{"paper_id":"3b75066f-bc10-4b64-b844-0e6132d61a0d","body_text":"Exploring Vaginal Microbiota–Tissue Resident Stem Cell Crosstalk: VCAM1-Mediated Enhancement of Regenerative Capacity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Exploring Vaginal Microbiota–Tissue Resident Stem Cell Crosstalk: VCAM1-Mediated Enhancement of Regenerative Capacity Hwayong Lee, Soo-Rim Kim, Eun-Kyung Min, Choon-Mi Lee, Kunhee Na, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7062920/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The vaginal microbiota plays a critical role in regulating endometrial development, which is key for successful embryo implantation and pregnancy. However, the extent to which the vaginal microbiota contributes to various tissue regeneration-associated functions of human endometrial stem cells, which play pivotal roles in endometrial development and subsequent endometrial receptivity, remains largely unexplored. Here, we demonstrate that exposure to microbiota-derived secretory factors enhances key regenerative functions of endometrial stem cells, including self-renewal, migratory capacity, multilineage differentiation potential, and metabolic activity via upregulation of VCAM1 (vascular cell adhesion molecule 1), which serves as a central regulatory hub, and the subsequent activation of the PI3K/Akt signaling pathway, highlighting a critical microbiota-driven mechanism governing endometrial stem cell function and tissue regeneration. Functional knockdown of VCAM1 and pharmacological inhibition of the Akt signaling pathway attenuated the microbiota-driven beneficial effects, confirming their functional roles. Notably, depletion of the vaginal microbiota impaired endometrial development and significantly reduced the clonogenicity of endometrial stem cells in vivo , reinforcing the essential role of microbiota-derived factors in endometrial homeostasis. These findings provide critical insights into the microbiota-endometrial stem cell crosstalk and highlight the therapeutic potential of microbiota-derived secretory factors in stem cell-based regenerative medicine and reproductive health. Biological sciences/Stem cells/Mesenchymal stem cells Health sciences/Health care/Therapeutics/Stem-cell therapies Endometrial stem cells Vaginal microbiota Secretory factors VCAM1 Akt signaling Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction The human vaginal microbiota consists of a diverse array of commensal microorganisms that play a crucial role in maintaining endometrial development 1 , 2 , a key process for successful embryo implantation and subsequent pregnancy. Among these, Lactobacilli species are predominant and serve as key regulators of infertility, implantation failure, and pregnancy complications 3 . Particularly, Lactobacillus iners modulate the local immune environment and contribute to the prevention of various gynecological disorders, including chronic endometritis, endometriosis, and pelvic inflammatory disease 4 – 6 . Despite substantial advances in elucidating the role of the vaginal microbiota in both the disruption and maintenance of uterine health 7 , the precise impact of L. iners on the regenerative functions of tissue-resident stem cells, as well as the underlying molecular mechanisms governing this crosstalk, remain largely unexplored. The endometrium lining the uterine cavity is among the most rapidly regenerating tissues, exhibiting substantial cyclic proliferation of up to approximately 7 mm within a single week during each menstrual cycle. 8 . As observed in various dynamic tissues, rapid regeneration and cyclic expansion of the endometrial functional layer are primarily driven by tissue-resident clonogenic stem cells 9 , 10 . Hence, the persistent activation and recruitment of resident endometrial stem cells capable of differentiating into distinct endometrial cell types are crucial for embryo implantation and subsequent successful pregnancy 11 . Lucas et al. demonstrated that a reduced population of clonogenic endometrial stem cells impairs the regenerative potential of the endometrium, leading to lower pregnancy rates in individuals experiencing recurrent pregnancy loss 12 . In this context, we hypothesized that L. iners , through their secretory factors, could enhance the regenerative potential of endometrial stem cells by promoting self-renewal, migratory capacity, multilineage differentiation potential, pluripotency, and energy-producing (metabolic) activities. In this study, we performed various in vitro experiments in which human endometrial stem cells were treated with L. iners -derived secretory factors. Our findings revealed a marked increase in the clonogenic endometrial stem cell subpopulation, along with enhanced migratory capacity, multilineage differentiation potential, and expression of pluripotency-associated genes, including c-MYC , KLF4 , NANOG , OCT4 , and SOX2 . Furthermore, treatment with L. iners -derived secretory factors markedly enhanced the metabolic activity of endometrial stem cells by stimulating energy production via mitochondrial oxidative phosphorylation and cytosolic glycolysis. We elucidated the molecular mechanisms underlying these effects by conducting large-scale RNA sequencing (bulk RNA-seq) following the treatment of endometrial stem cells with L. iners -derived secretory factors, leading to the identification of vascular cell adhesion molecule 1 ( VCAM1 ) as a key regulatory gene mediating the effects of these secretory factors. Bioinformatics analysis using KEGG pathway mapping and Gene Expression Omnibus (GEO) datasets further confirmed that vaginal microbiota interactions lead to upregulated VCAM1 expression levels. Further in vitro and in vivo functional studies revealed that VCAM1 knockdown abolished the beneficial effects of L. iners -derived secretory factors on the aforementioned endometrial stem cell functions, thereby establishing VCAM1 as a critical mediator of crosstalk between endometrial tissue-resident stem cells and the vaginal microbiota. Further analysis revealed that the L. iners -derived secretory factor activates key signaling pathways, notably the PI3K/Akt 13 pathway, which is critically involved in regulating the diverse functions of tissue-resident stem cells. Pharmacological inhibition of this pathway significantly attenuated secretory factor-induced enhancements in self-renewal, migratory capacity, differentiation potential, and pluripotency. These findings highlight the pivotal role of this signaling pathway in mediating the underlying mechanisms and provide new insights into how the vaginal microbiota regulates endometrial stem cell function and highlight the therapeutic potential of leveraging microbiota-derived secretory factors for advancements in regenerative medicine. By elucidating the intricate crosstalk between vaginal microbiota and tissue-resident stem cells, this study advances our understanding of tissue regeneration and paves the way for the development of innovative microbiota-based therapeutic strategies that target a range of tissue injury-related disorders. Materials and methods Isolation and culture of human endometrial stem cells from endometrial tissues Human endometrial stem cells were obtained from endometrial tissues of uterine fibroid patients with written informed consent from patients and approval of Gachon University Institutional Review Board (IRB No: GAIRB2018-134). Endometrial tissues were minced into small pieces. These small pieces were digested in DMEM containing 10% FBS and 250 U/ml type I collagenase for 5 h at 37°C in a rotating shaker. The digestion mixture was then filtered through a 40-µm cell strainer to separate stromal-like stem cells from epithelial gland fragments and undigested tissue. Isolated endometrial stem cells were then cultured following previously established protocols 14 . Endometrial cells were cultured in StemPro® MSC SFM CTS™ (GIBCO, Cat No.: A1033201) at 37°C under 5% CO 2 in air. The culture medium was changed every 2 or 3 days. Flow cytometry FACS analysis and cell sorting were performed using FACS Calibur and FACS Aria machines (Becton Dickinson, Palo Alto, CA), respectively. FACS data were analyzed using FlowJo software (Tree Star, Ashland, OR). Antibodies against the following proteins were used: APC-conjugated CD44 (BD Bioscience, Cat. 559942, dilution 1/40), PE-conjugated CD133 (MACS; Miltenyi Biotech, 130-080-081, dilution 1/40), CD34 (MACS; Miltenyi Biotech, 30-081-002), CD44 (MACS; Miltenyi Biotech, 130-095-180), CD45 (MACS; Miltenyi Biotech, 130-080-201), CD73 (MACS; Miltenyi Biotech, 130-095-182), CD105 (MACS; Miltenyi Biotech, 130-094-941), CD140b (MACS; Miltenyi Biotech, 130-105-279), and Ki67 (BD Pharmingen Tm , Cat. No.556027). The FACS gates were established by staining with an isotype antibody or secondary antibody. Cell proliferation assay The MTT assay was performed following the manufacturer’s instructions (Sigma, Cat. No.: M5655) to assess the growth-promoting effects of Lactobacillus iners -derived secretory factor treatment. Cells (1×10 4 cells/well) were seeded into 96-well plates. After 24 h of incubation, endometrial stem cells were treated with Lactobacillus iners -derived secretory factor or vehicle for 72 h. Viable cells were determined by measuring absorbance at 570 nm using a Versa Max microplate reader. In vitro cell migration assay Stimulatory effects of Lactobacillus iners -derived secretory factor treatment on the migration capacity of endometrial stem cells were analyzed by measuring the number of cells that migrated in response to vaginal microbiota crosstalk divided by the number of spontaneously migrating cells. Cells were plated into upper chambers of permeable Transwell supports (Corning Inc., Corning, NY, USA) at a density of 1 × 10 5 cells/well in 200 µL of culture medium to track the migration of cells. Transwell chambers had 8.0-µm pores in 6.5-mm-diameter polycarbonate membranes. They were used in a 24-well plate format. Noninvasive cells on the upper surface of each membrane were removed by scrubbing with laboratory paper. Migrated cells on the lower surface of each membrane were fixed with 3.7% paraformaldehyde for 5 min and stained with hematoxylin for 15 min. Later, the number of migrated cells was counted in three randomly selected fields of each well under a light microscope at 50X magnification. The difference in each group is shown as a fold change. Protein isolation and western blot analysis Protein expression levels were determined by western blot analysis as previously described 15 . Cells were lysed in a buffer containing 50 mM Tris, 5 mM EDTA, 150 mM NaCl, 1 mM DTT, 0.01% NP 40, and 0.2 mM PMSF. Protein concentrations of total cell lysates were measured using bovine serum albumin as a standard. Samples containing equal amounts of proteins were separated via sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) and then transferred onto nitrocellulose membranes (Bio-Rad Laboratories). These membranes were blocked with 5% skim milk in Tris-buffered saline containing Tween-20 at room temperature (RT). Membranes were then incubated with primary antibodies against MMP-2 (Cell Signaling #4022), MMP-9 (Cell Signaling #13667), VCAM1 (Abcam, ab134047), total PI3K (Cell Signaling #4292), phospho-PI3K (Cell Signaling #4228), total Akt (Cell Signaling #4491), phospho-Akt (Cell Signaling #4060), or β-actin (Abcam, ab189073) at 4°C overnight and then incubated with HRP-conjugated goat anti-rabbit IgG (BD Pharmingen, 554021) or goat anti-mouse IgG (BD Pharmingen, 554002) secondary antibodies at RT for 60 min. Antibody-bound proteins were detected using enhanced chemiluminescence (ECL) reagents. Adipogenic differentiation Endometrial stem cells were incubated with DMEM low-glucose medium supplemented with 500 µM methylxanthine, 5 µg/mL insulin, and 10% FBS. Endometrial stem cells were cultured for three weeks, with the medium refreshed twice weekly, either in the presence or absence of Lactobacillus iners -derived secretory factor treatment. Lipid droplet formation was confirmed by oil red O staining. Relative quantification of lipid droplet formation was determined by measuring absorbance at 500 nm. Osteogenic differentiation Endometrial stem cells were incubated with DMEM high-glucose medium supplemented with 0.1 µM dexamethasone, 10 mM β-glycerophosphate, 50 µM ascorbate and 10% FBS. Endometrial stem cells were maintained in culture for three weeks, with medium changes twice per week, either in the presence or absence of Lactobacillus iners -derived secretory factor exposure. Differentiated cells were stained with Alizarin Red S to detect de novo formation of bone matrix. Alizarin red S in each sample was quantified by measuring the optical density (OD) of the solution at 570 nm. Real-time PCR Total RNA was extracted from endometrial stem cells using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. Real-time PCR was performed using a Rotor-Gene Q (Qiagen). The reaction was subjected to amplification cycles of 95°C for 20 sec, 60°C for 20 sec, and 72°C for 25 sec. The relative mRNA expression of the selected gene was normalized to that of PPIA and quantified using the ΔΔCT method. Sequences of PCR primers are listed in Table 1 . Table 1. Primer Sequences for Quantitative RT-PCR Gene Gene bank No. Direction Primer sequence Human PPIA NM_021130 F TGCCATCGCCAAGGAGTAG R TGCACAGACGGTCACTCAAA Human IL6 NM_000600 F GGTACATCCTCGACGGCATCT R GTGCCTCTTTGCTGCTTTCAC Human P16 NM_000077 F CTACTGAGGAGCCAGCGTCT R CTGCCCATCATCATGACCT Human P18 NM_001262 F TGGGTCTTCCGCAAGAACTC R TGGCAGCCAAGTGCAAGGGC Human P21 NM_000389 F ACAGCAGAGGAAGACCATGTGGACC R CGTTTTCGACCCTGAGAGTCTCCAG Human C-MYC NM_002467 F AAAGGCCCCCAAGGTAGTTA R GCACAAGAGTTCCGTAGCTG Human KLF4 NM_001314052 F GAACTGACCAGGCACTACCG R TTCTGGCAGTGTGGGTCATA Human NANOG NM_024865 F TGGGATTTACAGGCGTGAGC R AAGCAAAGCCTCCCAATCCC Human OCT4 NM_002701 F AGCCCTCATTTCACCAGGCC R TGGGACTCCTCCGGGTTTTG Human SOX2 NM_003106 F AAATGGGAGGGGTGCAAAAGAGGAG R CAGCTGTCATTTGCTGTGGGTGATG Human VCAM1 NM_080682 F GATTCTGTGCCCACAGTAAGGC R TGGTCACAGAGCCACCTTCTTG Mouse HPRT NM_013556 F GCCTAAGATGAGCGCAAGTTG R TACTAGGCAGATGGCCACAGG Mouse C-MYC NM_010849 F CGCACACACAACGTCTTGGA R AGGATGTAGGCGGTGGCTTT Mouse KLF4 NM_010637 F GGTGCAGCTTGCAGCAGTAA R AAAGTCTAGGTCCAGGAGGT Mouse NANOG NM_028016 F GCCTTACGTACAGTTGCAGC R TCACCTGGTGGAGTCACAGA Mouse OCT4 NM_013633 F GCATTCAAACTGAGGCACCA R AGCTTCTTTCCCCATCCCA Mouse SOX2 NM_011443 F GAAGCGTGTACTTATCCTTCTTCAT R GAGTGGAAACTTTTGTCCGAGA VCAM1 knockdown Small hairpin RNA targeting VCAM1 (shRNA: accession No. NM_080682) and scrambled shRNA (shCTRL) were purchased from Bioneer (Daejeon, South Korea). For efficient shRNA transfection, reverse transfection was performed using Lipofectamine 2000 (Invitrogen, Cat No: 52887) according to the manufacturer’s protocol. We chose VCAM1 shRNA because it was the most effective at the mRNA level from five shRNAs designed from the target sequence based on qRT‒PCR analysis. Ingenuity pathway analysis (IPA) VCAM1-related gene analyses were performed with IPA version 2.0 software (Ingenuity Systems, Redwood City, CA, USA). Differentially expressed genes (t-test, P < 0.005) between Lactobacillus iners -derived secretory factor exposed cells and non-exposed cells were subjected to VCAM1-related gene analysis. The significance of each factor was measured by Fisher’s exact test ( p- value), which was used to identify differentially expressed genes from microarray data that overlapped with genes known to be regulated by a factor. The activation score (Z score) was used to show the status of predicted factors by comparing the observed differential regulation of genes (“up” or “down”) in the RNA Seq data relative to the literature-derived regulation direction, which could be either activating or inhibiting. Analysis of the GEO database GEO ( https://www.ncbi.nlm.nih.gov/geo/ ) is a freely distributed database repository of high-throughput gene expression data generated by genome hybridization arrays, chip sequencing, and DNA microarrays 16 , 17 . Researchers provide their experimental results in four categories: experimental designs, samples, platforms, and raw data. Clinical or experimental samples within each dataset are further organized based on various experimental subgroups such as treatment, physiologic condition, and disease state. These categorized biological data are presented as “GEO profiles”, which include dataset title, gene annotation, a chart depicting expression levels, and the rank for that gene across each sample 18 . Gene expression data were selected from GEO datasets according to multiple parameters such as tissues, cancers, diseases, genetic modifications, external stimuli, and development. Expression profiles of VCAM1 under various physiological conditions were analyzed according to previously established procedures 18 . Evaluation of effects of vaginal microbiota-derived secretory factor treatment in an animal model All animal experiments were approved and conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) (LCDI-2024-0016) of Gachon University. Both NSG (were purchased from Daehan Bio Link) and VCAM1 KO (were purchased from Orient Bio) mice were randomly divided four groups. 7-week-old immunodeficient NSG mice were subjected to treatment with 2% TCA (150 µl, administered directly into the uterine horn) to induce uterine endometrial ablation or with sterilized PBS vehicle as a control. Lactobacillus iners -derived secretory factor (20mg/kg) daily for one week. These mice were anesthetized and exsanguinated by cardiac puncture. Stem cells were then isolated from uterine and adipose tissues. Uterine, adipose tissues, or bone marrow were then minced into small pieces. These small pieces were then digested in DMEM containing 10% FBS and 250 U/ml type I collagenase for 5 h at 37°C. The digestion mixture was then filtered through a 40-µm cell strainer. Endometrial cells were cultured in StemPro® MSC SFM CTS™ (GIBCO, Cat No.: A1033201) at 37°C under 5% CO 2 in air. The culture medium was changed every 2 or 3 days. For further experiments, stem cells isolated from the endometrium were cultured and expanded in vitro with continuous exposure to Lactobacillus iners -derived secretory factor (10µl/ml) to properly mimic physiological conditions of stem cell-microbiota crosstalk in vivo . Statistical analysis All statistical data were analyzed with GraphPad Prism 5.0 (GraphPad Software, San Diego, CA) and evaluated using two-tailed Student’s t-tests. Values of P < 0.05 were considered to indicate statistical significance. Results Crosstalk with L. iners promotes various key regenerative functions in human endometrial stem cells in vitro Human endometrial stem cells were freshly obtained from endometrial tissue fragments, according to established protocols 19 (Suppl. Figure 1a), after which they were expanded by in vitro culture. Stem cell properties were subsequently evaluated using flow cytometry based on the expression of various positive and negative surface markers, including CD34, CD44, CD45, CD73, CD105, and CD140b (Suppl. Figure 1b). The multipotent differentiation potential of these stem cells into adipogenic and osteogenic lineages was evaluated using Oil Red O staining for adipocytes and Alizarin Red staining for osteoblasts (Suppl. Figure 1c). The schematic in Fig. 1 a outlines our core hypothesis, suggesting that crosstalk with the vaginal microbiota L. iners enhances the diverse functional properties of endometrial stem cells. Therefore, we assessed whether exposure to L. iners -derived secretory factors enhanced the functional characteristics of endometrial stem cells. Notably, exposure to L. iners -derived secretory factors significantly promoted the self-renewal capacity of endometrial stem cells (Fig. 1 b) and markedly increased the Ki-67⁺ clonogenic subpopulation (Fig. 1 c). Consistent with these findings, exposure to L. iners -derived secretory factors notably boosted the migratory potential of endometrial stem cells. (Fig. 1 d). To further validate the effects on migratory capacity, western blot analysis was performed to evaluate the protein expression levels of MMP-2 and MMP-9 20 , key regulators of cell migration and invasion through extracellular matrix remodeling. (Fig. 1 e). Furthermore, exposure to L. iners -derived secretory factors markedly enhanced the multi-lineage differentiation capacity of endometrial stem cells, promoting their differentiation into adipocytes (Fig. 1 f) and osteoblasts (Fig. 1 g). Consistent with these results, treatment with L. iners -derived secretory factors significantly upregulated the expression of key pluripotency-associated genes including KLF4 , e , OCT4 , and SOX2 . (Fig. 1 h). These findings indicate that crosstalk with L. iners substantially promoted various tissue regeneration-related functions of endometrial stem cells, including self-renewal, migration, multilineage differentiation potential, and pluripotency. Crosstalk with L. iners significantly increased energy-producing (metabolic) activities of endometrial stem cells in vitro Various stem cell functions associated with tissue regeneration, including self-renewal, differentiation capacity, and maintenance of pluripotency, are tightly regulated by energy-generating metabolic processes such as mitochondrial oxidative phosphorylation and cytosolic glycolysis 21 – 23 . Furthermore, resident microbiota has been implicated in the regulation of various aspects of stem cell homeostasis, including metabolic activity, development, and immune responses 24 . Mitochondrial oxidative phosphorylation, which relies on oxygen consumption, is a critical indicator of sustained ATP generation and cellular vitality 25 . To investigate the effects of vaginal microbiota interactions on the metabolic activity of endometrial stem cells, oxidative phosphorylation levels were measured in the presence and absence of L. iners -derived secretory factors using the Seahorse XF analyzer, which enables precise quantification of mitochondrial respiration by tracking real-time oxygen consumption rates (OCR) in live cells 26 . To inhibit coupled mitochondrial respiration, the ATP synthase inhibitor oligomycin, which specifically targets complex V of the electron transport chain, was administered 27 . FCCP, a powerful uncoupler of oxidative phosphorylation, was introduced to collapse the mitochondrial membrane potential (Δψm), causing proton leakage across the inner mitochondrial membrane and facilitating oxygen consumption without ATP generation 25 . Thus, FCCP administration enables the assessment of the mitochondria's real-time maximal respiratory capacity by measuring the OCR. Exposure to L. iners -derived secretory factors markedly enhanced mitochondrial oxidative phosphorylation in human endometrial stem cells (Fig. 2 a), accompanied by an increase in non-mitochondrial OCR (Fig. 2 b). Treatment with L. iners -derived secretory factors notably elevated basal respiration (Fig. 2 c), spare respiratory capacity (Fig. 2 d), and maximal mitochondrial respiration (Fig. 2 e), which collectively indicate the ability of mitochondria to generate additional ATP in response to a sudden surge in energy demand 28 . Furthermore, the total ATP generation from both mitochondrial and cytosolic sources was significantly elevated upon treatment with L. iners -derived secretory factors (Fig. 2 f). As glycolysis metabolizes glucose into pyruvic acid and protons under aerobic conditions 29 , 30 , we assessed glycolytic activity by quantifying real-time extracellular acidification rates (ECAR). Figure 2 g shows a schematic illustration of the assessment of glycolytic activity using a Seahorse XF analyzer. To inhibit glycolysis, the glucose analog 2-deoxyglucose was administered, allowing the real-time assessment of basal ECAR 31 . Rotenone and antimycin A were used to suppress complexes I and III of the mitochondrial respiratory chain, effectively inhibiting mitochondrial oxidative phosphorylation 32 . Real-time analysis of glycolytic rates revealed that endometrial stem cells treated with L. iners -derived secretory factors exhibited significantly higher glycolytic activity than the untreated cells (Fig. 2 g). Treatment with L. iners -derived secretory factors significantly increased basal glycolysis (Fig. 2 h) and compensatory glycolytic activity (Fig. 2 i). Validation of the vaginal microbiota-mediated crosstalk-induced enhancement of diverse endometrial stem cell functions in vivo using animal models Our in vitro results (Figs. 1 and 2 ) indicated that crosstalk mediated by L. iners had the potential to enhance a range of tissue regeneration-related functions in human endometrial stem cells. To investigate the potential of vaginal microbiota-mediated crosstalk to robustly stimulate endometrial stem cell function in vivo , we evaluated various tissue regeneration-associated activities following consecutive intravenous (IV) administration of L. iners- derived secretory factors (Fig. 3 a). Consistent with our in vitro findings, exposure to L. iners -derived secretory factors significantly increased self-renewal capacity of endometrial stem cells in vivo (Fig. 3 b). Similarly, in an animal model, exposure to L. iners -derived secretory factors significantly enhanced the migratory capacity of endometrial stem cells (Fig. 3 c) and upregulated the expression of MMP-2 and MMP-9 in vivo (Fig. 3 d). In vivo exposure to L. iners -derived secretory factors markedly promoted the multilineage differentiation potential of endometrial stem cells into adipocytes (Fig. 3 e) and osteoblasts (Fig. 3 f), and significantly upregulated the expression of pluripotency-associated genes, including c-MYC , KLF4 , NANOG , OCT4 , and SOX2 (Fig. 3 g). Interestingly, colony-forming assays conducted on endometrial stem cells isolated from the uterine endometrium of mice treated with a broad-spectrum antibiotic mixture to deplete the vaginal microbiota revealed a significant reduction in colony-forming efficiency compared to that in the control group (Fig. 3 h). Clonogenic stem cells in the endometrium play critical roles in endometrial development 12 . Therefore, to assess the effect of vaginal microbiota depletion on endometrial development, histopathological analysis was performed using hematoxylin and eosin staining under the same experimental conditions as previously mentioned. Comparative analysis revealed that the group treated with an antibiotic mixture to eliminate the vaginal microbiota exhibited significantly impaired endometrial development compared to the control group (Fig. 3 i). Furthermore, we investigated whether exposure to L. iners -derived secretory factors enhanced tissue repair-associated functions in other tissue-resident stem cells, including adipose tissue-derived stem cells (Suppl. Figure 2a), and bone marrow-derived stem cells (Suppl. Figure 3a). Consistently, exposure to L. iners -derived secretory factors significantly enhanced the self-renewal capacity (Figs. S2b and S3b) and migratory ability (Figs. S2c–d and S3c–d), and multilineage differentiation potential (Figs. S2e–f and S3e–f) of adipose tissue-derived and bone marrow-derived stem cells in vivo . Additionally, in vivo exposure to L. iners -derived secretory factors led to a significant upregulation of pluripotency-associated genes, including c-MYC , KLF4 , NANOG , OCT4 , and SOX2 , in both adipose tissue-derived and bone marrow-derived stem cells (Figs. S2g and S3g). These results suggest that the microbiota-mediated enhancement of stem cell function may be a broadly applicable mechanism that extends beyond endometrial stem cells to other stem cell types. VCAM1 serves as a critical mediator in the crosstalk between human endometrial stem cells and vaginal microbiota To elucidate the regulatory mechanism underlying the crosstalk between human endometrial stem cells and L. iners , we performed bulk RNA-Seq to analyze large-scale gene expression patterns in human endometrial stem cells following exposure to L. iners -derived secretory factors (Fig. 4 a). A substantial number of gene clusters were significantly upregulated in response to exposure to L. iners -derived secretory factors (Fig. 4 b). To further investigate the functional interplay between vaginal microbiota-mediated crosstalk and intracellular signaling networks in endometrial stem cells, we conducted a KEGG pathway enrichment analysis, which revealed significant activation of multiple tissue regeneration-associated signaling pathways following exposure to L. iners -derived secretory factors (Fig. 4 c). Among the genes exhibiting differential expression in response to L. iners -derived secretory factors, VCAM1 displayed a distinct expression pattern. Consistent with the observed functional changes, VCAM1 expression was significantly upregulated after exposure to L. iners -derived secretory factors (Fig. 4 d). To confirm the altered expression pattern of VCAM1 in response to L. iners -derived secretory factors, we conducted additional analyses on endometrial stem cells using real-time PCR and western blotting. Consistently, exposure to vaginal microbiota-derived secretory factors resulted in significant upregulation of VCAM1 expression (Fig. 4 e). To further validate the association between elevated VCAM1 expression and vaginal microbiota-mediated crosstalk, we analyzed data from the GEO database. VCAM1 expression was upregulated in various cell models upon interaction with normal flora, whereas its expression significantly decreased when microbiota interactions were disrupted (Fig. 4 f). GSEA also demonstrated a significant upregulation of TNF-alpha and immune response-related signaling pathways associated with VCAM1 following exposure to L. iners -derived secretory factors (Fig. 4 g). To investigate whether the activation of VCAM1-related signaling pathways was positively linked to exposure to L. iners -derived secretory factors, we conducted an extensive analysis of gene expression profiles and their corresponding signaling networks using Ingenuity Pathway Analysis (IPA). Exposure to L. iners -derived secretory factors in endometrial stem cells led to the upregulation of VCAM1 positive regulators, including IL13, PRKCD, and HIF1A (Fig. 4 h). These results suggest that VCAM1 functions as a robust response gene in stem cells following exposure to L. iners -derived secretory factors. Silencing VCAM1 effectively abolished the beneficial effects of L. iners -derived secretory factors on multiple endometrial stem cell functions To further elucidate the role of VCAM1 in regulating vaginal microbiota-mediated crosstalk related to various tissue regeneration-associated functions, we conducted knockdown experiments in endometrial stem cells using VCAM1-specific shRNA (Suppl. Figure 4a–c), as shown in Fig. 5 a. Notably, the promotion of self-renewal capacity (Fig. 5 b) and expansion of the clonogenic Ki-67⁺ subpopulation (Fig. 5 c) in endometrial stem cells induced by L. iners -derived secretory factors was markedly diminished upon VCAM1 knockdown. Moreover, VCAM1 depletion markedly diminished the vaginal microbiota crosstalk-driven promotion of stem cell migration (Fig. 5 d), along with a notable attenuation in the expression of key migration and invasion regulators, including MMP-2 and MMP-9 (Fig. 5 e). Furthermore, VCAM1 knockdown significantly reduced the beneficial effects of the vaginal microbiota-mediated crosstalk on the multilineage differentiation capacity of endometrial stem cells into adipocytes (Fig. 5 f) and osteoblasts (Fig. 5 g) in vitro . Silencing VCAM1 attenuated the vaginal microbiota crosstalk-driven upregulation of pluripotency-associated factors, including c-MYC, KLF4, NANOG, OCT4, and SOX2 (Fig. 5 h). These results highlight the pivotal role of VCAM1 in regulating the vaginal microbiota-mediated crosstalk, which influences various tissue regeneration-associated functions of human endometrial stem cells. Crosstalk between endometrial stem cells and vaginal microbiota is mediated through the activation of PI3K/Akt signaling pathways To elucidate the signaling pathways involved in the crosstalk between endometrial stem cells and vaginal microbiota, we examined the activation status of the PI3K/Akt pathway in response to L. iners -derived secretory factors. These pathways are well known for their critical roles in regulating the self-renewal 33 , migratory capacity 34 , and stemness 35 of human endometrial stem cells (Fig. 6 a). Accordingly, we investigated whether the PI3K/Akt signaling pathway exhibited similar activation patterns in response to L. iners -derived secretory factor exposure using western blot analysis. Consistent with the observed functional outcomes, exposure to L. iners -derived secretory factors led to significant activation of the PI3K/Akt signaling pathway in endometrial stem cells (Fig. 6 b). To further clarify the hierarchical relationship between VCAM1 and the PI3K/Akt signaling pathways, we conducted additional experiments involving VCAM1 knockdown along with the application of a specific inhibitor targeting the Akt signaling pathway. VCAM1 knockdown resulted in a significant reduction in the phosphorylation of Akt signaling pathways (Fig. 6 c). By contrast, the inhibition of Akt signaling using a specific pathway inhibitor (Fig. 6 d) had no appreciable effect on VCAM1 expression. Consistently, the enhanced PI3K and Akt signaling induced by L. iners -derived secretory factors were substantially attenuated following VCAM1 knockdown (Fig. 6 e). These results indicate that VCAM1 functions as an upstream regulator by modulating the activation of both the Akt signaling pathways. To further validate the association between elevated PI3K/Akt signaling activity and vaginal microbiota-driven interactions, we conducted a large-scale gene expression analysis using data from the GEO database. Notably, both PI3K and Akt expression levels were upregulated in various cell models upon interaction with normal flora (Fig. 6 f). Furthermore, GSEA demonstrated significant upregulation of PI3K/Akt signaling following exposure to L. iners -derived secretory factors (Fig. 6 g). To investigate whether the activation of Akt-related signaling pathways was positively linked to exposure to L. iners -derived secretory factors, we conducted an extensive analysis of gene expression profiles and their corresponding signaling networks using IPA. Exposure of endometrial stem cells to L. iners -derived secretory factors led to the upregulation of Akt-positive regulators, including MYC, KLF4, and PI3K (Fig. 6 h). Suppression of Akt signaling activity effectively abolished the positive effects of vaginal microbiota-driven crosstalk on various functional properties of endometrial stem cells To further explore whether the inhibition of the PI3K/Akt signaling pathway could reduce the stimulatory effects of vaginal microbiota-driven crosstalk on various endometrial stem cell functions, we evaluated the impact of Inhibitor V (targeting the Akt pathway) on various endometrial stem cell functions, both in the presence and absence of L. iners -derived secretory factors (Fig. 7 a). Our results demonstrated that the promotion of self-renewal capacity (Fig. 7 b) and expansion of the clonogenic Ki-67⁺ subpopulation (Fig. 7 c) in endometrial stem cells induced by L. iners -derived secretory factors was markedly attenuated upon Akt signaling inhibition. Furthermore, inhibition of the Akt signaling pathway markedly suppressed the vaginal microbiota crosstalk-driven promotion of cell migratory capacity (Fig. 7 d), accompanied by a pronounced reduction in the expression of MMP-2 and MMP-9 (Fig. 7 e). Moreover, blocking the Akt signaling pathway significantly diminished the vaginal microbiota crosstalk-induced enhancement of the multilineage differentiation potential of endometrial stem cells into adipocytes (Fig. 7 f) and osteoblasts (Fig. 7 g). Consistently, inhibition of the Akt signaling pathway significantly reduced the vaginal microbiota crosstalk-induced upregulation of pluripotency-associated genes, including KLF4 , NANOG , OCT4 , and SOX2 (Fig. 7 h). These findings underscore the critical role of the Akt signaling pathway as a downstream effector of VCAM1, orchestrating the vaginal microbiota-mediated crosstalk that governs various tissue regeneration-associated functions in human endometrial stem cells. Characterizing the expression patterns of diverse growth factors induced by vaginal microbiota crosstalk and investigating their correlations with various physiological states To investigate whether the enhancing effects of vaginal microbiota crosstalk on various human endometrial stem cell functions were mediated by the secretion of specific growth factors or cytokines, we performed antibody array analyses on cells treated with or without L. iners -derived secretory factors. Treatment of endometrial stem cells with vaginal microbiota-derived secretory factors altered the expression levels of 40 distinct proteins. The L. iners -derived secretory factor treatment led to the substantial upregulation of six key growth factors: colony stimulating factor 2 (CSF2), insulin-like growth factor-1 receptor (IGF-1R), keratinocyte growth factor (FGF-7), platelet-derived growth factor-AA (PDGF-AA), platelet-derived growth factor receptor β (PDGFRβ), and stem cell factor (SCF). By contrast, the expression levels of other growth factors exhibited only minimal deviations from baseline (Suppl. Figure 5a–c). These findings imply that these growth factors may at least partially contribute to the vaginal microbiota crosstalk-induced activation of the PI3K/Akt signaling pathway, thereby mediating the subsequent beneficial effects on endometrial stem cells. To further investigate the association between the aforementioned protein factors induced by vaginal microbiota-derived secretory factor exposure and various cellular conditions, we analyzed publicly available gene expression datasets from the GEO database. Consistent with our results, the GEO dataset analysis revealed that the expression of these protein factors was upregulated in the presence of normal flora, while exhibiting a marked reduction upon microbiota depletion (Suppl. Figure 5d). To investigate whether the activation of these six prominent protein factor-associated signaling pathways was positively linked to exposure to L. iners -derived secretory factors, we conducted an extensive analysis of gene expression profiles and their corresponding signaling networks using IPA. The aforementioned protein factors were not only involved in the activation of the PI3K/Akt signaling pathway but were also strongly correlated with the upregulation of key genes and regulatory signaling molecules governing stem cell activity in response to L. iners -derived secretory factor stimulation (Suppl. Figure 5e). VCAM1 knockout significantly attenuates the vaginal microbiota crosstalk-driven enhancement of various endometrial stem cell functions in vivo Our in vitro results emphasize the pivotal role of VCAM1 in regulating the crosstalk between vaginal microbiota and endometrial stem cells. To further explore the impact of VCAM1 deficiency on vaginal microbiota-mediated crosstalk and its effects on various tissue regeneration-associated functions of endometrial stem cells in vivo , we utilized VCAM1 knockout (K.O.) mice subjected to consecutive intravenous administration of L. iners -derived secretory factors. (Fig. 8 a). Consecutive exposure to L. iners -derived secretory factors did not result in a significant change in the self-renewal capacity of endometrial stem cells isolated from VCAM1 K.O. mice in vivo (Fig. 8 b). Similarly, the vaginal microbiota-derived secretory factor-induced enhancement of migratory capacity (Fig. 8 c) and the expression of MMP-2 and MMP-9 (Fig. 8 d) in endometrial stem cells showed minimal responsiveness in VCAM1 K.O. mice. Following successive exposure to vaginal microbiota-derived secretory factors, no significant enhancement was observed in the multilineage differentiation potential of endometrial stem cells from VCAM1 K.O. mice, either towards the adipogenic (Fig. 8 e) or osteogenic (Fig. 8 f) lineages in vivo . Additionally, the pronounced upregulation of pluripotency-associated genes ( c-MYC , KLF4 , NANOG , OCT4 , and SOX2 ) observed in wild-type mice following repeated exposure to vaginal microbiota-derived secretory factors was absent in VCAM1 K.O. mice (Fig. 8 g). Discussion Recent findings from the Human Microbiome Project estimated that the vaginal microbiota constitutes approximately 9% of the total bacterial population in females 36 . These microbial communities have been shown to play pivotal roles in various stages of reproduction, including gametogenesis 37 , fertilization 38 , as well as establishment and maintenance of pregnancy 39 . Accumulating evidence highlights the critical role of the vaginal microbiota in regulating endometrial development 1 , 2 , which is a key process for successful embryo implantation and pregnancy. Additionally, previous research has emphasized the importance of the microbiota in preserving epithelial homeostasis 40 , modulating immune responses 41 , and shaping metabolic pathways 42 . The regenerative capacity of tissue-resident stem cells is governed by the dynamic interplay between intrinsic cellular pathways and external environmental factors, including interactions with the host microbiota 24 , 43 , 44 . However, the extent to which vaginal microbiota contributes to various tissue regeneration-associated functions of human endometrial stem cells, which play a pivotal role in endometrial development and subsequent endometrial receptivity, remains largely unexplored. Our findings bridge this knowledge gap by demonstrating that the crosstalk between the vaginal microbiota and endometrial stem cells plays a pivotal role in promoting various regenerative functions, including self-renewal, migratory capacity, and multilineage differentiation potential in vitro (Fig. 1 a–h) and in vivo (Fig. 3 a–i). Notably, vaginal microbiota crosstalk results in increased expression of pluripotency-associated genes ( c-MYC , KLF4 , NANOG , OCT4 , and SOX2 ), suggesting that microbiota-derived signals actively sustain the stem-like properties of endometrial stem cells. By elucidating the underlying molecular mechanisms, we identified VCAM1 as a key mediator of this microbiota-endometrial stem cell crosstalk (Figs. 4 and 5 ) and demonstrated its involvement in activating the PI3K/Akt signaling pathway (Figs. 6 and 7 ), a crucial regulator of stem cell homeostasis and function. The PI3K/Akt signaling pathway is widely recognized as a critical regulator of endometrial stem cell self-renewal 33 , multilineage differentiation potential 34 , and migratory capacity 13 . Pharmacological inhibition of the PI3K/Akt pathway effectively suppressed the vaginal microbiota-mediated enhancement of various stem cell functions (Fig. 7 a–h), further confirming its role as a key downstream effector of microbiota-mediated stem cell regulation. One of the most striking findings of our study was the critical role of VCAM1 in mediating the beneficial effects of vaginal microbiota crosstalk on various endometrial stem cell functions. Functional knockdown of VCAM1 using a specific shRNA abolished the enhancement of self-renewal, migration, and differentiation induced by microbiota-derived secretory factors in vitro (Fig. 5 a–h) and in vivo (Fig. 8 a–g), highlighting its essential role in regulating stem cell activity. Additionally, bioinformatics analyses using KEGG pathway enrichment (Fig. 4 c) and GEO datasets (Fig. 4 g) further corroborated the link between microbiota interactions and VCAM1 upregulation in multiple cell models. These results suggest that VCAM1 acts as a core regulatory hub by integrating microbiota-derived signals to modulate endometrial stem cell behavior. Notably, VCAM1 is recognized as a crucial regulator of stem cell function beyond endometrial stem cells. Previous studies have demonstrated that VCAM1 is involved in the regulation of self-renewal 45 , differentiation 46 , and migration 47 across multiple stem cell types, including hematopoietic, mesenchymal, and neural stem cells. Given its broad regulatory function, the upregulation of VCAM1 in response to vaginal microbiota-derived secretory factors suggests that the microbiota-driven modulation of VCAM1 could serve as a fundamental mechanism governing stem cell behavior across various tissues. Energy-generating metabolic processes such as mitochondrial oxidative phosphorylation and cytosolic glycolysis play crucial roles in the regulation of various stem cell functions 48 – 52 , including self-renewal, differentiation, and pluripotency. Mitochondrial oxidative phosphorylation serves as the primary source of sustained ATP production, supporting the high energy demands required for stem cell maintenance and lineage commitment 48 . By contrast, cytosolic glycolysis facilitates rapid ATP generation and contributes to metabolic plasticity, enabling stem cells to adapt swiftly to changes in their microenvironment 53 . Emerging evidence suggests that metabolic processes are essential for preserving stem cell functionality, as regulations in metabolic states can dictate cell fate decisions and influence tissue regeneration 54 , 55 . Indeed, our data revealed that microbiota-derived secretory factors significantly activated this pathway, leading to enhanced energy-generating metabolic processes such as mitochondrial oxidative phosphorylation and cytosolic glycolysis in endometrial stem cells (Fig. 2 a–i). The observed increase in oxidative phosphorylation and glycolysis underscores the role of microbiota-derived factors in modulating cellular energy metabolism, which is fundamental for sustaining tissue-resident stem cell function. Moreover, our in vivo experiments validated the significance of vaginal microbiota-tissue-resident stem cell interactions in endometrial regeneration. Antibiotic-induced depletion of vaginal microbiota led to impaired endometrial development and a significant reduction in the clonogenic capacity of endometrial stem cells (Fig. 3 h and i). These findings reinforce the idea that a healthy vaginal microbiome is essential for maintaining the functional integrity of endometrial stem cells and subsequent optimal endometrial regeneration. Additionally, our study demonstrated that vaginal microbiota-derived secretory factors enhance various tissue regeneration-associated functions not only in endometrial stem cells but also in adipose tissue (Suppl. Figure 2) and bone marrow (Suppl. Figure 3)-derived stem cells, suggesting that microbiota-mediated stem cell modulation is a broadly applicable mechanism across multiple types of stem cells. Taken together, our findings reveal a novel microbiota-stem cell axis in endometrial regeneration and highlight the therapeutic potential of leveraging microbiota-derived secretory factors for regenerative medicine. Future studies should focus on identifying the specific protein components within the vaginal microbiota-derived secretory factors responsible for these effects and further delineate the downstream molecular networks involved. Understanding these interactions at a deeper level may pave the way for innovative microbiota-based therapeutic strategies that target a wide range of stem cell-based tissue injury-associated disorders. Declarations Conflict of Interest The authors have no competing interests as defined by Experimental & Molecular Medicine or other interests that might be perceived to influence the results and/or discussion reported in this article. Funding information: RS-2024-00455501/ 2021R1A5A2030333/ NRF- 2023R1A2C2002522/ 21A0103L1/ RS-2023-00254427 Acknowledgments This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean Government (MSIT) (RS-2024-00455501/ 2021R1A5A2030333/ NRF- 2023R1A2C2002522). This research was supported by the Korean Fund for Regenerative Medicine (KFRM) grant funded by the Korean government (the Ministry of Science and ICT, the Ministry of Health & Welfare) (code: 21A0103L1). This work was also supported by the NRF grant funded by the Korean Government (MSIT) (RS-2023-00254427). References Gao X, Louwers YV, Laven JSE, Schoenmakers S. Clinical Relevance of Vaginal and Endometrial Microbiome Investigation in Women with Repeated Implantation Failure and Recurrent Pregnancy Loss. Int J Mol Sci 2024; 25 . Tian Z, Zhao M, Sui X, Li X, Qin L, Chen ZJ et al. Associations between vaginal microbiota and endometrial polypoid lesions in women of reproductive age: a cross-sectional study. Reprod Biomed Online 2024; 48: 103602. Balla B, Illes A, Tobias B, Piko H, Beke A, Sipos M et al. The Role of the Vaginal and Endometrial Microbiomes in Infertility and Their Impact on Pregnancy Outcomes in Light of Recent Literature. Int J Mol Sci 2024; 25 . Zheng N, Guo R, Wang J, Zhou W, Ling Z. Contribution of Lactobacillus iners to Vaginal Health and Diseases: A Systematic Review. Front Cell Infect Microbiol 2021; 11: 792787. Chee WJY, Chew SY, Than LTL. Vaginal microbiota and the potential of Lactobacillus derivatives in maintaining vaginal health. Microb Cell Fact 2020; 19: 203. Santacroce L, Palmirotta R, Bottalico L, Charitos IA, Colella M, Topi S et al. Crosstalk between the Resident Microbiota and the Immune Cells Regulates Female Genital Tract Health. Life (Basel) 2023; 13 . Wang J, Li Z, Ma X, Du L, Jia Z, Cui X et al. Translocation of vaginal microbiota is involved in impairment and protection of uterine health. Nat Commun 2021; 12: 4191. McLennan CE, Rydell AH. Extent of endometrial shedding during normal menstruation. Obstet Gynecol 1965; 26: 605-621. Gargett CE, Nguyen HP, Ye L. Endometrial regeneration and endometrial stem/progenitor cells. Rev Endocr Metab Disord 2012; 13: 235-251. Gargett CE, Ye L. Endometrial reconstruction from stem cells. Fertil Steril 2012; 98: 11-20. Hong IS. Endometrial Stem Cells: Orchestrating Dynamic Regeneration of Endometrium and Their Implications in Diverse Endometrial Disorders. Int J Biol Sci 2024; 20: 864-879. Lucas ES, Dyer NP, Murakami K, Lee YH, Chan YW, Grimaldi G et al. Loss of Endometrial Plasticity in Recurrent Pregnancy Loss. Stem Cells 2016; 34: 346-356. Min EK, Kim SR, Lee CM, Na KH, Park CH, Oh BC et al. Identification of memory mechanism in tissue-resident stem cells via ANGPTL4 beyond immune cells upon viral antigen exposure. Mol Ther 2024; 32: 3042-3058. Park SR, Kim SR, Park CH, Lim S, Ha SY, Hong IS et al. Sonic Hedgehog, a Novel Endogenous Damage Signal, Activates Multiple Beneficial Functions of Human Endometrial Stem Cells. Mol Ther 2019; doi:10.1016/j.ymthe.2019.11.024. Choi ES, Jung JY, Lee JS, Park JH, Cho NP, Cho SD. Myeloid cell leukemia-1 is a key molecular target for mithramycin A-induced apoptosis in androgen-independent prostate cancer cells and a tumor xenograft animal model. Cancer Lett 2013; 328: 65-72. Barrett T, Suzek TO, Troup DB, Wilhite SE, Ngau WC, Ledoux P et al. NCBI GEO: mining millions of expression profiles--database and tools. Nucleic Acids Res 2005; 33: D562-566. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 2002; 30: 207-210. Barrett T, Edgar R. Mining microarray data at NCBI's Gene Expression Omnibus (GEO)*. Methods Mol Biol 2006; 338: 175-190. Cho A, Park SR, Kim SR, Nam S, Lim S, Park CH et al. An Endogenous Anti-aging Factor, Sonic Hedgehog, Suppresses Endometrial Stem Cell Aging through SERPINB2. Mol Ther 2019; 27: 1286-1298. Wang Y, Zheng L, Zhang L, Tai Y, Lin X, Cai Z. Roles of MMP-2 and MMP-9 and their associated molecules in the pathogenesis of keloids: a comprehensive review. Front Pharmacol 2024; 15: 1444653. Gan B, Hu J, Jiang S, Liu Y, Sahin E, Zhuang L et al. Lkb1 regulates quiescence and metabolic homeostasis of haematopoietic stem cells. Nature 2010; 468: 701-704. Gurumurthy S, Xie SZ, Alagesan B, Kim J, Yusuf RZ, Saez B et al. The Lkb1 metabolic sensor maintains haematopoietic stem cell survival. Nature 2010; 468: 659-663. Tothova Z, Gilliland DG. FoxO transcription factors and stem cell homeostasis: insights from the hematopoietic system. Cell Stem Cell 2007; 1: 140-152. Wu H, Mu C, Xu L, Yu K, Shen L, Zhu W. Host-microbiota interaction in intestinal stem cell homeostasis. Gut Microbes 2024; 16: 2353399. Haylett W, Swart C, van der Westhuizen F, van Dyk H, van der Merwe L, van der Merwe C et al. Altered Mitochondrial Respiration and Other Features of Mitochondrial Function in Parkin-Mutant Fibroblasts from Parkinson's Disease Patients. Parkinsons Dis 2016; 2016: 1819209. Ferrick DA, Neilson A, Beeson C. Advances in measuring cellular bioenergetics using extracellular flux. Drug Discov Today 2008; 13: 268-274. Abedin Z, Sen S, Field J. Aldo-keto reductases protect lung adenocarcinoma cells from the acute toxicity of B[a]P-7,8-trans-dihydrodiol. Chem Res Toxicol 2012; 25: 113-121. Desler C, Hansen TL, Frederiksen JB, Marcker ML, Singh KK, Juel Rasmussen L. Is There a Link between Mitochondrial Reserve Respiratory Capacity and Aging? J Aging Res 2012; 2012: 192503. Gatenby RA, Gillies RJ. Why do cancers have high aerobic glycolysis? Nat Rev Cancer 2004; 4: 891-899. Kato Y, Ozawa S, Miyamoto C, Maehata Y, Suzuki A, Maeda T et al. Acidic extracellular microenvironment and cancer. Cancer Cell Int 2013; 13: 89. Pajak B, Siwiak E, Soltyka M, Priebe A, Zielinski R, Fokt I et al. 2-Deoxy-d-Glucose and Its Analogs: From Diagnostic to Therapeutic Agents. Int J Mol Sci 2019; 21 . Trotta AP, Gelles JD, Serasinghe MN, Loi P, Arbiser JL, Chipuk JE. Disruption of mitochondrial electron transport chain function potentiates the pro-apoptotic effects of MAPK inhibition. J Biol Chem 2017; 292: 11727-11739. Park SR, Kim SR, Im JB, Lim S, Hong IS. Tryptophanyl-tRNA Synthetase, a Novel Damage-Induced Cytokine, Significantly Increases the Therapeutic Effects of Endometrial Stem Cells. Mol Ther 2020; 28: 2458-2472. Park SR, Kim SR, Park CH, Lim S, Ha SY, Hong IS et al. Sonic Hedgehog, a Novel Endogenous Damage Signal, Activates Multiple Beneficial Functions of Human Endometrial Stem Cells. Mol Ther 2020; 28: 452-465. Park SR, Kim SK, Kim SR, Kim D, Kim KW, Hong IS et al. Noncanonical functions of glucocorticoids: A novel role for glucocorticoids in performing multiple beneficial functions in endometrial stem cells. Cell Death Dis 2021; 12: 612. Liptakova A, Curova K, Zahumensky J, Visnyaiova K, Varga I. Microbiota of female genital tract - functional overview of microbial flora from vagina to uterine tubes and placenta. Physiol Res 2022; 71: S21-S33. Lledo B, Fuentes A, Lozano FM, Cascales A, Morales R, Hortal M et al. Identification of vaginal microbiome associated with IVF pregnancy. Sci Rep 2022; 12: 6807. Wang T, Li P, Bai X, Tian S, Yang M, Leng D et al. Vaginal microbiota are associated with in vitro fertilization during female infertility. Imeta 2024; 3: e185. Baud A, Hillion KH, Plainvert C, Tessier V, Tazi A, Mandelbrot L et al. Microbial diversity in the vaginal microbiota and its link to pregnancy outcomes. Sci Rep 2023; 13: 9061. Gierynska M, Szulc-Dabrowska L, Struzik J, Mielcarska MB, Gregorczyk-Zboroch KP. Integrity of the Intestinal Barrier: The Involvement of Epithelial Cells and Microbiota-A Mutual Relationship. Animals (Basel) 2022; 12 . Li Z, Xiong W, Liang Z, Wang J, Zeng Z, Kolat D et al. Critical role of the gut microbiota in immune responses and cancer immunotherapy. J Hematol Oncol 2024; 17: 33. Cox TO, Lundgren P, Nath K, Thaiss CA. Metabolic control by the microbiome. Genome Med 2022; 14: 80. Kim JE, Li B, Fei L, Horne R, Lee D, Loe AKH et al. Gut microbiota promotes stem cell differentiation through macrophage and mesenchymal niches in early postnatal development. Immunity 2023; 56: 2175. Dang H, Feng P, Zhang S, Peng L, Xing S, Li Y et al. Maternal gut microbiota influence stem cell function in offspring. Cell Stem Cell 2025; 32: 246-262 e248. Wang DY, Luo AF, Bai QR, Gong XL, Zheng Y, Shen Q et al. VCAM1 Labels a Subpopulation of Neural Stem Cells in the Adult Hippocampus and Contributes to Spatial Memory. Stem Cell Reports 2020; 14: 1093-1106. Hatori A, Fujii Y, Kawase-Koga Y, Ogasawara T, Chikira J, Minami S et al. VCAM-1 and GFPT-2: Predictive markers of osteoblast differentiation in human dental pulp stem cells. Bone 2023; 166: 116575. Ran Y, Dong Y, Li Y, Xie J, Zeng S, Liang C et al. Mesenchymal stem cell aggregation mediated by integrin alpha4/VCAM-1 after intrathecal transplantation in MCAO rats. Stem Cell Res Ther 2022; 13: 507. Jackson BT, Finley LWS. Metabolic regulation of the hallmarks of stem cell biology. Cell Stem Cell 2024; 31: 161-180. Li X, Jiang O, Wang S. Molecular mechanisms of cellular metabolic homeostasis in stem cells. Int J Oral Sci 2023; 15: 52. Tsogtbaatar E, Landin C, Minter-Dykhouse K, Folmes CDL. Energy Metabolism Regulates Stem Cell Pluripotency. Front Cell Dev Biol 2020; 8: 87. Burgess RJ, Agathocleous M, Morrison SJ. Metabolic regulation of stem cell function. J Intern Med 2014; 276: 12-24. Shyh-Chang N, Ng HH. The metabolic programming of stem cells. Genes Dev 2017; 31: 336-346. Gu W, Gaeta X, Sahakyan A, Chan AB, Hong CS, Kim R et al. Glycolytic Metabolism Plays a Functional Role in Regulating Human Pluripotent Stem Cell State. Cell Stem Cell 2016; 19: 476-490. Shapira SN, Christofk HR. Metabolic Regulation of Tissue Stem Cells. Trends Cell Biol 2020; 30: 566-576. Mahmoud AI. Metabolic switches during development and regeneration. Development 2023; 150 . Additional Declarations There is no conflict of interest Supplementary Files Supportinginformation.pdf supplementary figures and legends Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7062920\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":495053007,\"identity\":\"255f6e36-b1e8-4e50-81e2-83148e91ed9b\",\"order_by\":0,\"name\":\"Hwayong Lee\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBACPgYGNgaGigQkIR4CWtjA6AzJWhjbSNLC3nzsMe+8NHlz/jWGjwsY7OQZeM4+wK+F51i6Me+2HMOdM94YG89gSDZs4G03wK9FIsdMmndbBeOGG2e3SfMwMCcw8LMRcJj8+2/SvHMq7KFa6onQIsHDJs3bkJO44XwvSMvhBAbeNgJaeNLMJOccS0vecIP/szGPwXHDNp5j+LXwsx9+JvGmJtl2w/ljiY95Kqrl+XnS8GsBASZwTEgkAAkDcEwRBow/wPYdIEbtKBgFo2AUjEQAAPT6OowsTuwCAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0003-1958-8548\",\"institution\":\"Kangwon National University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hwayong\",\"middleName\":\"\",\"lastName\":\"Lee\",\"suffix\":\"\"},{\"id\":495053008,\"identity\":\"4e59033c-7aef-42ce-a9c0-064dd2ddab3e\",\"order_by\":1,\"name\":\"Soo-Rim Kim\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Gachon University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Soo-Rim\",\"middleName\":\"\",\"lastName\":\"Kim\",\"suffix\":\"\"},{\"id\":495053009,\"identity\":\"de7961a4-7166-4c7c-ba2c-050b699994c4\",\"order_by\":2,\"name\":\"Eun-Kyung Min\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Gachon University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Eun-Kyung\",\"middleName\":\"\",\"lastName\":\"Min\",\"suffix\":\"\"},{\"id\":495053010,\"identity\":\"43e60d5d-db78-46fd-90b1-32bac7c197d6\",\"order_by\":3,\"name\":\"Choon-Mi Lee\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Gachon University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Choon-Mi\",\"middleName\":\"\",\"lastName\":\"Lee\",\"suffix\":\"\"},{\"id\":495053011,\"identity\":\"a9f79745-977b-461c-b7c7-fda4c5b5c962\",\"order_by\":4,\"name\":\"Kunhee Na\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Gachon University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kunhee\",\"middleName\":\"\",\"lastName\":\"Na\",\"suffix\":\"\"},{\"id\":495053012,\"identity\":\"2d9d901b-a2ef-4fe2-b7d4-cf98a5598838\",\"order_by\":5,\"name\":\"Chan Hum Park\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hallym University College of Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chan\",\"middleName\":\"Hum\",\"lastName\":\"Park\",\"suffix\":\"\"},{\"id\":495053013,\"identity\":\"45d1230a-f34d-4c29-8884-56ca56f0e9bc\",\"order_by\":6,\"name\":\"Byung-Chul Oh\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Lee Gil Ya Cancer and Diabetes Institute, Gachon University College of Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Byung-Chul\",\"middleName\":\"\",\"lastName\":\"Oh\",\"suffix\":\"\"},{\"id\":495053014,\"identity\":\"a927d14d-e764-414b-83d6-9cd5896bc67d\",\"order_by\":7,\"name\":\"YunJae Jung\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Gachon University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"YunJae\",\"middleName\":\"\",\"lastName\":\"Jung\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-07 08:20:21\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7062920/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7062920/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":88335997,\"identity\":\"663b3ab9-13c0-489b-bea4-4e08a59f716e\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:57\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1448252,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEnhancing effects of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eLactobacillus iners\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e-derived secretory factors on diverse tissue regeneration-associated functions of endometrial stem cells \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e.\\u003c/strong\\u003e We conducted a series of experiments to determine whether vaginal microbiota-derived secretory factors could independently enhance various tissue regeneration-associated functions of endometrial stem cells \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. The proliferative effects of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL) on endometrial stem cells were evaluated following 72 h of treatment using an MTT assay \\u003cstrong\\u003e(b)\\u003c/strong\\u003e. Endometrial stem cells were treated with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors under the previously described conditions, and the proportion of Ki-67-positive cells was quantified via flow cytometry \\u003cstrong\\u003e(c)\\u003c/strong\\u003e. Endometrial stem cells were exposed to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors for 24 h and their impact on stem cell migratory capacity was subsequently evaluated using a Transwell assay \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. The expression levels of MMP-2 and MMP-9, critical regulators of cell migration, were analyzed via western blotting following 72-h treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors \\u003cstrong\\u003e(e)\\u003c/strong\\u003e. The effects of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor treatment on adipogenic \\u003cstrong\\u003e(f)\\u003c/strong\\u003e and osteogenic \\u003cstrong\\u003e(g)\\u003c/strong\\u003e differentiation were evaluated using Oil Red O staining and Alizarin Red staining, respectively. The stimulatory effects of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor treatment on the mRNA expression of key pluripotency-associated factors (KLF4, NANOG, OCT4, and SOX2) were analyzed using real-time PCR \\u003cstrong\\u003e(h)\\u003c/strong\\u003e. β-actin was used as the internal control. \\u003cem\\u003ePPIA\\u003c/em\\u003e was used as a housekeeping gene for real-time PCR analysis. All experiments were performed in triplicates. Data are presented as mean ± standard deviation (SD). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/2db5f039a0d4051e790bd246.jpg\"},{\"id\":88336001,\"identity\":\"e3f52916-8384-4adb-bea5-fa5002bd336b\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:58\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":837048,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eVaginal microbiota-derived secretory factor treatment stimulates energy-producing (metabolic) activities in endometrial stem cells.\\u003c/strong\\u003e To assess the impact of vaginal microbiota interactions on energy metabolism in endometrial stem cells, oxidative phosphorylation and glycolysis were analyzed following a 72-h treatment with or without \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL).\\u003cstrong\\u003e \\u003c/strong\\u003eMitochondrial oxidative phosphorylation was assessed by measuring real-time oxygen consumption rates (OCR) using the Seahorse XF Flux Analyzer (Seahorse Biosciences), enabling a comprehensive evaluation of cellular respiratory activity \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. Stem cells were plated at a density of 20,000 cells per well in multi-well plates containing growth medium. To evaluate mitochondrial respiration, cells were sequentially treated with 1.5 μM oligomycin, an ATP synthase inhibitor that blocks complex V and inhibits ATP-linked respiration, followed by 2 μM FCCP to dissipate the mitochondrial membrane potential (Δψm) by disrupting the proton gradient. Additionally, 0.5 μM rotenone and 0.5 μM antimycin A were administered to fully inhibit the mitochondrial electron transport chain, leading to complete respiratory collapse. The inhibitors were automatically administered into each well, and real-time OCR were measured at 15-min intervals. Treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors led to a notable increase in overall mitochondrial respiratory capacity, along with an elevation in non-mitochondrial OCR in endometrial stem cells \\u003cstrong\\u003e(b)\\u003c/strong\\u003e. Treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors also significantly elevated basal mitochondrial respiratory potential \\u003cstrong\\u003e(c)\\u003c/strong\\u003e, spare respiratory capacity \\u003cstrong\\u003e(d)\\u003c/strong\\u003e, and maximal respiratory function \\u003cstrong\\u003e(e)\\u003c/strong\\u003e, indicating enhanced mitochondrial efficiency in endometrial stem cells. Exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors resulted in a significant increase in ATP generation, enhancing energy production in both the cytosolic and mitochondrial compartments \\u003cstrong\\u003e(f)\\u003c/strong\\u003e. Glycolytic activity in endometrial stem cells was assessed by monitoring real-time OCR and extracellular acidification rates (ECAR) to evaluate glycolytic proton efflux rates (glycoPER) under various inhibitor conditions. Particularly, cells were cultured in glucose-free medium and treated with 1.67 μM antimycin A, 1.67 μM rotenone, and 50 mM 2-deoxyglucose (2-DG), a glycolysis inhibitor, to comprehensively analyze metabolic flux. Compensatory glycolysis refers to the cellular ability to sustain ATP production through glycolysis following the inhibition of mitochondrial respiration, ensuring energy demands are met under metabolic stress. Notably, the overall glycolytic capacity of endometrial stem cells was significantly elevated after a 72-h treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (25 nM), indicating enhanced metabolic adaptability \\u003cstrong\\u003e(g)\\u003c/strong\\u003e. Treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors led to a notable increase in both basal glycolysis \\u003cstrong\\u003e(h)\\u003c/strong\\u003e and compensatory glycolytic activity \\u003cstrong\\u003e(i)\\u003c/strong\\u003e, highlighting their role in enhancing metabolic flexibility in endometrial stem cells. Glycolytic ECAR measurements were normalized by the cell numbers in each well. Bar graphs represent the averages of three independent experiments. Significant differences are presented as *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/f4454f08dc2ee052107c8d56.jpg\"},{\"id\":88336939,\"identity\":\"9fb697fe-38d5-4fb8-ba44-1f93cf731671\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:08:58\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1644529,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eInfluence of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eLactobacillus iners\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e-derived secretory factor exposure on various tissue regeneration-associated functions of endometrial stem cells \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vivo\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e. \\u003c/strong\\u003eA schematic representation depicting the overall experimental design, as outlined in the ‘Materials and Methods’ section \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. Mice were administered consecutive intravenous injections of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (20 mg/kg) over the course of 1 week.Endometrial stem cells were subsequently extracted from endometrial tissues utilizing a collagenase-based primary culture technique. Following isolation, mouse endometrial stem cells were cultured \\u003cem\\u003ein vitro\\u003c/em\\u003e with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL) to effectively recapitulate the \\u003cem\\u003ein vivo \\u003c/em\\u003evaginal microbiota-stem cell crosstalk. Next, the impact of consecutive exposures to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors on the self-renewal ability of endometrial stem cells \\u003cem\\u003ein vivo\\u003c/em\\u003e was evaluated using MTT assays \\u003cstrong\\u003e(b)\\u003c/strong\\u003e. The enhancement of endometrial stem cell migratory potential following repeated \\u003cem\\u003ein vivo\\u003c/em\\u003e exposures to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors was evaluated using a Transwell assay \\u003cstrong\\u003e(c)\\u003c/strong\\u003e. Western blot analysis was performed to assess the protein expression levels of key positive regulators of cell migration (MMP-2 and MMP-9) following repeated \\u003cem\\u003ein vivo\\u003c/em\\u003e exposures to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. After repeated exposures to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, the multilineage differentiation potential of endometrial stem cells into adipocytes \\u003cstrong\\u003e(e)\\u003c/strong\\u003e and osteoblasts \\u003cstrong\\u003e(f)\\u003c/strong\\u003e was evaluated \\u003cem\\u003ein vivo\\u003c/em\\u003e using Oil Red O staining and Alizarin Red S staining, respectively. The enhancing effects of repeated \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposures on the \\u003cem\\u003ein vivo\\u003c/em\\u003emRNA expression of key pluripotency-associated genes (\\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e) were evaluated using real-time PCR \\u003cstrong\\u003e(g)\\u003c/strong\\u003e. To evaluate the effect of vaginal microbiota depletion on the colony-forming potential of endometrial stem cells \\u003cem\\u003ein vivo\\u003c/em\\u003e, mice were administered a broad-spectrum antibiotic mixture (10 µL/mL) to deplete vaginal microbiota. Endometrial stem cells were then isolated from the uterine endometrium and their colony-forming efficiency was subsequently assessed and compared to that of the control group \\u003cstrong\\u003e(h)\\u003c/strong\\u003e. To evaluate the effect of vaginal microbiota depletion on endometrial development, histopathological analysis was conducted using H\\u0026amp;E staining under the same experimental conditions as previously described \\u003cstrong\\u003e(i)\\u003c/strong\\u003e. Bar graphs represent the average of three independent experiments.\\u003cstrong\\u003e \\u003c/strong\\u003eβ-actin was used as the internal control. Mouse \\u003cem\\u003eHPRT\\u003c/em\\u003e was used as a housekeeping gene for real-time PCR analysis. All experiments were performed in triplicates. Data are presented as mean ± standard deviation (SD). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/ee583f3b314c6c0e63677736.jpg\"},{\"id\":88336002,\"identity\":\"e8818419-984c-4b63-b999-aa3efa9298d3\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:58\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1712393,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eVCAM1 identified as a key regulator of endometrial stem cells in response to vaginal microbiota-derived secretory factor exposure. \\u003c/strong\\u003eEndometrial stem cells were treated with \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL) to assess their functional response. Comprehensive RNA Seq data were visualized as a heatmap, highlighting differentially expressed genes between the control group and endometrial stem cells treated with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. Upregulated genes (displayed in red) and downregulated genes (shown in green) were compared to mRNA expression levels in the control group \\u003cstrong\\u003e(b)\\u003c/strong\\u003e. KEGG pathway analysis was conducted to identify potential signaling pathways and biological functions associated with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure. The results revealed significant activation of multiple tissue regeneration-associated signaling pathways in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors \\u003cstrong\\u003e(c)\\u003c/strong\\u003e. RNA-Seq analysis revealed that treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors led to a more than two-fold upregulation of 128 genes and downregulation of 101 genes in endometrial stem cells. The volcano plot provides a concise visualization of gene expression changes induced by \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure. Significantly upregulated genes (right) and downregulated genes (left) are depicted as distinct points within the scatter plot. Among the differentially expressed genes, VCAM1 exhibited a significant upregulation in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. The altered expression pattern of VCAM1 was further validated through real-time PCR and western blot analysis\\u003cstrong\\u003e (e)\\u003c/strong\\u003e. Furthermore, an analysis of the GEO data repository was conducted to explore the relationship between increased VCAM1 expression and different cell models following interactions with commensal microbiota \\u003cstrong\\u003e(f)\\u003c/strong\\u003e. Enrichment plot illustrating the upregulation of VCAM1-associated TNF-alpha and immune response-related signaling pathways \\u003cstrong\\u003e(g)\\u003c/strong\\u003e. IPA software was utilized to identify differentially activated genes in cells treated with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors compared to untreated controls. This analysis aimed to determine the activation status (active, inactive, or intermediate) of signaling molecules and transcription factors associated with VCAM1\\u003cstrong\\u003e (h)\\u003c/strong\\u003e. β-actin was used as an internal protein control and \\u003cem\\u003ePPIA\\u003c/em\\u003ewas used as the housekeeping gene for real-time PCR. All experiments were performed in triplicate. Data are presented as means ± standard deviations (SDs). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/e5f70a79c791bc44338799a3.jpg\"},{\"id\":88336943,\"identity\":\"87d90013-dd9a-42cd-9dc7-4325165136e3\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:08:58\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1587402,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eIdentification of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eVCAM1 \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eas a critical regulatory gene mediating the interaction between vaginal microbiota and endometrial stem cells \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro\\u003c/strong\\u003e\\u003c/em\\u003e. Endometrial stem cells were exposed to \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL) alone or concurrently transfected with VCAM1-targeting shRNA to evaluate its regulatory role \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. The effect of VCAM1 knockdown on \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor-mediated enhancement of endometrial stem cell self-renewal \\u003cstrong\\u003e(b) \\u003c/strong\\u003eand expansion of the clonogenic Ki-67⁺ subpopulation \\u003cstrong\\u003e(c)\\u003c/strong\\u003e was evaluated using MTT assays and flow cytometry, respectively, 72 h post-treatment. The attenuating effect of VCAM1 knockdown on the enhanced migration capacity of endometrial stem cells following exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors was evaluated using a Transwell assay \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. Western blot analysis was performed to examine the protein expression levels of key migration regulators (MMP-2 and MMP-9) following \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure, with or without VCAM1 knockdown \\u003cstrong\\u003e(e)\\u003c/strong\\u003e. Mitigating effects of VCAM1 knockdown on the \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor-induced enhancement of endometrial stem cell multilineage differentiation into adipocytes \\u003cstrong\\u003e(f) \\u003c/strong\\u003eand osteoblasts \\u003cstrong\\u003e(g)\\u003c/strong\\u003e were evaluated using Oil Red O and Alizarin Red S staining, respectively. The inhibitory effects of VCAM1 knockdown on the upregulation of pluripotency-associated genes (\\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e) induced by \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure were analyzed using real-time PCR \\u003cstrong\\u003e(h)\\u003c/strong\\u003e. β-actin was used as an internal control. \\u003cem\\u003ePPIA\\u003c/em\\u003e was used as a housekeeping gene for real-time PCR analysis. All experiments were performed in triplicates. Data are presented as mean ± standard deviation (SD). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/6194e70fa0a7992f9ec28eb5.jpg\"},{\"id\":88336009,\"identity\":\"197ce296-105c-449e-9758-7f6f26769268\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:58\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1469294,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCrosstalk between endometrial stem cells and vaginal microbiota is regulated via the PI3K/Akt signaling pathway, functioning as a downstream effector of VCAM1. \\u003c/strong\\u003eWe examined whether the PI3K/Akt signaling pathways demonstrated comparable activation patterns in regulating endometrial stem cell functions following vaginal microbiota-derived secretory factor exposure. Additionally, we investigated the role of these signaling pathways in mediating vaginal microbiota-stem cell crosstalk and their impact on various endometrial stem cell functions \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. Endometrial stem cells were treated with or without \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL) for 10 min, followed by cell lysis. Protein expression levels were analyzed via western blotting using antibodies specific to the phosphorylated forms of PI3K and Akt \\u003cstrong\\u003e(b)\\u003c/strong\\u003e. Western blot analysis was performed toelucidate the hierarchical relationship between VCAM1 and the PI3K/Akt signaling pathway with or without \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure (10 µL/mL). We performed additional experiments involving VCAM1 knockdown in combination with targeted inhibition of Akt signaling. Suppression of VCAM1 expression led to a marked decrease in Akt phosphorylation levels, indicating its upstream regulatory role \\u003cstrong\\u003e(c)\\u003c/strong\\u003e. Endometrial stem cells were preincubated with Akt inhibitor V (20 µM) for 1 h, followed by western blot analysis to evaluate VCAM1 expression levels \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. Western blot analysis was performed to evaluate PI3K and Akt signaling activity following VCAM1 knockdown, with or without exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors \\u003cstrong\\u003e(e)\\u003c/strong\\u003e. Furthermore, an analysis of the GEO data repository was conducted to explore the relationship between increased PI3K and Akt expression and different cell models following microbiota interactions \\u003cstrong\\u003e(f)\\u003c/strong\\u003e. Enrichment plot illustrating the upregulation of PI3K/Akt signaling pathways \\u003cstrong\\u003e(g)\\u003c/strong\\u003e. To determine whether Akt-related signaling pathway activation is directly associated with exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, we performed a comprehensive analysis of gene expression profiles and their corresponding signaling networks using IPA. This analysis aimed to determine the activation status (active, inactive, or intermediate) of signaling molecules and transcription factors associated with Akt signaling pathway\\u003cstrong\\u003e (h)\\u003c/strong\\u003e. β-actin was used as an internal control. All experiments were performed in triplicates. Data are presented as mean ± standard deviation (SD). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/55345249c040b1a3e24e0035.jpg\"},{\"id\":88336008,\"identity\":\"4d9975eb-ddf4-48ca-9e84-bee69ef8b658\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:58\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1601100,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePharmacological inhibition of PI3K/Akt signaling mitigates the enhancing effects of vaginal microbiota-derived secretory factor exposure on multiple endometrial stem cell functions. \\u003c/strong\\u003eWe examined whether the PI3K/Akt signaling pathways demonstrated comparable activation patterns in regulating endometrial stem cell functions following vaginal microbiota-derived secretory factor exposure. Additionally, we investigated the role of these signaling pathways in mediating vaginal microbiota-stem cell crosstalk and their impact on various endometrial stem cell functions \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. Endometrial stem cells were pretreated with Akt inhibitor V (20 µM) for 1 h before subsequent exposure to \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL). To evaluate the impact of Akt signaling inhibition on the self-renewal capacity of endometrial stem cells \\u003cstrong\\u003e(b)\\u003c/strong\\u003e and the expansion of the clonogenic Ki-67⁺ subpopulation \\u003cstrong\\u003e(c)\\u003c/strong\\u003efollowing \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor treatment, MTT assays and flow cytometry were performed 72 h post-treatment. Under identical treatment conditions, the attenuating effects of Akt signaling suppression on the enhanced migration capacity of endometrial stem cells in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure were evaluated using a Transwell assay \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. Western blot analysis was performed to examine the protein expression levels of key migration regulators (MMP-2 and MMP-9) following \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure, with or without Akt signaling pathway inhibition \\u003cstrong\\u003e(e)\\u003c/strong\\u003e. The mitigating effects of Akt signaling inhibition on the multilineage differentiation potential of endometrial stem cells into adipocytes \\u003cstrong\\u003e(f)\\u003c/strong\\u003e and osteoblasts \\u003cstrong\\u003e(g)\\u003c/strong\\u003e in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure were evaluated using Oil Red O staining and Alizarin Red S staining, respectively. The attenuating effects of Akt signaling inhibition on the \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor-induced upregulation of pluripotency-associated genes (\\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e) were analyzed using real-time PCR \\u003cstrong\\u003e(h)\\u003c/strong\\u003e.\\u003cstrong\\u003e \\u003c/strong\\u003eβ-actin was used as an internal control. \\u003cem\\u003ePPIA\\u003c/em\\u003e was used as a housekeeping gene for real-time PCR analysis. All experiments were performed in triplicates. Data are presented as mean ± standard deviation (SD). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure7.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/b814e1930cebffe52b8b53e3.jpg\"},{\"id\":88336016,\"identity\":\"a1afe644-d341-45c4-8f68-f3202b05d6a6\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:58\",\"extension\":\"jpg\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1263331,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eVCAM1 knockout markedly diminishes the vaginal microbiota-derived secretory factor-mediated enhancement of multiple endometrial stem cell functions \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vivo\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e. \\u003c/strong\\u003eA schematic representation depicting the \\u003cu\\u003eexperimental\\u003c/u\\u003e workflow, as outlined in the ‘Materials and Methods’ section, is provided \\u003cstrong\\u003e(a)\\u003c/strong\\u003e. VCAM1 knockout (K.O.) mice were administered intravenous injections of \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factors (20 mg/kg) daily for seven consecutive days. Subsequently, endometrial stem cells were isolated from endometrial tissues utilizing a collagenase-based primary culture technique. Following isolation, mouse endometrial stem cells were maintained \\u003cem\\u003ein vitro\\u003c/em\\u003e under either exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (10 µL/mL) or in control conditions without exposure, aiming to closely replicate the \\u003cem\\u003ein vivo\\u003c/em\\u003e stem cell-microbiota crosstalk environment. Next, the impact of VCAM1 knockout on the attenuation of endometrial stem cell self-renewal capacity was evaluated using MTT assays following \\u003cem\\u003ein vivo\\u003c/em\\u003e exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors \\u003cstrong\\u003e(b)\\u003c/strong\\u003e. The attenuating effect of VCAM1 knockout on the \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor-induced enhancement of endometrial stem cell migratory capacity \\u003cem\\u003ein vivo\\u003c/em\\u003e was evaluated using a Transwell assay \\u003cstrong\\u003e(c)\\u003c/strong\\u003e. Western blot analysis was performed to assess the protein expression levels of key migration regulators, MMP-2 and MMP-9, in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure, with or without VCAM1 knockout, \\u003cem\\u003ein vivo\\u003c/em\\u003e \\u003cstrong\\u003e(d)\\u003c/strong\\u003e. After repeated exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, the inhibitory effects of VCAM1 knockout on the multilineage differentiation potential of endometrial stem cells into adipocytes \\u003cstrong\\u003e(e) \\u003c/strong\\u003eand osteoblasts \\u003cstrong\\u003e(f)\\u003c/strong\\u003e \\u003cem\\u003ein vivo\\u003c/em\\u003e were evaluated using Oil Red O staining and Alizarin Red S staining, respectively. The attenuating effects of VCAM1 knockout on the upregulation of pluripotency-associated genes (\\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e) following \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure\\u003cem\\u003e in vivo \\u003c/em\\u003ewas examined via real-time PCR analysis \\u003cstrong\\u003e(g)\\u003c/strong\\u003e. β-actin was used as an internal control. \\u003cem\\u003ePPIA\\u003c/em\\u003e was used as a housekeeping gene for real-time PCR analysis. All experiments were performed in triplicates. Data are presented as mean ± standard deviation (SD). *, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05; **, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.005; and ***, \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.001 (two-sample \\u003cem\\u003et\\u003c/em\\u003e-test).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure8.tif.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/c04e10ea5c3da960ea1d49e5.jpg\"},{\"id\":98621867,\"identity\":\"a2af9665-1e14-4d7c-b0b0-e5185538e6a8\",\"added_by\":\"auto\",\"created_at\":\"2025-12-19 16:26:49\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":13765337,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/ea7bc7a2-df04-4f09-85be-83cb40cd62d4.pdf\"},{\"id\":88336003,\"identity\":\"ba8dc4a7-27f4-4a82-8c4c-93155662b364\",\"added_by\":\"auto\",\"created_at\":\"2025-08-05 12:00:58\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1377898,\"visible\":true,\"origin\":\"\",\"legend\":\"supplementary figures and legends\",\"description\":\"\",\"filename\":\"Supportinginformation.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7062920/v1/4bc1acfcabb34baaebfe0237.pdf\"}],\"financialInterests\":\"There is no conflict of interest\",\"formattedTitle\":\"Exploring Vaginal Microbiota–Tissue Resident Stem Cell Crosstalk:\\r\\nVCAM1-Mediated Enhancement of Regenerative Capacity\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe human vaginal microbiota consists of a diverse array of commensal microorganisms that play a crucial role in maintaining endometrial development \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e, a key process for successful embryo implantation and subsequent pregnancy. Among these, \\u003cem\\u003eLactobacilli\\u003c/em\\u003e species are predominant and serve as key regulators of infertility, implantation failure, and pregnancy complications \\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e. Particularly, \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e modulate the local immune environment and contribute to the prevention of various gynecological disorders, including chronic endometritis, endometriosis, and pelvic inflammatory disease \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR5\\\" citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Despite substantial advances in elucidating the role of the vaginal microbiota in both the disruption and maintenance of uterine health \\u003csup\\u003e\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e\\u003c/sup\\u003e, the precise impact of \\u003cem\\u003eL. iners\\u003c/em\\u003e on the regenerative functions of tissue-resident stem cells, as well as the underlying molecular mechanisms governing this crosstalk, remain largely unexplored.\\u003c/p\\u003e\\u003cp\\u003eThe endometrium lining the uterine cavity is among the most rapidly regenerating tissues, exhibiting substantial cyclic proliferation of up to approximately 7 mm within a single week during each menstrual cycle. \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. As observed in various dynamic tissues, rapid regeneration and cyclic expansion of the endometrial functional layer are primarily driven by tissue-resident clonogenic stem cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e. Hence, the persistent activation and recruitment of resident endometrial stem cells capable of differentiating into distinct endometrial cell types are crucial for embryo implantation and subsequent successful pregnancy \\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. Lucas et al. demonstrated that a reduced population of clonogenic endometrial stem cells impairs the regenerative potential of the endometrium, leading to lower pregnancy rates in individuals experiencing recurrent pregnancy loss \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. In this context, we hypothesized that \\u003cem\\u003eL. iners\\u003c/em\\u003e, through their secretory factors, could enhance the regenerative potential of endometrial stem cells by promoting self-renewal, migratory capacity, multilineage differentiation potential, pluripotency, and energy-producing (metabolic) activities.\\u003c/p\\u003e\\u003cp\\u003eIn this study, we performed various \\u003cem\\u003ein vitro\\u003c/em\\u003e experiments in which human endometrial stem cells were treated with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors. Our findings revealed a marked increase in the clonogenic endometrial stem cell subpopulation, along with enhanced migratory capacity, multilineage differentiation potential, and expression of pluripotency-associated genes, including \\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e. Furthermore, treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors markedly enhanced the metabolic activity of endometrial stem cells by stimulating energy production via mitochondrial oxidative phosphorylation and cytosolic glycolysis.\\u003c/p\\u003e\\u003cp\\u003eWe elucidated the molecular mechanisms underlying these effects by conducting large-scale RNA sequencing (bulk RNA-seq) following the treatment of endometrial stem cells with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, leading to the identification of vascular cell adhesion molecule 1 (\\u003cem\\u003eVCAM1\\u003c/em\\u003e) as a key regulatory gene mediating the effects of these secretory factors. Bioinformatics analysis using KEGG pathway mapping and Gene Expression Omnibus (GEO) datasets further confirmed that vaginal microbiota interactions lead to upregulated VCAM1 expression levels. Further \\u003cem\\u003ein vitro\\u003c/em\\u003e and \\u003cem\\u003ein vivo\\u003c/em\\u003e functional studies revealed that VCAM1 knockdown abolished the beneficial effects of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors on the aforementioned endometrial stem cell functions, thereby establishing VCAM1 as a critical mediator of crosstalk between endometrial tissue-resident stem cells and the vaginal microbiota.\\u003c/p\\u003e\\u003cp\\u003eFurther analysis revealed that the \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor activates key signaling pathways, notably the PI3K/Akt \\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e pathway, which is critically involved in regulating the diverse functions of tissue-resident stem cells. Pharmacological inhibition of this pathway significantly attenuated secretory factor-induced enhancements in self-renewal, migratory capacity, differentiation potential, and pluripotency. These findings highlight the pivotal role of this signaling pathway in mediating the underlying mechanisms and provide new insights into how the vaginal microbiota regulates endometrial stem cell function and highlight the therapeutic potential of leveraging microbiota-derived secretory factors for advancements in regenerative medicine. By elucidating the intricate crosstalk between vaginal microbiota and tissue-resident stem cells, this study advances our understanding of tissue regeneration and paves the way for the development of innovative microbiota-based therapeutic strategies that target a range of tissue injury-related disorders.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eIsolation and culture of human endometrial stem cells from endometrial tissues\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eHuman endometrial stem cells were obtained from endometrial tissues of uterine fibroid patients with written informed consent from patients and approval of Gachon University Institutional Review Board (IRB No: GAIRB2018-134). Endometrial tissues were minced into small pieces. These small pieces were digested in DMEM containing 10% FBS and 250 U/ml type I collagenase for 5 h at 37\\u0026deg;C in a rotating shaker. The digestion mixture was then filtered through a 40-\\u0026micro;m cell strainer to separate stromal-like stem cells from epithelial gland fragments and undigested tissue. Isolated endometrial stem cells were then cultured following previously established protocols \\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. Endometrial cells were cultured in StemPro\\u0026reg; MSC SFM CTS\\u0026trade; (GIBCO, Cat No.: A1033201) at 37\\u0026deg;C under 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e in air. The culture medium was changed every 2 or 3 days.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eFlow cytometry\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eFACS analysis and cell sorting were performed using FACS Calibur and FACS Aria machines (Becton Dickinson, Palo Alto, CA), respectively. FACS data were analyzed using FlowJo software (Tree Star, Ashland, OR). Antibodies against the following proteins were used: APC-conjugated CD44 (BD Bioscience, Cat. 559942, dilution 1/40), PE-conjugated CD133 (MACS; Miltenyi Biotech, 130-080-081, dilution 1/40), CD34 (MACS; Miltenyi Biotech, 30-081-002), CD44 (MACS; Miltenyi Biotech, 130-095-180), CD45 (MACS; Miltenyi Biotech, 130-080-201), CD73 (MACS; Miltenyi Biotech, 130-095-182), CD105 (MACS; Miltenyi Biotech, 130-094-941), CD140b (MACS; Miltenyi Biotech, 130-105-279), and Ki67 (BD Pharmingen\\u003csup\\u003eTm\\u003c/sup\\u003e, Cat. No.556027). The FACS gates were established by staining with an isotype antibody or secondary antibody.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCell proliferation assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe MTT assay was performed following the manufacturer\\u0026rsquo;s instructions (Sigma, Cat. No.: M5655) to assess the growth-promoting effects of \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor treatment. Cells (1\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well) were seeded into 96-well plates. After 24 h of incubation, endometrial stem cells were treated with \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor or vehicle for 72 h. Viable cells were determined by measuring absorbance at 570 nm using a Versa Max microplate reader.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eIn vitro\\u003c/b\\u003e \\u003cb\\u003ecell migration assay\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eStimulatory effects of \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor treatment on the migration capacity of endometrial stem cells were analyzed by measuring the number of cells that migrated in response to vaginal microbiota crosstalk divided by the number of spontaneously migrating cells. Cells were plated into upper chambers of permeable Transwell supports (Corning Inc., Corning, NY, USA) at a density of 1 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e cells/well in 200 \\u0026micro;L of culture medium to track the migration of cells. Transwell chambers had 8.0-\\u0026micro;m pores in 6.5-mm-diameter polycarbonate membranes. They were used in a 24-well plate format. Noninvasive cells on the upper surface of each membrane were removed by scrubbing with laboratory paper. Migrated cells on the lower surface of each membrane were fixed with 3.7% paraformaldehyde for 5 min and stained with hematoxylin for 15 min. Later, the number of migrated cells was counted in three randomly selected fields of each well under a light microscope at 50X magnification. The difference in each group is shown as a fold change.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eProtein isolation and western blot analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eProtein expression levels were determined by western blot analysis as previously described \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. Cells were lysed in a buffer containing 50 mM Tris, 5 mM EDTA, 150 mM NaCl, 1 mM DTT, 0.01% NP 40, and 0.2 mM PMSF. Protein concentrations of total cell lysates were measured using bovine serum albumin as a standard. Samples containing equal amounts of proteins were separated via sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) and then transferred onto nitrocellulose membranes (Bio-Rad Laboratories). These membranes were blocked with 5% skim milk in Tris-buffered saline containing Tween-20 at room temperature (RT). Membranes were then incubated with primary antibodies against MMP-2 (Cell Signaling #4022), MMP-9 (Cell Signaling #13667), VCAM1 (Abcam, ab134047), total PI3K (Cell Signaling #4292), phospho-PI3K (Cell Signaling #4228), total Akt (Cell Signaling #4491), phospho-Akt (Cell Signaling #4060), or β-actin (Abcam, ab189073) at 4\\u0026deg;C overnight and then incubated with HRP-conjugated goat anti-rabbit IgG (BD Pharmingen, 554021) or goat anti-mouse IgG (BD Pharmingen, 554002) secondary antibodies at RT for 60 min. Antibody-bound proteins were detected using enhanced chemiluminescence (ECL) reagents.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eAdipogenic differentiation\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eEndometrial stem cells were incubated with DMEM low-glucose medium supplemented with 500 \\u0026micro;M methylxanthine, 5 \\u0026micro;g/mL insulin, and 10% FBS. Endometrial stem cells were cultured for three weeks, with the medium refreshed twice weekly, either in the presence or absence of \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor treatment. Lipid droplet formation was confirmed by oil red O staining. Relative quantification of lipid droplet formation was determined by measuring absorbance at 500 nm.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eOsteogenic differentiation\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eEndometrial stem cells were incubated with DMEM high-glucose medium supplemented with 0.1 \\u0026micro;M dexamethasone, 10 mM β-glycerophosphate, 50 \\u0026micro;M ascorbate and 10% FBS. Endometrial stem cells were maintained in culture for three weeks, with medium changes twice per week, either in the presence or absence of \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor exposure. Differentiated cells were stained with Alizarin Red S to detect \\u003cem\\u003ede novo\\u003c/em\\u003e formation of bone matrix. Alizarin red S in each sample was quantified by measuring the optical density (OD) of the solution at 570 nm.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eReal-time PCR\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTotal RNA was extracted from endometrial stem cells using TRIzol reagent (Invitrogen) according to the manufacturer\\u0026rsquo;s protocol. Real-time PCR was performed using a Rotor-Gene Q (Qiagen). The reaction was subjected to amplification cycles of 95\\u0026deg;C for 20 sec, 60\\u0026deg;C for 20 sec, and 72\\u0026deg;C for 25 sec. The relative mRNA expression of the selected gene was normalized to that of PPIA and quantified using the ΔΔCT method. Sequences of PCR primers are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cstrong\\u003eTable 1. Primer Sequences for Quantitative RT-PCR\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"602\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGene bank No.\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDirection\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePrimer sequence\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman PPIA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_021130\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 49.7043%;\\\"\\u003e\\n \\u003cp\\u003eTGCCATCGCCAAGGAGTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 49.7043%;\\\"\\u003e\\n \\u003cp\\u003eTGCACAGACGGTCACTCAAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman IL6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_000600\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eGGTACATCCTCGACGGCATCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eGTGCCTCTTTGCTGCTTTCAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman P16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_000077\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eCTACTGAGGAGCCAGCGTCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eCTGCCCATCATCATGACCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman P18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_001262\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eTGGGTCTTCCGCAAGAACTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eTGGCAGCCAAGTGCAAGGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman P21\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_000389\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eACAGCAGAGGAAGACCATGTGGACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eCGTTTTCGACCCTGAGAGTCTCCAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman C-MYC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_002467\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eAAAGGCCCCCAAGGTAGTTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eGCACAAGAGTTCCGTAGCTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman KLF4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_001314052\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eGAACTGACCAGGCACTACCG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eTTCTGGCAGTGTGGGTCATA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman NANOG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_024865\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eTGGGATTTACAGGCGTGAGC\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eAAGCAAAGCCTCCCAATCCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman OCT4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_002701\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eAGCCCTCATTTCACCAGGCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eTGGGACTCCTCCGGGTTTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman SOX2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_003106\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eAAATGGGAGGGGTGCAAAAGAGGAG\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eCAGCTGTCATTTGCTGTGGGTGATG\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 18.4712%;\\\"\\u003e\\n \\u003cp\\u003eHuman VCAM1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 21.8296%;\\\"\\u003e\\n \\u003cp\\u003eNM_080682\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eGATTCTGTGCCCACAGTAAGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 10.9148%;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 48.6968%;\\\"\\u003e\\n \\u003cp\\u003eTGGTCACAGAGCCACCTTCTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 143px;\\\"\\u003e\\n \\u003cp\\u003eMouse HPRT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 141px;\\\"\\u003e\\n \\u003cp\\u003eNM_013556\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eGCCTAAGATGAGCGCAAGTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eTACTAGGCAGATGGCCACAGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 143px;\\\"\\u003e\\n \\u003cp\\u003eMouse C-MYC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 141px;\\\"\\u003e\\n \\u003cp\\u003eNM_010849\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eCGCACACACAACGTCTTGGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eAGGATGTAGGCGGTGGCTTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 143px;\\\"\\u003e\\n \\u003cp\\u003eMouse KLF4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 141px;\\\"\\u003e\\n \\u003cp\\u003eNM_010637\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eGGTGCAGCTTGCAGCAGTAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eAAAGTCTAGGTCCAGGAGGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd colspan=\\\"2\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eMouse NANOG \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; NM_028016\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGCCTTACGTACAGTTGCAGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eTCACCTGGTGGAGTCACAGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd colspan=\\\"2\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eMouse OCT4 \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; NM_013633\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGCATTCAAACTGAGGCACCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eAGCTTCTTTCCCCATCCCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 143px;\\\"\\u003e\\n \\u003cp\\u003eMouse SOX2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 141px;\\\"\\u003e\\n \\u003cp\\u003eNM_011443\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eGAAGCGTGTACTTATCCTTCTTCAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 73px;\\\"\\u003e\\n \\u003cp\\u003eR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"bottom\\\" style=\\\"width: 257px;\\\"\\u003e\\n \\u003cp\\u003eGAGTGGAAACTTTTGTCCGAGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\u003cp\\u003e\\u003cb\\u003eVCAM1 knockdown\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eSmall hairpin RNA targeting VCAM1 (shRNA: accession No. NM_080682) and scrambled shRNA (shCTRL) were purchased from Bioneer (Daejeon, South Korea). For efficient shRNA transfection, reverse transfection was performed using Lipofectamine 2000 (Invitrogen, Cat No: 52887) according to the manufacturer\\u0026rsquo;s protocol. We chose VCAM1 shRNA because it was the most effective at the mRNA level from five shRNAs designed from the target sequence based on qRT‒PCR analysis.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eIngenuity pathway analysis (IPA)\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eVCAM1-related gene analyses were performed with IPA version 2.0 software (Ingenuity Systems, Redwood City, CA, USA). Differentially expressed genes (t-test, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.005) between \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor exposed cells and non-exposed cells were subjected to VCAM1-related gene analysis. The significance of each factor was measured by Fisher\\u0026rsquo;s exact test (\\u003cem\\u003ep-\\u003c/em\\u003evalue), which was used to identify differentially expressed genes from microarray data that overlapped with genes known to be regulated by a factor. The activation score (Z score) was used to show the status of predicted factors by comparing the observed differential regulation of genes (\\u0026ldquo;up\\u0026rdquo; or \\u0026ldquo;down\\u0026rdquo;) in the RNA Seq data relative to the literature-derived regulation direction, which could be either activating or inhibiting.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eAnalysis of the GEO database\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eGEO (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ncbi.nlm.nih.gov/geo/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.ncbi.nlm.nih.gov/geo/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) is a freely distributed database repository of high-throughput gene expression data generated by genome hybridization arrays, chip sequencing, and DNA microarrays \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. Researchers provide their experimental results in four categories: experimental designs, samples, platforms, and raw data. Clinical or experimental samples within each dataset are further organized based on various experimental subgroups such as treatment, physiologic condition, and disease state. These categorized biological data are presented as \\u0026ldquo;GEO profiles\\u0026rdquo;, which include dataset title, gene annotation, a chart depicting expression levels, and the rank for that gene across each sample \\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e. Gene expression data were selected from GEO datasets according to multiple parameters such as tissues, cancers, diseases, genetic modifications, external stimuli, and development. Expression profiles of VCAM1 under various physiological conditions were analyzed according to previously established procedures \\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eEvaluation of effects of vaginal microbiota-derived secretory factor treatment in an animal model\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003e All animal experiments were approved and conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) (LCDI-2024-0016) of Gachon University. Both NSG (were purchased from Daehan Bio Link) and VCAM1 KO (were purchased from Orient Bio) mice were randomly divided four groups. 7-week-old immunodeficient NSG mice were subjected to treatment with 2% TCA (150 \\u0026micro;l, administered directly into the uterine horn) to induce uterine endometrial ablation or with sterilized PBS vehicle as a control. \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor (20mg/kg) daily for one week. These mice were anesthetized and exsanguinated by cardiac puncture. Stem cells were then isolated from uterine and adipose tissues. Uterine, adipose tissues, or bone marrow were then minced into small pieces. These small pieces were then digested in DMEM containing 10% FBS and 250 U/ml type I collagenase for 5 h at 37\\u0026deg;C. The digestion mixture was then filtered through a 40-\\u0026micro;m cell strainer. Endometrial cells were cultured in StemPro\\u0026reg; MSC SFM CTS\\u0026trade; (GIBCO, Cat No.: A1033201) at 37\\u0026deg;C under 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e in air. The culture medium was changed every 2 or 3 days. For further experiments, stem cells isolated from the endometrium were cultured and expanded \\u003cem\\u003ein vitro\\u003c/em\\u003e with continuous exposure to \\u003cem\\u003eLactobacillus iners\\u003c/em\\u003e-derived secretory factor (10\\u0026micro;l/ml) to properly mimic physiological conditions of stem cell-microbiota crosstalk \\u003cem\\u003ein vivo\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\u003cp\\u003eAll statistical data were analyzed with GraphPad Prism 5.0 (GraphPad Software, San Diego, CA) and evaluated using two-tailed Student\\u0026rsquo;s t-tests. Values of P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 were considered to indicate statistical significance.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eCrosstalk with\\u003c/b\\u003e \\u003cb\\u003eL. iners\\u003c/b\\u003e \\u003cb\\u003epromotes various key regenerative functions in human endometrial stem cells\\u003c/b\\u003e \\u003cb\\u003ein vitro\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eHuman endometrial stem cells were freshly obtained from endometrial tissue fragments, according to established protocols \\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e (Suppl. Figure\\u0026nbsp;1a), after which they were expanded by \\u003cem\\u003ein vitro\\u003c/em\\u003e culture. Stem cell properties were subsequently evaluated using flow cytometry based on the expression of various positive and negative surface markers, including CD34, CD44, CD45, CD73, CD105, and CD140b (Suppl. Figure\\u0026nbsp;1b). The multipotent differentiation potential of these stem cells into adipogenic and osteogenic lineages was evaluated using Oil Red O staining for adipocytes and Alizarin Red staining for osteoblasts (Suppl. Figure\\u0026nbsp;1c). The schematic in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea outlines our core hypothesis, suggesting that crosstalk with the vaginal microbiota \\u003cem\\u003eL. iners\\u003c/em\\u003e enhances the diverse functional properties of endometrial stem cells. Therefore, we assessed whether exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors enhanced the functional characteristics of endometrial stem cells. Notably, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors significantly promoted the self-renewal capacity of endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb) and markedly increased the Ki-67⁺ clonogenic subpopulation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). Consistent with these findings, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors notably boosted the migratory potential of endometrial stem cells. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed). To further validate the effects on migratory capacity, western blot analysis was performed to evaluate the protein expression levels of MMP-2 and MMP-9 \\u003csup\\u003e20\\u003c/sup\\u003e, key regulators of cell migration and invasion through extracellular matrix remodeling. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ee). Furthermore, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors markedly enhanced the multi-lineage differentiation capacity of endometrial stem cells, promoting their differentiation into adipocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ef) and osteoblasts (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eg). Consistent with these results, treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors significantly upregulated the expression of key pluripotency-associated genes including \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003ee\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eh). These findings indicate that crosstalk with \\u003cem\\u003eL. iners\\u003c/em\\u003e substantially promoted various tissue regeneration-related functions of endometrial stem cells, including self-renewal, migration, multilineage differentiation potential, and pluripotency.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCrosstalk with\\u003c/b\\u003e \\u003cb\\u003eL. iners\\u003c/b\\u003e \\u003cb\\u003esignificantly increased energy-producing (metabolic) activities of endometrial stem cells\\u003c/b\\u003e \\u003cb\\u003ein vitro\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eVarious stem cell functions associated with tissue regeneration, including self-renewal, differentiation capacity, and maintenance of pluripotency, are tightly regulated by energy-generating metabolic processes such as mitochondrial oxidative phosphorylation and cytosolic glycolysis \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR22\\\" citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, resident microbiota has been implicated in the regulation of various aspects of stem cell homeostasis, including metabolic activity, development, and immune responses \\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. Mitochondrial oxidative phosphorylation, which relies on oxygen consumption, is a critical indicator of sustained ATP generation and cellular vitality \\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e. To investigate the effects of vaginal microbiota interactions on the metabolic activity of endometrial stem cells, oxidative phosphorylation levels were measured in the presence and absence of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors using the Seahorse XF analyzer, which enables precise quantification of mitochondrial respiration by tracking real-time oxygen consumption rates (OCR) in live cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e. To inhibit coupled mitochondrial respiration, the ATP synthase inhibitor oligomycin, which specifically targets complex V of the electron transport chain, was administered \\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e. FCCP, a powerful uncoupler of oxidative phosphorylation, was introduced to collapse the mitochondrial membrane potential (Δψm), causing proton leakage across the inner mitochondrial membrane and facilitating oxygen consumption without ATP generation \\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e. Thus, FCCP administration enables the assessment of the mitochondria's real-time maximal respiratory capacity by measuring the OCR. Exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors markedly enhanced mitochondrial oxidative phosphorylation in human endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea), accompanied by an increase in non-mitochondrial OCR (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb). Treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors notably elevated basal respiration (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec), spare respiratory capacity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed), and maximal mitochondrial respiration (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ee), which collectively indicate the ability of mitochondria to generate additional ATP in response to a sudden surge in energy demand \\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, the total ATP generation from both mitochondrial and cytosolic sources was significantly elevated upon treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ef). As glycolysis metabolizes glucose into pyruvic acid and protons under aerobic conditions \\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e, we assessed glycolytic activity by quantifying real-time extracellular acidification rates (ECAR). Figure\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eg shows a schematic illustration of the assessment of glycolytic activity using a Seahorse XF analyzer. To inhibit glycolysis, the glucose analog 2-deoxyglucose was administered, allowing the real-time assessment of basal ECAR \\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. Rotenone and antimycin A were used to suppress complexes I and III of the mitochondrial respiratory chain, effectively inhibiting mitochondrial oxidative phosphorylation \\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e. Real-time analysis of glycolytic rates revealed that endometrial stem cells treated with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors exhibited significantly higher glycolytic activity than the untreated cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eg). Treatment with \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors significantly increased basal glycolysis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eh) and compensatory glycolytic activity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ei).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eValidation of the vaginal microbiota-mediated crosstalk-induced enhancement of diverse endometrial stem cell functions\\u003c/b\\u003e \\u003cb\\u003ein vivo\\u003c/b\\u003e \\u003cb\\u003eusing animal models\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eOur \\u003cem\\u003ein vitro\\u003c/em\\u003e results (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e) indicated that crosstalk mediated by \\u003cem\\u003eL. iners\\u003c/em\\u003e had the potential to enhance a range of tissue regeneration-related functions in human endometrial stem cells. To investigate the potential of vaginal microbiota-mediated crosstalk to robustly stimulate endometrial stem cell function \\u003cem\\u003ein vivo\\u003c/em\\u003e, we evaluated various tissue regeneration-associated activities following consecutive intravenous (IV) administration of \\u003cem\\u003eL. iners-\\u003c/em\\u003ederived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). Consistent with our \\u003cem\\u003ein vitro\\u003c/em\\u003e findings, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors significantly increased self-renewal capacity of endometrial stem cells \\u003cem\\u003ein vivo\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb). Similarly, in an animal model, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors significantly enhanced the migratory capacity of endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec) and upregulated the expression of MMP-2 and MMP-9 \\u003cem\\u003ein vivo\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ed). \\u003cem\\u003eIn vivo\\u003c/em\\u003e exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors markedly promoted the multilineage differentiation potential of endometrial stem cells into adipocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee) and osteoblasts (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ef), and significantly upregulated the expression of pluripotency-associated genes, including \\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eg). Interestingly, colony-forming assays conducted on endometrial stem cells isolated from the uterine endometrium of mice treated with a broad-spectrum antibiotic mixture to deplete the vaginal microbiota revealed a significant reduction in colony-forming efficiency compared to that in the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eh). Clonogenic stem cells in the endometrium play critical roles in endometrial development \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, to assess the effect of vaginal microbiota depletion on endometrial development, histopathological analysis was performed using hematoxylin and eosin staining under the same experimental conditions as previously mentioned. Comparative analysis revealed that the group treated with an antibiotic mixture to eliminate the vaginal microbiota exhibited significantly impaired endometrial development compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ei).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eFurthermore, we investigated whether exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors enhanced tissue repair-associated functions in other tissue-resident stem cells, including adipose tissue-derived stem cells (Suppl. Figure\\u0026nbsp;2a), and bone marrow-derived stem cells (Suppl. Figure\\u0026nbsp;3a). Consistently, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors significantly enhanced the self-renewal capacity (Figs. S2b and S3b) and migratory ability (Figs. S2c\\u0026ndash;d and S3c\\u0026ndash;d), and multilineage differentiation potential (Figs. S2e\\u0026ndash;f and S3e\\u0026ndash;f) of adipose tissue-derived and bone marrow-derived stem cells \\u003cem\\u003ein vivo\\u003c/em\\u003e. Additionally, \\u003cem\\u003ein vivo\\u003c/em\\u003e exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors led to a significant upregulation of pluripotency-associated genes, including \\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e, in both adipose tissue-derived and bone marrow-derived stem cells (Figs. S2g and S3g). These results suggest that the microbiota-mediated enhancement of stem cell function may be a broadly applicable mechanism that extends beyond endometrial stem cells to other stem cell types.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eVCAM1 serves as a critical mediator in the crosstalk between human endometrial stem cells and vaginal microbiota\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo elucidate the regulatory mechanism underlying the crosstalk between human endometrial stem cells and \\u003cem\\u003eL. iners\\u003c/em\\u003e, we performed bulk RNA-Seq to analyze large-scale gene expression patterns in human endometrial stem cells following exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea). A substantial number of gene clusters were significantly upregulated in response to exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb). To further investigate the functional interplay between vaginal microbiota-mediated crosstalk and intracellular signaling networks in endometrial stem cells, we conducted a KEGG pathway enrichment analysis, which revealed significant activation of multiple tissue regeneration-associated signaling pathways following exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec). Among the genes exhibiting differential expression in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, VCAM1 displayed a distinct expression pattern. Consistent with the observed functional changes, VCAM1 expression was significantly upregulated after exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ed). To confirm the altered expression pattern of VCAM1 in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, we conducted additional analyses on endometrial stem cells using real-time PCR and western blotting. Consistently, exposure to vaginal microbiota-derived secretory factors resulted in significant upregulation of VCAM1 expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ee). To further validate the association between elevated VCAM1 expression and vaginal microbiota-mediated crosstalk, we analyzed data from the GEO database. VCAM1 expression was upregulated in various cell models upon interaction with normal flora, whereas its expression significantly decreased when microbiota interactions were disrupted (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ef). GSEA also demonstrated a significant upregulation of TNF-alpha and immune response-related signaling pathways associated with VCAM1 following exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eg). To investigate whether the activation of VCAM1-related signaling pathways was positively linked to exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, we conducted an extensive analysis of gene expression profiles and their corresponding signaling networks using Ingenuity Pathway Analysis (IPA). Exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors in endometrial stem cells led to the upregulation of VCAM1 positive regulators, including IL13, PRKCD, and HIF1A (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eh). These results suggest that \\u003cem\\u003eVCAM1\\u003c/em\\u003e functions as a robust response gene in stem cells following exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eSilencing VCAM1 effectively abolished the beneficial effects of\\u003c/b\\u003e \\u003cb\\u003eL. iners\\u003c/b\\u003e\\u003cb\\u003e-derived secretory factors on multiple endometrial stem cell functions\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo further elucidate the role of VCAM1 in regulating vaginal microbiota-mediated crosstalk related to various tissue regeneration-associated functions, we conducted knockdown experiments in endometrial stem cells using VCAM1-specific shRNA (Suppl. Figure\\u0026nbsp;4a\\u0026ndash;c), as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea. Notably, the promotion of self-renewal capacity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb) and expansion of the clonogenic Ki-67⁺ subpopulation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ec) in endometrial stem cells induced by \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors was markedly diminished upon VCAM1 knockdown. Moreover, VCAM1 depletion markedly diminished the vaginal microbiota crosstalk-driven promotion of stem cell migration (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ed), along with a notable attenuation in the expression of key migration and invasion regulators, including MMP-2 and MMP-9 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ee). Furthermore, VCAM1 knockdown significantly reduced the beneficial effects of the vaginal microbiota-mediated crosstalk on the multilineage differentiation capacity of endometrial stem cells into adipocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ef) and osteoblasts (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eg) \\u003cem\\u003ein vitro\\u003c/em\\u003e. Silencing VCAM1 attenuated the vaginal microbiota crosstalk-driven upregulation of pluripotency-associated factors, including c-MYC, KLF4, NANOG, OCT4, and SOX2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eh). These results highlight the pivotal role of VCAM1 in regulating the vaginal microbiota-mediated crosstalk, which influences various tissue regeneration-associated functions of human endometrial stem cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCrosstalk between endometrial stem cells and vaginal microbiota is mediated through the activation of PI3K/Akt signaling pathways\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo elucidate the signaling pathways involved in the crosstalk between endometrial stem cells and vaginal microbiota, we examined the activation status of the PI3K/Akt pathway in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors. These pathways are well known for their critical roles in regulating the self-renewal \\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e, migratory capacity \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e, and stemness \\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e of human endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ea). Accordingly, we investigated whether the PI3K/Akt signaling pathway exhibited similar activation patterns in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor exposure using western blot analysis. Consistent with the observed functional outcomes, exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors led to significant activation of the PI3K/Akt signaling pathway in endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eb). To further clarify the hierarchical relationship between VCAM1 and the PI3K/Akt signaling pathways, we conducted additional experiments involving VCAM1 knockdown along with the application of a specific inhibitor targeting the Akt signaling pathway. VCAM1 knockdown resulted in a significant reduction in the phosphorylation of Akt signaling pathways (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ec). By contrast, the inhibition of Akt signaling using a specific pathway inhibitor (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ed) had no appreciable effect on VCAM1 expression. Consistently, the enhanced PI3K and Akt signaling induced by \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors were substantially attenuated following VCAM1 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ee). These results indicate that VCAM1 functions as an upstream regulator by modulating the activation of both the Akt signaling pathways. To further validate the association between elevated PI3K/Akt signaling activity and vaginal microbiota-driven interactions, we conducted a large-scale gene expression analysis using data from the GEO database. Notably, both PI3K and Akt expression levels were upregulated in various cell models upon interaction with normal flora (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ef). Furthermore, GSEA demonstrated significant upregulation of PI3K/Akt signaling following exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eg). To investigate whether the activation of Akt-related signaling pathways was positively linked to exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, we conducted an extensive analysis of gene expression profiles and their corresponding signaling networks using IPA. Exposure of endometrial stem cells to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors led to the upregulation of Akt-positive regulators, including MYC, KLF4, and PI3K (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eh).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eSuppression of Akt signaling activity effectively abolished the positive effects of vaginal microbiota-driven crosstalk on various functional properties of endometrial stem cells\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo further explore whether the inhibition of the PI3K/Akt signaling pathway could reduce the stimulatory effects of vaginal microbiota-driven crosstalk on various endometrial stem cell functions, we evaluated the impact of Inhibitor V (targeting the Akt pathway) on various endometrial stem cell functions, both in the presence and absence of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ea). Our results demonstrated that the promotion of self-renewal capacity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eb) and expansion of the clonogenic Ki-67⁺ subpopulation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ec) in endometrial stem cells induced by \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors was markedly attenuated upon Akt signaling inhibition. Furthermore, inhibition of the Akt signaling pathway markedly suppressed the vaginal microbiota crosstalk-driven promotion of cell migratory capacity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ed), accompanied by a pronounced reduction in the expression of MMP-2 and MMP-9 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ee). Moreover, blocking the Akt signaling pathway significantly diminished the vaginal microbiota crosstalk-induced enhancement of the multilineage differentiation potential of endometrial stem cells into adipocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ef) and osteoblasts (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eg). Consistently, inhibition of the Akt signaling pathway significantly reduced the vaginal microbiota crosstalk-induced upregulation of pluripotency-associated genes, including \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eh). These findings underscore the critical role of the Akt signaling pathway as a downstream effector of VCAM1, orchestrating the vaginal microbiota-mediated crosstalk that governs various tissue regeneration-associated functions in human endometrial stem cells.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCharacterizing the expression patterns of diverse growth factors induced by vaginal microbiota crosstalk and investigating their correlations with various physiological states\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eTo investigate whether the enhancing effects of vaginal microbiota crosstalk on various human endometrial stem cell functions were mediated by the secretion of specific growth factors or cytokines, we performed antibody array analyses on cells treated with or without \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors. Treatment of endometrial stem cells with vaginal microbiota-derived secretory factors altered the expression levels of 40 distinct proteins. The \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor treatment led to the substantial upregulation of six key growth factors: colony stimulating factor 2 (CSF2), insulin-like growth factor-1 receptor (IGF-1R), keratinocyte growth factor (FGF-7), platelet-derived growth factor-AA (PDGF-AA), platelet-derived growth factor receptor β (PDGFRβ), and stem cell factor (SCF). By contrast, the expression levels of other growth factors exhibited only minimal deviations from baseline (Suppl. Figure\\u0026nbsp;5a\\u0026ndash;c). These findings imply that these growth factors may at least partially contribute to the vaginal microbiota crosstalk-induced activation of the PI3K/Akt signaling pathway, thereby mediating the subsequent beneficial effects on endometrial stem cells. To further investigate the association between the aforementioned protein factors induced by vaginal microbiota-derived secretory factor exposure and various cellular conditions, we analyzed publicly available gene expression datasets from the GEO database. Consistent with our results, the GEO dataset analysis revealed that the expression of these protein factors was upregulated in the presence of normal flora, while exhibiting a marked reduction upon microbiota depletion (Suppl. Figure\\u0026nbsp;5d). To investigate whether the activation of these six prominent protein factor-associated signaling pathways was positively linked to exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors, we conducted an extensive analysis of gene expression profiles and their corresponding signaling networks using IPA. The aforementioned protein factors were not only involved in the activation of the PI3K/Akt signaling pathway but were also strongly correlated with the upregulation of key genes and regulatory signaling molecules governing stem cell activity in response to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factor stimulation (Suppl. Figure\\u0026nbsp;5e).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eVCAM1 knockout significantly attenuates the vaginal microbiota crosstalk-driven enhancement of various endometrial stem cell functions\\u003c/b\\u003e \\u003cb\\u003ein vivo\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eOur \\u003cem\\u003ein vitro\\u003c/em\\u003e results emphasize the pivotal role of VCAM1 in regulating the crosstalk between vaginal microbiota and endometrial stem cells. To further explore the impact of VCAM1 deficiency on vaginal microbiota-mediated crosstalk and its effects on various tissue regeneration-associated functions of endometrial stem cells \\u003cem\\u003ein vivo\\u003c/em\\u003e, we utilized VCAM1 knockout (K.O.) mice subjected to consecutive intravenous administration of \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors. (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003ea). Consecutive exposure to \\u003cem\\u003eL. iners\\u003c/em\\u003e-derived secretory factors did not result in a significant change in the self-renewal capacity of endometrial stem cells isolated from VCAM1 K.O. mice \\u003cem\\u003ein vivo\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eb). Similarly, the vaginal microbiota-derived secretory factor-induced enhancement of migratory capacity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003ec) and the expression of MMP-2 and MMP-9 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003ed) in endometrial stem cells showed minimal responsiveness in VCAM1 K.O. mice. Following successive exposure to vaginal microbiota-derived secretory factors, no significant enhancement was observed in the multilineage differentiation potential of endometrial stem cells from VCAM1 K.O. mice, either towards the adipogenic (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003ee) or osteogenic (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003ef) lineages \\u003cem\\u003ein vivo\\u003c/em\\u003e. Additionally, the pronounced upregulation of pluripotency-associated genes (\\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e) observed in wild-type mice following repeated exposure to vaginal microbiota-derived secretory factors was absent in VCAM1 K.O. mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eg).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eRecent findings from the Human Microbiome Project estimated that the vaginal microbiota constitutes approximately 9% of the total bacterial population in females \\u003csup\\u003e\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e. These microbial communities have been shown to play pivotal roles in various stages of reproduction, including gametogenesis \\u003csup\\u003e\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e, fertilization \\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e, as well as establishment and maintenance of pregnancy \\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e. Accumulating evidence highlights the critical role of the vaginal microbiota in regulating endometrial development \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e, which is a key process for successful embryo implantation and pregnancy. Additionally, previous research has emphasized the importance of the microbiota in preserving epithelial homeostasis \\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e, modulating immune responses \\u003csup\\u003e\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u003c/sup\\u003e, and shaping metabolic pathways \\u003csup\\u003e\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. The regenerative capacity of tissue-resident stem cells is governed by the dynamic interplay between intrinsic cellular pathways and external environmental factors, including interactions with the host microbiota \\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e. However, the extent to which vaginal microbiota contributes to various tissue regeneration-associated functions of human endometrial stem cells, which play a pivotal role in endometrial development and subsequent endometrial receptivity, remains largely unexplored.\\u003c/p\\u003e\\u003cp\\u003eOur findings bridge this knowledge gap by demonstrating that the crosstalk between the vaginal microbiota and endometrial stem cells plays a pivotal role in promoting various regenerative functions, including self-renewal, migratory capacity, and multilineage differentiation potential \\u003cem\\u003ein vitro\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea\\u0026ndash;h) and \\u003cem\\u003ein vivo\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea\\u0026ndash;i). Notably, vaginal microbiota crosstalk results in increased expression of pluripotency-associated genes (\\u003cem\\u003ec-MYC\\u003c/em\\u003e, \\u003cem\\u003eKLF4\\u003c/em\\u003e, \\u003cem\\u003eNANOG\\u003c/em\\u003e, \\u003cem\\u003eOCT4\\u003c/em\\u003e, and \\u003cem\\u003eSOX2\\u003c/em\\u003e), suggesting that microbiota-derived signals actively sustain the stem-like properties of endometrial stem cells. By elucidating the underlying molecular mechanisms, we identified VCAM1 as a key mediator of this microbiota-endometrial stem cell crosstalk (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e) and demonstrated its involvement in activating the PI3K/Akt signaling pathway (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e), a crucial regulator of stem cell homeostasis and function. The PI3K/Akt signaling pathway is widely recognized as a critical regulator of endometrial stem cell self-renewal \\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e, multilineage differentiation potential \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e, and migratory capacity \\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. Pharmacological inhibition of the PI3K/Akt pathway effectively suppressed the vaginal microbiota-mediated enhancement of various stem cell functions (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003ea\\u0026ndash;h), further confirming its role as a key downstream effector of microbiota-mediated stem cell regulation.\\u003c/p\\u003e\\u003cp\\u003eOne of the most striking findings of our study was the critical role of VCAM1 in mediating the beneficial effects of vaginal microbiota crosstalk on various endometrial stem cell functions. Functional knockdown of VCAM1 using a specific shRNA abolished the enhancement of self-renewal, migration, and differentiation induced by microbiota-derived secretory factors \\u003cem\\u003ein vitro\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea\\u0026ndash;h) and \\u003cem\\u003ein vivo\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003ea\\u0026ndash;g), highlighting its essential role in regulating stem cell activity. Additionally, bioinformatics analyses using KEGG pathway enrichment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec) and GEO datasets (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eg) further corroborated the link between microbiota interactions and VCAM1 upregulation in multiple cell models. These results suggest that VCAM1 acts as a core regulatory hub by integrating microbiota-derived signals to modulate endometrial stem cell behavior. Notably, VCAM1 is recognized as a crucial regulator of stem cell function beyond endometrial stem cells. Previous studies have demonstrated that VCAM1 is involved in the regulation of self-renewal \\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u003c/sup\\u003e, differentiation \\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e, and migration \\u003csup\\u003e\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e\\u003c/sup\\u003e across multiple stem cell types, including hematopoietic, mesenchymal, and neural stem cells. Given its broad regulatory function, the upregulation of VCAM1 in response to vaginal microbiota-derived secretory factors suggests that the microbiota-driven modulation of VCAM1 could serve as a fundamental mechanism governing stem cell behavior across various tissues.\\u003c/p\\u003e\\u003cp\\u003eEnergy-generating metabolic processes such as mitochondrial oxidative phosphorylation and cytosolic glycolysis play crucial roles in the regulation of various stem cell functions \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR49 CR50 CR51\\\" citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e\\u003c/sup\\u003e, including self-renewal, differentiation, and pluripotency. Mitochondrial oxidative phosphorylation serves as the primary source of sustained ATP production, supporting the high energy demands required for stem cell maintenance and lineage commitment \\u003csup\\u003e\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u003c/sup\\u003e. By contrast, cytosolic glycolysis facilitates rapid ATP generation and contributes to metabolic plasticity, enabling stem cells to adapt swiftly to changes in their microenvironment \\u003csup\\u003e\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e\\u003c/sup\\u003e. Emerging evidence suggests that metabolic processes are essential for preserving stem cell functionality, as regulations in metabolic states can dictate cell fate decisions and influence tissue regeneration \\u003csup\\u003e\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e\\u003c/sup\\u003e. Indeed, our data revealed that microbiota-derived secretory factors significantly activated this pathway, leading to enhanced energy-generating metabolic processes such as mitochondrial oxidative phosphorylation and cytosolic glycolysis in endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea\\u0026ndash;i). The observed increase in oxidative phosphorylation and glycolysis underscores the role of microbiota-derived factors in modulating cellular energy metabolism, which is fundamental for sustaining tissue-resident stem cell function.\\u003c/p\\u003e\\u003cp\\u003eMoreover, our \\u003cem\\u003ein vivo\\u003c/em\\u003e experiments validated the significance of vaginal microbiota-tissue-resident stem cell interactions in endometrial regeneration. Antibiotic-induced depletion of vaginal microbiota led to impaired endometrial development and a significant reduction in the clonogenic capacity of endometrial stem cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eh and i). These findings reinforce the idea that a healthy vaginal microbiome is essential for maintaining the functional integrity of endometrial stem cells and subsequent optimal endometrial regeneration. Additionally, our study demonstrated that vaginal microbiota-derived secretory factors enhance various tissue regeneration-associated functions not only in endometrial stem cells but also in adipose tissue (Suppl. Figure\\u0026nbsp;2) and bone marrow (Suppl. Figure\\u0026nbsp;3)-derived stem cells, suggesting that microbiota-mediated stem cell modulation is a broadly applicable mechanism across multiple types of stem cells.\\u003c/p\\u003e\\u003cp\\u003eTaken together, our findings reveal a novel microbiota-stem cell axis in endometrial regeneration and highlight the therapeutic potential of leveraging microbiota-derived secretory factors for regenerative medicine. Future studies should focus on identifying the specific protein components within the vaginal microbiota-derived secretory factors responsible for these effects and further delineate the downstream molecular networks involved. Understanding these interactions at a deeper level may pave the way for innovative microbiota-based therapeutic strategies that target a wide range of stem cell-based tissue injury-associated disorders.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eConflict of Interest\\u003c/h2\\u003e\\u003cp\\u003eThe authors have no competing interests as defined by \\u003cem\\u003eExperimental \\u0026amp; Molecular Medicine\\u003c/em\\u003e or other interests that might be perceived to influence the results and/or discussion reported in this article.\\u003c/p\\u003e\\u003c/p\\u003e\\u003ch2\\u003eFunding information:\\u003c/h2\\u003e\\u003cp\\u003eRS-2024-00455501/ 2021R1A5A2030333/ NRF- 2023R1A2C2002522/ 21A0103L1/ RS-2023-00254427\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgments\\u003c/h2\\u003e\\u003cp\\u003eThis work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean Government (MSIT) (RS-2024-00455501/ 2021R1A5A2030333/ NRF- 2023R1A2C2002522). This research was supported by the Korean Fund for Regenerative Medicine (KFRM) grant funded by the Korean government (the Ministry of Science and ICT, the Ministry of Health \\u0026amp; Welfare) (code: 21A0103L1). This work was also supported by the NRF grant funded by the Korean Government (MSIT) (RS-2023-00254427).\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eGao X, Louwers YV, Laven JSE, Schoenmakers S. Clinical Relevance of Vaginal and Endometrial Microbiome Investigation in Women with Repeated Implantation Failure and Recurrent Pregnancy Loss. \\u003cem\\u003eInt J Mol Sci \\u003c/em\\u003e2024; \\u003cstrong\\u003e25\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eTian Z, Zhao M, Sui X, Li X, Qin L, Chen ZJ\\u003cem\\u003e et al.\\u003c/em\\u003e Associations between vaginal microbiota and endometrial polypoid lesions in women of reproductive age: a cross-sectional study. \\u003cem\\u003eReprod Biomed Online \\u003c/em\\u003e2024; \\u003cstrong\\u003e48: \\u003c/strong\\u003e103602.\\u003c/li\\u003e\\n\\u003cli\\u003eBalla B, Illes A, Tobias B, Piko H, Beke A, Sipos M\\u003cem\\u003e et al.\\u003c/em\\u003e The Role of the Vaginal and Endometrial Microbiomes in Infertility and Their Impact on Pregnancy Outcomes in Light of Recent Literature. \\u003cem\\u003eInt J Mol Sci \\u003c/em\\u003e2024; \\u003cstrong\\u003e25\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eZheng N, Guo R, Wang J, Zhou W, Ling Z. Contribution of Lactobacillus iners to Vaginal Health and Diseases: A Systematic Review. \\u003cem\\u003eFront Cell Infect Microbiol \\u003c/em\\u003e2021; \\u003cstrong\\u003e11: \\u003c/strong\\u003e792787.\\u003c/li\\u003e\\n\\u003cli\\u003eChee WJY, Chew SY, Than LTL. Vaginal microbiota and the potential of Lactobacillus derivatives in maintaining vaginal health. \\u003cem\\u003eMicrob Cell Fact \\u003c/em\\u003e2020; \\u003cstrong\\u003e19: \\u003c/strong\\u003e203.\\u003c/li\\u003e\\n\\u003cli\\u003eSantacroce L, Palmirotta R, Bottalico L, Charitos IA, Colella M, Topi S\\u003cem\\u003e et al.\\u003c/em\\u003e Crosstalk between the Resident Microbiota and the Immune Cells Regulates Female Genital Tract Health. \\u003cem\\u003eLife (Basel) \\u003c/em\\u003e2023; \\u003cstrong\\u003e13\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eWang J, Li Z, Ma X, Du L, Jia Z, Cui X\\u003cem\\u003e et al.\\u003c/em\\u003e Translocation of vaginal microbiota is involved in impairment and protection of uterine health. \\u003cem\\u003eNat Commun \\u003c/em\\u003e2021; \\u003cstrong\\u003e12: \\u003c/strong\\u003e4191.\\u003c/li\\u003e\\n\\u003cli\\u003eMcLennan CE, Rydell AH. Extent of endometrial shedding during normal menstruation. \\u003cem\\u003eObstet Gynecol \\u003c/em\\u003e1965; \\u003cstrong\\u003e26: \\u003c/strong\\u003e605-621.\\u003c/li\\u003e\\n\\u003cli\\u003eGargett CE, Nguyen HP, Ye L. Endometrial regeneration and endometrial stem/progenitor cells. \\u003cem\\u003eRev Endocr Metab Disord \\u003c/em\\u003e2012; \\u003cstrong\\u003e13: \\u003c/strong\\u003e235-251.\\u003c/li\\u003e\\n\\u003cli\\u003eGargett CE, Ye L. Endometrial reconstruction from stem cells. \\u003cem\\u003eFertil Steril \\u003c/em\\u003e2012; \\u003cstrong\\u003e98: \\u003c/strong\\u003e11-20.\\u003c/li\\u003e\\n\\u003cli\\u003eHong IS. Endometrial Stem Cells: Orchestrating Dynamic Regeneration of Endometrium and Their Implications in Diverse Endometrial Disorders. \\u003cem\\u003eInt J Biol Sci \\u003c/em\\u003e2024; \\u003cstrong\\u003e20: \\u003c/strong\\u003e864-879.\\u003c/li\\u003e\\n\\u003cli\\u003eLucas ES, Dyer NP, Murakami K, Lee YH, Chan YW, Grimaldi G\\u003cem\\u003e et al.\\u003c/em\\u003e Loss of Endometrial Plasticity in Recurrent Pregnancy Loss. \\u003cem\\u003eStem Cells \\u003c/em\\u003e2016; \\u003cstrong\\u003e34: \\u003c/strong\\u003e346-356.\\u003c/li\\u003e\\n\\u003cli\\u003eMin EK, Kim SR, Lee CM, Na KH, Park CH, Oh BC\\u003cem\\u003e et al.\\u003c/em\\u003e Identification of memory mechanism in tissue-resident stem cells via ANGPTL4 beyond immune cells upon viral antigen exposure. \\u003cem\\u003eMol Ther \\u003c/em\\u003e2024; \\u003cstrong\\u003e32: \\u003c/strong\\u003e3042-3058.\\u003c/li\\u003e\\n\\u003cli\\u003ePark SR, Kim SR, Park CH, Lim S, Ha SY, Hong IS\\u003cem\\u003e et al.\\u003c/em\\u003e Sonic Hedgehog, a Novel Endogenous Damage Signal, Activates Multiple Beneficial Functions of Human Endometrial Stem Cells. \\u003cem\\u003eMol Ther \\u003c/em\\u003e2019; doi:10.1016/j.ymthe.2019.11.024.\\u003c/li\\u003e\\n\\u003cli\\u003eChoi ES, Jung JY, Lee JS, Park JH, Cho NP, Cho SD. Myeloid cell leukemia-1 is a key molecular target for mithramycin A-induced apoptosis in androgen-independent prostate cancer cells and a tumor xenograft animal model. \\u003cem\\u003eCancer Lett \\u003c/em\\u003e2013; \\u003cstrong\\u003e328: \\u003c/strong\\u003e65-72.\\u003c/li\\u003e\\n\\u003cli\\u003eBarrett T, Suzek TO, Troup DB, Wilhite SE, Ngau WC, Ledoux P\\u003cem\\u003e et al.\\u003c/em\\u003e NCBI GEO: mining millions of expression profiles--database and tools. \\u003cem\\u003eNucleic Acids Res \\u003c/em\\u003e2005; \\u003cstrong\\u003e33: \\u003c/strong\\u003eD562-566.\\u003c/li\\u003e\\n\\u003cli\\u003eEdgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. \\u003cem\\u003eNucleic Acids Res \\u003c/em\\u003e2002; \\u003cstrong\\u003e30: \\u003c/strong\\u003e207-210.\\u003c/li\\u003e\\n\\u003cli\\u003eBarrett T, Edgar R. Mining microarray data at NCBI\\u0026apos;s Gene Expression Omnibus (GEO)*. \\u003cem\\u003eMethods Mol Biol \\u003c/em\\u003e2006; \\u003cstrong\\u003e338: \\u003c/strong\\u003e175-190.\\u003c/li\\u003e\\n\\u003cli\\u003eCho A, Park SR, Kim SR, Nam S, Lim S, Park CH\\u003cem\\u003e et al.\\u003c/em\\u003e An Endogenous Anti-aging Factor, Sonic Hedgehog, Suppresses Endometrial Stem Cell Aging through SERPINB2. \\u003cem\\u003eMol Ther \\u003c/em\\u003e2019; \\u003cstrong\\u003e27: \\u003c/strong\\u003e1286-1298.\\u003c/li\\u003e\\n\\u003cli\\u003eWang Y, Zheng L, Zhang L, Tai Y, Lin X, Cai Z. Roles of MMP-2 and MMP-9 and their associated molecules in the pathogenesis of keloids: a comprehensive review. \\u003cem\\u003eFront Pharmacol \\u003c/em\\u003e2024; \\u003cstrong\\u003e15: \\u003c/strong\\u003e1444653.\\u003c/li\\u003e\\n\\u003cli\\u003eGan B, Hu J, Jiang S, Liu Y, Sahin E, Zhuang L\\u003cem\\u003e et al.\\u003c/em\\u003e Lkb1 regulates quiescence and metabolic homeostasis of haematopoietic stem cells. \\u003cem\\u003eNature \\u003c/em\\u003e2010; \\u003cstrong\\u003e468: \\u003c/strong\\u003e701-704.\\u003c/li\\u003e\\n\\u003cli\\u003eGurumurthy S, Xie SZ, Alagesan B, Kim J, Yusuf RZ, Saez B\\u003cem\\u003e et al.\\u003c/em\\u003e The Lkb1 metabolic sensor maintains haematopoietic stem cell survival. \\u003cem\\u003eNature \\u003c/em\\u003e2010; \\u003cstrong\\u003e468: \\u003c/strong\\u003e659-663.\\u003c/li\\u003e\\n\\u003cli\\u003eTothova Z, Gilliland DG. FoxO transcription factors and stem cell homeostasis: insights from the hematopoietic system. \\u003cem\\u003eCell Stem Cell \\u003c/em\\u003e2007; \\u003cstrong\\u003e1: \\u003c/strong\\u003e140-152.\\u003c/li\\u003e\\n\\u003cli\\u003eWu H, Mu C, Xu L, Yu K, Shen L, Zhu W. Host-microbiota interaction in intestinal stem cell homeostasis. \\u003cem\\u003eGut Microbes \\u003c/em\\u003e2024; \\u003cstrong\\u003e16: \\u003c/strong\\u003e2353399.\\u003c/li\\u003e\\n\\u003cli\\u003eHaylett W, Swart C, van der Westhuizen F, van Dyk H, van der Merwe L, van der Merwe C\\u003cem\\u003e et al.\\u003c/em\\u003e Altered Mitochondrial Respiration and Other Features of Mitochondrial Function in Parkin-Mutant Fibroblasts from Parkinson\\u0026apos;s Disease Patients. \\u003cem\\u003eParkinsons Dis \\u003c/em\\u003e2016; \\u003cstrong\\u003e2016: \\u003c/strong\\u003e1819209.\\u003c/li\\u003e\\n\\u003cli\\u003eFerrick DA, Neilson A, Beeson C. Advances in measuring cellular bioenergetics using extracellular flux. \\u003cem\\u003eDrug Discov Today \\u003c/em\\u003e2008; \\u003cstrong\\u003e13: \\u003c/strong\\u003e268-274.\\u003c/li\\u003e\\n\\u003cli\\u003eAbedin Z, Sen S, Field J. Aldo-keto reductases protect lung adenocarcinoma cells from the acute toxicity of B[a]P-7,8-trans-dihydrodiol. \\u003cem\\u003eChem Res Toxicol \\u003c/em\\u003e2012; \\u003cstrong\\u003e25: \\u003c/strong\\u003e113-121.\\u003c/li\\u003e\\n\\u003cli\\u003eDesler C, Hansen TL, Frederiksen JB, Marcker ML, Singh KK, Juel Rasmussen L. Is There a Link between Mitochondrial Reserve Respiratory Capacity and Aging? \\u003cem\\u003eJ Aging Res \\u003c/em\\u003e2012; \\u003cstrong\\u003e2012: \\u003c/strong\\u003e192503.\\u003c/li\\u003e\\n\\u003cli\\u003eGatenby RA, Gillies RJ. Why do cancers have high aerobic glycolysis? \\u003cem\\u003eNat Rev Cancer \\u003c/em\\u003e2004; \\u003cstrong\\u003e4: \\u003c/strong\\u003e891-899.\\u003c/li\\u003e\\n\\u003cli\\u003eKato Y, Ozawa S, Miyamoto C, Maehata Y, Suzuki A, Maeda T\\u003cem\\u003e et al.\\u003c/em\\u003e Acidic extracellular microenvironment and cancer. \\u003cem\\u003eCancer Cell Int \\u003c/em\\u003e2013; \\u003cstrong\\u003e13: \\u003c/strong\\u003e89.\\u003c/li\\u003e\\n\\u003cli\\u003ePajak B, Siwiak E, Soltyka M, Priebe A, Zielinski R, Fokt I\\u003cem\\u003e et al.\\u003c/em\\u003e 2-Deoxy-d-Glucose and Its Analogs: From Diagnostic to Therapeutic Agents. \\u003cem\\u003eInt J Mol Sci \\u003c/em\\u003e2019; \\u003cstrong\\u003e21\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eTrotta AP, Gelles JD, Serasinghe MN, Loi P, Arbiser JL, Chipuk JE. Disruption of mitochondrial electron transport chain function potentiates the pro-apoptotic effects of MAPK inhibition. \\u003cem\\u003eJ Biol Chem \\u003c/em\\u003e2017; \\u003cstrong\\u003e292: \\u003c/strong\\u003e11727-11739.\\u003c/li\\u003e\\n\\u003cli\\u003ePark SR, Kim SR, Im JB, Lim S, Hong IS. Tryptophanyl-tRNA Synthetase, a Novel Damage-Induced Cytokine, Significantly Increases the Therapeutic Effects of Endometrial Stem Cells. \\u003cem\\u003eMol Ther \\u003c/em\\u003e2020; \\u003cstrong\\u003e28: \\u003c/strong\\u003e2458-2472.\\u003c/li\\u003e\\n\\u003cli\\u003ePark SR, Kim SR, Park CH, Lim S, Ha SY, Hong IS\\u003cem\\u003e et al.\\u003c/em\\u003e Sonic Hedgehog, a Novel Endogenous Damage Signal, Activates Multiple Beneficial Functions of Human Endometrial Stem Cells. \\u003cem\\u003eMol Ther \\u003c/em\\u003e2020; \\u003cstrong\\u003e28: \\u003c/strong\\u003e452-465.\\u003c/li\\u003e\\n\\u003cli\\u003ePark SR, Kim SK, Kim SR, Kim D, Kim KW, Hong IS\\u003cem\\u003e et al.\\u003c/em\\u003e Noncanonical functions of glucocorticoids: A novel role for glucocorticoids in performing multiple beneficial functions in endometrial stem cells. \\u003cem\\u003eCell Death Dis \\u003c/em\\u003e2021; \\u003cstrong\\u003e12: \\u003c/strong\\u003e612.\\u003c/li\\u003e\\n\\u003cli\\u003eLiptakova A, Curova K, Zahumensky J, Visnyaiova K, Varga I. Microbiota of female genital tract - functional overview of microbial flora from vagina to uterine tubes and placenta. \\u003cem\\u003ePhysiol Res \\u003c/em\\u003e2022; \\u003cstrong\\u003e71: \\u003c/strong\\u003eS21-S33.\\u003c/li\\u003e\\n\\u003cli\\u003eLledo B, Fuentes A, Lozano FM, Cascales A, Morales R, Hortal M\\u003cem\\u003e et al.\\u003c/em\\u003e Identification of vaginal microbiome associated with IVF pregnancy. \\u003cem\\u003eSci Rep \\u003c/em\\u003e2022; \\u003cstrong\\u003e12: \\u003c/strong\\u003e6807.\\u003c/li\\u003e\\n\\u003cli\\u003eWang T, Li P, Bai X, Tian S, Yang M, Leng D\\u003cem\\u003e et al.\\u003c/em\\u003e Vaginal microbiota are associated with in vitro fertilization during female infertility. \\u003cem\\u003eImeta \\u003c/em\\u003e2024; \\u003cstrong\\u003e3: \\u003c/strong\\u003ee185.\\u003c/li\\u003e\\n\\u003cli\\u003eBaud A, Hillion KH, Plainvert C, Tessier V, Tazi A, Mandelbrot L\\u003cem\\u003e et al.\\u003c/em\\u003e Microbial diversity in the vaginal microbiota and its link to pregnancy outcomes. \\u003cem\\u003eSci Rep \\u003c/em\\u003e2023; \\u003cstrong\\u003e13: \\u003c/strong\\u003e9061.\\u003c/li\\u003e\\n\\u003cli\\u003eGierynska M, Szulc-Dabrowska L, Struzik J, Mielcarska MB, Gregorczyk-Zboroch KP. Integrity of the Intestinal Barrier: The Involvement of Epithelial Cells and Microbiota-A Mutual Relationship. \\u003cem\\u003eAnimals (Basel) \\u003c/em\\u003e2022; \\u003cstrong\\u003e12\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eLi Z, Xiong W, Liang Z, Wang J, Zeng Z, Kolat D\\u003cem\\u003e et al.\\u003c/em\\u003e Critical role of the gut microbiota in immune responses and cancer immunotherapy. \\u003cem\\u003eJ Hematol Oncol \\u003c/em\\u003e2024; \\u003cstrong\\u003e17: \\u003c/strong\\u003e33.\\u003c/li\\u003e\\n\\u003cli\\u003eCox TO, Lundgren P, Nath K, Thaiss CA. Metabolic control by the microbiome. \\u003cem\\u003eGenome Med \\u003c/em\\u003e2022; \\u003cstrong\\u003e14: \\u003c/strong\\u003e80.\\u003c/li\\u003e\\n\\u003cli\\u003eKim JE, Li B, Fei L, Horne R, Lee D, Loe AKH\\u003cem\\u003e et al.\\u003c/em\\u003e Gut microbiota promotes stem cell differentiation through macrophage and mesenchymal niches in early postnatal development. \\u003cem\\u003eImmunity \\u003c/em\\u003e2023; \\u003cstrong\\u003e56: \\u003c/strong\\u003e2175.\\u003c/li\\u003e\\n\\u003cli\\u003eDang H, Feng P, Zhang S, Peng L, Xing S, Li Y\\u003cem\\u003e et al.\\u003c/em\\u003e Maternal gut microbiota influence stem cell function in offspring. \\u003cem\\u003eCell Stem Cell \\u003c/em\\u003e2025; \\u003cstrong\\u003e32: \\u003c/strong\\u003e246-262 e248.\\u003c/li\\u003e\\n\\u003cli\\u003eWang DY, Luo AF, Bai QR, Gong XL, Zheng Y, Shen Q\\u003cem\\u003e et al.\\u003c/em\\u003e VCAM1 Labels a Subpopulation of Neural Stem Cells in the Adult Hippocampus and Contributes to Spatial Memory. \\u003cem\\u003eStem Cell Reports \\u003c/em\\u003e2020; \\u003cstrong\\u003e14: \\u003c/strong\\u003e1093-1106.\\u003c/li\\u003e\\n\\u003cli\\u003eHatori A, Fujii Y, Kawase-Koga Y, Ogasawara T, Chikira J, Minami S\\u003cem\\u003e et al.\\u003c/em\\u003e VCAM-1 and GFPT-2: Predictive markers of osteoblast differentiation in human dental pulp stem cells. \\u003cem\\u003eBone \\u003c/em\\u003e2023; \\u003cstrong\\u003e166: \\u003c/strong\\u003e116575.\\u003c/li\\u003e\\n\\u003cli\\u003eRan Y, Dong Y, Li Y, Xie J, Zeng S, Liang C\\u003cem\\u003e et al.\\u003c/em\\u003e Mesenchymal stem cell aggregation mediated by integrin alpha4/VCAM-1 after intrathecal transplantation in MCAO rats. \\u003cem\\u003eStem Cell Res Ther \\u003c/em\\u003e2022; \\u003cstrong\\u003e13: \\u003c/strong\\u003e507.\\u003c/li\\u003e\\n\\u003cli\\u003eJackson BT, Finley LWS. Metabolic regulation of the hallmarks of stem cell biology. \\u003cem\\u003eCell Stem Cell \\u003c/em\\u003e2024; \\u003cstrong\\u003e31: \\u003c/strong\\u003e161-180.\\u003c/li\\u003e\\n\\u003cli\\u003eLi X, Jiang O, Wang S. Molecular mechanisms of cellular metabolic homeostasis in stem cells. \\u003cem\\u003eInt J Oral Sci \\u003c/em\\u003e2023; \\u003cstrong\\u003e15: \\u003c/strong\\u003e52.\\u003c/li\\u003e\\n\\u003cli\\u003eTsogtbaatar E, Landin C, Minter-Dykhouse K, Folmes CDL. Energy Metabolism Regulates Stem Cell Pluripotency. \\u003cem\\u003eFront Cell Dev Biol \\u003c/em\\u003e2020; \\u003cstrong\\u003e8: \\u003c/strong\\u003e87.\\u003c/li\\u003e\\n\\u003cli\\u003eBurgess RJ, Agathocleous M, Morrison SJ. Metabolic regulation of stem cell function. \\u003cem\\u003eJ Intern Med \\u003c/em\\u003e2014; \\u003cstrong\\u003e276: \\u003c/strong\\u003e12-24.\\u003c/li\\u003e\\n\\u003cli\\u003eShyh-Chang N, Ng HH. The metabolic programming of stem cells. \\u003cem\\u003eGenes Dev \\u003c/em\\u003e2017; \\u003cstrong\\u003e31: \\u003c/strong\\u003e336-346.\\u003c/li\\u003e\\n\\u003cli\\u003eGu W, Gaeta X, Sahakyan A, Chan AB, Hong CS, Kim R\\u003cem\\u003e et al.\\u003c/em\\u003e Glycolytic Metabolism Plays a Functional Role in Regulating Human Pluripotent Stem Cell State. \\u003cem\\u003eCell Stem Cell \\u003c/em\\u003e2016; \\u003cstrong\\u003e19: \\u003c/strong\\u003e476-490.\\u003c/li\\u003e\\n\\u003cli\\u003eShapira SN, Christofk HR. Metabolic Regulation of Tissue Stem Cells. \\u003cem\\u003eTrends Cell Biol \\u003c/em\\u003e2020; \\u003cstrong\\u003e30: \\u003c/strong\\u003e566-576.\\u003c/li\\u003e\\n\\u003cli\\u003eMahmoud AI. Metabolic switches during development and regeneration. \\u003cem\\u003eDevelopment \\u003c/em\\u003e2023; \\u003cstrong\\u003e150\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Endometrial stem cells, Vaginal microbiota, Secretory factors, VCAM1, Akt signaling\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7062920/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7062920/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe vaginal microbiota plays a critical role in regulating endometrial development, which is key for successful embryo implantation and pregnancy. However, the extent to which the vaginal microbiota contributes to various tissue regeneration-associated functions of human endometrial stem cells, which play pivotal roles in endometrial development and subsequent endometrial receptivity, remains largely unexplored. Here, we demonstrate that exposure to microbiota-derived secretory factors enhances key regenerative functions of endometrial stem cells, including self-renewal, migratory capacity, multilineage differentiation potential, and metabolic activity via upregulation of VCAM1 (vascular cell adhesion molecule 1), which serves as a central regulatory hub, and the subsequent activation of the PI3K/Akt signaling pathway, highlighting a critical microbiota-driven mechanism governing endometrial stem cell function and tissue regeneration. Functional knockdown of VCAM1 and pharmacological inhibition of the Akt signaling pathway attenuated the microbiota-driven beneficial effects, confirming their functional roles. Notably, depletion of the vaginal microbiota impaired endometrial development and significantly reduced the clonogenicity of endometrial stem cells \\u003cem\\u003ein vivo\\u003c/em\\u003e, reinforcing the essential role of microbiota-derived factors in endometrial homeostasis. These findings provide critical insights into the microbiota-endometrial stem cell crosstalk and highlight the therapeutic potential of microbiota-derived secretory factors in stem cell-based regenerative medicine and reproductive health.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Exploring Vaginal Microbiota–Tissue Resident Stem Cell Crosstalk:\\nVCAM1-Mediated Enhancement of Regenerative Capacity\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-08-05 12:00:53\",\"doi\":\"10.21203/rs.3.rs-7062920/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"c264f001-f064-4983-b629-7396cb32a4c0\",\"owner\":[],\"postedDate\":\"August 5th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":52569225,\"name\":\"Biological sciences/Stem cells/Mesenchymal stem cells\"},{\"id\":52569226,\"name\":\"Health sciences/Health care/Therapeutics/Stem-cell therapies\"}],\"tags\":[],\"updatedAt\":\"2025-12-09T05:16:11+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-08-05 12:00:53\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7062920\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7062920\",\"identity\":\"rs-7062920\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}