected the cell cycle-related protein Cdc42 from the IP-MS results for further study (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Through bioinformatics analysis, we found a significant positive correlation between Cdc42 and MCM8 (FigurecS3B), Cdc42 was highly expressed in colon cancer (Figure\\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eC), and the Kaplan-Meier survival curve prediction results revealed that the high expression of Cdc42 was positively correlated with the poor prognosis of colon cancer patients (Figure\\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eD). The expression of Cdc42 in the clinical tissues of colon cancer was further analyzed. The immunohistochemical results showed that among 97 patients with colon cancer (collected at Xiangya Hospital of Central South University), the expression of Cdc42 in the tumor tissues of 74 patients was significantly higher than that in the adjacent tissues (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). The clinical information was statistically analyzed. The results showed that among 74 patients with high expression of Cdc42, 65 patients were in the clinical stage of T2-T4, indicating that high expression of Cdc42 was positively correlated with the clinical stage of colon cancer (Table\\u0026nbsp;1).\\u003c/p\\u003e\\u003cp\\u003eTo clarify the interaction between MCM8 and Cdc42, we conducted detection through Immunocoprecipitation (Co-IP) and immunofluorescence co-localization experiments. The results indicated that MCM8 and Cdc42 interacted in colon cancer cells. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD and \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE). To elucidated the regulatory effect of MCM8 on Cdc42, we detected the influence of MCM8 expression changes on the expression of Cdc42 protein by Western Blot and qPCR. The results showed that after knockdown of MCM8, the expression of Cdc42 protein was significantly down-regulated while the mRNA level remained unchanged (Figure\\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eE and \\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). After overexpression of MCM8, the expression of Cdc42 protein increased significantly (Figures \\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eG). The above results indicate that in colon cancer cells, MCM8 can positively regulate the protein level of Cdc42.Studies have shown that the mutual binding between protein molecules can affect the stability of target proteins. Therefore, we applied the Cycloheximide (CHX) half-life experiments to demonstrated that when MCM8 was knocked down, the expression level and stability of Cdc42 protein in colon cancer cells decreased significantly (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF).\\u003c/p\\u003e\\u003cp\\u003eApproximately 80% of intracellular proteins in eukaryotic cells are degraded through the Ubiquitin-Proteasome System (UPS) [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. We further explored whether MCM8 achieves stability regulation of Cdc42 protein through UPS. We knocked down MCM8 in colon cancer cell SW620 and treated it with the proteasome inhibitor MG132. The Western Blot results showed that MG132 treatment in colon cancer cells could restore the decreased expression of Cdc42 protein caused by MCM8 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG). The degradation of proteins by UPS depends on the ubiquitination modification of the target protein. Therefore, we further explored whether MCM8 would have an impact on the ubiquitination level of Cdc42. The effect of MCM8 on the ubiquitination level of Cdc42 protein was detected by the Ub-IP assay. The results showed that the ubiquitination level of Cdc42 protein decreased significantly after overexpression of MCM8 in colon cancer cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eH), while the ubiquitination level of Cdc42 protein increased significantly after knockdown of MCM8 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eI). The above results indicate that MCM8 can inhibit the ubiquitination level of Cdc42 protein.\\u003c/p\\u003e\\n\\u003ch3\\u003e4. MCM8 competes with HRD1 for binding CDC42 to increase its stability in CRC cells\\u003c/h3\\u003e\\n\\u003cp\\u003eThe above results indicate that MCM8 can inhibit the ubiquitination modification of Cdc42. To explore the possible mechanism, we analyzed the IP-MS results of MCM8 and took the intersection of the top 200 interacting proteins with the 600 common E3 enzymes in the human body [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. E3 ligases HRD1, STUB1 and OTUB1 were discovered (Figure\\u003cspan refid=\\\"MOESM4\\\" class=\\\"InternalRef\\\"\\u003eS4\\u003c/span\\u003eA). Further bioinformatics analysis revealed that among the three, only HRD1 had a significant negative correlation with Cdc42 in colon cancer. Therefore, we speculated that HRD1 might be the E3 ligase of Cdc42 (Figure\\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003eB-S3D). Meanwhile, Co- IP and immunofluorescence experiment showed that HRD1 physically interacted with CDC42 in the SW620 cells. The results of the Ub-IP experiment showed that the ubiquitination level of Cdc42 protein significantly increased after overexpression of HRD1 in colon cancer cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). After gradient overexpression of HRD1 in the SW620 cells, CDC42 increased in a dose-dependent manner (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD). Moreover, we expressed MCM8 and HRD1 in colon cancer cells. The protein expression levels of MCM8, Cdc42 and HRD1 were detected by Western Blot. The results showed that the protein level of MCM8 was not regulated by the expression level of HRD1. Moreover, the decrease in the expression level of Cdc42 protein caused by overexpression of HRD1 can be restored by the overexpression of MCM8, and the increase in the expression level of Cdc42 protein caused by overexpression of MCM8 can be restored by the overexpression of HRD1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE). The results suggest that in colon cancer cells, MCM8 promotes the stability of Cdc42 protein by competitively inhibiting HRD1.\\u003c/p\\u003e\\u003cp\\u003eSubsequently, we further verified whether the effect of MCM8 on the ubiquitination of Cdc42 was also achieved through competitive inhibition of HRD1. MCM8 and HRD1 were co-expressed in colon cancer cell line HCT116. The ubiquitination levels of Cdc42 protein were detected by Ub-IP. The results showed that the ubiquitination level of Cdc42 protein significantly increased after overexpression of HRD1, while the increased ubiquitination level of Cdc42 protein was restored after overexpression of MCM8 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF). It is indicated that MCM8 can inhibit the ubiquitination modification of Cdc42 protein by HRD1. Moreover, molecular docking indicates that both MCM8 (G2215) and HRD1 (S363) bind to the same site (E18) of Cdc42, therefore, the Cdc42 binding interface of MCM8 and HRD1 is mutually exclusive (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG), indicating that MCM8 competes with HRD1 for the binding of Cdc42. To sum up, MCM8 in colon cancer cells by competitive inhibition HRD1 of Cdc42 protein ubiquitin modification, inhibit the degradation of UPS, and promote the Cdc42 protein stability.\\u003c/p\\u003e\\n\\u003ch3\\u003e\\u003c/h3\\u003e\\n\\u003cdiv class=\\\"Heading\\\"\\u003e\\u003cb\\u003e5. MCM8 promotes malignant progression of CRC through CDC42 in vitro and in vivo\\u003c/b\\u003e\\u003c/div\\u003e\\u003cp\\u003eDue to the significant overexpression of MCM8 in colorectal cancer and its biological function in promoting malignant progression, we identified that MCM8 regulates and stabilizes CDC42 by competitively inhibiting HRD1. Therefore, we hypothesize that MCM8 promotes the malignant progression of colorectal cancer through the modulation of CDC42. CCK8 assay results demonstrated that knockdown of MCM8 significantly suppressed the proliferation of colorectal cancer cells in the SW620 cell line, whereas overexpression of CDC42 significantly rescued the reduction in cell proliferation caused by MCM8 knockdown in SW620 and CX-1 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA and S5A). This suggests that MCM8 promotes the proliferation of colorectal cancer cells through the regulation of CDC42. Furthermore, flow cytometry results revealed that MCM8 knockdown significantly induced apoptosis in colorectal cancer cells, while overexpression of CDC42 could reverse this effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB and S5C). The wound healing assay and Transwell assay showed that the reduction in cell migration and invasion due to MCM8 knockdown was significantly restored by CDC42 overexpression, while MCM8 overexpression enhanced cell migration and invasion, which could be significantly reversed by CDC42 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, \\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE, S5B and S5E). Flow cytometry analysis of cell cycle distribution revealed that following MCM8 knockdown, the cell cycle was arrested at the G1 phase, while co-transfection with the CDC42 expression plasmid led to progression from the G1 to the S phase, promoting the cell cycle. Additionally, Western blot analysis showed that co-transfection with the CDC42 expression plasmid restored the downregulation of cycle-related proteins, including Cyclin D1 and CDK4, caused by MCM8 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD and S5D). In summary, these results suggest that MCM8 promotes the malignant progression of colorectal cancer in vitro through the regulation of CDC42 expression.\\u003c/p\\u003e\\u003cp\\u003eSubsequently, we investigated the effect of MCM8 and CDC42 on the tumorigenic ability of colorectal cancer cells by knocking down MCM8 and simultaneously overexpressing CDC42 in the SW620 cell line, followed by a xenograft tumor formation assay in nude mice. The results showed that overexpression of CDC42 could reverse the tumor volume and weight reduction caused by MCM8 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF-\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eH). Western blot analysis of tumor tissues revealed the expression levels of MCM8 and CDC42 (Figure\\u003cspan refid=\\\"MOESM5\\\" class=\\\"InternalRef\\\"\\u003eS5\\u003c/span\\u003eF). Additionally, hematoxylin and eosin (HE) staining and immunohistochemistry (IHC) were performed to examine the expression differences of Ki-67, MCM8, and CDC42 in the tumor tissues. HE staining results demonstrated a reduction in the proportion of parenchymal cells in tumors following MCM8 knockdown, which was partially restored by overexpression of CDC42 (Figure\\u003cspan refid=\\\"MOESM5\\\" class=\\\"InternalRef\\\"\\u003eS5\\u003c/span\\u003eG). IHC analysis showed that CDC42 overexpression could reverse the decrease in the proliferation marker Ki-67 caused by MCM8 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eI).\\u003c/p\\u003e\\n\\u003ch3\\u003e6. MCM8 promotes the tumorigenesis ability and 5-FU resistance of SW620-FR cells\\u003c/h3\\u003e\\n\\u003cp\\u003eOncogenes not only influence tumor initiation and progression but also often promote the development of drug resistance. In particular, the development of resistance to the first-line chemotherapy drug 5-fluorouracil (5-FU) in colorectal cancer is one of the most common issues in clinical practice and frequently leads to poor prognosis and recurrence in patients. Therefore, after investigating the role of MCM8 in promoting colorectal cancer initiation and progression through CDC42, we further explored its impact on the formation of 5-FU resistance in colorectal cancer. We assessed the half-maximal inhibitory concentration (IC50) of 5-FU in parental SW620 cells and 5-FU-resistant SW620-FR cells using the CCK-8 assay. The results showed that the IC50 of SW620-FR cells (677.68 \\u0026micro;M) was significantly higher compared to the parental cells (85.45 \\u0026micro;M) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). The result of western blot showed that the expression of MCM8 and CDC42 was significantly increased in SW620-FR cells compared to the parental cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). We knocked down MCM8 in the SW620-FR cell line. The CCK-8 assay results showed that knocking down MCM8 could significantly reduce the IC50 value of the SW620-FR cell line (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD). Further, MCM8 was knocked down and Cdc42 was overexpressed in the SW620-FR cell line. The CCK-8 assay results showed that overexpression of Cdc42 could restore the decrease in IC50 value caused by knocking down MCM8 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE and \\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eF). To investigate the impact of MCM8 on the malignant phenotype of colorectal cancer drug-resistant cell lines, we employed CCK-8 and flow cytometry assays to assess changes in cell proliferation, cell cycle progression, and apoptosis levels following MCM8 knockdown in SW620-FR cells. The results showed that knockdown of MCM8 significantly reduced the proliferation capacity of the colorectal cancer resistant cells, arrested the cell cycle at the G1 phase, and markedly increased the level of apoptosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eG-\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eI).\\u003c/p\\u003e\\u003cp\\u003eTo validate the role of MCM8 in promoting tumorigenicity and 5-FU resistance in SW620-FR cells, we performed a xenograft tumor formation assay using MCM8 knockdown SW620-FR cells in nude mice. Mice were treated with intraperitoneal injections of 5-FU to investigate the effects of MCM8 on the in vivo tumorigenic ability and drug resistance of colorectal cancer resistant cells. The results showed that, compared to the control group, MCM8 knockdown improved the therapeutic effect of 5-FU and led to a reduction in tumor volume. Western blot analysis of tumor tissues revealed the expression of MCM8, while hematoxylin and eosin (HE) staining and immunohistochemistry (IHC) were used to assess the differences in the expression of Ki-67 and MCM8 in tumor tissues. HE staining results demonstrated that, compared to the control group, MCM8 knockdown combined with 5-FU treatment reduced the proportion of parenchymal cells in the tumor tissues. IHC results further showed that MCM8 knockdown combined with 5-FU treatment led to a further decrease in the expression of the proliferation marker Ki-67.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eColorectal cancer (CRC) is the third most common cancer globally and the second leading cause of cancer-related death worldwide. Its pathogenesis is complex and poses a serious threat to human health. Currently, most patients are diagnosed at advanced stages of the disease, losing the opportunity for surgery. Chemotherapy based on 5-fluorouracil (5-FU) remains the primary treatment modality [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. However, primary or secondary resistance to 5-FU frequently occurs in clinical settings, significantly limiting the effectiveness of treatment [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Therefore, understanding the mechanisms of 5-FU resistance in CRC and identifying potential molecular targets to predict and counteract this resistance are crucial. In this study, we analyzed pathological slides and clinical data from 97 colorectal cancer patients and found that MCM8 and Cdc42 were highly expressed in tumor tissues, and their expression levels were positively correlated with tumor progression, particularly with the T-stage of the tumors\\u003c/p\\u003e\\u003cp\\u003eMCM8 is a key member of the MCM protein family, plays a central role in DNA replication initiation, homologous recombination repair, and the maintenance of genome stability [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Numerous studies have shown that MCM8 is highly expressed in various tumor tissues, including glioblastoma, gastric cancer, bladder cancer, and colorectal cancer (CRC), where it promotes malignant progression [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR34\\\" citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. In recent years, a few studies have reported the mechanisms by which MCM8 promotes the malignant progression of colorectal cancer. For example, research by Mariano Golubicki et al. demonstrated that the knockout of MCM8 leads to defects in DNA mismatch repair (MMR) in colorectal cancer cells, contributing to a recessive genetic pattern of CRC susceptibility [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. Furthermore, in colorectal cancer, MCM8 also promotes carcinogenesis through non-DNA damage repair pathways. Shaojun Yu et al. suggested that MCM8 may regulate the expression of CHSY1 by affecting Nedd4-mediated ubiquitination, thereby exerting its tumor-promoting effects [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. However, this study is the first to discover that MCM8, by binding to and stabilizing Cdc42, promotes the proliferation, cell cycle progression, and inhibits apoptosis of colorectal cancer cells, thereby promoting the malignant progression of colorectal cancer.\\u003c/p\\u003e\\u003cp\\u003eThis study found that MCM8 positively regulates CDK4 and cyclin D1 proteins, promoting the transition of the cell cycle from the G1 phase to the S phase. Bioinformatics analysis revealed that MCM8 interacting proteins are enriched in signaling pathways regulating cell cycle processes. Further analysis of IP-MS results identified the cell cycle-related protein Cdc42 as an MCM8 interacting protein. It was further confirmed that MCM8 binds to and stabilizes Cdc42 by inhibiting its degradation via the UPS pathway. Abnormal expression of Cdc42 is associated with the development of various diseases, including autoimmune disorders, neurodegenerative diseases, and cardiovascular diseases [\\u003cspan additionalcitationids=\\\"CR37\\\" citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. Recent studies have shown that Cdc42 is highly expressed in multiple tumors, such as ovarian cancer, gastric cancer, and prostate cancer, and its expression is linked to tumor cell invasion, proliferation, and resistance to chemotherapy drugs such as sorafenib and cisplatin [\\u003cspan additionalcitationids=\\\"CR41\\\" citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e], contributing to malignant progression. In addition to transcriptional regulation and epigenetic abnormalities leading to the high expression of Cdc42 in tumors, studies have also found that dysregulation of the UPS pathway of Cdc42 contributes to its overexpression, thereby promoting tumor malignancy\\u003c/p\\u003e\\u003cp\\u003eTo identify the E3 ligase associated with Cdc42 and MCM8 in colorectal cancer, this study employed IP-MS screening and identified HRD1. HRD1 is an E3 ligase localized to the endoplasmic reticulum, and recent studies have shown that HRD1 can degrade PD-L1 via the UPS pathway in colorectal cancer, alleviating T cell immune suppression and enhancing the activity of tumor-infiltrating T cells, thereby exerting antitumor effects [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. In this study, we for the first time confirmed that HRD1 ubiquitinates Cdc42 in colorectal cancer, and this process is competitively inhibited by MCM8. Although we could not completely rule out the possibility that MCM8 regulates Cdc42 through the lysosomal pathway, our experiments, including CHX, MG132, and Ub-IP, strongly support that MCM8 regulates Cdc42 via the UPS pathway. Additionally, through molecular docking, we identified the specific binding sites of MCM8 and HRD1 with Cdc42, although this result has not been experimentally verified. Future experiments will be conducted to further validate these findings.\\u003c/p\\u003e\\u003cp\\u003e5-Fluorouracil (5-FU) is a first-line chemotherapeutic agent for various cancers, particularly colorectal cancer (CRC). However, its efficacy is often limited by the development of resistance. Research has shown that 5-FU resistance can arise through multiple mechanisms, including the impact on MDR transporters, DNA damage repair, and the tumor microenvironment [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Chinmayee Sethy et al. reported that 5-FU is metabolized into several active metabolites that disrupt thymidylate synthase (TS) activity and DNA/RNA synthesis, leading to DNA/RNA damage and cell death [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Furthermore, an increasing body of research has demonstrated that MCM family genes can also influence chemotherapeutic resistance through cell cycle regulation[\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. Additionally, it has been reported that in CRC, Cdc42 promotes oxaliplatin resistance by downregulating the expression of drug efflux proteins P-gp and MRP1 [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. In this study, we found that MCM8 and Cdc42 are highly expressed in 5-FU-resistant colorectal cancer cells. MCM8 regulates Cdc42 to affect the IC50 value of 5-FU in CRC, and knockdown of MCM8 enhances 5-FU sensitivity. These findings further support the role of MCM8 in promoting 5-FU resistance in colorectal cancer via Cdc42. In subsequent experiments, we will combine clinical resistance specimens, single-cell sequencing, and various molecular functional assays to explore the specific molecular mechanisms by which MCM8 promotes the development of 5-FU resistance in colorectal cancer.\\u003c/p\\u003e\\u003cp\\u003eIn summary, this study systematically elucidates the specific mechanisms by which MCM8 contributes to the development, progression, and drug resistance of colorectal cancer. It confirms that MCM8 competitively inhibits HRD1-mediated ubiquitin degradation of Cdc42, enhancing the stability of Cdc42 protein, thereby promoting colorectal cancer cell proliferation, cell cycle progression, migration, invasion, and resistance. The findings provide new potential targets for the clinical diagnosis and treatment of colorectal cancer, offering theoretical support and novel strategies to improve the prognosis of colorectal cancer patients.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eData Collection\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTranscriptomic data from CRC patient samples, along with corresponding clinical information, were retrieved from repositories such as The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. Only datasets with comprehensive clinical annotations and gene expression profiles were included in the analysis.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eClinical tissue samples\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eColorectal Cancer Fresh Tissue: Eight paired fresh samples were obtained from Hunan Provincial Cancer Hospital for Western Blot analysis of MCM8 expression. Colorectal Cancer Patient Tissue Sections: Ninety-seven pathological tissue sections were obtained from Xiangya Hospital, Central South University, for immunohistochemical analysis of MCM8 and Cdc42 expression. All tissue samples were collected with informed consent from the patients and approved by the ethics committees of Hunan Provincial Cancer Hospital and Xiangya Hospital. Tumor samples were identified by pathologists.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCell culture and transfection\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe normal colonic epithelial cell line NCM460 and CRC cell lines CX-1、HCT116、HT29、RKO、SW480、SW620 were purchased from the Cell Bank of the Chinese Academy of Science (Shanghai, China). These cells were cultured in DMEM medium (Gibco, USA), with all media enriched with 10% fetal bovine serum. streptomycin (Gibco, USA) at 37℃ in 5%CO\\u003csup\\u003e2\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003ePlasmid Transfection: Taking one well of a six-well plate as an example, cells in the logarithmic growth phase were used for transfection when the cell density reached 60\\u0026ndash;80%. Neofect transfection reagent was used for transfection, and the transfection reagent was prepared according to the manufacturer's instructions: 100 \\u0026micro;L pure DMEM culture medium, 2 \\u0026micro;L Neofect transfection reagent, and 2 \\u0026micro;g of the target plasmid were mixed, followed by incubation at room temperature for 15\\u0026ndash;30 minutes. After incubation, the mixture was added dropwise to the well containing 1.9 mL of complete culture medium. The cells were then transferred to a cell incubator and cultured for 36\\u0026ndash;48 hours before performing transfection efficiency assays and subsequent experiments.2.4 Immunohistochemistry (IHC) analysis\\u003c/p\\u003e\\u003cp\\u003eWe collected formalin-fixed paraffin-embedded (FFPE) samples from 98 CRC patients treated at Hunan Cancer Hospital (Changsha, China) between February 2016 and November 2020. Pathological sections were dried in a desiccator at 60\\u0026ndash;70\\u0026deg;C for 1hour, then rehydrated through an alcohol concentration gradient and placed in 0.01 M sodium citrate buffer at 100\\u0026deg;C for antigen retrieval. Endogenous peroxidase activity was blocked by incubation with 3% hydrogen peroxide solution at room temperature for 10 minutes. After three washes with PBS (three minutes each), the slides were incubated with the primary antibody (1:100 dilution) at 4\\u0026deg;C overnight and then with the secondary antibody (Transgon, China) at room temperature for 20 minutes. 3,3\\u0026prime;-diaminobenzidine (DAB) staining and hematoxylin counterstaining were performed. The sections were examined under a microscope after dehydration through an alcohol gradient and coating with neutral resin.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eWestern blot analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eProteins were extracted utilizing TPEB buffer (Invitrogen, Carlsbad, CA), and their concentrations were determined through a BCA analysis kit (Beyotime Biotechnology, Shanghai, China). Protein samples were separated by SDS-PAGE gel and transferred to a 0.25 \\u0026micro;m PVDF membrane (Millipore, Bedford, MA). After blocking with 5% skim milk in TBST (Tris-buffered saline and Tween-20) for 1 hour, the membranes were incubated overnight at 4◦C with primary antibodies against MCM8 (proteintech, CN, 16451-1-AP), Cdc42(Santa, USA, sc-8401),Ub (proteintech, CN, 10201-2-AP) Cyclin D1 (proteintech, CN, 60186-1-Ig), CDK4 (proteintech, CN, 11026-1-AP), HRD1 (proteintech, CN, 16451-1-AP) and Ki67 (GeneTex, USA, GTX103436). Following incubation with a secondary antibody (Transgon, China) for 2 hours at room temperature, an appropriate amount of Enhanced Chemiluminescence (ECL) reagent was prepared by mixing reagent A and B in equal volumes and then applied to the surface of the PVDF membrane. The protein blot was visualized via a chemiluminescence imaging system, and ImageLab (Bio-Rad, California, USA) was utilized to process the images.\\u003c/p\\u003e\\u003cp\\u003eQuantitative reverse transcriptase-PCR (qRT-RCR)\\u003c/p\\u003e\\u003cp\\u003eTotal RNA was isolated employing TRIzol reagent (Invitrogen, Carlsbad, CA), with reverse transcription conducted using a reverse transcription kit (Takara, Japan); thereafter, cDNA was ampliffed in accordance with the manufacturer\\u0026rsquo;s guidelines. The primer sequences essential for ampliffcation were as follows: MCM8 forward: GCTCTCCTCTCACAGTTACGATGG, reverse: GTGGAATCCGACCTGCTTCTCTC; Ccd42 forward: CCCTCTACTATTGAGAAACTTG, reverse: AGAACACTCCACATACTTGA.\\u003c/p\\u003e\\u003cp\\u003eConstruction of cell lines stably expressing MCM8 shRNA3, and corresponding control lentivirus shNC (ZV101-Amp-GFP-puromycin) were synthesized by Zorin Biological. Following a 48-hour infection, CRC cells were subjected to puromycin selection (1 \\u0026micro;g/mL) for two weeks to establish stably transfected cells.\\u003c/p\\u003e\\u003cp\\u003eCell viability assay\\u003c/p\\u003e\\u003cp\\u003eCell viability was assessed using CCK-8 kits (Biosharp, China) according to the manufacturer\\u0026rsquo;s instructions. Cells were plated into 96- well plates and, after adhesion, were treated with varying concentration gradients of drugs for 24 hours. Subsequently, CCK-8 reagent was introduced (10 \\u0026micro;L/well) and incubated at 37 ◦C for 2 hours. Absorbance was recorded at 450 nm, and cell viability was computed as follow:\\u003c/p\\u003e\\u003cp\\u003e(cell viability (%) = [A (dosing)\\u0026thinsp;\\u0026minus;\\u0026thinsp;A (blank)]/[A (0 dosing)\\u0026thinsp;\\u0026minus;\\u0026thinsp;A (blank)] \\u0026times; 100).\\u003c/p\\u003e\\u003cp\\u003eWound healing assay and transwell assay\\u003c/p\\u003e\\u003cp\\u003eWound Healing Assay: Transfected cells were seeded in 6-well plates, and images were taken at 0, 24, and 48 hours to monitor cell migration.\\u003c/p\\u003e\\u003cp\\u003eTranswell Assay: After 24 hours of incubation, migrated cells were fixed and stained with 0.1% crystal violet. Invasion was quantified by counting the cells that invaded Matrigel and adhered to the lower membrane surface.\\u003c/p\\u003e\\u003cp\\u003eCell apoptosis assay\\u003c/p\\u003e\\u003cp\\u003eCell suspensions and cells digested with EDTA-free trypsin were gathered and washed with pre-cooled PBS, followed by staining with an apoptosis detection kit (Vazyme, China). After 10 minutes of incubation at room temperature in obscurity, flow cytometry analyzed the stained specimens within one hour.\\u003c/p\\u003e\\u003cp\\u003eCo-immunoprecipitation (Co-IP) assays\\u003c/p\\u003e\\u003cp\\u003eFollowing expansion of a substantial number of SW620 cells, proteins were collected and extracted. Magnetic beads were added to the protein solution and incubated at 4\\u0026deg;C for 30 min. Subsequently, the magnetic beads were separated using a magnetic rack, and the remaining protein solution was transferred to a new EP tube. The protein solutions were divided into two groups: the IgG group and the target molecular antibody group. Corresponding antibodies (MCM8: proteintech, CN, 16451-1-AP, 1:1000; CDC42: Santa, USA, sc-8401, 1:1000; HRD1: proteintech, CN, 13473-1-AP, 1:1000) were added to each group and incubated overnight on a shaking table at 4\\u0026deg;C. A suitable amount of magnetic bead solution was divided into two groups, washed twice with pre-cooled PBS, and added to the protein-antibody complex, reacting at4\\u0026deg;C for approximately 4\\u0026ndash;6 h. The EP tube was placed on a magnetic rack to separate the magnetic beads from the protein solution. After separation, the solution underwent boiling at 100\\u0026deg;C for 10 min until protein denaturation. Following centrifugation and magnetic bead separation, the upper liquid was collected for subsequent Western blot detection. All blots and gels were derived from the same experiment and were processed in parallel.\\u003c/p\\u003e\\u003cp\\u003eSilver nitrate staining\\u003c/p\\u003e\\u003cp\\u003eIn this experiment, the Beyotime rapid silver dyeing kit (P0017S) was employed for silver staining of the gel obtained through electrophoresis. The subsequent differential bands were acquired for mass spectrometry analysis and detection. The procedure involved the following steps: The gel blocks post-electrophoresis were placed in a clean box and fixed at room temperature on a shaking table for 2 h. Subsequently, after absorbing the fixed solution and cleaning with ethanol, the gel blocks were rinsed twice with ddH2O. Following water absorption, silver sensitizing solution was added for 2 min. After absorbing and discarding ddH2O, an appropriate volume of silver solution was added, and incubation ensued at room temperature for 10 min. The previous liquid was discarded, and the gel blocks were washed twice. The reaction was terminated after absorbing and discarding water, by adding silver dye coloring solution and incubating for 3\\u0026ndash;10 min until clear and distinct protein bands emerged. Finally, the differentiated bands were photographed in a well-lit environment and excised for subsequent mass spectrometry analysis.\\u003c/p\\u003e\\u003cp\\u003eImmunofluorescence\\u003c/p\\u003e\\u003cp\\u003eCells were fixed on a cell pad using 4% paraformaldehyde for 15\\u0026ndash;30 min, cleaned with PBS to remove excess fixative. A 0.1\\u0026ndash;0.5% Triton X-100 PBS solution enhanced antibody penetration. The sample was blocked with a PBS solution containing bovine serum albumin or other blockers for 30 min to 1h. Overnight incubation at 4\\u0026deg;C with diluted primary antibodies was followed by PBS cleaning to remove unbound antibodies. Fluorescently labeled secondary antibodies were added and incubated for 1\\u0026ndash;2 h, with PBS cleaning to remove unbound secondary antibodies. Nuclei were stained with DAPI or other dyes. After covering with anti-fading sealant, fluorescence microscopy was used for observation and image capture to analyze fluorescence signal distribution and intensity.\\u003c/p\\u003e\\u003cp\\u003eAnimal experiments\\u003c/p\\u003e\\u003cp\\u003eFour-week-old nude male mice (BALB/c nu/nu) were obtained from the Laboratory Animal Center of Central South University and maintained in pathogen-free conditions. All animal experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals of Xiangya Hospital, Central South University (Changsha, China), with the approval of the Institutional Animal Ethics Committee.\\u003c/p\\u003e\\u003cp\\u003eXenograft mouse models: Cells in the active growth phase were digested with trypsin and counted. After resuspension in saline, an equal volume of matrigel was added, ensuring a concentration of 1\\u0026times;10\\u003csup\\u003e7\\u003c/sup\\u003e cells/ml. The cell suspension was kept on ice for use. Based on a dose of 1\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells per mouse, the cell suspension was injected subcutaneously into the back of nude mice. Mouse body weight (in grams) and tumor volume (calculated as volume\\u0026thinsp;=\\u0026thinsp;length \\u0026times; short diameter\\u003csup\\u003e2\\u003c/sup\\u003e, in mm\\u003csup\\u003e3\\u003c/sup\\u003e) were measured every three days. When the tumor size reached approximately 3000 mm\\u003csup\\u003e3\\u003c/sup\\u003e, the nude mice were euthanized, and the xenograft tumors were harvested. Tumor volume and weight were measured, and the samples were prepared for subsequent experiments.\\u003c/p\\u003e\\u003cp\\u003eIntraperitoneal Injection: The 5-FU (AmBeed) powder was dissolved in PBS containing 2% DMSO according to the manufacturer's instructions, and the solution was prepared and stored at -20\\u0026deg;C for later use. At a dosage of 25 mg/kg, 5-FU (with the control group receiving PBS containing 2% DMSO) was injected into the peritoneal cavity of nude mice every three days.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\u003cp\\u003eStatistical analysis: All statistical analyses utilized R software or GraphPad Prism 8. Student\\u0026rsquo;s t test determined statistical differences between the experimental and control groups. One-way ANOVA, followed by Tukey\\u0026rsquo;s post hoc test, assessed differences among multiple groups. Unless otherwise stated, significance was defined as P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eQiang Liu. and Bin Zhang contributed the idea for the article. Yuxuan Tian. performed the bioinformatics analysis. Siyi Qian and Longwu Zeng performed the experiments and wrote the original manuscript. Fuxin Chen and Binjei Zhao analyzed the data. Qiang Liu. and Bin Zhang revised the manuscript. All authors read and approved the final manuscript. Siyi Qian and Longwu Zeng have made equally significant contributions to the work and share equal responsibility and accountability for it.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis article was funded by the National Natural Science Foundation of China (Grant No. 82073099), Natural Science Foundation of Hunan Province (Grant No. 2024JJ5462) and the Hunan Province University Reform and Development funds of Hunan Provincial financial Department (xiang cai jiao zhi [2023] No.31).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eEthical permissions were granted by the institutional review board of the Hunan Cancer Hospital of Central South University. All patients provided their informed written consent to participate in this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRaw RNA sequence data that support the findings of this study are available from the TCGA or GEO, respectively. Further inquiries can be directed to the corresponding author.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eTIRENDI S, MARENGO B, DOMENICOTTI C, et al. Colorectal cancer and therapy response: a focus on the main mechanisms involved [J]. Front Oncol, 2023, 13: 1208140.\\u003c/li\\u003e\\n\\u003cli\\u003eSIMON K. Colorectal cancer development and advances in screening [J]. Clin Interv Aging, 2016, 11: 967-976.\\u003c/li\\u003e\\n\\u003cli\\u003eXIE Y H, CHEN Y X, FANG J Y. Comprehensive review of targeted therapy for colorectal cancer [J]. Signal Transduct Target Ther, 2020, 5(1): 22.\\u003c/li\\u003e\\n\\u003cli\\u003eTAMRAZ M, AL GHOSSAINI N, TEMRAZ S. Optimization of colorectal cancer screening strategies: New insights [J]. World J Gastroenterol, 2024, 30(28): 3361-3366.\\u003c/li\\u003e\\n\\u003cli\\u003eLEOWATTANA W, LEOWATTANA P, LEOWATTANA T. Systemic treatment for metastatic colorectal cancer [J]. World J Gastroenterol, 2023, 29(10): 1569-1588.\\u003c/li\\u003e\\n\\u003cli\\u003eSHIN A E, GIANCOTTI F G, RUSTGI A K. Metastatic colorectal cancer: mechanisms and emerging therapeutics [J]. Trends Pharmacol Sci, 2023, 44(4): 222-236.\\u003c/li\\u003e\\n\\u003cli\\u003eLudwig PS, Schwendener RA, Schott H. Synthesis and anticancer activities of amphiphilic 5-fluoro-2\\u0026apos;-deoxyuridylic acid prodrugs. Eur J Med Chem. 2005;40(5):494-504. doi:10.1016/j.ejmech.2004.12.006.\\u003c/li\\u003e\\n\\u003cli\\u003eSethy C, Kundu CN. 5-Fluorouracil (5-FU) resistance and the new strategy to enhance the sensitivity against cancer: Implication of DNA repair inhibition. Biomed Pharmacother. 2021;137:111285. doi:10.1016/j.biopha.2021.111285.\\u003c/li\\u003e\\n\\u003cli\\u003eGriffin WC, Trakselis MA. The MCM8/9 complex: A recent recruit to the roster of helicases involved in genome maintenance. DNA Repair (Amst). 2019 Apr;76:1-10.\\u003c/li\\u003e\\n\\u003cli\\u003ePark J, Long DT, Lee KY, Abbas T, Shibata E, Negishi M, Luo Y, Schimenti JC, Gambus A, Walter JC, Dutta A. The MCM8-MCM9 complex promotes RAD51 recruitment at DNA damage sites to facilitate homologous recombination. Mol Cell Biol. 2013 Apr;33(8):1632-44.\\u003c/li\\u003e\\n\\u003cli\\u003e]Lee KY, Im JS, Shibata E, Park J, Handa N, Kowalczykowski SC, Dutta A. c. Nat Commun. 2015 Jul 28;6:7744. \\u003c/li\\u003e\\n\\u003cli\\u003eZhang YX, He WB, Xiao WJ, Meng LL, Tan C, Du J, Lu GX, Lin G, Tan YQ. Novel loss-of-function mutation in MCM8 causes premature ovarian insufficiency. Mol Genet Genomic Med. 2020 Apr;8(4):e1165.\\u003c/li\\u003e\\n\\u003cli\\u003eRen Z, Li J, Zhao S, Qiao Q, Li R. Knockdown of MCM8 functions as a strategy to inhibit the development and progression of osteosarcoma through regulating CTGF. Cell Death Dis. 2021 Apr 7;12(4):376.\\u003c/li\\u003e\\n\\u003cli\\u003eWang X, Zhang L, Song Y, Jiang Y, Zhang D, Wang R, Hu T, Han S. MCM8 is regulated by EGFR signaling and promotes the growth of glioma stem cells through its interaction with DNA-replication-initiating factors. Oncogene. 2021 Jul;40(27):4615-4624. \\u003c/li\\u003e\\n\\u003cli\\u003eDesai S, Wood-Trageser M, Matic J, Chipkin J, Jiang H, Bachelot A, Dulon J, Sala C, Barbieri C, Cocca M, Toniolo D, Touraine P, Witchel S, Rajkovic A. MCM8 and MCM9 Nucleotide Variants in Women With Primary Ovarian Insufficiency. J Clin Endocrinol Metab. 2017 Feb 1;102(2):576-582.\\u003c/li\\u003e\\n\\u003cli\\u003ePeng YP, Zhu Y, Yin LD, Zhang JJ, Guo S, Fu Y, Miao Y, Wei JS. The Expression and Prognostic Roles of MCMs in Pancreatic Cancer. PLoS One. 2016 Oct 3;11(10):e0164150.\\u003c/li\\u003e\\n\\u003cli\\u003eNARAYANANS, CAICY, ASSARAFYG, et al. Targeting the ubiquitin-proteasome pathway to overcome anti-cancer drug resistance [J]. Drug Resist Updat, 2020, 48: 100663.\\u003c/li\\u003e\\n\\u003cli\\u003ePARK J, CHO J, SONG E J. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment [J]. Arch Pharm Res, 2020, 43(11): 1144-1161.\\u003c/li\\u003e\\n\\u003cli\\u003eYUAN T, YAN F, YING M, et al. Inhibition of Ubiquitin-Specific Proteases as a Novel Anticancer Therapeutic Strategy [J]. Front Pharmacol, 2018, 9: 1080\\u003c/li\\u003e\\n\\u003cli\\u003eGIELSDORF W, SCHUBERT K. [Biotransformation of doxylamine: isolation, identification and synthesis of some metabolites (author\\u0026apos;s transl)] [J]. J Clin Chem Clin Biochem, 1981, 19(7): 485-490.\\u003c/li\\u003e\\n\\u003cli\\u003eARPALAHTI L, HAGLUND C, HOLMBERG C I. Proteostasis Dysregulation in Pancreatic Cancer [J]. Adv Exp Med Biol, 2020, 1233: 101-115.\\u003c/li\\u003e\\n\\u003cli\\u003eXU Y, FANG D. Endoplasmic reticulum-associated degradation and beyond: The multitasking roles for HRD1 in immune regulation and autoimmunity [J]. J Autoimmun, 2020, 109: 102423.\\u003c/li\\u003e\\n\\u003cli\\u003eMURPHY N P, MOTT H R, OWEN D. Progress in the therapeutic inhibition of Cdc42 signalling [J]. Biochem Soc Trans, 2021, 49(3): 1443-1456.\\u003c/li\\u003e\\n\\u003cli\\u003eSTENGEL K R, ZHENG Y. Essential role of Cdc42 in Ras-induced transformation revealed by gene targeting [J]. PLoS One, 2012, 7(6): e37317.\\u003c/li\\u003e\\n\\u003cli\\u003eHU X, MA Z, XU B, et al. Glutamine metabolic microenvironment drives M2 macrophage polarization to mediate trastuzumab resistance in HER2-positive gastric cancer [J]. Cancer Commun (Lond), 2023, 43(8): 909-937.\\u003c/li\\u003e\\n\\u003cli\\u003eWANG T, RAO D, YU C, et al. RHO GTPase family in hepatocellular carcinoma [J]. Exp Hematol Oncol, 2022, 11(1): 91.\\u003c/li\\u003e\\n\\u003cli\\u003eFHU C W, ALI A. Dysregulation of the Ubiquitin Proteasome System in Human Malignancies: A Window for Therapeutic Intervention [J]. Cancers (Basel), 2021, 13(7): 13071513.\\u003c/li\\u003e\\n\\u003cli\\u003eLEE J, LEE Y, JUNG Y M, et al. Discovery of E3 Ligase Ligands for Target Protein Degradation [J]. Molecules, 2022, 27(19): 27196515.\\u003c/li\\u003e\\n\\u003cli\\u003eLI Q, GENG S, LUO H, et al. Signaling pathways involved in colorectal cancer: pathogenesis and targeted therapy [J]. Signal Transduct Target Ther, 2024, 9(1): 266.\\u003c/li\\u003e\\n\\u003cli\\u003eVODENKOVA S, BUCHLER T, CERVENA K, et al. 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future [J]. Pharmacol Ther, 2020, 206: 107447.\\u003c/li\\u003e\\n\\u003cli\\u003eZENG H, CHEN W, ZHENG R, et al. Changing cancer survival in China during 2003-15: a pooled analysis of 17 population-based cancer registries [J]. Lancet Glob Health, 2018, 6(5): e555-e567.\\u003c/li\\u003e\\n\\u003cli\\u003eHELDERMAN N C, TERLOUW D, BONJOCH L, et al. Molecular functions of MCM8 and MCM9 and their associated pathologies [J]. iScience, 2023, 26(6): 106737.\\u003c/li\\u003e\\n\\u003cli\\u003eHUANG B, LIN M, LU L, et al. Identification of mini-chromosome maintenance 8 as a potential prognostic marker and its effects on proliferation and apoptosis in gastric cancer [J]. J Cell Mol Med, 2020, 24(24): 14415-14425.\\u003c/li\\u003e\\n\\u003cli\\u003eZHU W, GAO F, ZHOU H, et al. Knockdown of MCM8 inhibits development and progression of bladder cancer in vitro and in vivo [J]. Cancer Cell Int, 2021, 21(1): 242.\\u003c/li\\u003e\\n\\u003cli\\u003eYU S, DAI W, ZHAO S, et al. Function and mechanism of MCM8 in the development and progression of colorectal cancer [J]. J Transl Med, 2023, 21(1): 623.\\u003c/li\\u003e\\n\\u003cli\\u003eGolubicki M, Bonjoch L, Acu\\u0026ntilde;a-Ochoa JG, et al. Germline biallelic Mcm8 variants are associated with early-onset Lynch-like syndrome. JCI Insight. 2020;5(18):e140698. Published 2020 Sep 17. doi:10.1172/jci.insight.140698\\u003c/li\\u003e\\n\\u003cli\\u003eZHANG Q, JIN D, MOU X, et al. PBMC CDC42 reveals the disease activity and treatment efficacy of TNF inhibitor in patients with ankylosing spondylitis [J]. J Clin Lab Anal, 2022, 36(3): e24267.\\u003c/li\\u003e\\n\\u003cli\\u003eZHU M, XIAO B, XUE T, et al. Cdc42GAP deficiency contributes to the Alzheimer\\u0026apos;s disease phenotype [J]. Brain, 2023, 146(10): 4350-4365.\\u003c/li\\u003e\\n\\u003cli\\u003eMAILLET M, LYNCH J M, SANNA B, et al. Cdc42 is an antihypertrophic molecular switch in the mouse heart [J]. J Clin Invest, 2009, 119(10): 3079-3088.\\u003c/li\\u003e\\n\\u003cli\\u003eXIE W, HAN Z, ZUO Z, et al. ASAP1 activates the IQGAP1/CDC42 pathway to promote tumor progression and chemotherapy resistance in gastric cancer [J]. Cell Death Dis, 2023, 14(2): 124.\\u003c/li\\u003e\\n\\u003cli\\u003eNOVAK C M, HORST E N, LIN E, et al. Compressive Stimulation Enhances Ovarian Cancer Proliferation, Invasion, Chemoresistance, and Mechanotransduction via CDC42 in a 3D Bioreactor [J]. Cancers (Basel), 2020, 12(6): 12061521.\\u003c/li\\u003e\\n\\u003cli\\u003eMALDONADO M D M, MEDINA J I, VELAZQUEZ L, et al. Targeting Rac and Cdc42 GEFs in Metastatic Cancer [J]. Front Cell Dev Biol, 2020, 8: 201.\\u003c/li\\u003e\\n\\u003cli\\u003eXIA J, XU M, HU H, et al. 5,7,4\\u0026apos;-Trimethoxyflavone triggers cancer cell PD-L1 ubiquitin-proteasome degradation and facilitates antitumor immunity by targeting HRD1 [J]. Med Comm (2020), 2024, 5(7): e611.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu X, Zhang F, Fan Y, Qiu C, Wang K. MCM4 potentiates evasion of hepatocellular carcinoma from sorafenib-induced ferroptosis through Nrf2 signaling pathway. Int Immunopharmacol. 2024;142(Pt A):113107. doi:10.1016/j.intimp.2024.113107\\u003c/li\\u003e\\n\\u003cli\\u003eWANG L, LIU X. Pan-Cancer Multi-Omics Analysis of Minichromosome Maintenance Proteins (MCMs) Expression in Human Cancers [J]. Front Biosci (Landmark Ed), 2023, 28(9): 230.\\u003c/li\\u003e\\n\\n\\u003c/ol\\u003e\"},{\"header\":\"Table 1\",\"content\":\"\\u003cp\\u003eTable 1 is available in the Supplementary Files section.\\u003c/p\\u003e\\n\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":true,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"journal-of-translational-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"jtrm\",\"sideBox\":\"Learn more about [Journal of Translational Medicine](http://translational-medicine.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/jtrm/default.aspx\",\"title\":\"Journal of Translational Medicine\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7116246/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7116246/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eColon cancer ranks among the top three in both the incidence and mortality rates of malignant tumors worldwide. Moreover, radical surgery is difficult for patients with advanced colon cancer, and chemotherapy drugs are prone to drug resistance. The five-year survival rate is only 13.1%. Therefore, an in-depth analysis of the occurrence, development and drug resistance mechanism of colon cancer is of great clinical significance for optimizing the treatment plan of patients and improving prognosis. As one of the homologous recombination repair proteins, micrormosomal maintenance protein 8 (MCM8) plays an important role in the normal physiological process of cells. In recent years, the research on its role in tumorigenesis and development has gradually deepened, but the role of MCM8 in the malignant progression of colon cancer still remains to be explored. MCM8 is abnormally highly expressed in colon cancer cells and tissues, and is positively correlated with the pathological stage progression and poor prognosis of patients. Our study indicated that MCM8 promotes the transition of the cell cycle from the G1 phase to the S phase. Moreover, our study showed that MCM8 interacted with Cdc42 and promoted its protein stability by competitively inhibiting the ubiquitination modification of Cdc42's E3 ubiquitin ligase HRD1. The rescue experiment showed that MCM8 promoted the proliferation, cell cycle progression, invasion, tumor-forming ability in vivo and resistance to 5-FU of colon cancer cells through Cdc42, while inhibiting cell apoptosis. Collectively, MCM8 is abnormally highly expressed in colon cancer and stabilizes Cdc42 protein by competitively inhibiting HRD1, thereby promoting the occurrence and development of colon cancer and the formation of 5-FU resistance.\\u003c/p\\u003e\",\"manuscriptTitle\":\"MCM8 Promotes NSCLC Progression by Competitively Inhibiting HRD1-Mediated CDC42 Ubiquitination and Degradation\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-08-12 13:02:54\",\"doi\":\"10.21203/rs.3.rs-7116246/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2025-08-06T18:45:14+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-08-06T18:43:53+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-08-05T14:13:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Journal of Translational Medicine\",\"date\":\"2025-08-03T05:08:44+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"journal-of-translational-medicine\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"jtrm\",\"sideBox\":\"Learn more about [Journal of Translational Medicine](http://translational-medicine.biomedcentral.com)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/jtrm/default.aspx\",\"title\":\"Journal of Translational Medicine\",\"twitterHandle\":\"@BioMedCentral\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"b8976bcf-c944-481e-8013-f533d70c13a8\",\"owner\":[],\"postedDate\":\"August 12th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-01-19T16:48:45+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-7116246\",\"link\":\"https://doi.org/10.1186/s12967-026-07687-0\",\"journal\":{\"identity\":\"journal-of-translational-medicine\",\"isVorOnly\":false,\"title\":\"Journal of Translational Medicine\"},\"publishedOn\":\"2026-01-16 16:30:15\",\"publishedOnDateReadable\":\"January 16th, 2026\"},\"versionCreatedAt\":\"2025-08-12 13:02:54\",\"video\":\"\",\"vorDoi\":\"10.1186/s12967-026-07687-0\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12967-026-07687-0\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7116246\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7116246\",\"identity\":\"rs-7116246\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}